WO2010073001A1 - Biomarker - Google Patents
Biomarker Download PDFInfo
- Publication number
- WO2010073001A1 WO2010073001A1 PCT/GB2009/002926 GB2009002926W WO2010073001A1 WO 2010073001 A1 WO2010073001 A1 WO 2010073001A1 GB 2009002926 W GB2009002926 W GB 2009002926W WO 2010073001 A1 WO2010073001 A1 WO 2010073001A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- patient
- biomarker
- acid sequence
- nucleic acid
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/10—Drugs for disorders of the urinary system of the bladder
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/158—Expression markers
Definitions
- the present application relates to biomarkers, in particular to biomarkers for bladder cancer and lung cancer.
- Bladder cancer is the fourth most common cancer in men and the tenth most common cancer in women; there are 10,000 new cases each year in the UK and 63,000 in the USA. At present, diagnosis is made by examining cells in urine that have detached from the bladder wall (cytology), or by removing tissue from the bladder for biopsy. Cytology is very specific but has low sensitivity, and both techniques are expensive and time consuming. A reliable biochemical marker for bladder cancer would be of great benefit to patients.
- TCC Transitional Cell Carcinomas
- Lung cancer is the most common cancer world wide, with 1.35 million new cases each year, 38,000 of which were in the UK.
- No reliable biochemical methods for diagnosing lung cancer are available; diagnosis is currently by X-ray followed by broncoscopy and/or a computerised tomography (CT) scan.
- CT computerised tomography
- a reliable biochemical test based on a single marker in serum or in sputum would be of great benefit to patients as it would speed up diagnosis. In addition, such a test is likely to be far cheaper than existing methods.
- Non-small cell lung cancers are grouped together because their prognosis and management are similar. They consist of squamous cell lung carcinoma, adenocarcinoma and large cell lung carcinoma. NSCLC is the most prevalent form of lung cancer making up 80.4% of cases. Small cell lung carcinoma (SCLC) comprises 16.8% of cases. SCLC often has an endocrine function that is an important component of the disease. Carcinoid and sarcoma cancers comprise 0.8% and 0.1% of cases respectively, with 1.9% of cases being of an unspecified type.
- a bladder cancer specific biomarker or a lung cancer specific biomarker comprising:-
- nucleic acid sequence comprising SEQ ID NO:1, or a fragment or variant thereof, or a nucleic acid molecule which comprises said nucleic acid sequence;
- amino acid sequence comprising SEQ ID NO:2, or a fragment or variant thereof, or an amino acid molecule which comprises said amino acid sequence.
- SEQ ID NO:1 corresponds to the nucleic acid sequence of the Engrailed-2 (EN2) gene (GenBank reference number NM 001427) and SEQ ID NO:2 corresponds to the EN2 protein encoded thereby (NCBI accession number P 19622, gi21903415).
- the EN2 gene is significantly up-regulated in bladder cancer and lung cancer.
- the EN2 gene encodes a homeodomain-containing transcription factor that has a number of important functions in early development including axonal guidance and boundary formation (reviewed in Morgan R, (2006). Engrailed: Complexity and economy of a multifunctional transcription factor. FEBS letters 580, 2531-2533, which is incorporated herein by reference in its entirety). Its NCBI/GenBank reference number is NM_001427. It has previously been reported to act as an oncogene in breast cancer, although no diagnostic significance has been attributed to it (Martin, N.L., Saba-El-Leil, M.K., Sadekova, S., Meloche, S. and Sauvageau, G. (2005) EN-2 is a candidate oncogene in human breast cancer. Oncogene 24, 6890-6901, which is incorporated herein by reference in its entirety).
- EN2 gene product is a 33kDa protein (EN2).
- fragments or variants thereof comprise:-
- nucleic acid sequence that has at least about 50%, or at least about 60%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% nucleic acid sequence identity with SEQ ID NO:1, a nucleic acid sequence that is hybridizable thereto under stringent conditions, and/or a nucleic acid sequence that is complementary thereto;
- amino acid sequence that has at least about 50%, or at least about 60%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% amino acid sequence identity with SEQ ID NO:2, or
- fragments or variants thereof comprise:-
- nucleic acid sequence an amino acid sequence encoded by a nucleic acid sequence, wherein said nucleic acid sequence has at least about 50%, or at least about 60%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% nucleic acid sequence identity with SEQ ID NO:1;
- nucleic acid sequence an amino acid sequence encoded by a nucleic acid sequence, wherein said nucleic acid sequence is hybridizable under stringent conditions to a nucleic acid sequence that has at least about 50%, or at least about 60%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% nucleic acid sequence identity with SEQ ID NO: 1 ; or
- nucleic acid sequence an amino acid sequence encoded by a nucleic acid sequence, wherein said nucleic acid sequence is complementary to a nucleic acid sequence that has at least about 50%, or at least about 60%, or at least about 70%, or at least about 75%, or at least about 80%, or at least about 85%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% nucleic acid sequence identity with SEQ ID NOrI.
- the fragments thereof comprise (i) at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight consecutive amino acids from SEQ ID NO:2 or (ii) a fragment of the nucleic acid sequence of SEQ ID NO:1 which encodes at least four, preferably at least five, preferably at least six, preferably at least seven, preferably at least eight consecutive amino acids from SEQ ID NO:2.
- Longer fragments are also preferred, for example at least about 10, 15, 20, 25, 30, 50, 75, 100, 150, 200, 225 and up to at least about 250 amino acids of SEQ ID NO:2 or corresponding coding fragments of SEQ ID NO:1.
- Fragments may also include truncated peptides that have x amino acids deleted from the N-terminus and/or C-terminus.
