WO2010035107A2 - Peptides and compositions for prevention of cell adhesion and methods of using same - Google Patents
Peptides and compositions for prevention of cell adhesion and methods of using same Download PDFInfo
- Publication number
- WO2010035107A2 WO2010035107A2 PCT/IB2009/006926 IB2009006926W WO2010035107A2 WO 2010035107 A2 WO2010035107 A2 WO 2010035107A2 IB 2009006926 W IB2009006926 W IB 2009006926W WO 2010035107 A2 WO2010035107 A2 WO 2010035107A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- protein
- comprised
- group
- medical device
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/43504—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates
- C07K14/43595—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from invertebrates from coelenteratae, e.g. medusae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/14—Macromolecular materials
- A61L27/22—Polypeptides or derivatives thereof, e.g. degradation products
- A61L27/227—Other specific proteins or polypeptides not covered by A61L27/222, A61L27/225 or A61L27/24
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L27/00—Materials for grafts or prostheses or for coating grafts or prostheses
- A61L27/28—Materials for coating prostheses
- A61L27/34—Macromolecular materials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L29/00—Materials for catheters, medical tubing, cannulae, or endoscopes or for coating catheters
- A61L29/04—Macromolecular materials
- A61L29/044—Proteins; Polypeptides; Degradation products thereof
- A61L29/048—Other specific proteins or polypeptides not covered by A61L29/045 - A61L29/047
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L29/00—Materials for catheters, medical tubing, cannulae, or endoscopes or for coating catheters
- A61L29/08—Materials for coatings
- A61L29/085—Macromolecular materials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L29/00—Materials for catheters, medical tubing, cannulae, or endoscopes or for coating catheters
- A61L29/14—Materials characterised by their function or physical properties, e.g. lubricating compositions
- A61L29/16—Biologically active materials, e.g. therapeutic substances
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L31/00—Materials for other surgical articles, e.g. stents, stent-grafts, shunts, surgical drapes, guide wires, materials for adhesion prevention, occluding devices, surgical gloves, tissue fixation devices
- A61L31/04—Macromolecular materials
- A61L31/043—Proteins; Polypeptides; Degradation products thereof
- A61L31/047—Other specific proteins or polypeptides not covered by A61L31/044 - A61L31/046
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L31/00—Materials for other surgical articles, e.g. stents, stent-grafts, shunts, surgical drapes, guide wires, materials for adhesion prevention, occluding devices, surgical gloves, tissue fixation devices
- A61L31/08—Materials for coatings
- A61L31/10—Macromolecular materials
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61L—METHODS OR APPARATUS FOR STERILISING MATERIALS OR OBJECTS IN GENERAL; DISINFECTION, STERILISATION OR DEODORISATION OF AIR; CHEMICAL ASPECTS OF BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES; MATERIALS FOR BANDAGES, DRESSINGS, ABSORBENT PADS OR SURGICAL ARTICLES
- A61L31/00—Materials for other surgical articles, e.g. stents, stent-grafts, shunts, surgical drapes, guide wires, materials for adhesion prevention, occluding devices, surgical gloves, tissue fixation devices
- A61L31/14—Materials characterised by their function or physical properties, e.g. injectable or lubricating compositions, shape-memory materials, surface modified materials
- A61L31/16—Biologically active materials, e.g. therapeutic substances
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P41/00—Drugs used in surgical methods, e.g. surgery adjuvants for preventing adhesion or for vitreum substitution
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F1/00—Treatment of water, waste water, or sewage
- C02F1/50—Treatment of water, waste water, or sewage by addition or application of a germicide or by oligodynamic treatment
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/415—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from plants
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/461—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from fish
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/06—Linear peptides containing only normal peptide links having 5 to 11 amino acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K7/00—Peptides having 5 to 20 amino acids in a fully defined sequence; Derivatives thereof
- C07K7/04—Linear peptides containing only normal peptide links
- C07K7/08—Linear peptides containing only normal peptide links having 12 to 20 amino acids
-
- C—CHEMISTRY; METALLURGY
- C09—DYES; PAINTS; POLISHES; NATURAL RESINS; ADHESIVES; COMPOSITIONS NOT OTHERWISE PROVIDED FOR; APPLICATIONS OF MATERIALS NOT OTHERWISE PROVIDED FOR
- C09D—COATING COMPOSITIONS, e.g. PAINTS, VARNISHES OR LACQUERS; FILLING PASTES; CHEMICAL PAINT OR INK REMOVERS; INKS; CORRECTING FLUIDS; WOODSTAINS; PASTES OR SOLIDS FOR COLOURING OR PRINTING; USE OF MATERIALS THEREFOR
- C09D5/00—Coating compositions, e.g. paints, varnishes or lacquers, characterised by their physical nature or the effects produced; Filling pastes
- C09D5/16—Antifouling paints; Underwater paints
- C09D5/1606—Antifouling paints; Underwater paints characterised by the anti-fouling agent
- C09D5/1612—Non-macromolecular compounds
- C09D5/1625—Non-macromolecular compounds organic
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F2303/00—Specific treatment goals
- C02F2303/20—Prevention of biofouling
-
- C—CHEMISTRY; METALLURGY
- C02—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F—TREATMENT OF WATER, WASTE WATER, SEWAGE, OR SLUDGE
- C02F3/00—Biological treatment of water, waste water, or sewage
- C02F3/34—Biological treatment of water, waste water, or sewage characterised by the microorganisms used
Definitions
- the present invention relates to isolated natural peptides and their use in prevention of cell adhesion.
- Microorganisms can live and proliferate as individual cells swimming freely in the environment (as plankton), or they can grow as highly organized, multicellular communities encased in a self-produced polymeric matrix in close association with surfaces and interfaces.
- the latter microbial lifestyle is referred to as biofilms.
- Biofilm formation represents an ancient, protected mode of growth that allows microbial survival in hostile environments and allows microorganisms to disperse and colonize new niches [Hall-Stoodley et al., Nat Rev Microbiol. (2004) 2(2):95-108].
- the composition of biofilms is complex and variable among different microbial species and even within the same species under different environmental conditions.
- biofilm formation represents the normal lifestyle of microorganism in the environment and all microbes can make biofilms.
- Previous studies revealed that bacterial biofilm formation progresses through multiple developmental stages differing in protein profiles [Sauer et al,, J Bacteriol. (2002) 184(4): 1140-54], beginning with attachment to surface, followed by the immigration and division to form microcolonies and finally maturation involving expression of matrix polymers.
- Bacteria within each biofilm stage display phenotypes and possess properties that are markedly different from those of the same group growing planktonically [Sauer et al., J Bacteriol. (2004) 186(21):7312-26].
- Biofilms are a major cause of systemic infections (e.g. nosocomial infections) in humans.
- biofilms can be associated with tissues (e.g., inner ears, teeth, gums, lungs, heart valves and the urogenital tract).
- tissues e.g., inner ears, teeth, gums, lungs, heart valves and the urogenital tract.
- An estimated 65 % of bacterial infections in humans are biofilm in nature.
- microorganisms tend to change their characteristics, sometimes drastically, such that doses of antibiotics which normally kill the organisms in suspended cultures are completely ineffective against the same microorganisms when the organisms are in attached or conglomerate biofilm form (U.S. Pat. No. 7189351).
- the present invention provides broad spectrum natural factors that interfere with biofilm formation at its initial stages, in a wide range of microorganisms. From these natural factors, peptides with high conservation sequences were isolated, and showed high activity in prevention of microbial adherence in its synthetic conformation.
- the conserved sequence is found in several marine organisms, including various known species of sea anemone, several fish (including Danio rerio- zebra fish), and in moss Physcomitrella patens subsp. Patens..
- Hydrae were shown to express orthologs of cnidarian phospholipase A2 toxins and cytolysicns belonging to the actinoporin family, and to express proteins similar to elapid-like phospholipases, cysteine-rich secretory proetins (CRISP), prokineticin-like polypeptides and toxic deoxyribonucleases.
- CRISP cysteine-rich secretory proetins
- FIG. 1 shows the crystal structure of the IGWY chain A of the water-soluble state of the pore-forrning cytolysin sticholysin Ii, the active region marked in yellow
- FIG. 2 shows the crystal structure of the 1 GWY chain B of the water-soluble state of the pore- forming cytolysin sticholysin Ii, the active region marked in yellow;
- FIG. 3 shows the structure of the 1KD6 chain A of the eukaryotic pore-forming cytolysin equinatoxin Ii, the active region marked in yellow;
- FIG. 4 shows the 3 -dimensional construct of an equinatoxin mutant, the active region marked in yellow;
- FIG. 5 is a bar chart showing the effects of different concentrations of synthetic proteins on growth of Pseudomonas aeruginosa ATCC 27853 over 24 hours; No bactericidal or bacteriostatic effect;
- FIG. 6 is a bar chart showing the effects of different concentrations of synthetic proteins on biofilm formation by Pseudomonas aeruginosa ATCC 27853 over 24 hours;
- FIG. 7 is a bar chart showing the effects of different concentrations of synthetic proteins on growth of a clinical isolate of Acinetobacter Baumannii over 24 hours; No bactericidal or bacteriostatic effect;
- FIG. 8 is a bar chart showing the effects of different concentrations of synthetic proteins on biofilm formation by a clinical isolate of Acinetobacter Baumannii over 24 hours
- FIG. 9 is a bar chart showing the effects of selected tentacular fractions from Actinia equina on biofilm formation by Acinetobacter baumannii, with PBS as a positive control;
- FIG. 10 is a bar chart showing the effects of fraction 13 on biofilm formation by various gram positive and gram negative bacteris
- FIG. 11 is a bar chart showing the effects of crude extracts from Anemonia, Aiptasia and Physcomitrella (Moss) on Pseudomonas aeruginosa in protein concentration of 50 ⁇ g/m"l;
- FIG. 12 is a bar chart showning the effects of five synthetic peptides and crude material from the moss of Physcomitrella patens;
- FIG. 13 shows fractions obtained by separation of crude extract of Aiptasia pulchella on Sephadex G- 10 column;
- FIG. 14 shows peaks obtained by rechromatography of the high molecular weight fraction of FIG. 13;
- FIG. 15 shows fractions obtained by reversed phase high performance liquid chromatography (RP-HPLC) separation with c-18 column, of the low molecular fraction of FIG. 14;
- FIGS. 16A-B show the general structure of a cyclic lead with emulsifier arm of a peptide according to the principles of the present invention.
- FIG. 17 is a flow chart showing development of a cyclic peptide lead with emulsifying arm.
