WO2010011111A4 - 뎁손을 유효성분으로 함유하는 노화조절용 및/또는 수명연장용 조성물 - Google Patents
뎁손을 유효성분으로 함유하는 노화조절용 및/또는 수명연장용 조성물 Download PDFInfo
- Publication number
- WO2010011111A4 WO2010011111A4 PCT/KR2009/004148 KR2009004148W WO2010011111A4 WO 2010011111 A4 WO2010011111 A4 WO 2010011111A4 KR 2009004148 W KR2009004148 W KR 2009004148W WO 2010011111 A4 WO2010011111 A4 WO 2010011111A4
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- dds
- composition
- aging
- dapsone
- life
- Prior art date
Links
Images
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/13—Amines
- A61K31/135—Amines having aromatic rings, e.g. ketamine, nortriptyline
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/63—Compounds containing para-N-benzenesulfonyl-N-groups, e.g. sulfanilamide, p-nitrobenzenesulfonyl hydrazide
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P39/00—General protective or antinoxious agents
- A61P39/06—Free radical scavengers or antioxidants
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the present invention relates to a composition for regulating senescence and / or prolonging the life span. More specifically, the present invention relates to a composition for regulating the aging and / or prolonging the life of the composition, which contains dexone as an active ingredient.
- Aging refers to the accumulation of cellular damage, cell membrane lipids, and intracellular proteins, which are continuously caused by various environmental hazards that persist as individuals live and by harmful products that are generated during their metabolic processes, such as free radicals
- a biological clock is inherent in genes of all individuals, such as damage accumulation theory of aging and telomere hypothesis, which suggests that degenerative dysfunction, direct and indirect DNA damage, and mitochondrial dysfunction occur.
- the genetic programming of aging can be broadly divided into two categories: the genetic program theory of aging.
- Dapsone (4,4'diaminodiphenylsulfone; hereinafter referred to as dexson or DDS) is a substance synthesized a century ago, and is well known as a leprosy treatment drug, and is also used as an important drug in many other skin diseases [1, 40]. It is not clear whether DDS functions as an oxidizing agent or an antioxidant. However, in some studies, DDS has been proposed as an oxidizing agent and to limit its use by causing hemolytic anemia [2, 3]. Several studies have suggested that DDS can function as an antioxidant [5, 6]. However, there is no known effect of this depigment on the control of aging, the prevention of aging, or the prolongation of life.
- the inventors of the present invention completed the present invention by discovering that a composition containing DDS (DDS) is excellent in a life extension effect in a small nematode, and that human fibroblasts are excellent in inhibiting the cytotoxicity induced by paraquat.
- DDS DDS
- the present invention has the effect of reducing the mitochondrial function of the small nematode and decreasing the expression of ROS-producing proteins in the cytoplasm, and also the NOX expression is decreased in the human fibroblasts, and the mitochondrial function recovery effect is excellent.
- compositions for regulating the aging and / or for prolonging the life which contains depozon as an active ingredient.
- a feature of the present invention is to contain dexson in a composition for regulating and / or prolonging the life of an individual to alleviate or inhibit the aging of the individual, with respect to the aging experienced by the individual in living. Accordingly, it is an object of the present invention to provide a composition containing a depixon, for the purpose of regulating the aging of cells and individuals.
- the present invention provides a composition for regulating the aging and / or extending the life span, which contains deboss as an active ingredient.
- the present inventors have made efforts to know whether a composition containing Dapson (DDS), which is widely used in the treatment of leprosy and various skin diseases and malaria diseases, has an effect of extending the life of the individual. As a result, it was found that the effect of extending the life of the object was excellent.
- DDS Dapson
- the term " senescene" has the same meaning as aging.
- "aging control” refers to all phenomena that control aging phenomena such as inhibition, prevention, and alleviation of aging.
- the composition of the present invention exhibits a biological phenomenon similar to that of young cells by temporarily inhibiting cell senescence or restoring the biological function of aging cells.
- the aging cells treated with the composition of the present invention recover the reactivity to growth factors such as EGF, restore signaling by the growth factors, and allow the cell cycle to operate normally.
