WO2010047062A1 - Rab6kifl/kif20a epitope peptide and vaccines containing the same - Google Patents
Rab6kifl/kif20a epitope peptide and vaccines containing the same Download PDFInfo
- Publication number
- WO2010047062A1 WO2010047062A1 PCT/JP2009/005382 JP2009005382W WO2010047062A1 WO 2010047062 A1 WO2010047062 A1 WO 2010047062A1 JP 2009005382 W JP2009005382 W JP 2009005382W WO 2010047062 A1 WO2010047062 A1 WO 2010047062A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- cancer
- rab6kifl
- oligopeptide
- peptides
- antigen
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K67/00—Rearing or breeding animals, not otherwise provided for; New or modified breeds of animals
- A01K67/027—New or modified breeds of vertebrates
- A01K67/0275—Genetically modified vertebrates, e.g. transgenic
- A01K67/0278—Knock-in vertebrates, e.g. humanised vertebrates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/04—Peptides having up to 20 amino acids in a fully defined sequence; Derivatives thereof
- A61K38/08—Peptides having 5 to 11 amino acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
- A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/0005—Vertebrate antigens
- A61K39/0011—Cancer antigens
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/14—Hydrolases (3)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Y—ENZYMES
- C12Y306/00—Hydrolases acting on acid anhydrides (3.6)
- C12Y306/04—Hydrolases acting on acid anhydrides (3.6) acting on acid anhydrides; involved in cellular and subcellular movement (3.6.4)
- C12Y306/04004—Plus-end-directed kinesin ATPase (3.6.4.4)
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2207/00—Modified animals
- A01K2207/15—Humanized animals
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/05—Animals comprising random inserted nucleic acids (transgenic)
- A01K2217/052—Animals comprising random inserted nucleic acids (transgenic) inducing gain of function
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/07—Animals genetically altered by homologous recombination
- A01K2217/075—Animals genetically altered by homologous recombination inducing loss of function, i.e. knock out
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2217/00—Genetically modified animals
- A01K2217/15—Animals comprising multiple alterations of the genome, by transgenesis or homologous recombination, e.g. obtained by cross-breeding
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2227/00—Animals characterised by species
- A01K2227/10—Mammal
- A01K2227/105—Murine
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
-
- A—HUMAN NECESSITIES
- A01—AGRICULTURE; FORESTRY; ANIMAL HUSBANDRY; HUNTING; TRAPPING; FISHING
- A01K—ANIMAL HUSBANDRY; AVICULTURE; APICULTURE; PISCICULTURE; FISHING; REARING OR BREEDING ANIMALS, NOT OTHERWISE PROVIDED FOR; NEW BREEDS OF ANIMALS
- A01K2267/00—Animals characterised by purpose
- A01K2267/03—Animal model, e.g. for test or diseases
- A01K2267/035—Animal model for multifactorial diseases
- A01K2267/0387—Animal model for diseases of the immune system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5152—Tumor cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5154—Antigen presenting cells [APCs], e.g. dendritic cells or macrophages
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/51—Medicinal preparations containing antigens or antibodies comprising whole cells, viruses or DNA/RNA
- A61K2039/515—Animal cells
- A61K2039/5158—Antigen-pulsed cells, e.g. T-cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/55—Medicinal preparations containing antigens or antibodies characterised by the host/recipient, e.g. newborn with maternal antibodies
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/57—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2
- A61K2039/572—Medicinal preparations containing antigens or antibodies characterised by the type of response, e.g. Th1, Th2 cytotoxic response
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/58—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation
- A61K2039/585—Medicinal preparations containing antigens or antibodies raising an immune response against a target which is not the antigen used for immunisation wherein the target is cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2799/00—Uses of viruses
- C12N2799/02—Uses of viruses as vector
- C12N2799/021—Uses of viruses as vector for the expression of a heterologous nucleic acid
- C12N2799/027—Uses of viruses as vector for the expression of a heterologous nucleic acid where the vector is derived from a retrovirus
Definitions
- the present invention relates to the field of biological science, more specifically to the field of cancer therapy.
- the present invention relates to novel oligopeptides and use thereof.
- CD8 positive CTLs recognize epitope peptides derived from the tumor-associated antigens (TAAs) found on major histocompatibility complex (MHC) class I molecule, and then kill the tumor cells.
- TAAs tumor-associated antigens
- MHC major histocompatibility complex
- NPL 3 Harris CC, J Natl Cancer Inst 1996 Oct 16, 88(20): 1442-55; NPL 4: Butterfield LH et al., Cancer Res 1999 Jul 1, 59(13): 3134-42; NPL 5: Vissers JL et al., Cancer Res 1999 Nov 1, 59(21): 5554-9; NPL 6: van der Burg SH et al., J Immunol 1996 May 1, 156(9): 3308-14; NPL 7: Tanaka F et al., Cancer Res 1997 Oct 15, 57(20): 4465-8; NPL 8: Fujie T et al., Int J Cancer 1999 Jan 18, 80(2): 169-72; NPL 9: Kikuchi M et al., Int J Cancer 1999 May 5, 81(3): 459-66; NPL 10: Oiso
- NPL 11 Belli F et al., J Clin Oncol 2002 Oct 15, 20(20): 4169-80
- NPL 12 Coulie PG et al., Immunol Rev 2002 Oct, 188: 33-42
- NPL 13 Rosenberg SA et al., Nat Med 2004 Sep, 10(9): 909-15).
- HLA class I-binding peptide sequence can be expected using algorithms (NPL 14: Journal of Immunological Methods, (1995), Vol.185, pp.181-190, NPL 15: J. Immunol., (1994), Vol.152, pp.163-175, NPL 16: protein science, (2000), Vol.9, pp.1838-1846).
- NPL 14 Journal of Immunological Methods, (1995), Vol.185, pp.181-190, NPL 15: J. Immunol., (1994), Vol.152, pp.163-175, NPL 16: protein science, (2000), Vol.9, pp.1838-1846.
- the expected epitope peptide can be processed naturally in the target cells and expressed on the target cell surface with HLA molecule.
- Pancreatic cancer has a poor prognosis, with an overall 5-year survival rate of about 5% (1).
- a surgical resection remains the only option for a long term survival, but patients with resectable pancreatic cancer are in the minority (9-22%) (NPL 20: Sener S F, et al. J Am Coll Surg 1999;189:1-7., NPL 21: Eloubeidi M A, et al. Am J Surg 2006;192:322-9., NPL 22: Goonetilleke K S,et al. Int J Surg 2007;5:147-51.). Even in these patients, however, the 5-year survival rate remains approximately 20% in spite of surgery with a curative intent (NPL 23: Smeenk H G, et al.
- NPL 24 Yeo C J, et al. Ann Surg 1995;221:721-31.
- NPL 25 Lockhart A C, et al. Gastroenterology 2005;128:1642-54.
- RAB6KIFL (KIF20A) was first identified to play a role in the dynamics of the Golgi apparatus through direct interaction with Rab6 small GTPase (NPL 26: Echard A, et al. Science 1998;279:580-5.).
- RAB6KIFL belongs to the kinesin superfamily of motor proteins, which have critical functions in trafficking of molecules and organelles (NPL 26: Echard A, et al. Science 1998;279:580-5.
- NPL 27 Hirokawa N, et al. Curr Opin Cell Biol 1998;10:60-73.
- NPL 28 Allan VJ, and Schroer TA. Curr Opin Cell Biol 1999;11:476-82.).
- RAB6KIFL (KIF20A) was recently shown to be up-regulated in several cancers such as bladder cancer (PTL 1: WO2006/085684), small cell lung cancer (SCLC) (PTL 2: WO2007/013665) and hormone-refractory prostate cancer (HRPC) (PTL 3: WO2008/102906), the disclosures of which are incorporated by reference herein. Further, some epitope peptides of KIF20A gene products were also identified (PTL 4: WO2008/102557).
- NPL 16 protein science, (2000), Vol.9, pp.1838-1846
- NPL 17 Parker KC, et al., (1994) J Immunol.;152(1):163-75.
- NPL 18 Kuzushima K, et al., (2001) Blood.;98(6):1872-81.
- NPL 19 Bachinsky MM, et. al., Cancer Immun. 2005 Mar 22;5:6.
- NPL 20 Sener S F, et al. J Am Coll Surg 1999;189:1-7.
- NPL 21 Eloubeidi M A, et al. Am J Surg 2006;192:322-9.
- NPL 22 Goonetilleke K S,et al. Int J Surg 2007;5:147-51.
- NPL 23 Smeenk H G, et al. Langenbecks Arch Surg 2005;390:94-103.
- NPL 24 Yeo C J, et al. Ann Surg 1995;221:721-31.
- NPL 25 Lockhart A C, et al. Gastroenterology 2005;128:1642-54.
- NPL 26 Echard A, et al. Science 1998;279:580-5.
- NPL 27 Hirokawa N, et al. Curr Opin Cell Biol 1998;10:60-73.
- NPL 28 Allan VJ, and Schroer TA. Curr Opin Cell Biol 1999;11:476-82.
- NPL 29 Taniuchi K, et al. Cancer Res 2005;65:105-12.
- the present invention is based in part on the discovery of new targets of immunotherapy. Because TAAs have often no immunogenicity, the discovery of appropriate targets is of extreme importance.
- the invention targets RAB6KIFL (SEQ ID NO: 2) encoded by the gene of GenBank Accession No. AF153329 or CR598555, also indicated by NM_005733 (SEQ ID NO: 1)), since RAB6KIFL has been identified as up-regulated in several cancers such as bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC).
- NSCLC non-small cell lung cancer
- SCLC small cell lung cancer
- the present invention provides RAB6KIFL gene products containing epitope peptides that elicit surprisingly strong CTL response that is specific to the corresponding molecules.
- Peripheral blood mononuclear cells (PBMCs) obtained from a healthy donor were stimulated using the peptides of the present invention.
- the present invention further provides established CTLs that specifically recognize HLA-A2 (A*0201) positive target cells pulsed with the respective peptides, and HLA-A2 (A*0201) restricted epitope peptides that can induce potent and specific immune responses against RAB6KIFL expressed on tumor.
- oligopeptides having CTL inducibility as well as an amino acid sequence selected from the group of SEQ ID NOs: 3, 4 and 5.
- one, two or several amino acids may be substituted, deleted, inserted and/or added, so long as the resulting modified oligopeptides retain the CTL inducibility of the original peptides.
- the present oligopeptides When administered to a subject, the present oligopeptides are presented on the surface of antigen-expressing cells and then induce CTLs targeting the respective peptides. Therefore, it is an object of the present invention to provide antigen-presenting cells and exosomes that present any of the present peptides, as well as methods for inducing antigen-presenting cells.
- An anti-tumor immune response is induced by the administration of the present RAB6KIFL oligopeptides or polynucleotides encoding the oligopeptides, as well as exosomes and antigen-presenting cells which present the RAB6KIFL oligopeptides. Therefore, it is yet another object of the present invention to provide pharmaceutical agents or pharmaceutical composition containing the oligopeptides or polynucleotides encoding them, as well as the exosomes and antigen-presenting cells as their active ingredients.
- the pharmaceutical agents or pharmaceutical compositions of the present invention find use as vaccines.
- the CTLs of the present invention also find use as vaccines against cancer.
- target cancers include, but are not limited to bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC).
- Figure 1 depicts markedly and frequently enhanced expression of RAB6KIFL mRNA in pancreatic cancer tissues as based on a cDNA microarray analysis.
- A depicts a list of up-regulated genes in pancreatic cancer cells. These genes were overexpressed in cancer cells in comparison to their normal counterparts. The expression of RAB6KIFL mRNA in pancreatic cancer cells was markedly enhanced in all of 6 pancreatic cancer patients.