- the present invention is of compositions comprising an isolated peptide which has one or more effects relating to prevention of bacterial substrate adhesion and the derived biof ⁇ lm formation, and optionally also prevention of cell-cell adhesion. Other effects may also optionally be provided, additionally or alternatively.
- the peptide may optionally and preferably comprise a sequence selected from the group consisting of YDYNWY, YDYNLY, FDYNFY, FDYNLY, FDYNWY, YDWNLY, YDWHLY and WDYNLY, extracted from organisms such as aquatic organisms and moss and methods of using same. Other sequences are described below.
- One of the major concerns in medicine is microbial biofilm formation.
- biofilms are a cause of systemic infections (e.g., nosocomial infections) and are a major concern when introducing products into the body (e.g., contact lenses, central venous catheters, mechanical heart valves and pacemakers).
- Biofilms are also a problem in many industries including the food, pharmaceutical, paint, water, shipping and engineering industries causing, amongst a wide range of negative effects, accelerated corrosion in industrial systems, oil souring and biofouling.
- biofouling may be caused by the adhesion of organisms to any surface in a marine or freshwater environment, including cooling towers, water pipes and filters in cooling or desalinization installations, irrigation and power stations, and membranes, such as those used in wastewater and desalinization systems. Biofouling also occurs in aquaculture systems in fish farms.
- Biofilms are very difficult to eliminate since microbes growing within are highly organized and can withstand hostile environments, such as high temperatures and anti-microbial agents (e.g., antibiotics).
- anti-microbial agents e.g., antibiotics
- Marine and fresh water plants and organisms including soft bodied water invertebrates, fish and moss are surrounded by broad spectrum species of microbial organisms. Since such plant and organisms lack specific immunity, they produce several factors which can prevent microbial colonization on their body surface.
- the most "sensitive" organisms are invertebrates belong to the phylum cnidaria that include the sea anemones, corals, jellyfish, hydroids, medusae, and sea fans.
- Such soft bodied organism which lack physical protection such as scales or shells, use proteins and secondary metabolites to protect themselves from the microbial environment surrounding them.
- sea anemones e.g., Actinia equina
- sea anemones e.g., Actinia equina
- equinatoxins toxic, pore forming peptides
- the present inventors have demonstrated that several active fractions obtained from sea anemones using liquid chromatography separations show a high level of prevention of microbial adherence to abiotic surfaces.
- the sea anemone includes 46 families that can be found in water sources around the world. Most sea anemones are sessile, with a specialized foot used to anchor them in soft substrates, or attach themselves to rocks and corals.
- the anti-adhesive activity was demonstrated with several species of sea anemone belonging to different genera: Actinia equine, Aiptasia and Ammonia.
- This protein has a highly conserved region, with unknown function, which is also a Trp-rich domain, and may be important for binding of the protein to lipid membrane.
- the present inventors have also found this region in the moss Physcomitrella patens.
- this region provides a peptide which is highly effective in prevention in biofilm formation, while being devoid of cytotoxic activity.
- the present inventors have characterized and isolated a natural peptide comprising a sequence selected from the group consisting of YDYNWY, YDYNLY, FDYNFY, FDYNLY, WDYNLY,
- the peptide comprises part of a sequence comprising up to about 30, up to about 40, or up to about 50 amino acids.
- the peptide is selected from the group consisting of
- MASIPYDWNLYSAWA MASIPYDWHLYNAWA
- MS/MS tandem mass spectroscopy
- the present inventors used the clustaLW program to identify biologically meaningful multiple sequence alignments of several anemone cytotoxin proteins and identify an anemone cytotoxin universal primer for use in a polymerase chain reaction (PCR).
- PCR polymerase chain reaction
- the conserved peptide region has been identified, for example, in the following natural proteins: LFSVPYDYNWYSNWW EqT-IV
- the peptide of the present invention comprises the sequence CMFSVPFDYNWYSNWWC.
- the peptide of the present invention is comprised in a protein having from about 100 to about 300 amino acids.
- Figures 1 and 2 shows the crystal structure of the IGWY chains A and B, respectively, of cytolysin sticholysin Ii.
- Figure 3 shows the structure of the 1KD6 chain A of the eukaryotic pore-forming cytolysin equinatoxin Ii.
- Figure 4 demonstrates the 3-dimensional construct of an equinatoxin mutant, having three cysteines introduced at positions 8, 18 and 69 (ITZQ Chain A).
- This mutant has been previously shown not to be hemolytically active (Kristan K, Podlesek Z, Hojnik V, Gutierrez- Aguirre I, Guncar G, Turk D, Gonzalez-Manas JM, Lakey JH, Macek P, Anderluh G (2004): Pore formation by equinatoxin, an eukaryotic pore-forming toxin, requires a flexible N-terminal region and a stable beta sandwich. J Biol Chem. 279(45):46509-46517). The protein thus lost its cytotoxicity, but was still active against bacterial adherence.
- the principles and operation of the present invention may be better understood with reference to the drawings and accompanying descriptions.
- composition comprising an isolated natural peptide, the peptide comprising a sequence selected from the group consisting of YDYNWY, YDYNLY, FDYNFY, FDYNLY, WDYNLY, FDYNWY, YDWNLY and YDWHLY.
- a method of preventing adhesion of a single cell organism to a surface comprising contacting the cell with a composition of comprising an isolated natural peptide comprising a sequence selected from the group consisting of YDYNWY, YDYNLY, FDYNFY, FDYNLY, WDYNLY, FDYNWY, YDWNLY and YDWHLY, thereby preventing adhesion of a cell to a surface.
- a domain which comprises at least one of the above peptides and which is effective against cell adhesion to a surface. More preferably, the domain is included as part of a protein. Optionally and most preferably, the domain exhibits anti-adhesive behavior, for example for the prevention of formation and/or treatment of a biofilm, but does not exhibit cytotoxic behavior.
- Gallus gallus >gi
- GENE ID 100086848 LOC 100086848
- isolated refers to a composition that has been removed from its in-vivo location (e.g. aquatic organism or moss).
- the isolated compositions of the present invention are substantially free from other substances (e.g., other proteins that do not comprise anti-adhesive effects) that are present in their in-vivo location (i.e. purified or semi- purified).
- aquatic organism refers to an organism living in a water environment (fnarine ⁇ o ⁇ freshwater) such as for example a fish ⁇ fal ⁇ QSs ⁇ le acfiM ⁇ c organism.
- sessile aquatic organism refers to an aquatic organism which is not freely moving for at least some a part of its life cycle.
- Aquatic sessile organisms are usually permanently attached to a solid substrate of some kind, such as to a rock or the hull of a ship due to physical anchorage to the substrate, or for any other reason (e.g. stone fish).
- sessile organisms include, but are not limited to, sessile cnidarians such as corals, sea anemones (e.g. Actinia equine and Aiptasia pulchella), sea pens, aquatic sessile larva (e.g., jellyfish larva), tube dwelling anemones and hydroids (e.g. Chlorohydra viridissima and Hydra vulgaris).
- sessile cnidarians such as corals, sea anemones (e.g. Actinia equine and Aiptasia pulchella), sea pens, aquatic sessile larva (e.g., jellyfish larva), tube dwelling anemones and hydroids (e.g. Chlorohydra viridissima and Hydra vulgaris).
- Exemplary fish that may be used according in embodiments of the present invention are preferably those dwelling in shallow waters or those that hide at the bottom layer of the ocean, sometimes in holes or caves. Such fish include eel and catfish.
- moss refers to a non-vascular plant of the bryophyta division, including any of the classes takakiposida, sphyagnopsida, andreaeopsida, anderaeobryopsida, polytirchopsida, or bryopsisa.
- the moss may comprise, for example, physcomitrella patens, Funaria hygrometrica; Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Bryophyta;Moss Superclass V; Bryopsida; Funariidae; Funariales; Funariaceae; or Physcomitrella.
- the compositions of the present invention may also be expressed in-vivo using genetic engineering techniques (e.g. using transgenic aquatic sessile organisms).
- the compositions of the present invention are devoid of cytotoxic or cytostatic activity, e.g. they are not bactericidal or bacteristatic. According to some embodiments of the present invention, the compositions of the present invention are resistant to lyophilization - e.g. their activities are preserved following freeze drying.
- single cell organism refers to a unicellular organism also termed a microorganism or a microbe.
- the single cell organism of the present invention can be a eukaryotic single cell organism (e.g., protozoa or fungi for example yeast) or a prokaryotic single cell organism (e.g., bacteria or archaea).
- the single cell organisms of the present invention may be in any cellular environment, such as for example, in a biof ⁇ lm, as isolated cells or as a cell suspension.
- biofilm refers to an extracellular matrix in which microorganisms are dispersed and/or form colonies. The biofilm typically is made of pOlysaccharides"and ⁇ otherMacro molecules: ⁇ '
- Exemplary bacterial cells include gram positive bacteria and gram negative bacteria.
- Gram-positive bacteria refers to bacteria characterized by having as part of their cell wall structure peptidoglycan as well as polysaccharides and/or teichoic acids and are characterized by their blue-violet color reaction in the Gram-staining procedure.
- Gram-positive bacteria include: Actinomyces spp., Bacillus anthracis, Bifidobacterium spp., Clostridium botulinum, Clostridium perfringens, Clostridium spp., Clostridium tetani, Corynebacterium diphtheriae, Corynebacterium jeikeium, Enterococcus faecalis, Enterococcus faecium, Erysipelothrix rhusiopathiae, Eubacterium spp., Gardnerella vaginalis, Gemella morbillorum, Leuconostoc spp., Mycobacterium abscessus, Mycobacterium avium complex, Mycobacterium chelonae, Mycobacterium fortuitum, Mycobacterium haemophilium, Mycobacterium kansasii, Mycobacterium leprae, Mycobacterium marinum, Mycobacterium s
- Gram-negative bacteria refer to bacteria characterized by the presence of a double membrane surrounding each bacterial cell.
- Representative Gram-negative bacteria include Acinetobacter calcoaceticus, Acinetobacter baumannii, Actinobacillus actinomycetemcomitans, Aeromonas hydrophila, Alcaligenes xylosoxidans, Bacteroides, Bacteroides fragilis, Bartonella bacilliformis, Bordetella spp., Borrelia burgdorferi, Branhamella catarrhalis, Brucella spp., Campylobacter spp., Chalmydia pneumoniae, Chlamydia psittaci, Chlamydia trachomatis, Chromobacterium violaceum, Citrobacter spp., Eikenella corrodens, Enterobacter aerogenes, Escherichia coli, Flavobacterium meningosepticum, Fusobacterium violaceum, Fus
- fungi refers to the heterotrophic organisms characterized by the presence of a chitinous cell wall, and in the majority of species, filamentous growth as multicellular hyphae.