- this inhibition or relaxation effect of cell senescence directly or indirectly affects the life span, which means that aging of the individual can be alleviated.
- Various animals including mammals can be used as a model animal to examine the effect of depswn on the lifetime of an individual, but in the present invention, a pretty nematode was used.
- Caenorhabditis elegans is a nematode that feeds on bacteria from soil and has no legs or wings, no eyes or twigs, and senses ambient temperature, texture and smell through sensory organs in the head or tail.
- the size of the adult is about 1 mm and it is a multicellular creature with a relatively simple shape.
- the body is transparent and is a hermaphroditic body, but there is also a body. Since it has been used as an experimental model in the 1970s, it has been widely used due to the convenience of its manipulation, and six chromosome maps have an advantage of being able to access the genetic map and nucleotide sequence by completing the genome project in 1999.
- Pretty nematodes are nematode after they have been hatched from eggs and then passed through egg stage and L1 to L4 larva stages. They take 3 days to be nematodes, The average life span is as short as 3 weeks, which can be very useful for studying life extension.
- the effect of dampson on the lifespan of an individual using a small nematode can be determined by first cultivating E. coli in a culture medium containing dodecsone and then using the nematode as a food to nurture a beautiful nematode .
- the antibiotic, dex- phon can reduce the growth of Escherichia coli, which can also affect the life span of the small nematode.
- PabA para- aminobenzoic acid
- the concentration of PABA is used in a concentration range of about 10 uM, which affects only the growth of E. coli, so that it does not affect the life of the beautiful nematode.
- the mechanism of extending the life span of a small nematode by the DDS-containing composition of the present invention can be controlled by an insulin signal, a mitochondrial complex, cytoplasmic ROS, and pyruvate kinase.
- the mitochondrial complex is preferably a complex V in the mechanism of life extension by the DDS, and the pyruvate kinase gene mutation is preferably pyk-1.
- the present inventors have also found that there is a regulating effect on senescence at a human cell level in a composition containing dodson (DDS). As a result, the present inventors have found that the regulation of intracellular mitochondrial function and the intracellular ROS It was found that the inhibitory effect of the produced material was excellent.
- DDS dodson
- human fibroblasts were treated, and it was examined whether dexpon inhibits the cytotoxicity caused by the parachute, by increasing the oxidative stress, which is one of the mechanisms related to aging, by treating the paraquat .
- Paraquat (hereinafter referred to as paraquat or PQ), which is a drug used in the present specification, is a kind of herbicide and causes serious cell damage through redox process.
- PQ is widely used to induce oxidative stress in cells by producing superoxide anion in NADPH-dependent metabolic processes.
- PLC Protein kinase C
- NOX NADPH oxidase
- the depotson-containing composition of the present invention reduces the expression of NOX by inhibiting the PKC activity induced by the paraquat, inhibits the abnormal function of mitochondria, i.e., the amount of complex protein in mitochondria, Changes, and increased production of ROS can be controlled by effectively controlling cell senescence.
- composition of the present invention can be formulated into cosmetic formulations, pharmaceutical formulations and formulations of health supplements or drinks by conventional methods known in the art.
- composition of the present invention When the composition of the present invention is prepared with a cosmetic composition, it contains the components commonly used in cosmetic compositions in addition to the above-mentioned effective ingredient, dexpon, and may contain conventional additives such as antioxidants, stabilizers, solubilizers, vitamins, , And a carrier.
- the cosmetic composition of the present invention can be prepared into any of the formulations conventionally produced in the art and can be used in the form of solutions, suspensions, emulsions, pastes, gels, creams, lotions, powders, soaps, , Oil, powder foundation, emulsion foundation, wax foundation and spray, but is not limited thereto.
- a soft lotion a nutritional lotion, a nutritional cream, a massage cream, an essence, an eye cream, a cleansing cream, a cleansing foam, a cleansing water, a pack, a spray or a powder.
- composition of the present invention when the composition of the present invention is prepared as a pharmaceutical composition or a health supplement, it may contain a pharmaceutically acceptable carrier or a food-acceptable carrier in addition to the depsone.