- x may be 1 or more (i.e. 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 30, 40, 50, 60, 70, 80, 90, 100 or more), but preferably less than 150 amino acids of SEQ ID NO:2 or corresponding coding fragments of SEQ ID NO:1.
- the fragments or variants thereof are functional fragments or variants thereof.
- a method for diagnosing bladder cancer or lung cancer in a patient or for identifying a patient at risk of delevoping bladder cancer or lung cancer comprising:
- a method for monitoring the progression of bladder cancer or lung cancer in a patient comprising:
- step (c) repeating steps (a) and (b) at two or more time intervals, wherein an increase in the amount of the cancer specific biomarker from the patient over time is associated with an increase in the progression of bladder cancer or lung cancer and a decrease in the amount of the cancer specific biomarker from the patient over time is associated with a decrease in the progression of bladder cancer or lung cancer.
- the methods of the present invention can be used to detect the onset, progression, stabilisation, amelioration and/or remission of bladder cancer or lung cancer.
- control may be from the same patient from a previous sample, to thus monitor onset or progression.
- control may be normalised for a population, particularly a healthy or normal population, where there is no bladder cancer or lung cancer.
- control may consist of the level of a biomarker found in a normal control sample from a normal subject.
- a method of diagnosing or monitoring the progression of bladder cancer or lung cancer comprising detecting and/or quantifying the cancer specific biomarker in a biological fluid obtained from a patient.
- At least two detection and/or quantification steps are provided, spaced apart temporally.
- the steps are spaced apart by a few days, weeks, years or months, to determine whether the levels of the cancer specific biomarker have changed, thus indicating whether there has been a change in the progression of the cancer, enabling comparisons to be made between a level of the biomarker in samples taken on two or more occasions, as an increase in the level of the biomarker over time is indicative of the onset or progression of the cancer, whereas a decrease in the level of the biomarker may indicate amelioration and/or remission of the cancer.
- the difference in the level of the biomarker is statistically significant, determined by using a "t-test" providing confidence intervals of preferably at least about 80%, preferably at least about 85%, preferably at least about 90%, preferably at least about 95%, preferably at least about 99%, preferably at least about 99.5%, preferably at least about 99.95%, preferably at least about 99.99%.
- the biomarkers and methods of the invention are particularly useful in detecting early stage cancer and are more sensitive than known methods for detecting early stage bladder cancer and lung cancer. Thus, the biomarkers and methods of the invention are particularly useful for confirming cancer when a patient has tested negative for cancer using conventional methods.
- Prognosis and choice of treatment are dependent upon the stage of the cancer and the patient's general state of health.
- stages are defined by whether the cancer is present only in the lining of the bladder or has spread to other areas.
- plan treatment it is desirable to know the stage of the disease.
- additional tests are generally performed to determine the stage of the cancer.
- Stage 0 is very early cancer. In this stage, the cancer is found only on the inner lining of the bladder. After the cancer is removed, no swelling or lumps will be observed during an internal examination.
- Stage I cancer cells have spread a little deeper into the inner lining of the bladder but have not spread to the muscular wall of the bladder.
- Stage II cancer cells have spread to the inside lining of the muscles lining the bladder
- hi Stage III cancer cells have spread throughout the muscular wall of the bladder, to the layer of tissue surrounding the bladder and/or to the nearby reproductive organs. In this stage, swelling or lumps may still be observed even after the cancerous tissue has been removed surgically.
- Stage IV cancer cells have spread to the wall of the abdomen or pelvis or to the nearby lymph nodes. Lymph nodes are small, bean-shaped structures that are found throughout the body; they produce and store infection-fighting cells. The cancer may have also spread to lymph nodes and other parts of the body far away from the bladder.
- staging is different for non-small cell versus small cell cancers of the lung.
- Non-small cell cancer is divided into four stages. Stage I is very localized cancer with no cancer in the lymph nodes. In stage II, cancer has spread to the lymph nodes at the top of the affected lung. In stage III, cancer has spread near to where the cancer started. This can be to the chest wall, the covering of the lung (pleura), the middle of the chest (mediastinum) or other lymph nodes. Stage IV cancer has spread to another part of the body.
- Small cell lung cancers are divided into two groups. This is because small cell lung cancer often spreads quite early. Even if spreading of the cancer is not visible on scans, it is likely that some cancer cells will have broken away and travelled through the bloodstream or lymph system. Accordingly, it is often preferred to treat small cell lung cancers as if they have spread, whether or not any secondary cancer is seen.
- the two stages of small cell lung cancers are limited disease, that is cancer that can only be seen in one lung and in nearby lymph nodes, and extensive disease, that is cancer that has spread outside the lung to the chest or to other parts of the body.
- stage can be said to refer to stage 0, stage I and/or stage II of bladder cancer or stage I and/or stage II of non-small cell lung cancer, or the limited disease stage of small cell lung cancers, as discussed above.
- stage III As used herein, it will be appreciated that this term can be said to refer to stage III and/or stage IV of bladder cancer or non-small cell lung cancer, or the extensive disease stage of small cell lung cancer, as discussed above.
- cancer disease states can be determined by a physician. It is also envisaged that they may be associated with non-metastatic and metastatic states, respectively.
- methods according to the present invention for detecting early stage cancer wherein an increase between the control and the sample obtained from the patient is indicative of early stage cancer.
- the increase is at least about 100%, preferably at least about 125%, preferably at least about 150%, preferably at least about 200%, preferably at least about 250%, preferably at least about 300%, preferably at least about 500%.