- B depicts the relative expression ratio of RAB6KIFL gene in normal tissues based on a cDNA microarray analysis. RAB6KIFL gene was faintly expressed only in the testis and thymus.
- FIG. 1 depicts the expression level of the RAB6KIFL gene was also enhanced in many lung and bladder cancers as well as pancreatic cancer based on the previous cDNA microarray analysis.
- Figure 2 depicts the analyses of RAB6KIFL mRNA expressed in human normal tissues, cancer cell lines, and cancer tissues.
- A depicts the expression of RAB6KIFL mRNA was investigated in various normal tissues by using RT-PCR analysis. RAB6KIFL mRNA was faintly expressed only in testis.
- B depicts the RT-PCR analysis of the RAB6KIFL expression in various cancer cell lines.
- C depicts the RT-PCR analysis of the RAB6KIFL expression in pancreatic tumor tissues (T), and their normal counterparts (N).
- FIG. 1 depicts pancreatic cancer-specific overexpression of RAB6KIFL protein detected by Western blotting analyses.
- A depicts that RAB6KIFL protein was not detected in eight normal tissues, whereas the testis gave a faint band that had a similar mobility with that observed in PANC1 cell lysate.
- B depicts that, in two pancreatic cancer patients, RAB6KIFL protein was detected in cancer tissues (T) but not in adjacent normal tissues (N). Anti-beta-actin blotting was also performed to monitor equal protein loading.
- FIG. 4 depicts immunohistochemical analyses of RAB6KIFL protein in pancreatic cancer (A) and various normal tissues (B).
- A depicts strong staining of RAB6KIFL was mainly observed at the cytoplasm and nuclei of cancer cells in 6 of 9 cases, whereas very weak staining was observed in aciner cells and normal ductal epithelium of their normal adjacent pancreatic tissues. Similar strong staining was observed in the metastatic foci of the peritoneum. Little staining was detected in tumor-forming pancreatitis.
- B depicts RAB6KIFL was not stained in the normal brain, lung, liver, kidney, stomach, small intestine, colon, spleen, skeletal muscle, skin, and thymus.
- FIG. 5 depicts identification of HLA-A2-restricted mouse CTL epitopes of human RAB6KIFL by using HLA-A2.1 (HHD) Tgm.
- HLA-A2.1 (HHD) Tgm were immunized with 5 x 10 5 syngeneic BM-DCs pulsed with the twelve sets of the mixture of three kinds of peptides selected from 36 candidate peptides in vivo at day 7 and 14.
- CD4- spleen cells isolated from immunized mice were stimulated with BM-DCs pulsed with each peptide for 6 days.
- the CTL-produced IFN-gamma was detected by an ELISPOT assay.
- RAB6KIFL-A2-9-12 SEQ ID NO: 3
- RAB6KIFL-A2-9-809 SEQ ID NO: 4
- RAB6KIFL-A2-10-284 SEQ ID NO: 5
- peptides were shown to induce peptide-reactive CTLs. These assays were done twice with similar results.
- B depicts immunohistochemical staining with anti-CD4 or anti-CD8 mAb in tissue specimens of HLA-A2 (HHD) Tgm immunized with the RAB6KIFL-A2-9-809 peptide. After two-times vaccination, these specimens were resected and analyzed.
- Figure 6 depicts induction of RAB6KIFL-specific human CTL from the PBMCs of HLA-A2-positive healthy donors.
- A depicts that the RAB6KIFL peptide-reactive CTLs were generated from the PBMCs of HLA-A2-positive healthy donors.
- CTLs exhibited cytotoxicity to the RAB6KIFL-A2-9-12 (left), RAB6KIFL-A2-9-809 (middle), and RAB6KIFL-A2-10-284 (right) peptide pulsed T2 cells, but not to irrelevant HIV peptide and peptide-unpulsed T2 cells.
- B depicts that these CTLs exhibited cytotoxicity to the RAB6KIFL + HLA-A2 (A*0201) + human pancreatic cancer cell line PANC1 and colon cancer cell line CaCo-2, but not to RAB6KIFL + HLA-A2 (A*0201) - human pancreatic cancer cell line PK8.
- C depicts the cytotoxicity of these CTLs was RAB6KIFL-specific.
- CTLs killed SKHep1/RAB6KIFL, a RAB6KIFL low HLA-A2+ human liver cancer cell line SKHep1 transfected with human RAB6KIFL gene, but not killed SKHep1/Mock.
- D depicts the inhibition of cytotoxicity by anti-HLA-class I mAb.
- the target cells PANC1 were incubated with anti-HLA-class I mAb (W6/32, IgG 2a ) or anti-HLA-DR mAb (H-DR-1, IgG 2a ) respectively for 1 hour, the CTLs generated from the PBMCs of healthy donor by stimulation with RAB6KIFL-A2-9-12 (upper), RAB6KIFL-A2-9-809 (middle), and RAB6KIFL-A2-10-284 (lower) peptide were added. IFN-gamma productions were markedly inhibited by W6/32, but not by H-DR-1.
- polypeptide peptide
- protein protein
- amino acid polymers in which one or more amino acid residue is a modified residue, or a non-naturally occurring residue, such as an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
- oligopeptide sometimes used in the present specification is used to refer to peptides of the present invention which are 20 residues or fewer, typically 15 residues or fewer in length and usually consist of between about 8 and about 11 residues, often 9 or 10 residues.
- amino acid refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that similarly function to the naturally occurring amino acids.
- Naturally occurring amino acids are those encoded by the genetic code, as well as those modified after translation in cells (e.g., hydroxyproline, gamma-carboxyglutamate, and O-phosphoserine).
- amino acid analog refers to compounds that have the same basic chemical structure (an alpha carbon bound to a hydrogen, a carboxy group, an amino group, and an R group) as a naturally occurring amino acid but have a modified R group or modified backbones (e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium).
- modified R group or modified backbones e.g., homoserine, norleucine, methionine, sulfoxide, methionine methyl sulfonium.
- amino acid mimetic refers to chemical compounds that have different structures but similar functions to general amino acids.
- Amino acids may be referred to herein by their commonly known three letter symbols or the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission.
- cancer refers to cancers over-expressing the RAB6KIFL gene.
- examples of cancers over-expressing RAB6KIFL include, but are not limited to, bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC).
- NSCLC non-small cell lung cancer
- SCLC small cell lung cancer
- cytotoxic T lymphocyte refers to a sub-group of T lymphocytes that are capable of recognizing non-self cells (e.g., tumor cells, virus-infected cells) and inducing the death of such cells.
- non-self cells e.g., tumor cells, virus-infected cells
- HLA-A2 binding peptides derived from RAB6KIFL were identified using the information on their binding affinities to HLA-A2.
- DCs dendritic cells
- CTLs were successfully established using each of the peptides, particularly following peptides: RAB6KIFL-A2-9-12 (SEQ ID NO: 3), RAB6KIFL-A2-9-809 (SEQ ID NO: 4), and RAB6KIFL-A2-10-284 (SEQ ID NO: 5).
- the present invention provides oligopeptides such as nonapeptides (peptides consisting of nine amino acid residues) and decapeptides (peptides consisting of ten amino acid residues) corresponding to CTL-recognized epitopes of RAB6KIFL.
- oligopeptides of the present invention include those peptides having an amino acid sequence selected from among SEQ ID NOs: 3, 4 and 5.
- binding affinity with HLA antigens can be measured as described, for example, in Parker KC et al., J Immunol 1994 Jan 1, 152(1): 163-75; and Kuzushima K et al., Blood 2001, 98(6): 1872-81.
- the methods for determining binding affinity is described, for example, in; Journal of Immunological Methods, 1995, 185: 181-190.; Protein Science, 2000, 9: 1838-1846.
- the present invention encompasses peptides of RAB6KIFL which are determined to bind with HLA antigens by such known programs.
- these peptides of the present invention can be flanked with additional amino acid residues so long as the peptide retains its CTL inducibility.
- Such peptides with CTL inducibility are, for example, less than about 40 amino acids, often less than about 20 amino acids, usually less than about 15 amino acids.
- the amino acid sequence flanking the peptides consisting of the amino acid sequence selected from the group of SEQ ID NOs: 3, 4 and 5 is not limited and can be composed of any kind of amino acids so long as it does not impair the CTL inducibility of the original peptide.
- the present invention also provides peptides having CTL inducibility, which comprises the amino acid sequence selected from the group of SEQ ID NOs: 3, 4 and 5.
- modified peptides i.e., peptides composed of an amino acid sequence in which one, two or several amino acid residues have been modified (i.e., substituted, deleted, added and/or inserted) as compared to an original reference sequence
- modified peptides have been known to retain the biological activity of the original peptide (Mark et al., Proc Natl Acad Sci USA 1984, 81: 5662-6; Zoller and Smith, Nucleic Acids Res 1982, 10: 6487-500; Dalbadie-McFarland et al., Proc Natl Acad Sci USA 1982, 79: 6409-13).
- the oligopeptides of the present invention may have both CTL inducibility and an amino acid sequence selected from the group of SEQ ID NOs: 3, 4 and 5 wherein one, two or several amino acids are added, inserted, deleted, and/or substituted.
- amino acid side chain characteristics that are desirable to conserve include, for example, hydrophobic amino acids (A, I, L, M, F, P, W, Y, V), hydrophilic amino acids (R, D, N, C, E, Q, G, H, K, S, T), and side chains having the following functional groups or characteristics in common: an aliphatic side-chain (G, A, V, L, I, P); a hydroxyl group containing side-chain (S, T, Y); a sulfur atom containing side-chain (C, M); a carboxylic acid and amide containing side-chain (D, N, E, Q); a base containing side-chain (R, K, H); and an aromatic containing side-chain (H, F, Y, W).
- A, I, L, M, F, P, W, Y, V hydrophilic amino acids
- R, D, N, C, E, Q amino acids
- G, A, V, L, I, P a hydroxyl group containing side
- the following eight groups each contain amino acids that are accepted in the art as conservative substitutions for one another: 1) Alanine (A), Glycine (G); 2) Aspartic acid (D), Glutamic acid (E); 3) Aspargine (N), Glutamine (Q); 4) Arginine (R), Lysine (K); 5) Isoleucine (I), Leucine (L), Methionine (M), Valine (V); 6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W); 7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M) (see, e.g., Creighton, Proteins 1984).
- Such conservatively modified peptides are also considered to be peptides of the present invention.
- peptides of the present invention are not restricted thereto and can include non-conservative modifications, so long as the peptide retains the CTL inducibility of the original peptide.
- modified peptides should not exclude CTL inducible peptides of polymorphic variants, interspecies homologues, and alleles of RAB6KIFL.
- a small number for example, 1, 2 or several
- a small percentage of amino acids for example, 1, 2 or several
- the term “several” means 5 or fewer amino acids, for example, 3 or fewer.
- the percentage of amino acids to be modified can be 20% or less, for example, 15% of less, for example 10% or 1 to 5%.
- peptides of the present invention When used in the context of immunotherapy, peptides of the present invention should be presented on the surface of a cell or exosome, preferably as a complex with an HLA antigen. Therefore, t is preferable to select peptides that not only induce CTLs but also that possess high binding affinity to the HLA antigen. To that end, the peptides can be modified by substitution, insertion, deletion, and/or addition of the amino acid residues to yield a modified peptide having improved binding affinity.
- peptides having the amino acid sequences of SEQ ID NOs: 3, 4 or 5 wherein the second amino acid from the N-terminus is substituted with leucine or methionine and/or wherein the C-terminus is substituted with valine or leucine are encompassed by the present invention.