- the carrier include a carbohydrate-based compound such as lactose, Cellulose, calcium carbonate, alginate, gelatin, calcium silicate, microcrystalline cellulose, polyvinylpyrrolidone, cellulose, water, syrup, (Eg corn oil, cottonseed oil, soybean oil, olive oil, coconut oil), polyethylene glycol, methylcellulose, methylhydroxybenzoate, propylhydroxybenzoate, talc, magnesium stearate And mineral oils, but are not limited thereto.
- the composition of the present invention may further contain lubricants, wetting agents, sweeteners, flavors, emulsifiers, suspending agents, preservatives, etc. in addition to the above components.
- composition of the present invention may be prepared in a unit dose form by formulating it with a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs.
- a pharmaceutically acceptable carrier and / or excipient according to a method which can be easily carried out by those having ordinary skill in the art to which the present invention belongs.
- the formulations may be in the form of solutions, suspensions or emulsions in oils or aqueous media, or in the form of excipients, powders, granules, tablets or capsules, and the compositions of the present invention may contain suitable quantities of salts And a buffered solution in which the PH modifier is dissolved.
- a dispersant or a stabilizer may be further added.
- Suitable pharmaceutically acceptable carriers and formulations are described in detail in Remington ' s Pharmaceutical Sciences (19th ed., 1995).
- composition of the present invention can be administered orally or parenterally.
- parenteral administration the composition can be administered by intravenous injection, subcutaneous injection, muscle injection, intraperitoneal injection, transdermal administration, or the like.
- the preferred dosage form is oral.
- the appropriate dosage of the pharmaceutical composition of the present invention varies depending on factors such as the formulation method, administration method, age, body weight, sex, pathological condition, food, administration time, administration route, excretion rate and responsiveness of the patient, Usually, a skilled physician can easily determine and prescribe dosages effective for the desired treatment or prophylaxis, and may determine dosages in single, multiple doses per day.
- the daily dose of the pharmaceutical composition of the present invention is 1 mg to 150 mg of dextrone per 50 kg of a single dose, preferably 50 to 100 mg.
- a method of regulating aging of cells comprising the step of applying a composition containing, as an active ingredient, dexone to an aging cell.
- the present invention also provides a method for extending the life of an individual comprising applying the composition to a subject.
- the aging cell is an animal, preferably a mammal, more preferably a human cell, most preferably a human fibroblast.
- the subject is also an animal, preferably a mammal and a pretty nematode, most preferably a human and a pretty nematode.
- the present invention relates to a composition for regulating senescence and / or prolonging the life span. Specifically, the present invention relates to a composition for regulating senescence and / or prolonging the life of a composition containing depenson as an active ingredient.
- the effect of aging control or life extension is excellent.
- the administration of DDS increased the lifespan of dwarf nematodes independently of daf-16, delayed the aging process, and decreased the activities of mitochondrial complex V protein and cytoplasmic dual oxidase 1 (Duox1) . It was also confirmed that dexson decreased the oxygen consumption rate in the small nematode and decreased ROS formation.
- dexpon treatment the production of ROS by paraquat, which is an oxidative stress inducer, was reduced and the sensitivity by paraquat was also low.
- structural prediction and molecular and biochemical analyzes suggested that pyruvate kinase is the target of dexpon.
- dexpon reduced the expression of NOX in the cells and regenerated mitochondria function. Due to this comprehensive result, the effect of increasing the life span at individual and cellular levels is excellent.
- FIG. 1 is a graph showing the degree of growth of bacteria by PABA treatment. At this time, the growth of bacteria was observed in the group treated with the PABA control and 2 mM of DDS, and the inhibition of the dietary restriction by inhibiting the proliferation of OP50 by DDS was prevented. OP50 bacteria were treated with PABA (2 uM) alone or PABA and DDS at the same time for 36 h.
- FIG. 2 is a graph showing an intake amount of DDS of a pretty little nematoda administered with DDS. More specifically, as a result of chromatograms of insects containing DDS using HPLC, DDS was measured in the worms fed the OP50 bacteria treated with DDS, 10 ⁇ M of DDS was added to the HPLC as a comparative control (left) and the DDS was treated One OP50 was used to measure insects (right) and compared. The inserted table shows the details of the DDS peak shown in the graph.