- methods according to the present invention for detecting late stage cancer wherein an increase between the control and the sample obtained from the patient is indicative of late stage cancer.
- the increase is at least about 100%, preferably at least about 125%, preferably at least about 150%, preferably at least about 200%, preferably at least about 250%, preferably at least about 300%, preferably at least about 500%, preferably at least about 750%, preferably at least about 1000%, preferably at least about 1500%.
- an increase, relative to an earlier stage sample or control is indicative of progression of the cancer from an earlier stage to later stage of disease, for example from stage 0 to stage I, from stage I to stage II, from stage II to stage III, from stage III to stage IV, from early stage to late stage, or from limited disease stage to extensive disease stage.
- the increase is at least about 100%, preferably at least about 125%, preferably at least about 150%, preferably at least about 200%, preferably at least about 250%, preferably at least about 300%, preferably at least about 500%, preferably at least about 750%, preferably at least about 1000%, preferably at least about 1500%.
- the bladder cancer specific biomarker is indicative of the presence of bladder cancer or the risk of developing bladder cancer when present at a level of at least about 2-fold, preferably at least about 5-fold, preferably at least about 10-fold, preferably at least about 20- fold, preferably at least about 50-fold, preferably at least about 100-fold, preferably at least about 200-fold, preferably at least about 500-fold, preferably at least about 750-fold, preferably at least about 1000-fold that of a normal control.
- the lung cancer specific biomarker is is indicative of the presence of lung cancer or the risk of developing lung cancer when present at a level of of at least about 2-fold, preferably at least about 5 fold, preferably at least about 10-fold, preferably at least about 15-fold, preferably at least about 20-fold, preferably at least about 25-fold, preferably at least about 30-fold that of a normal control.
- a method for monitoring the efficacy of a treatment for bladder cancer or lung cancer comprising detecting and/or quantifying the presence of the cancer specific biomarker in a biological sample obtained from a patient.
- detection and/or quantification of the melanoma specific biomarker is by one or more of MALDI-TOF, SELDI, via interaction with a ligand or ligands, 1-D or 2-D gel-based analysis systems, Liquid Chromatography, combined liquid chromatography and Mass spectrometry techniques including ICAT(R) or iTRAQ(R), thin-layer chromatography, NMR spectroscopy, sandwich immunoassays, enzyme linked immunosorbent assays (ELISAs), radioimmunoassays (RAI), enzyme immunoassays (EIA), lateral flow/immunochromatographic strip tests, Western Blotting, immunoprecipitation, particle-based immunoassays including using gold, silver, or latex particles, magnetic particles or Q-dots, and immunohistochemistry on tissue sections.
- detection and/or quantification of the cancer specific biomarker is performed on a microtitre plate, strip format, array or on a chip.
- detection and/or quantification of the cancer specific biomarker is by an ELISA comprising antibodies specific for the cancer specific biomarker, preferably linked to a reporter.
- detection and/or quantification of the cancer specific biomarker is by a biosensor.
- the sample comprises biological fluid or tissue obtained from the patient.
- the biological fluid or tissue comprises cellular fluid, cerebrospinal fluid (CSF), semen, urine, blood, sputum or saliva, hi preferred embodiments relating to bladder cancer, the sample is urine obtained from a patient.
- CSF cerebrospinal fluid
- the sample is sputum obtained from a patient.
- the biomarker is detectable on the surface of cells. It is also preferred that the biological fluid is substantially or completely free of whole/intact cells. Preferably the biological fluid is free of platelets and cell debris (such as that produced upon the lysis of cells). Preferably the biological fluid is free of both prokaryotic and eukaryotic cells.
- Such samples can be obtained by any number of means known in the art, such as will be apparent to the skilled person. For instance, urine and sputum samples are easily attainable, whilst blood or serum samples can be obtained parenterally by using a needle and syringe, for instance.
- Cell free or substantially cell free samples can be obtained by subjecting the sample to various techniques known to those of skill in the art which include, but are not limited to, centrifugation and filtration.
- samples such as tissue homogenates, tissue sections and biopsy specimens.
- Another aspect of the present invention relates to a method for treating a patient with bladder cancer or lung cancer, the method comprising administering to a patient a therapeutically effective amount of (i) a biomarker of the present invention or (ii) an antibody or fragment thereof that specifically binds to a biomarker of the present invention.
- Another aspect of the present invention relates to a method for imaging bladder cancer or lung cancer in a patient, the method comprising administering to a patient an antibody or fragment thereof that specifically binds to a biomarker of the present invention.
- the antibody is conjugated to a detectable marker, for example a fluorescent marker or tag.
- the antibody is a monoclonal antibody.
- the antibody is conjugated to a growth inhibitory agent.
- the antibody is conjugated to a cytotoxic agent, for example a toxin, antibiotic, lytic enzyme or radioactive isotope.
- compositions comprising a biomarker of the present invention or an antibody or fragment thereof that binds to a biomarker of the present invention.
- the composition is a pharmaceutical composition.
- a vaccine comprising a biomarker of the present invention or an antibody or fragment thereof that binds to a biomarker of the present invention.
- Another aspect of the present invention relates to use of the cancer specific biomarker, detectable in a body fluid, as a biomarker for bladder cancer or lung cancer.
- said use is in a method selected from the group consisting of: clinical screening, methods of prognosis assessment, monitoring the results of therapy, method to identify patients most likely to respond to a particular therapeutic treatment, and drug screening and development.
- Another aspect of the present invention relates to use of (i) a biomarker of the present invention, or (ii) an antibody or fragment thereof that specifically binds to a biomarker of the present invention, in the manufacture of a medicament for the treatment of bladder cancer or lung cancer.