- Substitutions can be introduced not only at the terminal amino acids but also at the position of potential TCR recognition of peptides.
- amino acid substitutions in a peptide can be equal to or better than the original, for example CAP1, p53 (264-272), Her-2/neu (369-377) or gp100 (209-217) (Zaremba et al. Cancer Res. 57, 4570-4577, 1997, T. K.
- the present invention also contemplates the addition of amino acids to the sequences disclosed here.
- one, two or several amino acids can also be added to the N and/or C-terminus of the present peptides.
- modified peptides having high HLA antigen binding affinity and retained CTL inducibility are also included in the present invention.
- the peptide sequence is identical to a portion of the amino acid sequence of an endogenous or exogenous protein having a different function, side effects such as autoimmune disorders and/or allergic symptoms against specific substances may be induced. Therefore, it is preferable to first perform homology searches using available databases to avoid situations in which the sequence of the peptide matches the amino acid sequence of another protein.
- the objective peptide can be modified in order to increase its binding affinity with HLA antigens, and/or increase its CTL inducibility without any danger of such side effects.
- CTL inducibility indicates the ability of the peptide to induce cytotoxic lymphocytes (CTLs) when presented on antigen-presenting cells.
- CTL inducibility includes the ability of the peptide to induce CTL activation, CTL proliferation, promote CTL lysis of target cells, and to increase CTL IFN-gamma production.
- Confirmation of CTL inducibility is accomplished by inducing antigen-presenting cells carrying human MHC antigens (for example, B-lymphocytes, macrophages, and dendritic cells (DCs)), or more specifically DCs derived from human peripheral blood mononuclear leukocytes, and after stimulation with the peptides, mixing with CD8-positive cells, and then measuring the IFN-gamma produced and released by CTL against the target cells.
- human MHC antigens for example, B-lymphocytes, macrophages, and dendritic cells (DCs)
- DCs dendritic cells
- transgenic animals that have been produced to express a human HLA antigen (for example, those described in BenMohamed L, Krishnan R, Longmate J, Auge C, Low L, Primus J, Diamond DJ, Hum Immunol 2000 Aug, 61(8): 764-79, Related Articles, Books, Linkout Induction of CTL response by a minimal epitope vaccine in HLA A*0201/DR1 transgenic mice: dependence on HLA class II restricted T(H) response) can be used.
- the target cells can be radio-labeled with 51 Cr and such, and cytotoxic activity can be calculated from radioactivity released from the target cells.
- CTL inducibility can be assessed by measuring IFN-gamma produced and released by CTL in the presence of antigen-presenting cells (APCs) that carry immobilized peptides, and visualizing the inhibition zone on the media using anti-IFN-gamma monoclonal antibodies.
- APCs antigen-presenting cells
- the peptides of the present invention can also be linked to other substances, so long as the resulting linked peptide retains the requisite CTL inducibility of the original peptide.
- suitable substances include, but are not limited to: peptides, lipids, sugar and sugar chains, acetyl groups, natural and synthetic polymers, etc.
- the peptides can contain modifications such as glycosylation, side chain oxidation, or phosphorylation, etc. provided the modifications do not destroy the biological activity of the original peptide. These kinds of modifications can be performed to confer additional functions (e.g., targeting function, and delivery function) or to stabilize the polypeptide.
- polypeptides For example, to increase the in vivo stability of a polypeptide, it is known in the art to introduce D-amino acids, amino acid mimetics or unnatural amino acids; this concept can also be adapted to the present polypeptides.
- the stability of a polypeptide can be assayed in a number of ways. For instance, peptidases and various biological media, such as human plasma and serum, can be used to test stability (see, e.g., Verhoef et al., Eur J Drug Metab Pharmacokin 1986, 11: 291-302).
- the peptides of the present invention may be linked to other peptides via spacers or linkers.
- other peptides include, but are not limited to, CTL inducible peptides derived from other TAAs.
- two or more peptides of the present invention may be linked via spacers or linkers.
- the peptides linked via spacers or linkers may be the same or different each other.
- Spacers or linkers are not specifically limited, but are preferably peptides, more preferably peptides having one or more cleavage sites which are capable of being cleaved by enzymes such as peptidases, proteases and proteasomes.
- linkers or spacers include, but are not limited to: AAY (P. M. Daftarian et al., J Trans Med 2007, 5:26), AAA, NKRK (R. P. M. Sutmuller et al., J Immunol. 2000, 165: 7308-7315) or, one to several lysine redsidues (S. Ota et al., Can Res. 62, 1471-1476, K. S. Kawamura et al., J Immunol. 2002, 168: 5709-5715).
- the peptides of the present invention encompass those peptides linked to other peptides via spacers or linkers.
- the peptides of the present invention can also be described as "RAB6KIFL peptide(s)", “RAB6KIFL polypeptide(s)” or “RAB6KIFL oligopeptide”.
- the peptides of the present invention can be prepared using well known techniques. For example, the peptides can be prepared synthetically, using recombinant DNA technology or chemical synthesis. The peptides of the present invention can be synthesized individually or as longer polypeptides composed of two or more peptides. The peptides can then be isolated i.e., purified or isolated so as to be substantially free of other naturally occurring host cell proteins and fragments thereof, or any other chemical substances.
- a peptide of the present invention can be obtained through chemical synthesis based on the selected amino acid sequence.
- Examples of conventional peptide synthesis methods that can be adapted to the synthesis include, but are not limited to: (i) Peptide Synthesis, Interscience, New York, 1966; (ii) The Proteins, Vol. 2, Academic Press, New York, 1976; (iii) Peptide Synthesis (in Japanese), Maruzen Co., 1975; (iv) Basics and Experiment of Peptide Synthesis (in Japanese), Maruzen Co., 1985; (v) Development of Pharmaceuticals (second volume) (in Japanese), Vol. 14 (peptide synthesis), Hirokawa, 1991; (vi) WO99/67288; and (vii) Barany G. & Merrifield R.B., Peptides Vol. 2, "Solid Phase Peptide Synthesis", Academic Press, New York, 1980, 100-118.
- the present peptides can be obtained adapting any known genetic engineering methods for producing peptides (e.g., Morrison J, J Bacteriology 1977, 132: 349-51; Clark-Curtiss & Curtiss, Methods in Enzymology (eds. Wu et al.) 1983, 101: 347-62).
- a suitable vector harboring a polynucleotide encoding the objective peptide in an expressible form e.g., downstream of a regulatory sequence corresponding to a promoter sequence
- the host cell is then cultured to produce the peptide of interest.
- the peptide can also be produced in vitro adopting an in vitro translation system.
- polynucleotides which encodes any of the aforementioned peptides of the present invention. These include polynucleotides derived from the natural occurring RAB6KIFL/KIF20A gene (GenBank Accession No. NM_005733 (SEQ ID NO: 1)) as well as those having a conservatively modified nucleotide sequence thereof.
- RAB6KIFL/KIF20A gene GenBank Accession No. NM_005733 (SEQ ID NO: 1)
- conservely modified nucleotide sequence refers to sequences which encode identical or essentially identical amino acid sequences. Due to the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein.
- the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine.
- the codon can be altered to any of the corresponding codons described without altering the encoded polypeptide.
- Such nucleic acid variations are "silent variations," which are one species of conservatively modified variations. Every nucleic acid sequence herein which encodes a peptide also describes every possible silent variation of the nucleic acid.
- each codon in a nucleic acid can be modified to yield a functionally identical molecule. Accordingly, each silent variation of a nucleic acid that encodes a peptide is implicitly described in each disclosed sequence.
- the polynucleotide of the present invention can be composed of DNA, RNA, and derivatives thereof.
- a DNA is suitably composed of bases such as A, T, C, and G, and T is replaced by U in an RNA.
- the polynucleotide of the present invention can encode multiple peptides of the present invention with or without intervening amino acid sequences in between.
- the intervening amino acid sequence can provide a cleavage site (e.g., enzyme recognition sequence) of the polynucleotide or the translated peptides.
- the polynucleotide can include any additional sequences to the coding sequence encoding the peptide of the present invention.
- the polynucleotide can be a recombinant polynucleotide that includes regulatory sequences required for the expression of the peptide or can be an expression vector (plasmid) with marker genes and such.
- such recombinant polynucleotides can be prepared by the manipulation of polynucleotides through conventional recombinant techniques using, for example, polymerases and endonucleases.
- a polynucleotide can be produced by insertion into an appropriate vector, which can be expressed when transfected into a competent cell.
- a polynucleotide can be amplified using PCR techniques or expression in suitable hosts (see, e.g., Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory, New York, 1989).
- a polynucleotide can be synthesized using the solid phase techniques, as described in Beaucage SL & Iyer RP, Tetrahedron 1992, 48: 2223-311; Matthes et al., EMBO J 1984, 3: 801-5.
- Vectors containing the polynucleotide of the present invention and host cells harboring the vectors are also included in the present invention.
- Exosomes The present invention further provides intracellular vesicles called exosomes, which present complexes formed between the peptides of this invention and HLA antigens on their surface. Exosomes can be prepared, for example by using the methods detailed in Japanese Patent Application Kohyo Publications Nos. Hei 11-510507 and WO99/03499, and can be prepared using APCs obtained from patients who are subject to treatment and/or prevention. The exosomes of this invention can be inoculated as vaccines, in a fashion similar to the peptides of this invention.
- HLA antigens comprised in the complexes must match that of the subject requiring treatment and/or prevention.
- HLA-A2 type that is highly expressed among the Japanese and Caucasian is favorable for obtaining effective results, and subtypes such as HLA-A2 (A*0201) and HLA-A2 (A*0206) find use.
- the type of HLA antigen of the patient requiring treatment is investigated in advance, which enables appropriate selection of peptides having high levels of binding affinity to this antigen, or having CTL inducibility by antigen presentation.
- substitution or addition of 1, 2, or several amino acids can be performed based on the amino acid sequence of the naturally occurring RAB6KIFL partial peptide.
- HLA-A2 (A*0201) antigen for the exosome of the present invention
- a peptide having the sequence selected peptide of SEQ ID NO: 3, 4 and 5 finds use.
- the present invention also provides isolated APCs that present complexes formed between HLA antigens and the peptides of this invention on its surface.
- the APCs that are obtained by contacting the peptides of this invention, or introducing the polynucleotides encoding the peptides of this invention in an expressible form can be derived from patients who are subject to treatment and/or prevention, and can be administered as vaccines by themselves or in combination with other drugs including the peptides of this invention, exosomes, or cytotoxic T cells.
- the APCs are not limited to a particular kind of cells and include dendritic cells (DCs), Langerhans cells, macrophages, B cells, and activated T cells, which are known to present proteinaceous antigens on their cell surface so as to be recognized by lymphocytes. Since DC is a representative APC having the strongest CTL inducing action among APCs, DCs find use as the APCs of the present invention.
- DCs dendritic cells
- Langerhans cells macrophages
- B cells and activated T cells, which are known to present proteinaceous antigens on their cell surface so as to be recognized by lymphocytes. Since DC is a representative APC having the strongest CTL inducing action among APCs, DCs find use as the APCs of the present invention.
- an APC can be obtained by inducing DCs from peripheral blood monocytes and then contacting (stimulating) them with the peptides of this invention in vitro, ex vivo or in vivo.
- APCs that present the peptides of this invention are induced in the body of the subject.
- the phrase "inducing APC” includes contacting (stimulating) a cell with the peptides of this invention, or nucleotides encoding the peptides of this invention to present complexes formed between HLA antigens and the peptides of this invention on cell's surface.