- FIG. 4 shows the activity of the insect on day 23 when the DDS was fed or not. Photographs were taken every 20 seconds after administration of DDS, and the results were shown. At this time, the arrow indicates the initial position of the worm.
- FIG. 5 shows the results of delaying the progress of aging by DDS.
- FIG. 5A is a photograph showing self-emission of consumable pigment (lipofuscin) in the small intestine of DDS-fed worms during the lifetime and after the L4 stage. In this case, the number means the day after passing the adult, F2 means that DDS has been administered and that 2 generations have passed, and L4 means administration of DDS after L4.
- FIG. 5B is a graph showing the quantitative difference in the accumulation of lipofuscin of FIG. 5A, wherein more than 30 worms were observed daily. The error bars represent the standard deviation, * indicates P ⁇ 0.0001, and ** indicates P ⁇ 0.001. (Mann-Whitney t-test)
- FIG. 7 is a graph showing the growth curve of a nematode, which is a target substance of DDS, folP, with or without defective bacteria. At this time, folP showed a prolonged lifespan in a pretty little nematode fed defective bacteria. The results of two of three experiments showed a significant increase in lifetime.
- FIG. 8 is a graph showing mitochondrial separation and Western blotting to determine the amount of complex V of mitochondria. ⁇ -tubulin was used as a control. Results were statistically treated using mean and variance of 4 replicates.
- FIG. 9 is a graph showing the measurement of the amount of ATP in the small nematode by DDS treatment (administration).
- FIG. 10 shows the oxygen consumption rate of the nymphs of the small nymphs by DDS treatment (administration). At this time, the average of 4 replicates was calculated.
- FIG. 11 is a graph showing the results of inhibition of H 2 O 2 produced by PQ by administration of DDS.
- the production of H 2 O 2 produced was measured using a plate reader at 540 nm absorbance using AmplexRed. (*: Compared to control group not treated with PQ, **: compared to group treated with PQ and not treated with DDS)
- FIG. 12 is a graph showing the saturation rate in liquid NGM medium containing PQ (250 mM, for 7 hours) for worms treated with DDS or not. At this time, both groups were treated with PABA and lifetime measurements were performed until the worm died ( p ⁇ 0.0001).
- FIG. 13 shows the results of measuring the amount of ceDoux1 mRNA by RT-PCT for DDS-fed worms and non-fed worms. At this time, Actin was used as a control group, and the results were averaged for 4 experiments (* P ⁇ 0.005).
- Figure 14 shows the structural modeling of DDS and PK (PEP binding active sites).
- Figure 15 lists the pyruvate kinase sequences of different species. Potential residues (PEP binding active sites) interacting with DDS are indicated by red and dot. Abbreviations: CePYK-1, C. elegans PYK-1; CePYK-2, C. elegans PYK-2; Sc, S. cerevisiae ; Tm, T. maritime; Pf, P. furiosus ; 1pkm, cat PK; And la5u, rabbit PK. Residue K246, marked with an asterisk (*), is one of the PEP binding sites of PK.
- Figure 16 shows the results of 'PK inhibition' by DDS in vitro (16A) and in vivo (16B).
- the activity of PK was analyzed by the decrease of lactate dehydrogenase (LDH) from pyruvate and NADH to lactate and NAD at 340 nm absorbance.
- LDH lactate dehydrogenase
- the pyruvate and ATP used here were formed from PK - induced phosphoenolpyruvate (PEP) and ADP.
- In vitro assays were carried out by placing the DDS directly into the reaction mixture with PK and in vivo analysis by inserting the inseminated DDS.
- Figure 17A shows an increase in pyruvate content in Pretty nematode by DDS treatment (* P ⁇ 0.001) and 17B shows an increase in pyruvate content in pyk-1 (ok1754) mutant worms without DDS treatment .
- FIG. 18 is a graph showing the life extension of the pyk-1 (ok1754) mutant animal, showing an increase in the lifespan of the pyk-1 (ok1754) mutant animal not treated with DDS.