- composition comprising (i) a biomarker of the present invention, or (ii) an antibody or fragment thereof that specifically binds to a biomarker of the present invention, wherein the composition is for use in the treatment of bladder cancer or lung cancer.
- Another aspect of the present invention relates to an antibody or fragment thereof that specifically binds to a biomarker of the present invention for use in a method of imaging bladder cancer or lung cancer in a patient.
- the methods and compositions of the invention are for treatment or diagnosis of disease at an early stage, for example, before symptoms of the disease appear. In some embodiments, the methods and compositions of the invention are for treatment or diagnosis of disease at a clinical stage
- kits for use in the methods or uses described above wherein the kit comprises a ligand capable of binding or specifically recognising the cancer specific biomarker, detectable in a body fluid and reporter means.
- the kit is an array or chip.
- the kit comprises a microtitre plate, test strip, array or chip.
- Figure 1 shows the analysis of EN2 protein in urine from patients undergoing cytoscopic examination for suspected bladder cancer
- Figure 2 shows the expression of EN2 in lung cancer
- Figure 3 shows that EN2 is present on the surface of bladder cancer cells
- Figure 4 shows the nucleic acid sequence of EN2 (SEQ ID NO:1)
- Figure 5 shows the amino acid sequence of EN2 (SEQ ID NO:2).
- the invention relates to bladder cancer specific biomarkers and to lung cancer specific biomarkers.
- the terms “comprises” and “comprising” are interpreted to mean “includes, among other things”. These terms are not intended to be construed as “consists of only”. Within this specification, the term “about” means plus or minus 20%, more preferably plus or minus 10%, even more preferably plus or minus 5%, most preferably plus or minus 2%.
- the term "therapeutically effective amount” means the amount of a composition which is required to reduce the severity of and/or ameliorate at least one condition or symptom which results from the disease in question.
- a compound according to the present invention or prodrug form thereof is formulated into a pharmaceutical formulation which is formulated to be compatible with its intended route of administration, for example for oral, rectal, parenteral or other modes of administration.
- Pharmaceutical formulations are usually prepared by mixing the active substance with a conventional pharmaceutically acceptable diluent or carrier.
- pharmaceutically acceptable carrier is intended to include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical administration.
- Examples of pharmaceutically acceptable diluents or carrier are water, gelatin, gum arabicum, lactose, microcrystalline cellulose, starch, sodium starch glycolate, calcium hydrogen phosphate, magnesium stearate, talcum, colloidal silicon dioxide, and the like.
- diluents or carrier water, gelatin, gum arabicum, lactose, microcrystalline cellulose, starch, sodium starch glycolate, calcium hydrogen phosphate, magnesium stearate, talcum, colloidal silicon dioxide, and the like.
- the use of such media and agents for pharmaceutically active substances is well known in the art. Except insofar as any conventional media or agent is incompatible with the active compound, use thereof in the compositions is contemplated.
- Such formulations may also contain other pharmacologically active agents, and conventional additives, such as stabilizers, wetting agents, emulsifiers, flavouring agents, buffers, and the like.
- the formulations can be further prepared by known methods such as granulation, compression, microencapsulation, spray coating, etc.
- the formulations may be prepared by conventional methods in the dosage form of tablets, capsules, granules, powders, syrups, suspensions, suppositories or injections.
- Liquid formulations may be prepared by dissolving or suspending the active substance in water or other suitable vehicles. Tablets and granules may be coated in a conventional manner.
- Solutions or suspensions used for parenteral, intradermal, or subcutaneous application can include the following components: a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol or other synthetic solvents; antibacterial agents such as benzyl alcohol or methyl parabens; antioxidants such as ascorbic acid or sodium bisulfite; chelating agents such as ethylenediaminetetraacetic acid; buffers such as acetates, citrates or phosphates and agents for the adjustment of tonicity such as sodium chloride or dextrose. pH can be adjusted with acids or bases, such as hydrochloric acid or sodium hydroxide.
- the parenteral preparation can be enclosed in ampoules, disposable syringes or multiple dose vials made of glass or plastic.
- compositions suitable for injectable use include sterile aqueous solutions (where water soluble) or dispersions and sterile powders for the extemporaneous preparation of sterile injectable solutions or dispersion.
- suitable carriers include physiological saline, bacteriostatic water, Cremophor ELTM (BASF, Parsippany, NJ) or phosphate buffered saline (PBS).
- the composition must be sterile and should be fluid to the extent that easy syringability exists. It must be stable under the conditions of manufacture and storage and must be preserved against the contaminating action of microorganisms such as bacteria and fungi.
- the carrier can be a solvent or dispersion medium containing, for example, water, ethanol, polyol (for example, glycerol, propylene glycol, and liquid polyetheylene glycol, and the like), and suitable mixtures thereof.
- the proper fluidity can be maintained, for example, by the use of a coating such as lecithin, by the maintenance of the required particle size in the case of dispersion and by the use of surfactants.
- Prevention of the action of microorganisms can be achieved by various antibacterial and antifungal agents, for example, parabens, 'chlorobutanol, phenol, ascorbic acid, thimerosal, and the like.
- isotonic agents for example, sugars, polyalcohols such as manitol, sorbitol, sodium chloride in the composition.
- Prolonged absorption of the injectable compositions can be brought about by including in the composition an agent which delays absorption, for example, aluminum mono stearate and gelatin.
- Sterile injectable solutions can be prepared by incorporating the active compound (e.g., a compound according to an embodiment of the invention) in the required amount in an appropriate solvent with one or a combination of ingredients enumerated above, as required, followed by filtered sterilization.