- the APCs can be administered to the subject as a vaccine.
- the ex vivo administration can include the steps of: a: collecting APCs from a first subject: b: contacting with the APCs of step a, with the peptide; and c: administering the peptide-loaded APCs to a second subject.
- the first subject and the second subject can be the same individual, or may be different individuals.
- use of the peptides of this invention for manufacturing a pharmaceutical composition inducing antigen-presenting cells is provided.
- the present invention provides a method or process for manufacturing a pharmaceutical composition for inducing antigen-presenting cells, wherein the method includes the step of admixing or formulating the peptide of the present invention with a pharmaceutically acceptable carrier.
- the present invention provides a method or process for manufacturing a pharmaceutical composition for treating cancers including bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC), wherein the method includes the step of admixing or formulating the peptide of the present invention with a pharmaceutically acceptable carrier.
- the present invention also provides the peptides of the present invention for inducing antigen-presenting cells.
- the APCs obtained by step b can be administered to the subject as a vaccine.
- the present invention provides the peptides for treating cancers including bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC).
- cancers including bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC).
- NSCLC non-small cell lung cancer
- SCLC small cell lung cancer
- the APCs of the present invention have a high level of CTL inducibility.
- the high level is relative to the level of that by APC contacting with no peptide or peptides which can not induce the CTL.
- Such APCs having a high level of CTL inducibility can be prepared by a method which includes the step of transferring genes containing polynucleotides that encode the peptides of this invention to APCs in vitro.
- the introduced genes can be in the form of DNAs or RNAs. Examples of methods for introduction include, without particular limitations, various methods conventionally performed in this field, such as lipofection, electroporation, and calcium phosphate method can be used.
- the APCs of the present invention present on its surface a complex of an HLA antigen and a oligopeptide comprising an amino acid sequence selected from among SEQ ID NO: 3, 4 and 5.
- the APCs of the present invention carry HLA-A2 antigen, in particular HLA-A2 (A*0201) on its surface.
- oligopeptide to form complex with an HLA antigen may be a oligopeptide comprising an amino acid sequence selected from among SEQ ID NO: 3, 4, and 5, wherein one, two or several amino acids are substituted, inserted, deleted and/or added, for example, the second amino acid from the N-terminus may be substituted with leucine or methionine, and/or the C-terminal amino acid may be substituted with valine or leucine.
- Cytotoxic T cells A cytotoxic T cell induced against any of the peptides of the present invention strengthens the immune response targeting tumor-associated endothelia in vivo and thus can be used as vaccines, in a fashion similar to the peptides per se.
- the present invention also provides isolated cytotoxic T cells that are specifically induced or activated by any of the present peptides.
- Such cytotoxic T cells can be obtained by (1) administering to a subject, and then collecting cytotoxic T cells from the subject, or (2) contacting (stimulating) subject-derived APCs, and CD8-positive cells, or peripheral blood mononuclear leukocytes in vitro with the peptides of the present invention and then isolating cytotoxic T cells.
- the cytotoxic T cells which have been induced by stimulation from APCs that present the peptides of this invention, can be derived from patients who are subject to treatment and/or prevention, and can be administered by themselves or in combination with other drugs including the peptides of this invention or exosomes for the purpose of regulating effects.
- the obtained cytotoxic T cells act specifically against target cells presenting the peptides of this invention, or for example, the same peptides used for induction.
- the cytotoxic T cells can recognize (i.e., binding to) a complex formed between a HLA antigen and the peptide of the present invention on a target cell surface with the T cell receptor, and then attack the target cell to induce the death of the target cell.
- the target cells can be cells that endogenously express RAB6KIFL, or cells that are transfected with the RAB6KIFL gene; and cells that present a peptide of this invention on the cell surface due to stimulation by the peptide can also serve as targets of activated CTL attack.
- the target cells carry HLA-A2 antigen, in particular HLA-A2 (A*020) on its surface.
- T cell receptor The present invention also provides a composition composed of a nucleic acid sequence encoding polypeptides that are capable of forming a subunit of a T cell receptor (TCR), and methods of using the same.
- the TCR alpha and beta have the ability to form TCR that confer specificity to T cells against tumor cells expressing RAB6KIFL.
- the nucleic acid sequence of TCR alpha and beta chains of the TCR expressed in the CTL induced with one or more peptides of this invention can be isolated and used to construct suitable vectors that can mediate high efficiency gene transfer into primary human lymphocytes (WO2007/032255 and Morgan RA, et al., J Immunol, 171, 3287 (2003)).
- these vectors are retroviral vectors.
- the invention provides an off-the-shelf composition allowing rapid modification of a patient's own T cells (or those of another mammal) to rapidly and easily produce modified T cells having excellent cancer cell killing properties.
- the present invention provides CTLs which are prepared by transduction with the nucleic acids encoding the TCR subunits polypeptides that bind to the RAB6KIFL peptide e.g. SEQ ID NOs: 3, 4 and 5 in the context of HLA-A2 (A*0201).
- the transduced CTLs are capable of homing to cancer cells in vivo, and can be expanded by well known culturing methods in vitro (e.g., Kawakami et al., J Immunol., 142, 3452-3461 (1989)).
- the T cells of the invention can be used to form an immunogenic composition useful in treating or the prevention of cancer in a patient in need of therapy or protection (WO2006/031221).
- prevention and prophylaxis are interchangeably used herein to refer to any activity that reduces the burden of mortality or morbidity from disease.
- Prevention and prophylaxis can occur "at primary, secondary and tertiary prevention levels.” While primary prevention and prophylaxis avoid the development of a disease, secondary and tertiary levels of prevention and prophylaxis encompass activities aimed at the prevention and prophylaxis of the progression of a disease and the emergence of symptoms as well as reducing the negative impact of an already established disease by restoring function and reducing disease-related complications.
- prevention and prophylaxis can include a wide range of prophylactic therapies aimed at alleviating the severity of the particular disorder, e.g. reducing the proliferation and metastasis of tumors.
- the treatment and/or prophylaxis of cancer and/or the prevention of postoperative recurrence thereof include any of the following steps, such as the surgical removal of cancer cells, the inhibition of the growth of cancerous cells, the involution or regression of a tumor, the induction of remission and suppression of occurrence of cancer, the tumor regression, and the reduction or inhibition of metastasis.
- Effectively treating and/or the prophylaxis of cancer decreases mortality and improves the prognosis of individuals having cancer, decreases the levels of tumor markers in the blood, and alleviates detectable symptoms accompanying cancer.
- reduction or improvement of symptoms constitutes effectively treating and/or the prophylaxis include 10%, 20%, 30% or more reduction, or stable disease.
- the peptides of this invention or polynucleotides encoding such peptides can be used for the treatment and/or for the prophylaxis of cancer, and/or prevention of postoperative recurrence thereof.
- the present invention provides a pharmaceutical agent or composition for treating and/or for preventing of cancer, and/or preventing the postoperative recurrence thereof, which includes one or more of the peptides of this invention, or polynucleotides encoding the peptides as an active ingredient.
- the present peptides can be expressed on the surface of any of the foregoing exosomes or cells, such as APCs for the use as pharmaceutical agents or composition.
- the aforementioned cytotoxic T cells which target any of the peptides of the present invention can also be used as the active ingredient of the present pharmaceutical agents or composition.
- the phrase "targeting a peptide” refers to recognizing (i.e., binding to) a complex formed between a HLA antigen and a peptide on a target cell surface with the T cell receptor, and then attacking the target cell to induce the death of the target cell.
- the present invention also provides the use of an active ingredient selected from among: (a) a peptide of the present invention, (b) a nucleic acid encoding such a peptide as disclosed herein in an expressible form, (c) an APC of the present invention, and (d) a cytotoxic T cells of the present invention in manufacturing a pharmaceutical composition or agent for treating cancer.
- an active ingredient selected from among: (a) a peptide of the present invention, (b) a nucleic acid encoding such a peptide as disclosed herein in an expressible form, (c) an APC of the present invention, and (d) a cytotoxic T cells of the present invention in manufacturing a pharmaceutical composition or agent for treating cancer.
- the present invention further provides an active ingredient selected from among: (a) a peptide of the present invention, (b) a nucleic acid encoding such a peptide as disclosed herein in an expressible form, (c) an APC of the present invention, and (d) a cytotoxic T cells of the present invention for use in treating cancer.
- the present invention further provides a method or process for manufacturing a pharmaceutical composition or agent for treating cancer, wherein the method or process includes the step of formulating a pharmaceutically or physiologically acceptable carrier with an active ingredient selected from among: (a) a peptide of the present invention, (b) a nucleic acid encoding such a peptide as disclosed herein in an expressible form, (c) an APC of the present invention, and (d) a cytotoxic T cells of the present invention as active ingredients.
- a pharmaceutically or physiologically acceptable carrier with an active ingredient selected from among: (a) a peptide of the present invention, (b) a nucleic acid encoding such a peptide as disclosed herein in an expressible form, (c) an APC of the present invention, and (d) a cytotoxic T cells of the present invention as active ingredients.
- the present invention also provides a method or process for manufacturing a pharmaceutical composition or agent for treating cancer, wherein the method or process includes the step of admixing an active ingredient with a pharmaceutically or physiologically acceptable carrier, wherein the active ingredient is selected from among: (a) a peptide of the present invention, (b) a nucleic acid encoding such a peptide as disclosed herein in an expressible form, (c) an APC of the present invention, and (d) a cytotoxic T cells of the present invention.
- composition or agent of the present invention may be used for either or both the prophylaxis of cancer and prevention of postoperative recurrence thereof.
- the present pharmaceutical agents or compositions find use as a vaccine.
- the phrase "vaccine” also referred to as an immunogenic composition refers to a substance that has the function to induce anti-tumor immunity upon inoculation into animals.
- the pharmaceutical agents or compositions of the present invention can be used to treat and/or prevent cancers, and/or prevention of postoperative recurrence thereof in subjects or patients including human and any other mammal including, but not limited to, mouse, rat, guinea-pig, rabbit, cat, dog, sheep, goat, pig, cattle, horse, monkey, baboon, and chimpanzee, particularly a commercially important animal or a domesticated animal.
- oligopeptides having an amino acid sequence selected from among SEQ ID NOs: 3, 4 and 5 have been found to be HLA-A2 (A*0201)-restricted epitope peptides, that can induce potent and specific immune response. Therefore, the present pharmaceutical agents or compositions which include any of these oligopeptides with the amino acid sequences of SEQ ID NOs: 3, 4 or 5 are particularly suited for the administration to subjects whose HLA antigen is HLA-A2 (A*0201). The same applies to pharmaceutical agents or compositions which include polynucleotides encoding any of these oligopeptides.
- Cancers to be treated by the pharmaceutical agents or compositions of the present invention are not limited and include all kinds of cancers wherein RAB6KIFL is involved, including for example, bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC).
- the pharmaceutical agents or compositions of the present invention are preferably applied to pancreatic cancer.
- the present pharmaceutical agents or compositions can contain in addition to the aforementioned active ingredients, other peptides which have the ability to induce CTLs against cancerous cells, other polynucleotides encoding the other peptides, other cells that present the other peptides, or such.
- the other peptides that have the ability to induce CTLs against cancerous cells are exemplified by cancer specific antigens (e.g., identified TAAs), but are not limited thereto.
- the pharmaceutical agents or compositions of the present invention can optionally include other therapeutic substances as an active ingredient, so long as the substance does not inhibit the antitumoral effect of the active ingredient, e.g., any of the present peptides.
- formulations can include anti-inflammatory agents or compositions, pain killers, chemotherapeutics, and the like.