- the N2 and ok1754 mutants were fed with OP50 bacteria grown in media containing PABA alone or containing PABA + DDS.
- Figure 19 is a graph showing that pyk-2 RNAi has no effect on the lifespan of wild - type N2 and pyk-1 mutant animals.
- Figure 20 shows the increase in pyruvate content in the isp-1 mutant bug (* P ⁇ 0.001).
- Fig. 21 shows that DDS does not affect the offspring in the beautiful nematode.
- A is the result of RT-PCR of the mRNA of the gene related to the child action in the worms fed or not fed with DDS.
- B) was carried out using immunoassay in the transgenic (transgenic) nymphs with GFP :: lgg-1, a marker of child action. At this time, it can be seen that there is no significant difference in the worms that eat DDS through the immunoblot. All results are summarized in three independent experiments.
- FIG. 22 shows that the low concentration of DDS also has an effect almost similar to the life extension of insects.
- the survival curves of insects with DDS at 0.5 mM or 1 mM showed similar prolonged life span.
- Figure 23 shows the effect of DDS on the viability of human diploid fibroblasts (HDFs) cells treated with PQ.
- DDS was pretreated with human fibroblasts for 3 hours, and 1 mM PQ for 48 hours Lt; / RTI > Cell counting Kit-8 was added to the cells and cultured for 48 hours to measure cell viability.
- DPI 5 uM
- NAC 2 mM
- Results were normalized to control group and expressed as control rate (%).
- Three experiments were performed and the statistical significance was expressed as #, * Significantly different p ⁇ 0.005 (#: control group without any treatment (CC), *: control group treated with only PQ (C)).
- Figure 24 shows the effect of DDS on cytoplasmic or mitochondrial superoxide anion production induced by PQ.
- Human fibroblasts were grown in 96 well plates for 24 hours and cultured in DDS, DPI (5 uM, 30 min), and NAC (2 mM) was pretreated for 3 hours. Cells were treated with 1 mM PQ for 30 min and incubated for 15 min at 37 ° C with oxidant-sensitive fluorescent dyes (A) DHE (5 uM, cytosol specific) and (B) MitoSOX (5 uM, mitochondria specific) . Fluorescence changes were measured by using a multiwell plate reader.
- Figure 25 shows the results of measuring the DPPH radical scavenging activity of DDS in vitro (in vitro), and the change in protein amount of SOD1 and SOD2, enzymes that remove excess oxide anion produced in HDF treated with PQ
- A Cell-free system
- A A graph depicting the inhibition of DPPH (200 uM) radicals by the effect of DDS with radical scavenging activity in vitro.
- Trolox B
- Figure 26 shows the effect of DDS on NOX4 mRNA increased by PQ in human fibroblasts.
- A Human fibroblasts were pretreated with DDS, DPI (5 uM), and NAC (2 mM) ) For 5 minutes. The amount of NOX4 (HDF specific) mRNA, which is the source of excess cytoplasmic oxide anion generated by PQ, was measured by RT-PCR.
- B % compared to the control (human fibroblasts without any treatment).
- Figure 27 shows the effect of DDS on PQ-induced calcium-dependent PKC activity in human fibroblasts, showing the effect of DDS on PQ-induced changes in calcium amount in human fibroblasts.
- HDF cells were grown in 96-well pate and measured by Fluo-4AM, which measures intracellular calcium.
- Various concentrations of DDS (27A) and 5uM of DPI were pretreated and treated with 1mM PQ (27B).
- FIG. 28 shows PQ-induced PKC phosphorylation measured by Western blotting.
- Human fibroblasts were pretreated with DDS, 1 mM PQ was treated for 1 minute or 5 minutes, and cells were collected to analyze PKC phosphorylation Significance compared to # p ⁇ 0.05 CC * compared to p ⁇ 0.05 C).
- Figure 29 shows the effect of DDS on mitochondrial changes induced by PQ in human fibroblasts.
- the present inventors observed various changes induced by PQ, such as the amount of protein in the lowered mitochondrial constitutive complex and the membrane potential of the lowered mitochondria Respectively.