- Representative fungi whose adhesion may be prevented according to the method of the present invention include Candida albicans, Saccharomyces cerevisiae, Candida glabrata, Candida parapsilosis and Candida dubliniensis.
- the phrase "preventing adhesion” refers to reducing or eliminating cell attachment to a surface (e.g. by reducing the rate of growth on a surface).
- the compositions of the present invention prevent cell adhesion by as much as 10 %, more preferably by 20 %, more preferably by 30 %, more preferably by 40 %, more preferably by 50 %, more preferably by 60 %, more preferably by 70 %, more preferably by 80 %, more preferably by 90 % and most preferably by 100% as measured by a cell adhesion assay. Exemplary cell adhesion assays are described herein below and in the Examples section that follows. It will be appreciated that the compositions of the present invention may also be capable of preventing cell aggregation (i.e. cell aggregation not to a surface).
- the present invention contemplates prevention of cellular adhesion to a wide variety of surfaces including fabrics, fibers, foams, films, concretes, masonries, glass, metals, plastics, polymers, and like.
- the surface is comprised in a device that is susceptible to biofilm formation.
- Exemplary devices whose surfaces are contemplated by the present invention include, but are not limited to, vessel hulls, automobile surfaces, air plane surfaces, membranes, filters, and industrial equipment.
- the surface may also be comprised in medical devices, instruments, and implants. Examples of such medical devices, instruments, and implants include any object that is capable of being implanted temporarily or permanently into a mammalian organism, such as a human.
- Representative medical devices, instruments, and implants that may be used according to the present invention include, for example, central venous catheters, urinary catheters, endotracheal tubes, mechanical heart valves, pacemakers, vascular grafts, stents and prosthetic joints. Methods ⁇ of preventing " cell " attachme ⁇ T ' to "" medical devices ' and furthef examples thereof " are described herein below.
- the surface is comprised in a biological tissue, such as for example, mammalian tissues e.g. the skin.
- the method of the present invention is effected by contacting the cell with a composition from an organism capable of preventing adhesion of the cell to a surface.
- the term "contacting" refers to the positioning of the compositions of the present invention such that they are in direct or indirect contact with the adhesive cells in such a way that the active agent comprised within is able to prevent adhesion of cells thereto.
- the present invention contemplates both applying the compositions of the present invention to a desirable surface and/or directly to the adhesive cells.
- the contacting may be effected in vivo (i.e. within a mammalian body), ex vivo (i.e. in cells removed from the body) and/ or in vitro (i.e. outside a mammalian body).
- Contacting the compositions with a surface can be effected using any method known in the art including spraying, spreading, wetting, immersing, dipping, painting, ultrasonic welding, welding, bonding or adhering.
- the compositions of the present invention may be attached as monolayers or multiple layers.
- the compositions of the present invention may be comprised in a whole living organism.
- the present invention contemplates adding live aquatic organisms to an underwater environment such that they are able to contact a surface and/or cells adhered thereto (e.g. underwater pipes, ship hull) preventing microorganism adhesion thereto.
- the active agent may be secreted from the aquatic organism.
- the aquatic organism does not have to be in direct contact with the surface or microorganism cells, but in sufficient proximity such that the active agent is able to diffuse to its site of action.
- the compositions of the present invention may be secreted into water and used in water purification treatments such as for example desalination of sea water or brackish water.
- a pharmaceutical composition comprising a pharmaceutically acceptable carrier or diluent and as an active ingredient a peptide isolated from an isolated natural peptide, said peptide comprising a sequence selected from the group consisting of YDYNWY, YDYNLY, FDYNFY, FDYNLY, WDYNLY, FDYNWY, YDWNLY and YDWHLY, or any other sequence as described herein.
- the above peptides may optionally be altefe3T30 ⁇ ai.no fb " fm " ri ⁇ n-peptide analogs, " incTu ' dfng " Bufrf ⁇ t : lfmffe ⁇ d ⁇ to replacing one or more bonds with less labile bonds, cyclization (described in greater detail below) and the like.
- a peptide may optionally be converted to a small molecule through computer modeling, as described for example in PCT Application No. WO/2007/147098, hereby incorporated by reference as if fully set forth herein.
- a "peptidomimetic organic moiety" can optionally be substituted for amino acid residues in a peptide according to the present invention both as conservative and as non-conservative substitutions. These moieties are also termed "non-natural amino acids” and may optionally replace amino acid residues, amino acids or act as spacer groups within the peptides in lieu of deleted amino acids.
- the peptidomimetic organic moieties optionally and preferably have steric, electronic or conf ⁇ gurational properties similar to the replaced amino acid and such peptidomimetics are used to replace amino acids in the essential positions, and are considered conservative substitutions. However such similarities are not necessarily required.
- the only restriction on the use of peptidomimetics is that the composition at least substantially retains its physiological activity as compared to the native peptide according to the present invention.
- Peptidomimetics may optionally be used to inhibit degradation of the peptides by enzymatic or other degradative processes.
- the peptidomimetics can optionally and preferably be produced by organic synthetic techniques.
- suitable peptidomimetics include D amino acids of the corresponding L amino acids, tetrazol (Zabrocki et al., J. Am. Chem. Soc. 110:5875 5880 (1988)); isosteres of amide bonds (Jones et al., Tetrahedron Lett. 29: 3853 3856 (1988)); LL 3 amino 2 propenidone 6 carboxylic acid (LL Acp) (Kemp et al., J. Org. Chem.
- exemplary peptidomimetics include hydroxy 1,2,3,4 tetrahydroisoquinoline 3 carboxylate (Miyake et al., J. Takeda Res. Labs 43:53 76 (1989)); 1,2,3,4 tetrahydro- isoquinoline 3 carboxylate (Kazmierski et al., J. Am. Chem. Soc.
- HIC histidine isoquinolone carboxylic acid
- (2S, 3S) methyl phenylalanine, (2S, 3R) methyl phenylalanine, (2R, 3S) methyl phenylalanine and (2R, 3R) methyl phenylalanine Zazmierski and Hruby, Tetrahedron Lett. (1991.((
- ill ⁇ strafive ⁇ bl ⁇ Tlira-Tirnrting lio ⁇ -naturar amino ⁇ ac ⁇ ds ⁇ include " beta-ami ⁇ o acids (beta3 and beta2), homo-amino acids, cyclic amino acids, aromatic amino acids, Pro and Pyr derivatives, 3-substituted Alanine derivatives, Glycine derivatives, ring-substituted Phe and Tyr Derivatives, linear core amino acids or diamino acids. They are available from a variety of suppliers, such as Sigma-Aldrich (USA) for example
- any part of a peptide may optionally be chemically modified, i.e. changed by addition of functional groups.
- the modification may optionally be performed during synthesis of the molecule if a chemical synthetic process is followed, for example by adding a chemically modified amino acid.
- chemical modification of an amino acid when it is already present in the molecule (“in situ" modification) is also possible .
- the amino acid of any of the sequence regions of the molecule can optionally be modified according to any one of the following exemplary types of modification (in the peptide conceptually viewed as "chemically modified")
- Non-limiting exemplary types of modification include carboxymethylation, acylation, phosphorylation, glycosylation or fatty acylation.
- Ether bonds can optionally be used to join the serine or threonine hydroxyl to the hydroxyl of a sugar.
- Amide bonds can optionally be used to join the glutamate or aspartate carboxyl groups to an amino group on a sugar (Garg and Jeanloz, Advances in Carbohydrate Chemistry and Biochemistry, Vol. 43, Academic Press (1985); Kunz, Ang. Chem. Int. Ed.
- Acetal and ketal bonds can also optionally be formed between amino acids and carbohydrates.
- Fatty acid acyl derivatives can optionally be made, for example, by acylation of a free amino group (e.g., lysine) (Toth et al., Peptides: Chemistry, Structure and Biology, Rivier and Marshal, eds., ESCOM Publ., Leiden, 1078-1079 (1990)).
- Examples of the numerous known modifications typically include, but are not limited to: acetylation, acylation, amidation, ADP-ribosylation, glycosylation, GPI anchor formation. covalent attachment of a lipid or lipid derivative, methylation, myristylation, pegylation, prenylation, phosphorylation, ubiquitination, or any similar process.
- a method of preventing or treating a pathogen infection in a subject in need thereof comprising administering to the subject a therapeutically effective amount of the pharmaceutical composition, thereby treating or preventing the pathogen infection.
- y 4 rccofding ⁇ to ⁇ alfernatiVe embodiments of " tRfiTaspecf of ⁇ th " e " present fnve ⁇ ti ⁇ nrtr ⁇ efe ⁇ is provided a method of preventing attachment of exogenous bacteria to the gastrointestinal tract.
- the mammalian gastrointestinal tract contains a wide variety of indigenous microflora, which provide resistance to colonization by enteric pathogen.
- the indigenous microflora In return for providing the host with enhanced defense against pathogens, the indigenous microflora gain access to a nutrient- enriched, stable environment, and thereby enter a symbiotic relation with the host's intestinal tract.
- Symbiotic bacteria attach to the gastrointestinal epithelium in humans by high-affinity, receptor-mediated attachment.
- exogenous bacteria attach to the epithelium by a low- affinity mechanism.
- the compositions of the present invention are expected to selectively prevent or decrease this low-affinity attachment, thereby preventing the initial step of biofilm formation.
- composition of the present invention is therefore useful for treatment or prevention of diseases of the gastrointestinal tract, such as, for example, Crohn's disease or ulcerative colitis, including, for example, collagneous colitis, lymphocytic colitis, ischaemic colitis, diversion colitis, infective colitis and Behcet's syndrome.
- diseases of the gastrointestinal tract such as, for example, Crohn's disease or ulcerative colitis, including, for example, collagneous colitis, lymphocytic colitis, ischaemic colitis, diversion colitis, infective colitis and Behcet's syndrome.
- a "pharmaceutical composition” refers to a preparation of one or more of the active ingredients described herein with other chemical components such as physiologically suitable carriers and excipients.
- the purpose of a pharmaceutical composition is to facilitate administration of a compound to an organism.
- active ingredient refers to the organism compositions (and agents purified therefrom) accountable for the intended biological effect.