- dispersions are prepared by incorporating the active compound into a sterile vehicle which contains a basic dispersion medium and the required other ingredients from those enumerated above.
- the preferred methods of preparation are vacuum drying and freeze-drying which yields a powder of the active ingredient plus any additional desired ingredient from a previously sterile-filtered solution thereof.
- Oral compositions generally include an inert diluent or an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets. For the purpose of oral therapeutic administration, the active compound can be incorporated with excipients and used in the form of tablets, troches, or capsules. Oral compositions can also be prepared using a fluid carrier for use as a mouthwash, wherein the compound in the fluid carrier is applied orally and swished and expectorated or swallowed. Pharmaceutically compatible binding agents, and/or adjuvant materials can be included as part of the composition.
- the tablets, pills, capsules, troches and the like can contain any of the following ingredients, or compounds of a similar nature: a binder such as microcrystalline cellulose, gum tragacanth or gelatin; an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; a sweetening agent such as sucrose or saccharin; or a flavoring agent such as peppermint, methyl salicylate, or orange flavoring.
- a binder such as microcrystalline cellulose, gum tragacanth or gelatin
- an excipient such as starch or lactose, a disintegrating agent such as alginic acid, Primogel, or corn starch
- a lubricant such as magnesium stearate or Sterotes
- a glidant such as colloidal silicon dioxide
- the compounds are delivered in the form of an aerosol spray from pressured container or dispenser which contains a suitable propellant, e.g., a gas such as carbon dioxide, or a nebulizer.
- a suitable propellant e.g., a gas such as carbon dioxide, or a nebulizer.
- Systemic administration can also be by transmucosal or transdermal means.
- penetrants appropriate to the barrier to be permeated are used in the formulation.
- penetrants are generally known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives.
- Transmucosal administration can be accomplished through the use of nasal sprays or suppositories.
- the active compounds are formulated into ointments, salves, gels, or creams as generally known in the art.
- the compounds can also be prepared in the form of suppositories (e.g., with conventional suppository bases such as cocoa butter and other glycerides) or retention enemas for rectal delivery.
- suppositories e.g., with conventional suppository bases such as cocoa butter and other glycerides
- retention enemas for rectal delivery.
- the active compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
- a controlled release formulation including implants and microencapsulated delivery systems.
- Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.
- the materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
- Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art.
- Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
- the specification for the dosage unit forms of the invention are dictated by and directly dependent on the unique characteristics of the active compound and the particular therapeutic effect to be achieved, and the limitations inherent in the art of compounding such an active compound for the treatment of individuals.
- Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population).
- the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD50/ED50.
- Compounds which exhibit large therapeutic indices are preferred. While compounds that exhibit toxic side effects may be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
- the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
- the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
- the dosage may vary within this range depending upon the dosage form employed and the route of administration utilized.
- the therapeutically effective dose can be estimated initially from cell culture assays.
- a dose may be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
- IC50 i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms
- levels in plasma may be measured, for example, by high performance liquid chromatography.
- compositions can be included in a container, pack, or dispenser together with instructions for administration.
- identity is a relationship between two or more polypeptide sequences or two or more polynucleotide sequences, as determined by comparing the sequences.
- identity also means the degree of sequence relatedness between polypeptide or polynucleotide sequences, as the case may be, as determined by the match between strings of such sequences. Percentage identity can be readily calculated by known methods, including but not limited to those described in Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D.
- Methods to determine identity are codified in publicly available computer programs.
- Preferred computer program methods to determine percentage identity between two sequences include, but are not limited to, the GCG program package (Devereux, J., et al., Nucleic Acids Research 12(1): 387 (1984), which is incorporated herein by reference in its entirety), BLASTP, BLASTN, and FASTA (Atschul, S. F. et al., J. Molec. Biol. 215: 403-410 (1990), which is incorporated herein by reference in its entirety).
- the BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al., NCBI NLM NIH Bethesda, Md.
- nucleotide having a nucleotide sequence having at least, for example, 95% “identity" to a reference nucleotide sequence of "SEQ ID NO: A” it is intended that the nucleotide sequence of the polynucleotide is identical to the reference sequence except that the polynucleotide sequence may include up to five point mutations per each 100 nucleotides of the reference nucleotide sequence of "SEQ ID NO: A.”
- up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5%
- mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
- a polypeptide having an amino acid sequence having at least, for example, 95% identity to a reference amino acid sequence of "SEQ ID NO:B" is intended that the amino acid sequence of the polypeptide is identical to the reference sequence except that the polypeptide sequence may include up to five amino acid alterations per each 100 amino acids of the reference amino acid of "SEQ ID NO: B.”
- up to 5% of the amino acid residues in the reference sequence may be deleted or substituted with another amino acid, or a number of amino acids up to 5% of the total amino acid residues in the reference sequence may be inserted into the reference sequence.
- These alterations of the reference sequence may occur at the amino or
- hybridizes under stringent conditions is intended to describe conditions for hybridization and washing under which nucleotide sequences encoding a receptor at least 50% homologous to each other typically remain hybridized to each other.
- the conditions can be such that sequences at least about 65%, at least about 70%, or at least about 75% or more homologous to each other typically remain hybridized to each other.
- stringent conditions are known to those skilled in the art and can be found in Current Protocols in Molecular Biology, John Wiley & Sons, N. Y. (1989), 6. 3.1-6.3.6, which is incorporated herein by reference in its entirety.
- an isolated receptor nucleic acid molecule that hybridizes under stringent conditions to the sequence of SEQ ID NO:1 corresponds to a naturally-occurring nucleic acid molecule.