- the medicaments of the present invention can also be administered sequentially or concurrently with the one or more other pharmacologic agents or compositions.
- the amounts of medicament and pharmacologic agent or compositions depend, for example, on what type of pharmacologic agent(s) or compositions(s) is/are used, the disease being treated, and the scheduling and routes of administration.
- the pharmaceutical agents or compositions of this invention can include other agents or compositions conventional in the art having regard to the type of formulation in question.
- the present pharmaceutical agents or compositions can be included in articles of manufacture and kits containing materials useful for treating the pathological conditions of the disease to be treated, e.g, cancer.
- the article of manufacture can include a container of any of the present pharmaceutical agents or compositions with a label. Suitable containers include bottles, vials, and test tubes. The containers can be formed from a variety of materials, such as glass or plastic.
- the label on the container should indicate the agent or compositions are used for treating or prevention of one or more conditions of the disease.
- the label can also indicate directions for administration and so on.
- kits including a pharmaceutical agent or compositions of the present invention can optionally further include a second container housing a pharmaceutically-acceptable diluent. It can further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for use.
- compositions can, if desired, be presented in a pack or dispenser device which can contain one or more unit dosage forms containing the active ingredient.
- the pack can, for example, include metal or plastic foil, such as a blister pack.
- the pack or dispenser device can be accompanied by instructions for administration.
- compositions containing the peptides as the active ingredient can be administered directly as a pharmaceutical agent or compositions or if necessary, that has been formulated by conventional formulation methods.
- carriers, excipients, and such that are ordinarily used for drugs can be included as appropriate without particular limitations. Examples of such carriers are sterilized water, physiological saline, phosphate buffer, culture fluid and such.
- the pharmaceutical agents or compositions can contain as necessary, stabilizers, suspensions, preservatives, surfactants and such.
- the pharmaceutical agents or compositions of this invention can be used for anticancer purposes.
- the peptides of this invention can be prepared as a combination, composed of two or more of peptides of the invention, to induce CTL in vivo.
- the peptide combination can take the form of a cocktail or can be conjugated to each other using standard techniques.
- the peptides can be chemically linked or expressed as a single fusion polypeptide sequence.
- the peptides in the combination can be the same or different.
- APCs that present any of the peptides of this invention on their cell surface are obtained by removing APCs (e.g., DCs) from the subjects, which are stimulated by the peptides of this invention, CTL is induced in the subjects by readministering these APCs (e.g., DCs) to the subjects, and as a result, aggressiveness towards the cancer cells, such as bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma and small cell lung cancer (SCLC) can be increased.
- APCs e.g., DCs
- CTL is induced in the subjects by readministering these APCs (e.g., DCs) to the subjects, and as a result, aggressiveness towards the cancer cells, such as bladder cancer, breast cancer, cholangiocellular carcinoma, esophageal cancer, non-small cell lung cancer (NSCLC), pancreatic cancer, prostate cancer, renal carcinoma
- the pharmaceutical agents or compositions for the treatment and/or prevention of cancer which include a peptide of this invention as the active ingredient, can also include an adjuvant known to effectively establish cellular immunity. Alternatively, they can be administered with other active ingredients, and they can be administered by formulation into granules.
- An adjuvant refers to a compound that enhances the immune response against the protein when administered together (or successively) with the protein having immunological activity. Adjuvants contemplated herein include those described in the literature (Clin Microbiol Rev 1994, 7: 277-89). Examples of suitable adjuvants include, but are not limited to, aluminum phosphate, aluminum hydroxide, alum, cholera toxin, salmonella toxin, and such, but are not limited thereto.
- liposome formulations may be conveniently used.
- granular formulations in which the peptide is bound to few-micrometers diameter beads, and formulations in which a lipid is bound to the peptide may be conveniently used.
- the pharmaceutical agents or compositions of the invention may further include a component which primes CTL.
- Lipids have been identified as agents or compositions capable of priming CTL in vivo against viral antigens.
- palmitic acid residues can be attached to the epsilon -and alpha-amino groups of a lysine residue and then linked to a peptide of the invention.
- the lipidated peptide can then be administered either directly in a micelle or particle, incorporated into a liposome, or emulsified in an adjuvant.
- lipid priming of CTL responses E.
- coli lipoproteins such as tripalmitoyl-S-glycerylcysteinlyseryl- serine (P3CSS) can be used to prime CTL when covalently attached to an appropriate peptide (see, e.g., Deres et al., Nature 1989, 342: 561-4).
- P3CSS tripalmitoyl-S-glycerylcysteinlyseryl- serine
- the method of administration can be oral, intradermal, subcutaneous, intravenous injection, or such, and systemic administration or local administration to the vicinity of the targeted sites.
- the administration can be performed by single administration or boosted by multiple administrations.
- the dose of the peptides of this invention can be adjusted appropriately according to the disease to be treated, age of the patient, weight, method of administration, and such, and is ordinarily 0.001 mg to 1000 mg, for example, 0.001 mg to 1000 mg, for example, 0.1 mg to 10 mg, and can be administered once in a few days to few months.
- One skilled in the art can appropriately select a suitable dose.
- compositions containing polynucleotides as the active ingredient can also contain nucleic acids encoding the peptides disclosed herein in an expressible form.
- the phrase "in an expressible form” means that the polynucleotide, when introduced into a cell, will be expressed in vivo as a polypeptide that induces anti-tumor immunity.
- the nucleic acid sequence of the polynucleotide of interest includes regulatory elements necessary for expression of the polynucleotide.
- the polynucleotide(s) can be equipped so to achieve stable insertion into the genome of the target cell (see, e.g., Thomas KR & Capecchi MR, Cell 1987, 51: 503-12 for a description of homologous recombination cassette vectors). See, e.g., Wolff et al., Science 1990, 247: 1465-8; U.S. Patent Nos. 5,580,859; 5,589,466; 5,804,566; 5,739,118; 5,736,524; 5,679,647; and WO 98/04720.
- DNA-based delivery technologies include "naked DNA”, facilitated (bupivacaine, polymers, peptide-mediated) delivery, cationic lipid complexes, and particle-mediated (“gene gun”) or pressure-mediated delivery (see, e.g., U.S. Patent No. 5,922,687).
- the peptides of the present invention can also be expressed by viral or bacterial vectors.
- expression vectors include attenuated viral hosts, such as vaccinia or fowlpox. This approach involves the use of vaccinia virus, e.g., as a vector to express nucleotide sequences that encode the peptide. Upon introduction into a host, the recombinant vaccinia virus expresses the immunogenic peptide, and thereby elicits an immune response.
- Vaccinia vectors and methods useful in immunization protocols are described in, e.g., U.S. Patent No. 4,722,848. Examples of another vector include BCG (Bacille Calmette Guerin).
- BCG vectors are described in Stover et al., Nature 1991, 351: 456-60.
- a wide variety of other vectors useful for therapeutic administration or immunization e.g., adeno and adeno-associated virus vectors, retroviral vectors, Salmonella typhi vectors, detoxified anthrax toxin vectors, and the like, will be apparent. See, e.g., Shata et al., Mol Med Today 2000, 6: 66-71; Shedlock et al., J Leukoc Biol 2000, 68: 793-806; Hipp et al., In Vivo 2000, 14: 571-85.
- Delivery of a polynucleotide into a subject can be either direct, in which case the subject is directly exposed to a polynucleotide-carrying vector, or indirect, in which case, cells are first transformed with the polynucleotide of interest in vitro, then the cells are transplanted into the subject.
- two approaches are known, respectively, as in vivo and ex vivo gene therapies.
- the method of administration can be oral, intradermal, subcutaneous, intravenous injection, or such, and systemic administration or local administration to the vicinity of the targeted sites finds use.
- the administration can be performed by single administration or boosted by multiple administrations.
- the dose of the polynucleotide in the suitable carrier or cells transformed with the polynucleotide encoding the peptides of this invention can be adjusted appropriately according to the disease to be treated, age of the patient, weight, method of administration, and such, and is ordinarily 0.001 mg to 1000 mg, for example, 0.001 mg to 1000 mg, for example, 0.1 mg to 10 mg, and can be administered once every a few days to once every few months.
- One skilled in the art can appropriately select the suitable dose.
- peptides, exosomes, APCs and CTLs Methods using the peptides, exosomes, APCs and CTLs
- the peptides of the present invention and polynucleotides encoding such peptides can be used for inducing APCs and CTLs.
- the exosomes and APCs of the present invention can be also used for inducing CTLs.
- the peptides, polynucleotides, exosomes and APCs can be used in combination with any other compounds so long as the compounds do not inhibit their CTL inducibility.
- any of the aforementioned pharmaceutical agents or compositions of the present invention can be used for inducing CTLs, and in addition thereto, those including the peptides and polynucleotides can be also be used for inducing APCs as discussed below.
- APCs antigen-presenting cells
- the present invention provides methods of inducing APCs using the peptides of this invention or polynucleotides encoding the peptides.
- the induction of APCs can be performed as described above in section "VI. Antigen-presenting cells”.
- This invention also provides a method for inducing APCs having a high level of CTL inducibility, the induction of which has been also mentioned under the item of "VI. Antigen-presenting cells", supra.
- the methods for inducing APCs include at least one step selected from among: a: contacting APCs with the peptides of the present invention, and b: introducing the polypeptides of the present invention in an expressible form into APCs.
- Such methods for inducing APCs are preferably performed in vitro or ex vivo.
- APCs to be induced may be obtained from a subject to be treated or others whose HLA antigens are the same as the subject.
- the APCs induced by the present methods carry HLA-A2 antigen, in particular HLA-A2 (A*0201) on its surface.
- the present invention provides methods for inducing CTLs using the peptides of this invention, polynucleotides encoding the peptides, or exosomes or APCs presenting the peptides.
- the present invention also provides methods for inducing CTLs using a polynucleotide encoding a polypeptide that is capable of forming a T cell receptor (TCR) subunit recognizing (i.e., binding to) a complex of the peptides of the present invention and HLA antigens on a cell surface.
- TCR T cell receptor
- the methods for inducing CTLs include at least one step selected from among: a: contacting a CD8-positive T cell with an antigen-presenting cell and/or an exosome that presents on its surface a complex of an HLA antigen and a peptide of the present invention, and b: introducing a polynucleotide encoding a polypeptide that is capable of forming a TCR subunit recognizing a complex of a peptide of the present invention and an HLA antigen into a CD8 positive T cell.
- the peptides of this invention When the peptides of this invention are administered to a subject, CTL is induced in the body of the subject, and the strength of the immune response targeting the tumor-associated endothelia is enhanced.
- the peptides and polynucleotides encoding the peptides can be used for an ex vivo therapeutic method, in which subject-derived APCs, and CD8-positive cells, or peripheral blood mononuclear leukocytes are contacted (stimulated) with the peptides of this invention in vitro, and after inducing CTL, the activated CTL cells are returned to the subject.
- the method can include steps of: a: collecting APCs from subject, b: contacting with the APCs of step a, with the peptide, c: mixing the APCs of step b with CD 8+ T cells, and co-culturing for inducing CTLs, and d: collecting CD 8+ T cells from the co-culture of step c.
- the present invention provides a method or process for manufacturing a pharmaceutical agent or composition inducing CTLs, wherein the method comprises the step of admixing or formulating the peptide of the present invention with a pharmaceutically acceptable carrier. Further, the present invention also provides the peptide of the present invention for inducing CTLs.
- the CD8 + T cells having cytotoxic activity obtained by step d can be administered to the subject as a vaccine.