- physiologically acceptable carrier and “pharmaceutically acceptable carrier,” which may be used interchangeably, refer to a carrier or a diluent that does not cause significant irritation to an organism and does not abrogate the biological activity and properties of the administered compound.
- An adjuvant is included under these phrases.
- excipient refers to an inert substance added to a pharmaceutical composition to further facilitate administration of an active ingredient.
- excipients include calcium carbonate, calcium phosphate, various sugars and types of starch, cellulose derivatives, gelatin, vegetable oils, and polyethylene glycols.
- compositions of the present invention may be administere ⁇ dlo ⁇ a ⁇ subject in ⁇ need ⁇ thereof irf order to prevent or treafaTpathogerTinfection ' :
- the term "subject in need thereof refers to a mammal, preferably a human subject.
- treating refers to curing, reversing, attenuating, alleviating, minimizing, suppressing or halting the deleterious effects of a pathogen infection.
- pathogen infection refers to any medical condition which is caused by a pathogenic organism.
- pathogen infections include, but are not limited to, chronic infectious diseases, subacute infectious diseases, acute infectious diseases, viral diseases, bacterial diseases, protozoan diseases, parasitic diseases, fungal diseases, mycoplasma diseases, archaea diseases and prion diseases.
- the pathogen infection is caused by an organism capable of growing in or on a biofilm.
- pathogen infections caused by microbial biofilms include native valve endocarditis (NVE), otitis media (OM), chronic bacterial prostatitis, cystic fibrosis (CF) and periodontitis. Additional pathogen infections that are not specifically attributed to biofilms include, but are not limited to urinary infections, female genital tract infections and pneumonia.
- Infections due to implantation of medical devices include vascular catheter infections, arterial prosthetic infections, infections of prosthetic heart valves, prosthetic joint infections, infections of central nervous system shunts, orthopedic implant infections, pacemaker and defibrillator infections, hemodialysis and peritoneal dialysis infections, ocular infections, urinary tract infections, infections of the female genital tract, infections associated with endotracheal intubation and tracheostomy and dental infections.
- pathogenic organism refers to any single cell organism which is capable of causing disease, especially a living microorganism such as a bacteria or fungi.
- the pathogenic organism is capable of growing in or on a biofilm.
- Many common pathogenic organisms exist in mammals (e.g. humans) as biofilms and cause disease.
- Mannheimia haemolytica and Pasteurella multocida causing pneumonia
- Fusobacterium necrophorum causing liver abscess
- Staphylococcus aureus and Pseudomonas aeruginosa causing wound infections
- Escherichia coli and Salmonella spp causing enteritis
- Staphylococcus aureus and Staphylococcus epidermidis causing OM
- Streptococci sp. Staphylococci sp., Candida, and Aspergillus sp. (causing NVE).
- treatment of infectious diseases may be combined with other treatment methods known in the art (i.e., combination tterapy)T " ⁇ The ⁇ e ⁇ tm;lude7 " but ⁇ a ⁇ e “ ⁇ nbT “ l ⁇ mifed “ to7 “ an ⁇ irhicroB ⁇ ar " agehfs " such a? ⁇ pe " n ⁇ cffl ⁇ ns, cephalosporins, carbapenems, aminoglycosides, macrolides, lincomycins, tetracyclines, chloramphenicol, and griseofulvin.
- Suitable routes of administration may, for example, include oral, rectal, transmucosal, especially transnasal, intestinal, or parenteral delivery, including intramuscular, subcutaneous, and intramedullary injections, as well as intrathecal, direct intraventricular, intravenous, inrtaperitoneal, intranasal, or intraocular injections.
- compositions of the present invention may be manufactured by processes well known in the art, e.g., by means of conventional mixing, dissolving, granulating, dragee- making, levigating, emulsifying, encapsulating, entrapping, or lyophilizing processes.
- compositions for use in accordance with the present invention thus may be formulated in conventional manner using one or more physiologically acceptable carriers comprising excipients and auxiliaries, which facilitate processing of the active ingredients into preparations that can be used pharmaceutically. Proper formulation is dependent upon the route of administration chosen.
- the active ingredients of the pharmaceutical composition may be formulated in aqueous solutions, preferably in physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
- physiologically compatible buffers such as Hank's solution, Ringer's solution, or physiological salt buffer.
- penetrants appropriate to the barrier to be permeated are used in the formulation. Such penetrants are generally known in the art.
- compositions of the present invention may be formulated as a gel, a cream, a wash, a rinse or a spray.
- the pharmaceutical composition can be formulated readily by combining the active compounds with pharmaceutically acceptable carriers well known in the art.
- Such carriers enable the pharmaceutical composition to be formulated as tablets, pills, dragees, capsules, liquids, gels, syrups, slurries, suspensions, and the like, for oral ingestion by a patient.
- Pharmacological preparations for oral use can be made using a solid excipient, optionally grinding the resulting mixture, and processing the mixture of granules, after adding suitable auxiliaries as desired, to obtain tablets or dragee cores.
- Suitable excipients are, in particular, fillers such as sugars, including lactose, sucrose, mannitol, or sorbitol; cellulose preparations such as, for example, maize starch, wheat starch, rice starch, potato starch, gelatin, gum tf ag ⁇ ac " anth7 " fnethy rcelTuloseT hydroxypropylmethyl-cellulose, and sodTunT carHometHylcell ⁇ lose ; and/or physiologically acceptable polymers such as polyvinylpyrrolidone (PVP).
- disintegrating agents such as cross-linked polyvinyl pyrrolidone, agar, or alginic acid or a salt thereof, such as sodium alginate, may be added.
- Dragee cores are provided with suitable coatings.
- suitable coatings For this purpose, concentrated sugar solutions may be used which may optionally contain gum arabic, talc, polyvinyl pyrrolidone, carbopol gel, polyethylene glycol, titanium dioxide, lacquer solutions, and suitable organic solvents or solvent mixtures.
- Dyestuffs or pigments may be added to the tablets or dragee coatings for identification or to characterize different combinations of active compound doses.
- compositions that can be used orally include push-fit capsules made of gelatin, as well as soft, sealed capsules made of gelatin and a plasticizer, such as glycerol or sorbitol.
- the push-fit capsules may contain the active ingredients in admixture with Filler such as lactose, binders such as starches, lubricants such as talc or magnesium stearate, and, optionally, stabilizers.
- the active ingredients may be dissolved or suspended in suitable liquids, such as fatty oils, liquid paraffin, or liquid polyethylene glycols.
- stabilizers may be added. All formulations for oral administration should be in dosages suitable for the chosen route of administration.
- compositions may take the form of tablets or lozenges formulated in conventional manner.
- the active ingredients for use according to the present invention are conveniently delivered in the form of an aerosol spray presentation from a pressurized pack or a nebulizer with the use of a suitable propellant, e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane, or carbon dioxide.
- a suitable propellant e.g., dichlorodifluoromethane, trichlorofluoromethane, dichloro-tetrafluoroethane, or carbon dioxide.
- the dosage may be determined by providing a valve to deliver a metered amount.
- Capsules and cartridges of, for example, gelatin for use in a dispenser may be formulated containing a powder mix of the compound and a suitable powder base, such as lactose or starch.
- compositions described herein may be formulated for parenteral administration, e.g., by bolus injection or continuous infusion.
- Formulations for injection may be presented in unit dosage form, e.g., in ampoules or in multidose containers with, optionally, an added preservative.
- the compositions may be suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing, and/or dispersing agents.
- compositions for parenteral " ⁇ 3n ⁇ Krstfati ⁇ rrTncrude aqueous solutions " of " the active preparation in water-soluble form.
- suspensions of the active ingredients may be prepared as appropriate oily or water-based injection suspensions.
- Suitable lipophilic solvents or vehicles include fatty oils such as sesame oil, or synthetic fatty acid esters such as ethyl oleate, triglycerides, or liposomes.
- Aqueous injection suspensions may contain substances that increase the viscosity of the suspension, such as sodium carboxymethyl cellulose, sorbitol, or dextran.
- the suspension may also contain suitable stabilizers or agents that increase the solubility of the active ingredients, to allow for the preparation of highly concentrated solutions.
- the active ingredient may be in powder form for constitution with a suitable vehicle, e.g., a sterile, pyrogen-free, water-based solution, before use.
- a suitable vehicle e.g., a sterile, pyrogen-free, water-based solution
- compositions of the present invention may also be formulated in rectal compositions such as suppositories or retention enemas, using, for example, conventional suppository bases such as cocoa butter or other glycerides.
- compositions suitable for use in the context of the present invention include compositions wherein the active ingredients are contained in an amount effective to achieve the intended purpose. More specifically, a "therapeutically effective amount” means an amount of active ingredients (e.g., an aquatic organism composition or a moss composition) effective to prevent, alleviate, or ameliorate symptoms of a pathogenic infection (e.g., fever) or prolong the survival of the subject being treated.
- a "therapeutically effective amount” means an amount of active ingredients (e.g., an aquatic organism composition or a moss composition) effective to prevent, alleviate, or ameliorate symptoms of a pathogenic infection (e.g., fever) or prolong the survival of the subject being treated.
- the dosage or the therapeutically effective amount can be estimated initially from in vitro and cell culture assays.
- a dose can be formulated in animal models to achieve a desired concentration or titer. Such information can be used to more accurately determine useful doses in humans.
- Toxicity and therapeutic efficacy of the active ingredients described herein can be determined by standard pharmaceutical procedures in vitro, in cell cultures or experimental animals.
- the data obtained from these in vitro and cell culture assays and animal studies can be used in formulating a range of dosage for use in human.
- the dosage may vary depending upon the dosage form employed and the route of administration utilized.
- the exact formulation, route of administration, and dosage can be chosen by the individual physician in view of the patient's condition. (See, e.g., Fingl, E. et al. (1975), "The Pharmacological Basis of Therapeutics," Ch. 1, p. l .)
- Dosage amount arid " admihTstrat ⁇ rT intervals may sufficient plasma or brain levels of the active ingredient to induce or suppress the biological effect (i.e., minimally effective concentration, MEC).
- MEC minimally effective concentration
- the MEC will vary for each preparation, but can be estimated from in vitro data. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. Detection assays can be used to determine plasma concentrations.
- dosing can be of a single or a plurality of administrations, with course of treatment lasting from several days to several weeks, or until cure is effected or diminution of the disease state is achieved.
- compositions to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of administration, the judgment of the prescribing physician, etc.
- compositions of the present invention may, if desired, be presented in a pack or dispenser device, such as an FDA-approved kit, which may contain one or more unit dosage forms containing the active ingredient.