- a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule having a nucleotide sequence that occurs in nature (e. g., encodes a natural protein).
- antibody or antibody fragment refers to an antibody (for example IgG, IgM, IgA, IgD or IgE) or fragment (such as a Fab, F(ab')2, Fv, disulphide linked Fv, scFv, closed conformation multispecific antibody, disulphide-linked scFv, diabody) whether derived from any species naturally producing an antibody, or created by recombinant DNA technology; whether isolated from serum, B- cells, hybridomas, transfectomas, yeast or bacteria.
- an antibody for example IgG, IgM, IgA, IgD or IgE
- fragment such as a Fab, F(ab')2, Fv, disulphide linked Fv, scFv, closed conformation multispecific antibody, disulphide-linked scFv, diabody
- the term “treatment” means treatment of an existing disease and/or prophylactic treatment in order to prevent incidence of a disease.
- the methods of the invention can be used for the treatment, prevention, inhibition of progression or delay in the onset of disease.
- biomarker is used throughout the art and means a distinctive biological or biologically-derived indicator of a process, event or condition. In other words, a biomarker is indicative of a certain biological state, such as the presence of cancerous tissue. In some cases, different forms of biomarkers can be indicative of certain disease states but, without being bound by theory, it is thought that merely the presence of elevated levels of the biomarkers of the present invention in body fluids such as sputum or urine, is indicative of lung cancer or bladder cancer, respectively.
- glycoforms for instance, of the EN2 peptide
- different glycoforms such as altered glycoform structure or sugar content
- may yet be determined for EN2 but these are encompassed and may even also be indicative of the progress of bladder cancer or lung cancer.
- EN2 is found in the urine of patients with bladder cancer. It is thought that EN-2 may be secreted or may be detectable in body fluids due to leaking from damaged or dead cells. Such increased levels are indicative of both early stage and late stage bladder cancer and lung cancer. Whilst there is a significant rise between control or normal levels and early stage bladder cancer and lung cancer, there is also a very significant increase between early and late stage bladder cancer and lung cancer. Broadly, it is an advantage of the present invention that the substance and also the state of the cancer can be detected. This aids in the prognosis and provision of suitable therapies.
- the present invention is particularly sensitive.
- the methods of the present invention may detect the onset of cancer prior to any other detection method and prior to the onset of the overt symptoms of cancer.
- the cancer may be treated at an early stage when it is more susceptible to such treatment and less likely to have entered the metastatic stage.
- the biomarkers of the present invention can be used in methods of diagnosis, for instance clinical screening, and in methods of prognosis assessment, monitoring the results of therapy, identifying patients most likely to respond to a particular therapeutic treatment, drug screening and development.
- the biomarkers of the present invention and uses thereof are valuable for identification of new drug treatments and for discovery of new targets for drug treatment.
- diagnosis encompasses identification, confirmation, and or characterisation of the presence or absence of bladder cancer or lung cancer, together with the developmental stage thereof, such as early stage or late stage, or benign or metastatic cancer.
- EN2 in bladder cancer.
- the number of EN2 mRNA transcripts in three different TCC tumours was compared to that in normal tissue adjacent to the tumour ('NAT') using semi-quantitative PCR. This revealed that EN2 is expressed at a 1457 fold greater level in tumours than in the NAT.
- EN2 protein detection by western blotting 1.5ml of urine was centrifuged at 10,000g for five minutes to remove cells and cellular debris. 20 ⁇ l of the supernatant were then mixed directly with 5 ⁇ l LDL gel running buffer (Invitrogen) and 2 ⁇ l reducing agent (Invitrogen) and heated to 7O 0 C for ten minutes. Proteins were resolved by 10% SDS-polyacrylamide gel electrophoresis and transferred to a polyvinylidene fluoride membrane. Anti-EN2 antibody (Abeam, UK) was used at a concentration of 0.5 ⁇ g/ml.
- Beta-actin human
- HsBeta-ActinF 5' ATGTACCCTGGCATTGCCGAC 3' (SEQ ID NO:3)
- HsBeta-ActinR 5' GACTCGTCATACTCCTGCTTG 3' (SEQ ID NO:4)
- HsEN2F 5' GAACCCGAACAAAGAGGACA 3' (SEQ ID NO:5)
- HsEN2R 5' CGCTTGTTCTGGAACCAAAT 3' (SEQ ID NO:6)
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Analytical Chemistry (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Pathology (AREA)
- Immunology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Animal Behavior & Ethology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Hospice & Palliative Care (AREA)
- Biochemistry (AREA)
- Oncology (AREA)
- Pulmonology (AREA)