- Human fibroblasts were pretreated with DDS, DPI, and NAC and treated with 1 mM PQ for 24 hours.
- the amount of protein in the constitutive complex of mitochondria is complex I (20 kDa ND6 subunit), Complex II (30 kDa FeS, non-heme iron protein, SDHB), Complex III (47 kDa core protein 2) Complex V (55 kDa subunit a ATP synthase), etc.
- B The effect of DDS on PQ-induced mitochondrial membrane potential in human fibroblasts.
- the membrane potential of mitochondria was ( ⁇ m) DiOC 6.
- Human fibroblasts were pretreated with DDS, DPI, and NAC, treated with PQ 1 mM for 24 hours, and then treated with 40 nM DiOC6 for 15 minutes.
- Cary Eclipse fluorescence spectrophotometer (Varian, California, USA) was used, and the excitation wavelength was measured at 480 nm and the emission wavelength at 520 nm.
- FIG. 30 shows the result of visualization with confocal microscopy by staining with Mitotracker Red to analyze the structural change of mitochondria.
- Human fibroblasts were treated with 1 mM PQ (24 h) and DDS (or DPI) as in the above experiment and covered with glass cover slip.
- a pretty little nematode (C. elegans) was used as a model animal.
- the lines used for the experiments were wild-type N2 Bristol and mutants daf-16 (cf1038), clk-1 (e2519), isp-1 (qm150) and adls2122 [GFP :: lgg-1 , rol-6 (su10060)].
- L4-stage mothers were transferred to a medium containing dex- son and PABA.
- first-generation offspring of the adult were transferred to a new medium and eggs were laid for 4 to 5 hours.
- the second generation offspring of eggs were kept on the three mediums until they were not laying eggs on each of the 10 mediums, and the lifespan was measured.
- the self-emission of the small nematode was photographed for 800 msec through the 525 nm band reversal. Each picture was adjusted with Adobe Photoshop CS2.
- the amount of self-emission in the small intestine was measured by using Image J 1.35 to measure the brightness of the pixels in a certain region.
- the average and standard error were obtained by measuring more than 30 beautiful nymphs every day.
- This HPLC system consists of a JASCO HPLC pump PU-980 and a JASCO UV-975 detector.
- a C18 150 X 4.6 mm (5 ⁇ m) column was used and the flow rate was 1.0 mL / min.
- DDS was prepared by dissolving solution of water: acetonitrile: glacial acetic acid: triethylamine (80: 20: 1.0: 0.05, by volume) and both tests were performed at 295 nm (285 nm emi / 340 nm exi).
- the amount of ATP was determined by slightly modifying the previously described method [38]. To analyze the total amount of ATP, either PABA alone or with PABA and dexpon were fed together and the other nematodes were grown in S Basal buffer (0.1 M NaCl / 0.05 M potassium phosphate buffer, pH 6.0) And a measurement sample was prepared. The sample was finally adjusted to 100 ul and frozen at -80 ⁇ ⁇ . The frozen nymphs were immediately boiled for 15 minutes to release ATP, kept cool and centrifuged (15,000 g, for 5 minutes) to remove debris from the nymphs. The amount of ATP was measured by a bioluminescence assay kit CLS II (Roche Molecular Biochemicals) reagent and a luminometer (PerkinElmer). The amount of APT was normalized to the amount of protein.
- PCR Master Mix (Genenmed) was used for gene amplification (PCR), and the nucleotide sequences of primers used were ceDuox1; 5'-CTTCACACCGTTGGACATTG-3 '(forward primer) and 5'-GAAGATGTGTGAGCCGGAAT-3' (reverse primer), Actin; 5'-TCGTAGGACTTCTCGAGGGA-3 '(forward primer) and 5'-ATGTTGCCGCTCTCGTAGTT-3' (reverse primer) were used.