- the pack may, for example, comprise metal or plastic foil, such as a blister pack.
- the pack or dispenser device may be accompanied by instructions for administration.
- the pack or dispenser device may also be accompanied by a notice in a form prescribed by a governmental agency regulating the manufacture, use, or sale of pharmaceuticals, which notice is reflective of approval by the agency of the form of the compositions for human or veterinary administration. Such notice, for example, may include labeling approved by the U.S. Food and Drug Administration for prescription drugs or of an approved product insert.
- Compositions comprising a preparation of the invention formulated in a pharmaceutically acceptable carrier may also be prepared, placed in an appropriate container, and labeled for treatment of an indicated condition, as further detailed above.
- the present invention also contemplates medical devices in which the above- described compositions are attached thereto.
- the term “medical device” refers to any implant, instrument, apparatus, implement, machine, device or any other similar or related object (including any component or accessory)7which ⁇ islnTended ⁇ foTT ⁇ se ⁇ in thTdia " g " nosis; treatfnerit7cufe " ⁇ r prevention of " dfsease ⁇ ” ⁇ r other conditions.
- Such medical device is intended for use in man or other animals and is anticipated to affect the structure or any function of the body. Such medical device does not achieve its primary intended purposes through chemical action and is not dependent upon being metabolized for the achievement of its primary intended purposes.
- implant refers to any object intended for placement in a human body that is not a living tissue.
- the implant may be temporary or permanent.
- An implant can be an article comprising artificial components, such as catheters or pacemakers.
- Implants can also include naturally derived objects that have been processed so that their living tissues have been devitalized.
- bone grafts that have been processed so that their living cells are removed (acellularized), but so that their shape is retained to serve as a template for ingrowth of bone from a host.
- naturally occurring coral can be processed to yield hydroxyapatite preparations that can be applied to the body for certain orthopedic and dental therapies.
- the present invention therefore envisions coating medical devices with the compositions of the present invention to prevent cell adherence thereto so as to reduce/eliminate any possible cell aggregation and biofilm formation known to occur following implantation.
- Device-related infections usually result from the introduction of microorganisms, primarily bacteria, during the device insertion or implantation procedure, or from attachment of blood-borne organisms to the newly inserted device and their subsequent propagation on its surface.
- Coating the medical device with the compositions of the present invention will therefore inhibit biofilm formation of one or more microbial species, will prevent medical device related infections, and consequently will reduce the need of antibiotic treatment or removal of the medical device from the subject.
- Medical devices that may be coated according to the teachings of the present invention include, but not limiting to, artificial blood vessels, catheters and other devices for the removal or delivery of fluids to patients, artificial hearts, artificial kidneys, orthopedic pins, prosthetic joints, plates and implants; catheters and other tubes (including urological and biliary tubes, endotracheal tubes, peripherably insertable central venous catheters, dialysis catheters, long term tunneled central venous catheters, peripheral venous catheters, short term central venous catheters, arterial catheters, pulmonary catheters, Swan-Ganz catheters, urinary catheters, peritoneal catheters), urinary devices (including long term urinary devices, tissue bonding urinary devices, artificial urinary sphincters, urinary dilators), shunts (including ventricular or arterio-venous shunts); prostheses (including breast implants, penile prostheses, vascular grafting prostheses, aneurysm repair devices, mechanical heart valves, artificial joints, artificial
- compositions of the present invention are coating of surfaces found in the medical and dental environment.
- surfaces include the inner and outer aspects of various instruments and devices, whether disposable or intended for repeated uses.
- Such surfaces include the entire spectrum of articles adapted for medical use, including without limitation, scalpels, needles, scissors and other devices used in invasive surgical, therapeutic or diagnostic procedures; blood filters.
- Other examples will be readily apparent to practitioners in these arts.
- Surfaces found in the medical environment also include the inner and outer aspects of pieces of medical equipment, medical gear worn or carried by personnel in the health care setting.
- Such surfaces can include surfaces intended as biological barriers to infectious organisms in medical settings, such as gloves, aprons and faceshields.
- Commonly used materials for biological barriers are thermoplastic or polymeric materials such as polyethylene, dacron, nylon, polyesters, polytetrafluoroethylene, polyurethane, latex, silicone and vinyl.
- Other surfaces can include counter tops and fixtures in areas used for medical procedures or for preparing medical apparatus, tubes and canisters used in respiratory treatments, including the administration of oxygen, of solubilized drugs in nebulizers and of anesthetic agents.
- Other such surfaces can include handles and cables for medical or dental equipment not intended to be sterile. Additionally, such surfaces can include those non-sterile external surfaces of tubes and other apparatus found in areas where blood or body fluids or other hazardous biomaterials are commonly encountered.
- compositions of the present invention can be used on the surface of or within these medical devices to provide long term protection against microorganism colonization and reduce the incidence of device-related infections.
- These compositions can also be incorporated in combination with an anti-microbial agent (e.g., antibiotic agent) into coatings for medical devices.
- an anti-microbial agent e.g., antibiotic agent
- Such a combination will sufficiently kill or inhibit the initial colonizing bacteria and prevent device-related infections as long as the substance is presented in an inhibitory concentration at the device-microbe interface.
- compositions of the present invention can be directly incorporated into the polymeric matrix of the medical device at the polymer synthesis stage or at the device manufacture stage.
- the compositions can also be covalently attached to the medical device polymer.
- Additional surfaces that can be treated according to the teachings of the present invention include the inner and outer aspects of those articles involved in water purification, water storage and water delivery, and those articles involved in food processing.
- the present invention envisions coating a solid surface of a food or beverage container to extend the shelf life of its contents.
- compositions of the present invention can be used for removal of disease-causing microorganisms from external surfaces. These can include, for example food processing equipment for home use, materials for infant care, tampons, soap, detergents, health and skincare products, household cleaners and toilet bowls.
- the surface may be also be laboratory articles including, but not limited to, microscopic slide, a culturing hood, a Petri dish or any other suitable type of tissue culture vessel or container known in the art.
- compositions of the present invention as anti-fouling agents.
- anti-fouling agents refers to the compounds used to protect underwater surfaces from attaching single cell organisms. These single cell organisms include microorganism such as bacteria and fungi.
- underwater surfaces include any water immersed surface, including ships'/boats's hulls (i.e., the body or frame of a ship or boat), submergence vehicles, navigational aids, screens, nets, constructions, floating or emplaced offshore platforms (e.g., docks), buoys, signaling equipment and articles which come into contact with sea water or salty, water.
- Other underwater surfaces include structures exposed to sea water including pilings, marine markers, undersea conveyances like cabling and pipes, fishing nets, bulkheads, cooling towers, and any device or structure that operates submerged.
- the compositions of the present invention can be incorporated into marine coatings to limit undesirable marine fouling.
- the anti-fouling agents of the present invention can be formulated so as not to contain toxic materials (such as heavy metals), and still retain their efficacy.
- the anti-fouling paint of the present invention may further contain binders(s), pigment(s), solvent(s) and additive(s).
- solvents examples include aromatic hydrocarbons such as xylene and toluene; aliphalfif Hydrocarbons such as hexane ⁇ ancTFeptane " , e ' sters such as etEyFacetate and " butyl acetate; amides such as N-methylpyrrolidone and N,N-dimethylformamide; alcohols such as isopropyl alcohol and butyl alcohol; ethers such as dioxane, THF and diethyl ether; and ketones such as methyl ethyl ketone, methyl isobutyl ketone and methyl isoamyl ketone.
- aromatic hydrocarbons such as xylene and toluene
- aliphalfif Hydrocarbons such as hexane ⁇ ancTFeptane " , e ' sters such as etEyFacetate and " butyl acetate
- amides such as N-methylpyr
- binders examples include alkyd resin, acrylic or vinyl emulsions, polyurethane resins, epoxy resins, silicone based resins, acrylic resins, inorganic silicate based resins, vinyl resins, particularly a vinyl chloride/vinyl acetate copolymer, and rosin.
- pigments examples include titanium dioxide, cuprous oxide, iron oxide, talc, aluminium flakes, mica flakes, ferric oxide, cuprous thiocyanate, zinc oxide, cupric acetate meta-arsenate, zinc chromate, zinc dimethyl dithiocarbamate, zinc ethylene bis(dithiocarbamate) and zinc diethyl dithiocarbamate.
- additives examples include dehumidifiers, wetting/dispersing agents, anti-settling agents, anti-skinning agents, drying/curing agents, anti-marring agents and additives ordinarily employed in coating compositions as stabilizers and anti-foaming agents. Additionally, any antibiotic which is relatively insoluble in seawater can be used with an anti-fouling marine paint.
- compositions of the present invention may also be used for providing antibacterial properties in cosmetics, to prevent spoiling of the product.
- compositions may further be used to provide an antibacterial effect to the mouth, teeth and gums, such as by incorporation in a toothpaste, mouthwash, or chewing gum.
- the present teachings portray a wide range of novel anti-adhesive agents isolated from organisms such as aquatic organisms and moss.
- the broad spectrum of the anti adhesion effects of these agents e.g. inhibiting adhesion of gram positive and gram negative bacteria
- these agents together with their ability to effect the initial, vulnerable stages of microbial biofilm formation, makes these agents prime candidates as anti-biofilm agents.
- the anti-adhesive agents described herein are clonable enabling modifications and mass production thereof. In addition their stability (i.e. resistance to environmental conditions) makes these agents suitable for a diverse array of applications.
- Example 1 MS/MS analysis of an active fraction extracted from Aiptesia anemone
- Purified template DNA was prepared from 25 mg of Aiptasia pulchella and Anemonia viridans using the wizard genomic DNA purification kit (Promega, USDA), according to the manufacturer's protocol for isolation of genomic DNA from animal tissu. PCR was carried out on 500 ng of purified template DNA from Aiptasia pulchella and Anemonia viridans using Reddy Mix PCR master mix (ABgene, UK), with the following protocol: 95°C-5min (95 0 C 30sec, 52 0 C 30sec and 72°C lmin) X35, 72 0 C for lOmin.
- a PCR amplicon from Aiptasia pulchella gave the following 265bp sequence: GTGTCGCCAACGAGTCGGGATGCACTTGGGAAAAGCCAAATACATACTTCTTCTCTG CrraCTGA ⁇ GTATAA ⁇ GTGtXTCrCTCTAXAGCTTGX ⁇ ATCTAT ⁇ AAAAGCACTTTTGTA CGGCCCACGTAAGACAACAGGGCCTGTTGCCACGGGAGCTGTTGGAGTGCTCACTT ACAAAATGTTGTGCACCAATGAGACGAACACTCTGGCTGTTCTTTTCAGTGTACCCT TCGACTACAACTTGTACAGCAACTGGTGGAAATGTCAA
- the relevant peptide sequence [FSVPFDYNL YSNWW] appears in the Aiptasial sequence.