- Urology & Nephrology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Investigating Or Analysing Biological Materials (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ES09805934T ES2725150T3 (es) | 2008-12-23 | 2009-12-21 | Biomarcador |
| RU2011130795/10A RU2573925C2 (ru) | 2008-12-23 | 2009-12-21 | Биомаркер |
| CN200980155785.7A CN102301006B (zh) | 2008-12-23 | 2009-12-21 | 生物标志 |
| BRPI0923525-6A BRPI0923525A2 (pt) | 2008-12-23 | 2009-12-21 | biomarcador específico para câncer de bexiga, seus usos, anticorpo ou fragmento do mesmo, composições, vacina, kit, e métodos para diagnosticar, formar imagem e monitorar a progressão e eficácia de um tratamento do câncer de bexiga em um paciente |
| EP09805934.8A EP2382327B1 (en) | 2008-12-23 | 2009-12-21 | Biomarker |
| NZ593392A NZ593392A (en) | 2008-12-23 | 2009-12-21 | Biomarker for detecting bladder cancer |
| JP2011541583A JP5947040B2 (ja) | 2008-12-23 | 2009-12-21 | バイオマーカー |
| US13/141,787 US9624548B2 (en) | 2008-12-23 | 2009-12-21 | Methods for diagnosing cancer |
| AU2009332712A AU2009332712B2 (en) | 2008-12-23 | 2009-12-21 | Biomarker |
| MX2011006773A MX343251B (es) | 2008-12-23 | 2009-12-21 | Biomarcador. |
| CA2747760A CA2747760C (en) | 2008-12-23 | 2009-12-21 | Engrailed-2 (en2) biomarker for bladder cancer |
| IL213510A IL213510A (en) | 2008-12-23 | 2011-06-13 | Biomarker |
| ZA2011/05184A ZA201105184B (en) | 2008-12-23 | 2011-07-14 | Biomarker |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0823445.2 | 2008-12-23 | ||
| GBGB0823445.2A GB0823445D0 (en) | 2008-12-23 | 2008-12-23 | Biomarker |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010073001A1 true WO2010073001A1 (en) | 2010-07-01 |
Family
ID=40344114
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2009/002926 Ceased WO2010073001A1 (en) | 2008-12-23 | 2009-12-21 | Biomarker |
Country Status (15)
| Country | Link |
|---|---|
| US (1) | US9624548B2 (https=) |
| EP (1) | EP2382327B1 (https=) |
| JP (1) | JP5947040B2 (https=) |
| CN (1) | CN102301006B (https=) |
| AU (1) | AU2009332712B2 (https=) |
| BR (1) | BRPI0923525A2 (https=) |
| CA (1) | CA2747760C (https=) |
| ES (1) | ES2725150T3 (https=) |
| GB (1) | GB0823445D0 (https=) |
| IL (1) | IL213510A (https=) |
| MX (1) | MX343251B (https=) |
| NZ (1) | NZ593392A (https=) |
| RU (1) | RU2573925C2 (https=) |
| WO (1) | WO2010073001A1 (https=) |
| ZA (1) | ZA201105184B (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2597831C2 (ru) * | 2011-01-19 | 2016-09-20 | Кантаргия Аб | Анти-il1rap антитела и их применение при лечении людей |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB2472856B (en) | 2009-08-21 | 2012-07-11 | Cantargia Ab | IL1-RAP modulators and uses thereof |
| US11371941B2 (en) * | 2016-07-04 | 2022-06-28 | Celltool Gmbh | Device and method for the determination of transfection |
| KR101777085B1 (ko) * | 2017-02-23 | 2017-09-11 | 주식회사 성균바이오텍 | En2 단백질의 면역원성 단편 펩타이드 또는 이를 특이적으로 인식하는 항체 조성물 |
| KR101923199B1 (ko) | 2018-04-25 | 2018-11-28 | 주식회사 무진메디 | 펩스타틴 a를 함유하는 소변 내 en2 진단용 조성물 |
| US20220389514A1 (en) | 2019-10-02 | 2022-12-08 | Kyushu University, National University Corporation | Biomarker, method, kit and array for predicting therapeutic effects of bcg intravesical infusion therapy in treating bladder cancer |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050042650A1 (en) * | 2003-07-08 | 2005-02-24 | Guy Sauvageau | EN2 gene, diagnostic and therapeutic uses thereof |
| WO2008075056A1 (en) * | 2006-12-19 | 2008-06-26 | The University Of Surrey | Cancer biomarkers |
| WO2009074328A2 (en) * | 2007-12-11 | 2009-06-18 | Epigenomics Ag | Methods and nucleic acids for analyses of lung carcinoma |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101175862A (zh) * | 2005-02-10 | 2008-05-07 | 肿瘤疗法科学股份有限公司 | 诊断膀胱癌的方法 |
| WO2008087040A2 (en) * | 2007-01-19 | 2008-07-24 | Epigenomics Ag | Methods and nucleic acids for analyses of cell proliferative disorders |
-
2008
- 2008-12-23 GB GBGB0823445.2A patent/GB0823445D0/en not_active Ceased
-
2009
- 2009-12-21 EP EP09805934.8A patent/EP2382327B1/en not_active Not-in-force
- 2009-12-21 AU AU2009332712A patent/AU2009332712B2/en not_active Ceased
- 2009-12-21 RU RU2011130795/10A patent/RU2573925C2/ru not_active IP Right Cessation
- 2009-12-21 JP JP2011541583A patent/JP5947040B2/ja not_active Expired - Fee Related
- 2009-12-21 NZ NZ593392A patent/NZ593392A/xx not_active IP Right Cessation
- 2009-12-21 BR BRPI0923525-6A patent/BRPI0923525A2/pt not_active Application Discontinuation
- 2009-12-21 WO PCT/GB2009/002926 patent/WO2010073001A1/en not_active Ceased
- 2009-12-21 CA CA2747760A patent/CA2747760C/en active Active
- 2009-12-21 US US13/141,787 patent/US9624548B2/en active Active
- 2009-12-21 ES ES09805934T patent/ES2725150T3/es active Active
- 2009-12-21 MX MX2011006773A patent/MX343251B/es active IP Right Grant
- 2009-12-21 CN CN200980155785.7A patent/CN102301006B/zh not_active Expired - Fee Related
-
2011
- 2011-06-13 IL IL213510A patent/IL213510A/en active IP Right Grant
- 2011-07-14 ZA ZA2011/05184A patent/ZA201105184B/en unknown