- the APCs to be mixed with the CD8 + T cells in above step c can also be prepared by transferring genes coding for the present peptides into the APCs as detailed above in section "VI. Antigen-presenting cells"; but are not limited thereto and any APC or exosome which effectively presents the present peptides to the T cells can be used for the present method.
- cDNA Microarray analysis A profiling of the gene expression by a cDNA microarray analysis was done as described previously (Nakamura T, et al. Oncogene 2004;23:2385-400). The tissue samples from pancreatic cancers and adjacent noncancerous normal pancreatic tissues were obtained from surgical specimens, and all patients provided their written informed consent to participate in this study. In Figs. 1C, the relative expression ratio was calculated by dividing the value of the expression of RAB6KIFL mRNA in cancer cells by that in normal counterpart. In Figs.
- the relative expression ratio of normal tissues was calculated by dividing the value of the expression of RAB6KIFL mRNA in each normal tissue by the value of the expression of RAB6KIFL mRNA in control RNA that was a mixture of equal amount of RNA samples from 40 normal tissues indicated in Figs. 1B.
- mice HLA-A2.1 (HHD) Tgm; H-2D b-/- beta 2m -/- double knockout mice introduced with a human beta 2m-HLA-A2.1 (alpha 1, alpha 2)-H-2D b (alpha 3 transmembrane cytoplasmic; HHD) monochain construct gene were generated in the Department SIDA-Retrovirus, Unite d' Immunite Cellulaire Antivirale, Institute Pasteur, France (Pascolo S, et al. J Exp Med 1997;185:2043-51, Firat H, et al. Eur J Immunol 1999;29:3112-21) and kindly provided by Dr. F.A. Lemonnier. The mice were maintained at the Center for Animal Resources and Development of Kumamoto University and they were handled in accordance with the animal care guidelines of Kumamoto University.
- the human pancreatic cancer cell line PANC1, human colon cancer cell line CaCo-2, and a TAP-deficient and HLA-A2 (A*0201)-positive cell line T2 were purchased from Riken Cell Bank (Tsukuba, Japan).
- the human pancreatic cancer cell line PK8 was kindly provided by the Cell Resource Center for Biomedical Research Institute of Development, Aging and Cancer, Tohoku University (Sendai, Japan).
- the human liver cancer cell line SKHep1 was kindly provided by Dr. Kyogo Ito, Kurume University (Kurume, Japan).
- HLA-A2 The expression of HLA-A2 was examined using flow cytometry with an anti-HLA-A2 monoclonal antibody (mAb), BB7.2 (One Lambda, Inc., Canoga Park, CA) in order to select the HLA-A2-positive blood donors and target cell lines for the cytotoxicity assays.
- mAb monoclonal antibody
- BB7.2 One Lambda, Inc., Canoga Park, CA
- RT-PCR Reverse transcription-PCR
- the primer sequences were as follows: RAB6KIFL, sense 5'- CTACAAGCACCCAAGGACTCT -3' (SEQ ID NO: 6) and antisense 5'- AGATGGAGAAGCGAATGTTT -3' (SEQ ID NO: 7) and beta-actin, sense 5'- CATCCACGAAACTACCTTCAACT-3' (SEQ ID NO: 8) and antisense 5'- TCTCCTTAGAGAGAAGTGGGGTG-3' (SEQ ID NO: 9), and used RT-PCR reactions consisting of initial denaturation at 94 degrees C for 5 minutes and 32-35 amplification cycles at an annealing temperature of 58 degrees C. After normalization by beta-actin mRNA as a control, the expression of RAB6KIFL mRNA was compared in tissues and
- Lentiviral gene transfer A lentiviral vector-mediated gene transfer was performed as described previously(Imai K, et al. Clin Cancer Res 2008; 14:6487-95, Tahara-Hanaoka S, et al. Exp Hematol 2002; 30:11-7). Briefly, 17 micro-g of CSII-CMV-RfA and CSIIEF-RfA self-inactivating vectors (Miyoshi H, et al.
- mice with peptides were done as previously described (Nakatsura T, et al. Biochem Biophys Res Commun 2003; 306:16-25).
- the frequency of cells producing IFN-gamma/1 x 10 5 CD4- spleen cells upon stimulation with syngeneic BM-DC (1 x 10 4 /well) pulsed with or without each peptide was analyzed by an enzyme-linked immunospot (ELISPOT) assay as previously described ( Komori H, et al. Clin Cancer Res 2006; 12: 2689-97).
- ELISPOT enzyme-linked immunospot
- PBMCs isolated from a normal volunteer positive for HLA-A2 using Ficoll-Plaque were sorted to CD8 + population and CD14 + population with microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany).
- the CD14 + population was cultured in the presence of 100 ng/mL granulocyte-macrophage colony-stimulating factor (GM-CSF; PeproTec Inc., NJ, USA) and 10 ng/mL interleukin (IL)-4 (PeproTec) in AIM-V (Invitrogen) containing 2% heat-inactivated autologous plasma. After 5 days of culture, OK-432 was added into the dish to make the DCs mature. At seven days after starting to culture the cytokine-generated DCs, they were pulsed with 20 ng/mL HLA-A2-binding peptides in the presence of 4 micro g/mL beta 2-microglobulin (Sigma-Aldrich, St.
- the CTLs were cocultured with each of the cancer cells, or the peptide-pulsed T2 cells, as a target cell (5 X 10 3 /well) at the indicated effector/target ratio and a standard 51 Cr release assay was done as described previously (Yoshitake Y, et al. Clin Cancer Res 2004;10:6437-48. Imai K, et al. Clin Cancer Res 2008; in press. ). Briefly, target cells were labeled with 3.7 KBq Na 2 51 Cr 4 (Perkin Elmer Life Sciences) for 1 h at 37 degree C in a CO 2 incubator.
- Target cells were rinsed three times, and peptide-pulsed target cells were prepared by incubating the cells with 20 micro g/mL peptide for 3 h at 37 degrees C.
- Target cells were mixed with effector cells in final volume of 200 micro L in flat-bottomed microtiter plates and incubated. After 6h incubation, 50 micro L of the supernatant was collected from each well and the radioactivity was quantified using a gamma counter. The specific cytotoxicity was evaluated by calculating the percentage of specific 51 Cr release.
- HLA-class I or HLA-DR
- a cancer cell line in the 51 Cr release assay or ELISPOT assay the target cancer cells were incubated for 1 hour with 10 micro g/mL anti-class I mAb, W6/32, or 10 micro g/mL anti-HLA-DR mAb, H-DR-1, and then the effects of the mAbs on either the cytotoxic activity or the production of IFN-gamma by the CTLs were examined.
- RAB6KIFL/KIF20A was focused as a novel TAA of pancreatic cancer.
- the expression of the RAB6KIFL gene in pancreatic cancer tissues was markedly enhanced in all of the 6 patients tested (the average of the relative expression ratio: 32,000, range: 15-72,000).
- the RAB6KIFL gene was faintly expressed only in testis and thymus (Fig. 1B).
- the expression level of the RAB6KIFL gene was also enhanced in lung and bladder cancers based on the previous cDNA microarray analysis (Fig. 1C) (Nakamura T, et al. Oncogene 2004;23:2385-400, Kitahara O, et al.
- RAB6KIFL mRNA and protein in normal organs, cancer cell lines, and pancreatic cancer tissues The expression of the RAB6KIFL gene in normal tissues at the mRNA level was analyzed using RT-PCR analysis. A semiquantitative RT-PCR analysis of RAB6KIFL in the normal tissues revealed that it was expressed only in testis (Fig. 2A). The expression of the RAB6KIFL gene was detected in the almost all pancreatic and other HLA-A2-positive cancer cell lines using an RT-PCR analysis (Fig. 2B).
- the expression of the RAB6KIFL gene was analyzed using an RT-PCR analysis in the pancreatic cancer tissues and their adjacent normal counterparts, which were surgically resected.
- the expression of the RAB6KIFL gene was detected in 5 of 8 pancreatic cancer tissues, but little expression was detected in their normal counterparts (Fig. 2C). In addition, its expression was detected in the metastatic foci of the skin and peritoneum.
- HLA-A2 (A*0201) binding peptides derived from RAB6KIFL Table 1A and B show HLA-A2 (A*0201) binding peptides of the RAB6KIFL protein in the order of score of prediction high binding affinity. In total, 36 peptides with potential HLA-A2 binding activity were selected.
- CD4 - spleen cells (2 x 10 4 ) showed 149.0 plus/minus 22.2 spot counts/well in response to the BM-DCs pulsed with the RAB6KIFL-A2-9-12 peptide, whereas they showed 32.6 plus/minus 9.9 spot counts/well in the presence of the BM-DCs without peptide loading (P ⁇ 0.01).
- CD4 - spleen cells stimulated with BM-DCs pulsed with RAB6KIFL-A2-9-809 peptide showed 117.2 plus/minus 23.4 spot counts/well, whereas they showed 51.4 plus/minus 7.8 spot counts/well in the presence of BM-DCs without peptide loading (P ⁇ 0.01).
- CD4 - spleen cells stimulated with BM-DCs pulsed with RAB6KIFL-A2-10-284 peptide also showed 141.2 plus/minus 5.5 spot counts/well, whereas they showed 19.2 plus/minus 5.2 spot counts/well in the presence of BM-DCs without peptide loading (P ⁇ 0.01). No significant peptide-specific response was observed with the other peptides.
- RAB6KIFL-A2-9-12, RAB6KIFL-A2-9-809 and RAB6KIFL-A2-10-284 peptides could be the HLA-A2 restricted CTL epitope peptides in the HLA-A2.1 (HHD) Tgm, and those peptides were expected to be epitopes for human CTLs.
- mice affected with autoimmune diseases such as abnormal hair and skin, diarrhea and weight loss were also not observed in these mice.
- lymphocytes stimulated with RAB6KIFL-A2-9-809 peptide did not attack the normal tissues at least in HLA-A2 Tgm.
- RAB6KIFL-reactive CTLs Induction of RAB6KIFL-reactive CTLs from PBMCs of HLA-A2 (A*0201)-positive healthy donors The generation of RAB6KIFL-specific CTLs was attempted from the PBMCs of healthy donors positive for HLA-A2 (A*0201) by the stimulation with the RAB6KIFL-A2-9-12 (SEQ ID NO: 3), RAB6KIFL-A2-9-809 (SEQ ID NO: 4) and RAB6KIFL-A2-10-284 (SEQ ID NO: 5) peptides.
- PBMCs were isolated form HLA-A2-positive healthy donors, and the CD8 + T cells sorted from the PBMCs were incubated with the autologous monocyte-derived DCs pulsed with each peptide. After three times stimulations, the cytotoxic activity against the peptide-pulsed T2 cells was examined by a 51 Cr release assay (Fig. 6A) and an IFN-gamma ELISPOT assay (data not shown).
- RAB6KIFL-reactive CTLs stimulated with RAB6KIFL-A2-9-12 (left), RAB6KIFL-A2-9-809 (middle), or RAB6KIFL-A2-10-284 (right) peptide exhibited cytotoxicity to PANC1 (RAB6KIFL + , HLA-A2 + ), CaCo-2 (RAB6KIFL + , HLA-A2 + ), but not to PK8 (RAB6KIFL + , HLA-A2 - ) in healthy donors.
- SKHep1/RAB6KIFL (RAB6KIFL high , HLA-A2 + ), the SKHep1 (RAB6KIFL low , HLA-A2 + ) cells transfected with the RAB6KIFL gene (Fig. 2B), were used as target cells to confirm that these peptides were processed naturally from the RAB6KIFL protein in the cancer cells.