- PCR amplicon from Anemonia viridans gave the following 254bp sequence: TGTGTCGACAACGAGTCgGGCaagacgtGgaCCGCAntgaaCACATACTTCCGTTCTGGcAC CTCTGATnTCrTCCTTCCCCATACAGTTCCACATGGTAAGGCACTGCTCTACAACGGT CAGAAAGATCGTGGTCCAGTTGCGACTGGCGtgGTTGGAGTACTTGCTTATGcCATGA GCgATGGAAACACCCtGGCCGTTTTgTTCAGCrTTCCCTaTGACTATAACCtGTACAGCA ACTGGTGGAATGTCAA
- Example 3 Comparison of activity of synthetic peptides Peptides listed below were synthesized using solid-phase methods and purification to 90% scale was performed by Peptron Inc. (Taejeon, Korea).
- peptides were dissolved using 20 ⁇ l dimethyl sulfoxide (DMSO) and diluted in double distilled-water to a concentration of 5mg/ml. Further dilutions were performed in phosphate buffered saline (PBS).
- DMSO dimethyl sulfoxide
- PBS phosphate buffered saline
- biof ⁇ lms were grown in 96-well round-bottom polystyrene plates. Briefly, 180 ⁇ l of overnight cultures were added to wells supplemented with 20 ⁇ l of appropriate peptide diluted in PBS. After 24 h of incubation at 37 0 C, each well was washed with water and was stained with 250 ⁇ l of crystal violet solution. The dye was then removed by thorough washing with water. For quantification of attached cells, crystal violet was solubilized in 250 ⁇ l of 1% sodium dodecyl sulfate (SDS) and the absorbance was measured at 595nm.
- SDS sodium dodecyl sulfate
- a manual Parallel Peptide synthesizer with peptide purifier is used to produce peptides which differ from each other in length and cyclization strategy.
- Each peptide is screened for anti- adhesive activity in microplate and flow cell assays, and selection of highly active peptides is performed.
- Computerized modeling of several versions of peptide is used to optimize selection of the active compounds.
- bioassay is scaled up using the BacTiter-Glo microbial cell viability Assay of Promega, USA. This method uses more sensitive spectrometric technique based on luminescence.
- FIG. 16A shows the generalized structure of the cyclic lead with emulsifier arm.
- the linear analog is a 14mer peptide with hydrophobic core (6aa) that * is ⁇ de “ fined ⁇ s " a " pharmacophore.
- Cyclic leadsHre prepared7pfeserving this pharmacophore and an emulsifying arm (hydrophobic moiety) such as polyethylene, polypropylene, Teflon etc. is then added to provide absorbing capabilities to a hydrophobic polymeric surface (Figure 16B).
- the cyclic lead is prepared using 9H-fluoren-9-ylmethoxycarbonyl solid phase peptide synthesis (Fmoc SPPS).
- the first protected amino acid is condensed with chlorotitryl (Cl-Trt) resin using N,N-diisopropylethylamine (DIEA) in dichloromethane (DCM) or with Rink Amide using O-Benzotriazole-N,N,N',N'-tetramethyl- uronium-hexafluoro-phosphate (HBTU) as coupling reagent.
- Cl-Trt chlorotitryl
- DIEA N,N-diisopropylethylamine
- DCM dichloromethane
- Rink Amide O-Benzotriazole-N,N,N',N'-tetramethyl- uronium-hexafluoro-phosphate
- next couplings are performed using a standard Fmoc protocol with 2-(lH-7- Azabenzotriazol-l-yl) ⁇ l,l,3,3-tetramethyl uronium hexafluorophosphate Methanaminium (HATU) or benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate (PyBoP), DIEA in N-methyl-2-pyrrolidinone (NMP).
- HATU 2-(lH-7- Azabenzotriazol-l-yl) ⁇ l,l,3,3-tetramethyl uronium hexafluorophosphate Methanaminium
- PyBoP benzotriazol-1-yl-oxytripyrrolidinophosphonium hexafluorophosphate
- NMP N-methyl-2-pyrrolidinone
- allyloxycarbonyl (alloc) groups are deprotected by Pd-triphenylphosphine (Tetrakis) using acetyl hydroxide/ N-methyl maleimide/diethene chloride (AcOH/NMM/DCE) cocktail.
- the cyclization step is carried out as a standard coupling reaction (in the case of formation of an amide bond) or by bubbling oxygen (in the case of formation of a disulfide bridge). Other types of cyclizations as known in the art may also be performed.
- the peptides are cleaved from the resin by treatment with trifluoroacetic acid:dichloromethane:tri-iso-propylsilane (TFA:DCM:TIS), 1 :98:1 in the presence of 1,2- ethanedithiol for 30 min in case of the Cl-Trt resin, and in the presence of 95% TFA, TIS and H 2 O in the case of Rink Amide.
- TFA trifluoroacetic acid:dichloromethane:tri-iso-propylsilane
- the crude product in the solution (AcOH/H 2 O 1 :1) is purified by preparative HPLC or MPLC to afford pure cyclic peptide.
- the purity is determined by analytical HPLC.
- the structures are confirmed by LC-MS and AA analysis.
- the next stage involves linkage of the hydrophobic arm for introducing absorbing properties to the cyclic peptide lead. This arm is linked using standard SPPS protocol.
- Figure 17 shows a flowchart outlining the process for development of a cyclic peptide lead with an emulsifying arm.
- Example 4 Treatment of water or fluid medium
- compositions and/or organisms may optionally and preferably be used to treat water and/or a fluid medium, or a system or apparatus containing such, including but not limited to a reverse osmosis filter and/or filtration apparatus or system.
- seawater synthetic media is determined (see (Fritzmann et al., 2007: Fritzmann, C, Lowenberg, J., Wintgens, T., and Melin, T. (2007) State-of-the-art of reverse osmosis desalination. Desalination 216: 1-76) and IDE reports http://www.ide-tech.tech.com/) and are used for cell attachment biofilm growth experiments.
- microbial consortium being isolated from the desalination plant in Palmachim
- real seawater is used as a media for microbial attachment and biofilm growth experiments.
- Model strains to be used are Vibrio fisheri and Caulobacter crescentus.
- one channel is supplemented with an extract and the other serves as a control with only the solvent being added to the media (for example, when the extract is dissolved in ethanol).
- the flowcell biofilms are microscopically analyzed at different time points (up to 14 days of experiment) when viable cells, dead cells and Extra cellular polymeric substances (EPS) are stained with fluorescent probes (different flourescent labelled lectins are used for probing different polysacharide constitutents in the EPS) and visualized with laser scanning confocal microscopy (LSCM).
- Microscopic analysis is performed using image processing analysis softwares such as Imaris bitplane and COMSTAT (Heydorn et al., 2002: Ersboll, B., Kato, J., Hentzer, M., Parsek, M.R., Tolker-Nielsen, T. et al.
- Calcium which has significant effect on the adhesiveness and the compactness of the biofilm is also monitored and visualized with LSCM using Calcium specific fluorochromes such as Fura-2 (Grynkiewicz et al., 1985: Grynkiewicz, G., Poenie, M., and Tsien, R. Y.
- Antifouling properties are also examined by analyzing the adherence of different types of EPC/bacteria with QCM-D surface-modified crystals covalently bonded to different peptides.
- QCM-D employs an ultra-sensitive mass sensor (silica-coated quartz crystal) housed inside a flow cell with a well-defined geometry and hydrodynamic characteristics, a design that allows real-time monitoring of mass adsorption with no required labeling.
- the piezoelectric quartz crystal oscillates laterally with an amplitude of 1-2 nm when a voltage is applied to the electrodes affixed to the quartz crystal. As deposition (adsorption) occurs on the crystal surface, it leads to a shift in the vibrational frequency of the crystal.
- thickness and structural conformation of the adsorbed layer can be extracted by simultaneous monitoring of the energy of dissipation, which is the sum of all energy losses within the system per oscillation cycle.
- QCM-D in addition to measuring the adsorption and adherence of the different types of EPS (i.e., changes in polysaccharides/protein contents) under different environmental conditions (i.e., changes in divalent cation concentrations), QCM-D can also reveal the visco-elastic properties, conformational changes, and thickness of the precipitated nano-layer.