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20050042650A1 (en) * | 2003-07-08 | 2005-02-24 | Guy Sauvageau | EN2 gene, diagnostic and therapeutic uses thereof |
| WO2008075056A1 (en) * | 2006-12-19 | 2008-06-26 | The University Of Surrey | Cancer biomarkers |
| WO2009074328A2 (en) * | 2007-12-11 | 2009-06-18 | Epigenomics Ag | Methods and nucleic acids for analyses of lung carcinoma |
Non-Patent Citations (16)
| Title |
|---|
| "Biocomputing: Informatics and Genome Projects", 1993, ACADEMIC PRESS |
| "Computational Molecular Biology", 1988, OXFORD UNIVERSITY PRESS |
| "Computer Analysis of Sequence Data, Part I", 1994, HUMANA PRESS |
| "Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS, pages: 6. 3.1 - 6.3.6 |
| "Sequence Analysis Primer", 1991, M STOCKTON PRESS |
| ALTSCHUL, S. ET AL., J. MOL. BIOL., vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL, S. ET AL.: "BLAST Manual", NCBI NLM NIH |
| ATSCHUL, S. F. ET AL., J. MOLEC. BIOL., vol. 215, 1990, pages 403 - 410 |
| BOSE SUDEEP K ET AL: "EN2 is a potential candidate oncogene in prostate cancer", PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, NEW YORK, NY, US, vol. 48, 18 April 2007 (2007-04-18), pages 503, XP001537997, ISSN: 0197-016X * |
| CARILLO, H.; LIPMAN, D., SIAM J. APPLIED MATH., vol. 48, 1988, pages 1073 |
| DEVEREUX, J. ET AL., NUCLEIC ACIDS RESEARCH, vol. 12, no. 1, 1984, pages 387 |
| MARTIN, N.L.; SABA-EL-LEIL, M.K.; SADEKOVA, S.; MELOCHE, S.; SAUVAGEAU, G.: "EN-2 is a candidate oncogene in human breast cancer", ONCOGENE, vol. 24, 2005, pages 6890 - 6901 |
| MORGAN R: "Engrailed: Complexity and economy of a multifunctional transcription factor", FEBS LETTERS, vol. 580, 2006, pages 2531 - 2533 |
| MORGAN RICHARD ET AL: "Prostate cancer cells express and secrete the Engrailed transcription factor", PROCEEDINGS OF THE ANNUAL MEETING OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH, NEW YORK, NY, US, vol. 47, 5 April 2006 (2006-04-05), pages 622, XP001537996, ISSN: 0197-016X * |
| RAUCH TIBOR ET AL: "Homeobox gene methylation in lung cancer studied by genome-wide analysis with a microarray-based methylated CpG island recovery assay", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 104, no. 13, March 2007 (2007-03-01), pages 5527 - 5532, XP002577090, ISSN: 0027-8424 * |
| VON HEINJE, G.: "Sequence Analysis in Molecular Biology", 1987, ACADEMIC PRESS |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2597831C2 (ru) * | 2011-01-19 | 2016-09-20 | Кантаргия Аб | Анти-il1rap антитела и их применение при лечении людей |
Also Published As
| Publication number | Publication date |
|---|---|
| MX343251B (es) | 2016-10-31 |
| AU2009332712A1 (en) | 2011-07-07 |
| US20120020888A1 (en) | 2012-01-26 |
| IL213510A0 (en) | 2011-07-31 |
| CN102301006A (zh) | 2011-12-28 |
| NZ593392A (en) | 2013-05-31 |
| CA2747760C (en) | 2020-01-21 |
| EP2382327A1 (en) | 2011-11-02 |
| RU2011130795A (ru) | 2013-01-27 |
| ES2725150T3 (es) | 2019-09-19 |
| IL213510A (en) | 2016-04-21 |
| EP2382327B1 (en) | 2019-02-13 |
| US9624548B2 (en) | 2017-04-18 |
| JP5947040B2 (ja) | 2016-07-06 |
| AU2009332712B2 (en) | 2015-05-28 |
| JP2012513584A (ja) | 2012-06-14 |
| CA2747760A1 (en) | 2010-07-01 |
| CN102301006B (zh) | 2015-07-15 |
| ZA201105184B (en) | 2012-02-29 |
| GB0823445D0 (en) | 2009-01-28 |
| RU2573925C2 (ru) | 2016-01-27 |
| MX2011006773A (es) | 2011-08-03 |
| BRPI0923525A2 (pt) | 2020-08-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2747760C (en) | Engrailed-2 (en2) biomarker for bladder cancer | |
| CN112626207B (zh) | 一种用于区分非侵袭性和侵袭性无功能垂体腺瘤的基因组合 | |
| US20120263654A1 (en) | Melanoma specific biomarker | |
| US20120183554A1 (en) | Biomarker | |
| US20120219501A1 (en) | Biomarker en2 for gynaecological cancer | |
| US9803196B2 (en) | Compositions and methods for treating, diagnosing and monitoring disease | |
| WO2016102560A1 (en) | Glycosylated biomarker | |
| NZ615915B2 (en) | Compositions and methods for treating, diagnosing and monitoring disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200980155785.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09805934 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 593392 Country of ref document: NZ Ref document number: 2009332712 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 4568/DELNP/2011 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2747760 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011541583 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2011/006773 Country of ref document: MX |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2009332712 Country of ref document: AU Date of ref document: 20091221 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009805934 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011130795 Country of ref document: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13141787 Country of ref document: US |
|
| REG | Reference to national code |
Ref country code: BR Ref legal event code: B01A Ref document number: PI0923525 Country of ref document: BR |
|
| ENP | Entry into the national phase |
Ref document number: PI0923525 Country of ref document: BR Kind code of ref document: A2 Effective date: 20110622 |