- the CTLs induced by stimulation with RAB6KIFL-A2-9-12 (left), RAB6KIFL-A2-9-809 (middle), and RAB6KIFL-A2-10-284 (right) peptide exhibited cytotoxicity against SKHep1/RAB6KIFL, but not against SKHep1/Mock.
- an HLA-class I blocking assay was performed by using the mAb against HLA-class I (W6/32) was used to block the recognition of cancer cells by the CTLs (Fig. 6D).
- the anti-HLA-class I antibody could markedly inhibit the IFN-gamma production stimulated with PANC1 cells in an ELISPOT assay of the CTLs generated by stimulation with RAB6KIFL-A2-9-12 (left), RAB6KIFL-A2-9-809 (middle), or RAB6KIFL-A2-10-284 (right) peptide, with statistical significance (Fig. 6D, P ⁇ 0.01).
- RAB6KIFL is a TAA as a promising target of anticancer immunotherapy for pancreatic cancer.
- the cDNA microarray analysis showed that RAB6KIFL mRNA was overexpressed in pancreatic cancer cells (Imai K, Hirata S, Irie A, Senju S, Ikuta Y, Yokomine K, Harao M, Inoue M, Tsunoda T, Nakatsuru S, Nakagawa H, Nakamura Y, et al.
- HLA-A2 (HHD) Tgm identified three HLA-A2-restricted RAB6KIFL epitope peptides which could stimulate the generation of HLA-A2-restricted mouse CTLs by the vaccination with the 36 candidate peptides predicted to have binding affinity to HLA-A2 (A*0201) by the BIMAS algorithm, without causing autoimmune phenomenon such as lymphocyte infiltration or tissue destruction (Fig. 5).
- the RAB6KIFL-reactive CTLs could be generated from PBMCs stimulated with all of these three peptides in three independent healthy donors (Fig. 6). These CTLs could kill not only the T2 cells pulsed with its cognate peptide, but also the cancer cell lines expressing both RAB6KIFL and HLA-A2. The antigen-specificity of CTLs to these peptides was confirmed by the findings that these CTLs exhibited cytotoxicity to SKHep1 cells transfected with human RAB6KIFL gene, but not to the mock-transfected SKHep1.
- RAB6KIFL peptides (RAB6KIFL-A2-9-12, RAB6KIFL-A2-9-809, and RAB6KIFL-A2-10-284) are naturally processed from RAB6KIFL protein in cancer cells and presented onto the cell surface together with HLA-A2 molecules to be recognized by the CTLs.
- the RAB6KIFL-A2-9-809 peptide can be more effectively processed from RAB6KIFL protein in comparison to the RAB6KIFL-A2-9-12 and RAB6KIFL-A2-10-284 peptides in cancer cells, because the RAB6KIFL-A2-9-809 peptide-induced CTLs exhibited stronger cytotoxicity directed against cancer cells expressing both RAB6KIFL and HLA-A2 in comparison to cytotoxicity mediated by CTLs induced by stimulation with the RAB6KIFL-A2-9-12 or the RAB6KIFL-A2-10-284 peptides.
- HLA-A2.1 (HHD) Tgm that lacked expression of endogenous mouse H-2 b -encoded class I molecules were used to identify HLA-A2-restricted CTL epitope peptides of RAB6KIFL.
- HLA-A2.1 (HHD) Tgm was reported to be a versatile animal model for the preclinical evaluation of peptide-based immunotherapy (Imai K, et al. Clin Cancer Res 2008; 14:6487-95, Komori H, et al. Clin Cancer Res 2006; 12:2689-97, Harao M, et al. Int J Cancer 2008; 123: 2616-25, Pascolo S, et al. J Exp Med 1997; 185: 2043-51, Firat H, et al. Eur J Immunol 1999; 29: 3112-21).
- RAB6KIFL was selected as a target which was barely expressed in adult normal tissues. However, it was very important to determine whether vaccination of RAB6KIFL could induce autoimmune diseases either during or after anticancer immunotherapy.
- the amino-acid sequences of two of three epitope peptides are not conserved between human and mouse (RAB6KIFL-A2-9-12, human: LLSDDDVVV (SEQ ID NO: 3), mouse: LLSDEDVVD (SEQ ID NO: 11); RAB6KIFL-A2-10-284, human: AQPDTAPLPV (SEQ ID NO: 5), mouse: AQPDTVPVSV) (SEQ ID NO: 12).
- HLA-A2 Tgm the autoimmune phenomenon in HLA-A2 Tgm was investigated after two-times vaccination with RAB6KIFL-A2-9-809 peptide in which amino-acid sequences were completely conserved between in human and mouse.
- One of the advantages of using HLA-A2 Tgm is that the possibility of autoimmune phenomenon could be investigated in vivo.
- the number of normal tissues investigated herein is limited, it is not possible to exclude the possible expression of RAB6KIFL in some normal tissues that has not been investigated herein. Therefore, it must be careful about induction of autoimmune diseases when utilizing RAB6KIFL peptides for cancer immunotherapy.
- RAB6KIFL is a TAA containing epitope peptides that can elicit CTLs reactive to cancer cells expressing both RAB6KIFL and HLA-A2. Since RAB6KIFL is highly expressed in a wide range of human malignancies, RAB6KIFL is therefore a promising target for peptide-based immunotherapy for the treatment of a broad-spectrum of malignancies, especially pancreatic cancer. Further investigation of the capability for induction of RAB6KIFL-specific CTLs in pancreatic cancer patients thus remains an issue of great importance for clinical application.
- the present invention describes new TAAs, particularly those derived from RAB6KIFL that induce potent and specific anti-tumor immune responses and have applicability to a wide array of cancer types.
- TAAs warrant further development as peptide vaccines against diseases associated with RAB6KIFL, e.g., cancers such as bladder cancer, cervical cancer, cholangiocellular carcinoma, esophagus cancer, gastric cancer, non-small cell lung cancer (NSCLC), osteosarcoma, pancreatic cancer, renal carcinoma and soft tissue tumor.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Zoology (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pharmacology & Pharmacy (AREA)
- Public Health (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Biochemistry (AREA)
- Epidemiology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Gastroenterology & Hepatology (AREA)
- Wood Science & Technology (AREA)
- Mycology (AREA)
- Biophysics (AREA)
- Biotechnology (AREA)
- Toxicology (AREA)
- General Engineering & Computer Science (AREA)
- Environmental Sciences (AREA)
- Oncology (AREA)
- Biomedical Technology (AREA)
- Biodiversity & Conservation Biology (AREA)
- Animal Husbandry (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (17)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| HK11111730.9A HK1157397B (en) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a epitope peptide and vaccines containing the same |
| MX2011004176A MX2011004176A (es) | 2008-10-22 | 2009-10-15 | Peptido-epitope rab6kifl/kif20a y vacunas que contienen el mismo. |
| UAA201106195A UA102274C2 (ru) | 2008-10-22 | 2009-10-15 | Эпитопный пептид rab6kifl/kif20a и вакцины, которые его содержат |
| CN200980151824.6A CN102264897B (zh) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a表位肽及包含它的疫苗 |
| JP2011517539A JP5663790B2 (ja) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20aエピトープペプチドおよびそれを含むワクチン |
| US13/125,548 US8883966B2 (en) | 2008-10-22 | 2009-10-15 | RAB6KIFL/KIF20A epitope peptide and vaccines containing the same |
| EP09821762.3A EP2362906B1 (en) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a epitope peptide and vaccines containing the same |
| RU2011120447/10A RU2532105C2 (ru) | 2008-10-22 | 2009-10-15 | Эпитопные пептиды rab6kifl/kif20a и содержащие их вакцины |
| AU2009305847A AU2009305847B2 (en) | 2008-10-22 | 2009-10-15 | RAB6KIFL/KIF20A epitope peptide and vaccines containing the same |
| CA2741399A CA2741399C (en) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a epitope peptide and vaccines containing the same |
| ES09821762.3T ES2541325T3 (es) | 2008-10-22 | 2009-10-15 | Péptido de epítopo RAB6KIFL/KIF20A y vacunas que contienen el mismo |
| KR1020117011590A KR101705150B1 (ko) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a 에피토프 펩티드 및 이를 포함하는 백신 |
| NZ592461A NZ592461A (en) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a epitope peptide and vaccines containing the same |
| BRPI0919766-4A BRPI0919766B1 (pt) | 2008-10-22 | 2009-10-15 | Oligopeptídeo, seu uso, agente farmacêutico ou composição para o tratamento e/ou profilaxia de câncer, e/ou prevenção de recorrência pósoperatória do mesmo, métodos in vitro para induzir uma célula apresentadora de antígeno e para induzir um ctl |
| IL212046A IL212046A (en) | 2008-10-22 | 2011-03-31 | Oligopeptide rab6kifl Medicinal products containing it and their use in the treatment of cancer and soaking of cytotoxic lymphocytes |
| ZA2011/03667A ZA201103667B (en) | 2008-10-22 | 2011-05-19 | Rab6kifl/kif20a epitope peptide and vaccines containing the same |
| US14/500,877 US9132176B2 (en) | 2008-10-22 | 2014-09-29 | RAB6KIFL/KIF20A epitope peptide and vaccines containing the same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US19710608P | 2008-10-22 | 2008-10-22 | |
| US61/197,106 | 2008-10-22 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/125,548 A-371-Of-International US8883966B2 (en) | 2008-10-22 | 2009-10-15 | RAB6KIFL/KIF20A epitope peptide and vaccines containing the same |
| US14/500,877 Division US9132176B2 (en) | 2008-10-22 | 2014-09-29 | RAB6KIFL/KIF20A epitope peptide and vaccines containing the same |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2010047062A1 true WO2010047062A1 (en) | 2010-04-29 |
Family
ID=42119117
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2009/005382 Ceased WO2010047062A1 (en) | 2008-10-22 | 2009-10-15 | Rab6kifl/kif20a epitope peptide and vaccines containing the same |
Country Status (20)
| Country | Link |
|---|---|
| US (2) | US8883966B2 (enExample) |
| EP (1) | EP2362906B1 (enExample) |
| JP (1) | JP5663790B2 (enExample) |
| KR (1) | KR101705150B1 (enExample) |
| CN (2) | CN104086625B (enExample) |
| AR (1) | AR073967A1 (enExample) |
| AU (1) | AU2009305847B2 (enExample) |
| BR (1) | BRPI0919766B1 (enExample) |
| CA (1) | CA2741399C (enExample) |
| CO (1) | CO6362049A2 (enExample) |
| ES (1) | ES2541325T3 (enExample) |
| IL (1) | IL212046A (enExample) |
| MX (1) | MX2011004176A (enExample) |
| NZ (1) | NZ592461A (enExample) |
| RU (1) | RU2532105C2 (enExample) |
| SG (1) | SG195571A1 (enExample) |
| TW (1) | TWI455720B (enExample) |
| UA (1) | UA102274C2 (enExample) |
| WO (1) | WO2010047062A1 (enExample) |
| ZA (1) | ZA201103667B (enExample) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013133405A1 (ja) | 2012-03-09 | 2013-09-12 | オンコセラピー・サイエンス株式会社 | ペプチドを含む医薬組成物 |