- Example 5 Effect of active peptides on reverse osmosis biofouling under desalination conditions
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- General Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Medicinal Chemistry (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Epidemiology (AREA)
- Molecular Biology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Engineering & Computer Science (AREA)
- Surgery (AREA)
- Vascular Medicine (AREA)
- Heart & Thoracic Surgery (AREA)
- Gastroenterology & Hepatology (AREA)
- Zoology (AREA)
- Biomedical Technology (AREA)
- Toxicology (AREA)
- Transplantation (AREA)
- Dermatology (AREA)
- Oral & Maxillofacial Surgery (AREA)
- Tropical Medicine & Parasitology (AREA)
- Water Supply & Treatment (AREA)
- Environmental & Geological Engineering (AREA)
- Hydrology & Water Resources (AREA)
- Wood Science & Technology (AREA)
- Materials Engineering (AREA)
- Botany (AREA)
- Pharmacology & Pharmacy (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Peptides Or Proteins (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (13)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA2737682A CA2737682C (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| EP14153264.8A EP2789626B1 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| EP19184917.3A EP3670524A1 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US13/120,049 US9029318B2 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| ES09740951T ES2753900T3 (es) | 2008-09-24 | 2009-09-23 | Péptidos y composiciones para la prevención de la adhesión celular y métodos de uso de los mismos |
| EP09740951.0A EP2344521B1 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| JP2011527422A JP5676451B2 (ja) | 2008-09-24 | 2009-09-23 | ペプチド |
| AU2009295575A AU2009295575B2 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| KR1020157032926A KR101788284B1 (ko) | 2008-09-24 | 2009-09-23 | 세포 유착 방지를 위한 펩티드와 조성물 및 그것의 사용 방법 |
| CN200980138283.3A CN102171239B (zh) | 2008-09-24 | 2009-09-23 | 用于防止细胞粘附的肽和组合物及其使用方法 |
| IL211930A IL211930A (en) | 2008-09-24 | 2011-03-24 | Peptides and nonsense for their use in preventing cell adhesion |
| US14/708,014 US9777050B2 (en) | 2008-09-24 | 2015-05-08 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US15/721,404 US11001612B2 (en) | 2008-09-24 | 2017-09-29 | Peptides and compositions for prevention of cell adhesion and methods of using same |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US13667308P | 2008-09-24 | 2008-09-24 | |
| US61/136,673 | 2008-09-24 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US13/120,049 A-371-Of-International US9029318B2 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US14/708,014 Continuation US9777050B2 (en) | 2008-09-24 | 2015-05-08 | Peptides and compositions for prevention of cell adhesion and methods of using same |
Publications (3)
| Publication Number | Publication Date |
|---|---|
| WO2010035107A2 true WO2010035107A2 (en) | 2010-04-01 |
| WO2010035107A3 WO2010035107A3 (en) | 2010-05-20 |
| WO2010035107A9 WO2010035107A9 (en) | 2010-07-15 |
Family
ID=41698391
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IB2009/006926 Ceased WO2010035107A2 (en) | 2008-09-24 | 2009-09-23 | Peptides and compositions for prevention of cell adhesion and methods of using same |
Country Status (12)
| Country | Link |
|---|---|
| US (3) | US9029318B2 (enExample) |
| EP (3) | EP2344521B1 (enExample) |
| JP (2) | JP5676451B2 (enExample) |
| KR (2) | KR101788284B1 (enExample) |
| CN (2) | CN102171239B (enExample) |
| AU (1) | AU2009295575B2 (enExample) |
| CA (1) | CA2737682C (enExample) |
| ES (2) | ES2753900T3 (enExample) |
| HK (1) | HK1213903A1 (enExample) |
| IL (1) | IL211930A (enExample) |
| SG (2) | SG10202000552YA (enExample) |
| WO (1) | WO2010035107A2 (enExample) |
Cited By (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010076642A1 (en) * | 2008-12-29 | 2010-07-08 | Tel Hashomer Medical Research, Infrastructure And Services Ltd | Peptides and compositions for prevention of cell adhesion and methods of using same |
| WO2012164380A3 (en) * | 2011-05-31 | 2013-06-27 | Hutchison Biofilm Medical Solutions Limited | Dispersion and detachment of cell aggregates |
| WO2015063608A3 (en) * | 2013-10-31 | 2015-08-06 | Hutchison Biofilm Medical Solutions Limited | Prevention and dispersion of biolfilm |
| EP3699185A1 (en) * | 2019-02-20 | 2020-08-26 | Université de Rennes 1 | Peptides for preventing biofilm formation |
| US11001612B2 (en) | 2008-09-24 | 2021-05-11 | Amir Zlotkin | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US11174299B2 (en) | 2008-12-29 | 2021-11-16 | Dispersebio Ltd. | Peptides and compositions for prevention of cell adhesion and methods of using same |
| WO2024213802A1 (en) * | 2023-04-14 | 2024-10-17 | Oxford Nanopore Technologies Plc | Novel pore monomers and pores |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8513305B2 (en) | 2007-05-14 | 2013-08-20 | Research Foundation Of State University Of New York | Induction of a physiological dispersion response in bacterial cells in a biofilm |
| AU2012346594B2 (en) | 2011-11-30 | 2017-12-21 | Agency For Science, Technology And Research | GM1 ganglioside to Annexin V microparticle polypeptide ratio for biological monitoring |
| JP6443235B2 (ja) * | 2015-06-15 | 2018-12-26 | 三菱ケミカル株式会社 | 細胞外多糖類の検出を使用した汚泥の脱水方法 |
| KR101819190B1 (ko) * | 2015-10-14 | 2018-01-16 | 주식회사 큐얼스 | 미세조류 파괴용 조성물 |
| US11541105B2 (en) | 2018-06-01 | 2023-01-03 | The Research Foundation For The State University Of New York | Compositions and methods for disrupting biofilm formation and maintenance |
| MX2021004543A (es) * | 2018-11-01 | 2021-09-10 | Biofouling Tech Inc | Proteccion duradera contra la bioincustracion. |
| KR102277536B1 (ko) | 2019-04-25 | 2021-07-15 | 동국대학교 산학협력단 | 생물오손 방지를 위한 체내 삽입형 의료기기 및 체내 삽입형 의료기기의 표면에 생물오손 방지막의 형성방법 |
| WO2020252003A1 (en) | 2019-06-13 | 2020-12-17 | Hollister Incorporated | Reusable urinary catheter products |
| US12440644B2 (en) | 2019-06-25 | 2025-10-14 | Hollister Incorporated | Reusable urinary catheter products |
| KR102520633B1 (ko) | 2021-02-17 | 2023-04-11 | 동의대학교 산학협력단 | 흡수성이 향상된 치과용 멤브레인 필터 및 그 제조방법 |
| EP4464714A1 (en) * | 2023-05-19 | 2024-11-20 | Karlsruher Institut für Technologie | Screening method for cell-repelling peptides |
Family Cites Families (49)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NL154600B (nl) | 1971-02-10 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen. |
| NL154598B (nl) | 1970-11-10 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van laagmoleculire verbindingen en van eiwitten die deze verbindingen specifiek kunnen binden, alsmede testverpakking. |
| NL154599B (nl) | 1970-12-28 | 1977-09-15 | Organon Nv | Werkwijze voor het aantonen en bepalen van specifiek bindende eiwitten en hun corresponderende bindbare stoffen, alsmede testverpakking. |
| US3901654A (en) | 1971-06-21 | 1975-08-26 | Biological Developments | Receptor assays of biologically active compounds employing biologically specific receptors |
| US3853987A (en) | 1971-09-01 | 1974-12-10 | W Dreyer | Immunological reagent and radioimmuno assay |
| US3867517A (en) | 1971-12-21 | 1975-02-18 | Abbott Lab | Direct radioimmunoassay for antigens and their antibodies |
| NL171930C (nl) | 1972-05-11 | 1983-06-01 | Akzo Nv | Werkwijze voor het aantonen en bepalen van haptenen, alsmede testverpakkingen. |
| US3850578A (en) | 1973-03-12 | 1974-11-26 | H Mcconnell | Process for assaying for biologically active molecules |
| US3935074A (en) | 1973-12-17 | 1976-01-27 | Syva Company | Antibody steric hindrance immunoassay with two antibodies |
| US3996345A (en) | 1974-08-12 | 1976-12-07 | Syva Company | Fluorescence quenching with immunological pairs in immunoassays |
| US4034074A (en) | 1974-09-19 | 1977-07-05 | The Board Of Trustees Of Leland Stanford Junior University | Universal reagent 2-site immunoradiometric assay using labelled anti (IgG) |
| US3984533A (en) | 1975-11-13 | 1976-10-05 | General Electric Company | Electrophoretic method of detecting antigen-antibody reaction |
| US4098876A (en) | 1976-10-26 | 1978-07-04 | Corning Glass Works | Reverse sandwich immunoassay |
| US4286988A (en) | 1980-06-30 | 1981-09-01 | The United States Of America As Represented By The Secretary Of The Navy | Copper base antifouling paints with pH control |
| US4879219A (en) | 1980-09-19 | 1989-11-07 | General Hospital Corporation | Immunoassay utilizing monoclonal high affinity IgM antibodies |
| US4678512A (en) | 1982-02-12 | 1987-07-07 | Grams Ralph R | Marine coating compositions and method |
| US5011771A (en) | 1984-04-12 | 1991-04-30 | The General Hospital Corporation | Multiepitopic immunometric assay |
| US4666828A (en) | 1984-08-15 | 1987-05-19 | The General Hospital Corporation | Test for Huntington's disease |
| US4683202A (en) | 1985-03-28 | 1987-07-28 | Cetus Corporation | Process for amplifying nucleic acid sequences |
| US4801531A (en) | 1985-04-17 | 1989-01-31 | Biotechnology Research Partners, Ltd. | Apo AI/CIII genomic polymorphisms predictive of atherosclerosis |
| GB8511144D0 (en) | 1985-05-02 | 1985-06-12 | Int Paint Plc | Marine anti-fouling paint |
| JPH07764Y2 (ja) | 1987-05-19 | 1995-01-11 | 日産自動車株式会社 | 自動変速機のロツクアツプ制御装置 |
| US4865909A (en) | 1987-10-21 | 1989-09-12 | W. L. Gore & Associates, Inc. | Microporous anti-fouling marine coating |
| US5272057A (en) | 1988-10-14 | 1993-12-21 | Georgetown University | Method of detecting a predisposition to cancer by the use of restriction fragment length polymorphism of the gene for human poly (ADP-ribose) polymerase |
| US5192659A (en) | 1989-08-25 | 1993-03-09 | Genetype Ag | Intron sequence analysis method for detection of adjacent and remote locus alleles as haplotypes |
| US5143545A (en) | 1991-09-20 | 1992-09-01 | The United States Of America As Represented By The Secretary Of The Navy | Antifouling marine coatings |
| US5281521A (en) | 1992-07-20 | 1994-01-25 | The Trustees Of The University Of Pennsylvania | Modified avidin-biotin technique |