- eat2 Forward primer (5'-GCAAATTCCCCATGGTACAC -3 ') and reverse primer (5'-CATGGAAAGTGAGCACGAGA-3'); eat3 : Forward primer (5'-AGGCTGCATCAGAACGTCTT -3 ') and reverse primer (5'-TGTTTGTGCTCTGGATCTGC -3'); bec1: Forward primer (5'-CAAAGAAGGCCAGATTCAGC -3 ') and reverse primer (5'-CGTTGTCGGATGGTTTTCTT -3'); let-512 / VPS34: Forward primer (5'-TATGCGAGTCTCCACGTCAG -3 ') and reverse primer (5'-CCAATCGATCCTTTGCTTGT -3'): T22H9.2 (ATg9): Forward primer (5'- CACTTCAACGAGCTTGACCA -3 ') and reverse primer (5'-GTGATGACGTGTTCCACCTG -3'); atgr-18 (ATg9): Forward primer (5'- CACTTCAACGAGCTTGACC
- lamp1 Forward primer (5'-CAACGCTTACAAGTGCTCCA -3 ') and reverse primer (5'-ACGACGATTGGGACAACTTC -3'); lamp2: Forward primer (5'-GGCCAAAAGAAACTTGTCCA -3 ') and reverse primer (5'-TTTCGTCATTGGAAGCTGTG -3').
- Amplex Red hydrogen peroxide / peroxygenase assay kit (Molecular Probes, Eugene, OR) [39] was used to measure the effect of dexpon on ROS elimination.
- 150 PABA alone or 150 nevus nematodes fed with PABA and dexpon were treated with paraquat 250 mM for 1 hour.
- To the wells of a 96-well plate were added 50 ul of each of the 100 nymphs and Amplex Red (200 uM) was added to each well in an amount of 50 ul. After standing at 22 ° C for 90 minutes, the amount of hydrogen peroxide was measured using a plate reader (Tecan, infinite 200) and an absorbance of 540 nm.
- Oxygen consumption was measured using a Clark-type oxygen electrode (782 Oxygen Meter, Strathkelvin Instruments, Glasgow, UK) (50, 51). Pretty nematodes were grown on NGM agar medium supplemented with PABA alone or PABA and DDS, respectively, and the contamination was washed off with S-basal buffer 4 times. 200 ⁇ L of S-basal buffer was placed in a Mitocell chamber equipped with a Clark-type oxygen electrode, and oxygen consumption was measured for several minutes. Samples were recovered from the chambers and homogenized using a Precellys24 homogenizer by placing glass beads twice for 20 seconds at 5000 rpm. Were centrifuged at 15,000 g for 20 minutes and used for quantification of supernatant proteins using a BCA protein quantification kit. The oxygen consumption rate was corrected with the total protein.
- DALI search [52] with DHPS structure and Streptococcus pneumoniae (PDB ID; 2VEG), Cat & rabbit pyruvate kinase (PDB ID; 1PKM, 1A5U respectively) and obtained Z scores of 15.1 and 15.0.
- the RMSD value was 3.1.
- DDS has been modeled preferentially at the aminophenyl group position, which is structurally PABA binding region of DHPS.
- the structure of the cat pyruvate kinase is consistent with DHPS.
- the final model of the DDS was manually transformed by the program COOT to control the steric hindrance between the possible joining areas of PK and DDS [53].
- PK residues potentially bind to DDS were selected using a model of cat pyruvate kinase structure and DDS, and PK sequences of six different species were conserved.
- the pyruvate content was measured using a commercially available fluorescence-based assay kit (BioVision). The pyruvate content was corrected by total protein and expressed in nmol / mg of protein. Measurements were performed three times.
- Example 14 Measurement of activity of pyruvate kinase (pyruvate kinase)
- Sample preparation was obtained by placing a glass bead in a 100 mM potassium phosphate buffer, pH 7.6 at 37 ° C for 2 hours at 5000 rpm for 20 seconds using a Precellys24 homogenizer. Chaps were added to the homogenized sample to a final concentration of 1% and centrifuged at 15000 g for 20 minutes. The activity of pyruvate kinase activity was measured with reference to the previous paper [54].