| WO2014010231A1 (en) | 2012-07-10 | 2014-01-16 | Oncotherapy Science, Inc. | Kif20a epitope peptides for th1 cells and vaccines containing the same |
| WO2018138110A1 (en) | 2017-01-25 | 2018-08-02 | Ose Immunotherapeutics | Method for manufacturing a stable emulsion for peptide delivery |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US10412682B2 (en) * | 2017-08-30 | 2019-09-10 | Qualcomm Incorporated | Mechanism to update/download profile using low power or no power |
| CN107460250B (zh) * | 2017-09-28 | 2020-07-28 | 郑州大学第一附属医院 | 基于kif14、kif15和kif20a基因的透明细胞肾癌诊断试剂盒及其使用方法 |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006085684A2 (en) * | 2005-02-10 | 2006-08-17 | Oncotherapy Science, Inc. | Method of diagnosing bladder cancer |
| WO2007013665A2 (en) * | 2005-07-27 | 2007-02-01 | Oncotherapy Science, Inc. | Method of diagnosing small cell lung cancer |
| WO2008102557A1 (en) * | 2007-02-21 | 2008-08-28 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
| WO2008102906A1 (en) * | 2007-02-20 | 2008-08-28 | Oncotherapy Science, Inc. | Hspc-hrpc transition genes |
Family Cites Families (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| IL103928A0 (en) | 1991-12-11 | 1993-04-04 | American Home Prod | Expression of specific immunogens using viral antigens |
| US6783961B1 (en) | 1999-02-26 | 2004-08-31 | Genset S.A. | Expressed sequence tags and encoded human proteins |
| KR20010071033A (ko) | 1998-07-28 | 2001-07-28 | 교고 이또 | Sart-1 유래의 hla-a2 구속성 종양항원 펩티드 |
| JP2004526401A (ja) | 2000-03-29 | 2004-09-02 | コリクサ コーポレイション | 肺癌の治療および診断のための組成物および方法 |
| CN1469926A (zh) | 2000-03-29 | 2004-01-21 | 科里克萨有限公司 | 治疗和诊断肺癌的组合物和方法 |
| CN100400099C (zh) | 2001-01-04 | 2008-07-09 | 北京迪威华宇生物技术有限公司 | 预防和治疗人前列腺癌的重组蛋白疫苗 |
| JP2005527180A (ja) | 2001-04-18 | 2005-09-15 | プロテイン デザイン ラブス, インコーポレイテッド | 肺がんの診断方法、肺がんの修飾因子の組成及びスクリーニングの方法 |
| AU2002347428A1 (en) | 2001-06-18 | 2003-01-02 | Eos Biotechnology Inc. | Methods of diagnosis of ovarian cancer, compositions and methods of screening for modulators of ovarian cancer |
| US20030194704A1 (en) | 2002-04-03 | 2003-10-16 | Penn Sharron Gaynor | Human genome-derived single exon nucleic acid probes useful for gene expression analysis two |
| DK2261249T3 (en) | 2002-09-12 | 2015-02-16 | Oncotherapy Science Inc | KDR peptides and vaccines comprising the same |
| WO2004058153A2 (en) | 2002-12-20 | 2004-07-15 | Millennium Pharmaceuticals, Inc. | Methods and compositions for treating cancer using 15986, 2188, 20743, 9148, 9151, 9791, 44252, 14184, 42461, 8204, 7970, 25552, 21657, 26492, 2411, 15088, 1905, 28899, 63380, 33935, 10480, 12686, 25501, 17694, 15701, 53062, 49908, 21612, 38949, 6216, 46863, 9235, 2201, 6985, 9883, 12238, 18057, 21617, 39228, 49928, 54476. |
| WO2005019258A2 (en) | 2003-08-11 | 2005-03-03 | Genentech, Inc. | Compositions and methods for the treatment of immune related diseases |
| EP1765378B1 (en) | 2004-07-12 | 2014-04-16 | Medical Research Fund of Tel Aviv Sourasky Medical Center | Agent capable of downregulating an msf-a-dependent hif-1a and use thereof in cancer treatment |
| CN100381460C (zh) | 2004-11-30 | 2008-04-16 | 北京市肿瘤防治研究所 | Her-2模拟抗原表位及含有该表位的肽 |
| EP1853703B1 (en) | 2005-02-25 | 2011-04-13 | Oncotherapy Science, Inc. | Peptide vaccines for lung cancers expressing ttk polypeptides |
| CN100348614C (zh) | 2005-06-03 | 2007-11-14 | 北京大学 | 一种肝癌-睾丸特异性抗原蛋白质和抗原肽 |
| US20070099209A1 (en) * | 2005-06-13 | 2007-05-03 | The Regents Of The University Of Michigan | Compositions and methods for treating and diagnosing cancer |
| US8030443B2 (en) | 2005-08-09 | 2011-10-04 | Kurume University | Squamous cell carcinoma antigen-derived peptide binding to HLA-A24 molecule |
| EP1983003A3 (en) | 2007-04-19 | 2009-03-11 | Peter Hornbeck | Tyrosine phosphorylation sites and antibodies specific for them |
| TW201008574A (en) | 2008-08-19 | 2010-03-01 | Oncotherapy Science Inc | INHBB epitope peptides and vaccines containing the same |
-
2009
- 2009-10-15 WO PCT/JP2009/005382 patent/WO2010047062A1/en not_active Ceased
- 2009-10-15 RU RU2011120447/10A patent/RU2532105C2/ru active
- 2009-10-15 AU AU2009305847A patent/AU2009305847B2/en not_active Ceased
- 2009-10-15 SG SG2013077631A patent/SG195571A1/en unknown
- 2009-10-15 UA UAA201106195A patent/UA102274C2/ru unknown
- 2009-10-15 US US13/125,548 patent/US8883966B2/en active Active
- 2009-10-15 CA CA2741399A patent/CA2741399C/en active Active
- 2009-10-15 BR BRPI0919766-4A patent/BRPI0919766B1/pt not_active IP Right Cessation
- 2009-10-15 CN CN201410198295.8A patent/CN104086625B/zh not_active Expired - Fee Related
- 2009-10-15 NZ NZ592461A patent/NZ592461A/xx not_active IP Right Cessation
- 2009-10-15 EP EP09821762.3A patent/EP2362906B1/en active Active
- 2009-10-15 KR KR1020117011590A patent/KR101705150B1/ko not_active Expired - Fee Related
- 2009-10-15 MX MX2011004176A patent/MX2011004176A/es active IP Right Grant
- 2009-10-15 CN CN200980151824.6A patent/CN102264897B/zh not_active Expired - Fee Related
- 2009-10-15 ES ES09821762.3T patent/ES2541325T3/es active Active
- 2009-10-15 JP JP2011517539A patent/JP5663790B2/ja active Active
- 2009-10-21 TW TW098135570A patent/TWI455720B/zh not_active IP Right Cessation
- 2009-10-23 AR ARP090104100A patent/AR073967A1/es unknown
-
2011
- 2011-03-31 IL IL212046A patent/IL212046A/en active IP Right Grant
- 2011-04-26 CO CO11050897A patent/CO6362049A2/es active IP Right Grant
- 2011-05-19 ZA ZA2011/03667A patent/ZA201103667B/en unknown
-
2014
- 2014-09-29 US US14/500,877 patent/US9132176B2/en active Active
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2006085684A2 (en) * | 2005-02-10 | 2006-08-17 | Oncotherapy Science, Inc. | Method of diagnosing bladder cancer |
| WO2007013665A2 (en) * | 2005-07-27 | 2007-02-01 | Oncotherapy Science, Inc. | Method of diagnosing small cell lung cancer |
| WO2008102906A1 (en) * | 2007-02-20 | 2008-08-28 | Oncotherapy Science, Inc. | Hspc-hrpc transition genes |
| WO2008102557A1 (en) * | 2007-02-21 | 2008-08-28 | Oncotherapy Science, Inc. | Peptide vaccines for cancers expressing tumor-associated antigens |
Non-Patent Citations (2)
| Title |
|---|
| IMAI K. ET AL: "Identification of a novel tumor-associated antigen, RAB6KIFL, as a candidate of target for immunotherapy of pancreatic cancer, 1-H-W15-1-O/P", PROCEEDINGS OF THE JAPANESE SOCIETY FOR IMMUNOLOGY, vol. 38, November 2008 (2008-11-01), pages 101, XP008168633 * |
| See also references of EP2362906A4 * |
Cited By (12)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013133405A1 (ja) | 2012-03-09 | 2013-09-12 | オンコセラピー・サイエンス株式会社 | ペプチドを含む医薬組成物 |
| WO2014010231A1 (en) | 2012-07-10 | 2014-01-16 | Oncotherapy Science, Inc. | Kif20a epitope peptides for th1 cells and vaccines containing the same |
| JP2015524788A (ja) * | 2012-07-10 | 2015-08-27 | オンコセラピー・サイエンス株式会社 | Th1細胞のKIF20Aエピトープペプチドおよびこれを含有するワクチン |
| EP2872530A4 (en) * | 2012-07-10 | 2016-04-06 | Oncotherapy Science Inc | KIF20A EPITOPE PEPTIDES FOR TH1 CELLS AND VACCINES CONTAINING SAME |
| US9561265B2 (en) | 2012-07-10 | 2017-02-07 | Oncotherapy Science, Inc. | KIF20A epitope peptides for TH1 cells and vaccines containing the same |
| TWI609879B (zh) * | 2012-07-10 | 2018-01-01 | 腫瘤療法 科學股份有限公司 | 對於th1細胞之kif20a抗原決定位胜肽及含此之疫苗 |
| TWI636791B (zh) * | 2012-07-10 | 2018-10-01 | 腫瘤療法 科學股份有限公司 | 對於th1細胞之kif20a抗原決定位胜肽及含此之疫苗 |
| US10172926B2 (en) | 2012-07-10 | 2019-01-08 | Oncotherapy Science, Inc. | KIF20A epitope peptides for TH1 cells and vaccines containing the same |
| TWI659043B (zh) * | 2012-07-10 | 2019-05-11 | 日商腫瘤療法.科學股份有限公司 | 對於th1細胞之kif20a抗原決定位胜肽及含此之疫苗 |
| WO2018138110A1 (en) | 2017-01-25 | 2018-08-02 | Ose Immunotherapeutics | Method for manufacturing a stable emulsion for peptide delivery |
| EP4029494A1 (en) | 2017-01-25 | 2022-07-20 | OSE Immunotherapeutics | Method for manufacturing a stable emulsion for peptide delivery |
| EP4649954A2 (en) | 2017-01-25 | 2025-11-19 | Ose Immunotherapeutics | Method for manufacturing a stable emulsion for peptide delivery |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2508601B1 (en) | Tem8 peptides and vaccines comprising the same | |
| WO2010021111A1 (en) | Inhbb epitope peptides and vaccines containing the same | |
| CA2734467C (en) | Hig2 and urlc10 epitope peptide and vaccines containing the same | |
| WO2009150835A1 (en) | Iqgap3 epitope peptides and vaccines containing the same | |
| AU2009277811B2 (en) | MELK epitope peptides and vaccines containing the same | |
| AU2009258775A1 (en) | MYBL2 epitope peptides and vaccines containing the same | |
| CA2674365A1 (en) | Foxp3 peptide vaccine | |
| US9132176B2 (en) | RAB6KIFL/KIF20A epitope peptide and vaccines containing the same | |
| AU2008238739B2 (en) | TEM8 peptides and vaccines comprising the same | |
| HK1157397B (en) | Rab6kifl/kif20a epitope peptide and vaccines containing the same | |
| HK1175197B (en) | Tem8 peptides and vaccines comprising the same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200980151824.6 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09821762 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009305847 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/A/2011/004176 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2741399 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 592461 Country of ref document: NZ Ref document number: 2011517539 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2009305847 Country of ref document: AU Date of ref document: 20091015 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 3358/CHENP/2011 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009821762 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 20117011590 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: A201106195 Country of ref document: UA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2011120447 Country of ref document: RU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13125548 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: PI0919766 Country of ref document: BR Kind code of ref document: A2 Effective date: 20110420 |