| WO1995016000A1 (en) | 1993-12-09 | 1995-06-15 | The Research Foundation Of State University Of New York | Aquatic antifouling compositions and methods |
| AUPQ002399A0 (en) * | 1999-04-28 | 1999-05-20 | Australian National University, The | Model membrane systems |
| US7834146B2 (en) * | 2000-05-08 | 2010-11-16 | Monsanto Technology Llc | Recombinant polypeptides associated with plants |
| US7556807B2 (en) | 2001-02-20 | 2009-07-07 | Kane Biotech, Inc. | Signal peptides, nucleic acid molecules and methods for treatment of caries |
| US7189351B2 (en) * | 2001-10-25 | 2007-03-13 | Spherix Incorporated | D-tagatose as an anti-biofilm agent |
| WO2003050708A1 (en) | 2001-12-07 | 2003-06-19 | Vitesse Semiconductor Company | A method and system for transporting information via the xgmii or fiber channel standard |
| GB0200689D0 (en) * | 2002-01-10 | 2002-02-27 | Univ Newcastle | Fusion proteins |
| CN1162541C (zh) * | 2002-09-03 | 2004-08-18 | 中山大学 | 一种海葵细胞毒素基因、其编码的蛋白及应用 |
| WO2005121778A2 (en) * | 2004-06-14 | 2005-12-22 | Galapagos N.V. | Methods for identification, and compounds useful for the treatment of degenerative & inflammatory diseases |
| EP1793875B9 (en) | 2004-06-16 | 2010-09-08 | Affinergy, Inc. | Ifbm's to promote attachment of target analytes |
| US20090156471A1 (en) | 2004-07-15 | 2009-06-18 | Ramot At Tel Aviv University Ltd. | Use of anti-amyloid agents for treating and typing pathogen infections |
| GB0502046D0 (en) * | 2005-02-01 | 2005-03-09 | Sinclair Pharmaceuticals Ltd | Method |
| WO2007089272A2 (en) * | 2005-07-22 | 2007-08-09 | The Regents Of The University Of Colorado, A Body Corporate | Non-toxic biofilm inhibitor |
| US8048443B2 (en) * | 2005-12-16 | 2011-11-01 | Cerapedics, Inc. | Pliable medical device and method of use |
| US20070293435A1 (en) | 2006-06-16 | 2007-12-20 | Naomi Balaban | Identification and Use of Non-Peptide Analogs of RNAIII-Inhibiting Peptide for the Treatment of Staphylococcal Infections |
| DK2126060T3 (en) * | 2007-03-22 | 2017-01-16 | Dsm Ip Assets Bv | Hitherto unknown lysyl oxidases |
| US20080241281A1 (en) | 2007-03-29 | 2008-10-02 | Texas Tech University System | Compositions & methods for activation and inhibition of Staphylococcus aureus biofilm development |
| JP5823692B2 (ja) | 2007-09-20 | 2015-11-25 | テル ハショメール メディカル リサーチ インフラストラクチャ アンド サービシーズ リミテッド | 細胞接着の予防のための水生生物起源の組成物、及びこれを使用する方法 |
| US8551555B2 (en) * | 2007-12-26 | 2013-10-08 | Intel Corporation | Biocompatible coatings for medical devices |
| SG10202000552YA (en) | 2008-09-24 | 2020-03-30 | Tel Hashomer Medical Research Infrastructure And Services Ltd | Peptides and compositions for prevention of cell adhesion and methods of using same |
| SG10201401054YA (en) | 2008-12-29 | 2014-07-30 | Tel Hashomer Medical Res Infrastructure & Services Ltd | Peptides and compositions for prevention of cell adhesion and methods of using same |
| JP6208358B2 (ja) | 2014-07-09 | 2017-10-04 | ジヤトコ株式会社 | ロックアップクラッチの制御装置 |
-
2009
- 2009-09-23 SG SG10202000552YA patent/SG10202000552YA/en unknown
- 2009-09-23 SG SG10201504623VA patent/SG10201504623VA/en unknown
- 2009-09-23 CA CA2737682A patent/CA2737682C/en active Active
- 2009-09-23 KR KR1020157032926A patent/KR101788284B1/ko active Active
- 2009-09-23 ES ES09740951T patent/ES2753900T3/es active Active
- 2009-09-23 EP EP09740951.0A patent/EP2344521B1/en active Active
- 2009-09-23 US US13/120,049 patent/US9029318B2/en active Active
- 2009-09-23 CN CN200980138283.3A patent/CN102171239B/zh active Active
- 2009-09-23 JP JP2011527422A patent/JP5676451B2/ja active Active
- 2009-09-23 EP EP19184917.3A patent/EP3670524A1/en not_active Withdrawn
- 2009-09-23 AU AU2009295575A patent/AU2009295575B2/en active Active
- 2009-09-23 CN CN201510209329.3A patent/CN104892728A/zh active Pending
- 2009-09-23 ES ES14153264.8T patent/ES2690348T3/es active Active
- 2009-09-23 WO PCT/IB2009/006926 patent/WO2010035107A2/en not_active Ceased
- 2009-09-23 EP EP14153264.8A patent/EP2789626B1/en active Active
- 2009-09-23 KR KR1020117008716A patent/KR101594202B1/ko active Active
-
2011
- 2011-03-24 IL IL211930A patent/IL211930A/en active IP Right Grant
- 2011-10-18 HK HK15112562.6A patent/HK1213903A1/zh unknown
-
2014
- 2014-07-31 JP JP2014156280A patent/JP5750703B2/ja active Active
-
2015
- 2015-05-08 US US14/708,014 patent/US9777050B2/en active Active
-
2017
- 2017-09-29 US US15/721,404 patent/US11001612B2/en active Active
Cited By (30)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US11001612B2 (en) | 2008-09-24 | 2021-05-11 | Amir Zlotkin | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US9732124B2 (en) | 2008-12-29 | 2017-08-15 | Tel Hashomer Medical Research, Infrastructure And Services Ltd. | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US11566054B2 (en) | 2008-12-29 | 2023-01-31 | Dispersebio Ltd. | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US8552147B2 (en) | 2008-12-29 | 2013-10-08 | Tel Hashomer Medical Research, Infrastructure And Services Ltd. | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US11174299B2 (en) | 2008-12-29 | 2021-11-16 | Dispersebio Ltd. | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US9045550B2 (en) | 2008-12-29 | 2015-06-02 | Tel Hashomer Medical Research, Infrastructure and Services Ltd, the Technology Transfer Company of Chaim | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US10508136B2 (en) | 2008-12-29 | 2019-12-17 | Tel Hashomer Medical Research, Infrastructure And Services Ltd. | Peptides and compositions for prevention of cell adhesion and methods of using same |
| WO2010076642A1 (en) * | 2008-12-29 | 2010-07-08 | Tel Hashomer Medical Research, Infrastructure And Services Ltd | Peptides and compositions for prevention of cell adhesion and methods of using same |
| US20180153172A1 (en) * | 2011-05-31 | 2018-06-07 | Hutchison Biofilm Medical Solutions Ltd | Dispersion and detachment of cell aggregates |
| EP3527581A3 (en) * | 2011-05-31 | 2019-11-27 | Hutchison Biofilm Medical Solutions Limited | Dispersion and detachment of cell aggregates |
| WO2012164380A3 (en) * | 2011-05-31 | 2013-06-27 | Hutchison Biofilm Medical Solutions Limited | Dispersion and detachment of cell aggregates |
| KR20170093993A (ko) * | 2011-05-31 | 2017-08-16 | 허치슨 바이오필름 메디컬 솔루션스 리미티드 | 세포 응집물의 분산 및 분리 |
| CN107325165A (zh) * | 2011-05-31 | 2017-11-07 | 和黄生物膜医疗解决方案有限公司 | 细胞聚集体的分散和脱离 |
| JP2017226662A (ja) * | 2011-05-31 | 2017-12-28 | ハチソン バイオフィルム メディカル ソリューションズ リミテッド | 細胞集塊の分散及び脱離 |
| US9284351B2 (en) | 2011-05-31 | 2016-03-15 | Hutchison Biofilm Medical Solutions Ltd. | Dispersion and detachment of cell aggregates |
| AU2012264385B2 (en) * | 2011-05-31 | 2018-06-28 | Hutchison Biofilm Medical Solutions Limited | Dispersion and detachment of cell aggregates |
| KR101920541B1 (ko) * | 2011-05-31 | 2018-11-20 | 허치슨 바이오필름 메디컬 솔루션스 리미티드 | 세포 응집물의 분산 및 분리 |
| EP2714719B1 (en) * | 2011-05-31 | 2018-12-12 | Hutchison Biofilm Medical Solutions Limited | Dispersion and detachment of cell aggregates |
| US11202851B2 (en) | 2011-05-31 | 2021-12-21 | Dispersebio Ltd. | Dispersion and detachment of cell aggregates |
| US9700058B2 (en) | 2011-05-31 | 2017-07-11 | Hutchison Biofilm Medical Solutions Ltd. | Dispersion and detachment of cell aggregates |
| JP2014520098A (ja) * | 2011-05-31 | 2014-08-21 | ハチソン バイオフィルム メディカル ソリューションズ リミテッド | 細胞集塊の分散及び脱離 |
| CN104039812A (zh) * | 2011-05-31 | 2014-09-10 | 和黄生物膜医疗解决方案有限公司 | 细胞聚集体的分散和脱离 |
| KR102211724B1 (ko) * | 2011-05-31 | 2021-02-03 | 허치슨 바이오필름 메디컬 솔루션스 리미티드 | 세포 응집물의 분산 및 분리 |
| EP3632457A1 (en) * | 2013-10-31 | 2020-04-08 | Hutchison Biofilm Medical Solutions Limited | Use of peptides in antibiotic resistance |
| WO2015063608A3 (en) * | 2013-10-31 | 2015-08-06 | Hutchison Biofilm Medical Solutions Limited | Prevention and dispersion of biolfilm |
| AU2014343371B2 (en) * | 2013-10-31 | 2019-03-14 | Hutchison Biofilm Medical Solutions Limited | Use of peptides in antibiotic resistance |
| CN105828828A (zh) * | 2013-10-31 | 2016-08-03 | 和黄生物膜医疗解决方案有限公司 | 肽在抗生素抗性中的用途 |
| WO2020169709A1 (en) * | 2019-02-20 | 2020-08-27 | Universite De Rennes 1 | Peptides for preventing biofilm formation |
| EP3699185A1 (en) * | 2019-02-20 | 2020-08-26 | Université de Rennes 1 | Peptides for preventing biofilm formation |
| WO2024213802A1 (en) * | 2023-04-14 | 2024-10-17 | Oxford Nanopore Technologies Plc | Novel pore monomers and pores |
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US11001612B2 (en) | Peptides and compositions for prevention of cell adhesion and methods of using same | |
| US11566054B2 (en) | Peptides and compositions for prevention of cell adhesion and methods of using same | |
| CA2837412C (en) | Dispersion and detachment of cell aggregates | |
| HK40013071A (en) | Dispersion and detachment of cell aggregates | |
| HK1158658B (zh) | 用於防止细胞粘附的肽和组合物及其使用方法 | |
| HK1158658A (en) | Peptides and compositions for prevention of cell adhesion and methods of using same | |
| AU2015224504A1 (en) | Peptides and compositions for prevention of cell adhesion and methods of using same |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200980138283.3 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09740951 Country of ref document: EP Kind code of ref document: A2 |
|
| ENP | Entry into the national phase |
Ref document number: 2011527422 Country of ref document: JP Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2737682 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 13120049 Country of ref document: US |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009295575 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2479/DELNP/2011 Country of ref document: IN |
|
| ENP | Entry into the national phase |
Ref document number: 20117008716 Country of ref document: KR Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009740951 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2009295575 Country of ref document: AU Date of ref document: 20090923 Kind code of ref document: A |