- Measurements were performed at 37 ° C and were performed in 100 mM potassium phosphate buffer, pH 7.6 at 37 ° C, 100 mM MgSO 4 , 1.3 mM ⁇ -NADH, 5000 units / mL of lactate dehydrogenase (LDH), 2 mM adenosine diphosphate And 300 ⁇ L of a reaction mixture containing 17 mM phosphoenolpyruvate (PEP). The change in the degree of oxidation of NADH was measured at an absorbance of 340 nm. PK 1 unit was defined as the change of PEP 1.0 ⁇ mole to pyruvate at pH 7.6 and 37 ° C per minute.
- Protein quantification was performed using a BCA protein assay kit (Pierce), and pyruvate kinase activity was expressed in units / mg of protein.
- BCA protein assay kit Pieris Biol kits
- pyruvate kinase activity was expressed in units / mg of protein.
- rabbit muscle Type I pyruvate kinase Sigma.
- PK was not added to the control group and pyruvate was added instead of PEP.
- Dapsone 4,4'-diaminodiphenylsulfone (hereinafter referred to as DDS) was purchased from Taegeuk Chemical Company, and was dissolved in a solution of paraquat, 2,2-diphenyl-1-picrylhydrazyl (DPPH), trichloros, iodonium -Acetyl-L-cysteine (NAC) was purchased from Sigma.
- Cell Counting Kit (CCK-8) was purchased from Dojindo Laboratory (Japan). Reagent was purchased from MRC (Cincinnati, USA).
- Fluorescent materials of dihydroetiem (DHE), Red, Fluo-4 AM, MitoTracker Red CMXRos and 3,3- dihexyloxacarbocyanine (DiOC6) were purchased from Molecular Probes ).
- the radical scavenging activity was measured by measuring the reducing power of DPPH contained in methanol.
- the effect of DDS on radical scavenging was based on the previously studied method [12] and Trolox was used as a positive control.
- DDS (0.1-100 uM) dissolved in 0.5 ml of methanol and Trolox were mixed with 2.5 ml of methanol containing 200 uM of DPPH in a test tube.
- Example 18 Measurement of NADPH oxidase 4 (NOX4) mRNA level by RT-PCR
- RNA of human fibroblasts was isolated using Trizol reagent (MRC Cincinnati, US) and RT-PCR was performed using Biometra T Gradient PCR (Biometra, Goettingen, Germany) instrument to measure NOX4 and GAPDH.
- the PCR amplified DNA was separated into 1.2% agarose gel, stained with EtBr, visualized, and photographed with UV.
- Human fibroblasts were cultured in 96-well plates. Human fibroblasts were pretreated with DDS, DPI (30 min) and NAC for 3 hours, treated with 1 mM PQ for 30 minutes, and then the fluorescent substance dihydroethidium (DHE) 5? Lt; 0 > C for 15 minutes. The cells were rinsed twice with DPBS, and the fluorescent ethidium-DNA was immediately measured at 515 nm excitation wavelength and 590 nm emission wavelength using a Cary Eclipse fluorescence spectrophotometer (Varian, California, USA).
- DHE dihydroethidium
- MitoSOX Red The measurement of the mitochondrial excess oxide anion was performed using a fluorescent material called MitoSOX Red.
- the reduced fluorescent material does not fluoresce until it enters the respiratory cell, and the oxidized fluorescent probe selectively strikes the mitochondria [13].
- Human fibroblasts were pretreated with DDS, DPI (30 min), and NAC for 3 hours, treated with 1 mM PQ for 30 minutes, then the fluorescent material MitoSOX Red 5?
- M was light-shielded and incubated at 37 ⁇ for 15 minutes Lt; / RTI > Cells were washed twice with DPBS and fluorescence was measured immediately at 515 nm excitation wavelength and 590 nm emission wavelength using CEFS (Cary Eclipse fluorescence spectrophotometer (Varian, California, USA)).
- CEFS Cary Eclipse fluorescence spectrophotometer
- Example 21 Measurement of the amount of activated PKC and mitochondrial complex by Western blot analysis
- DDS and PQ treated lysates of human fibroblasts were resuspended in sample buffer (50 mM Tris-HCl (pH 6.8), 2% SDS, 0.14 M 2-mercaptoethanol, 10% glycerol, and 0.001% Bromophenol Blue ), And they were separated by electrophoresis.
- MS601 Total OXPHOS Complexes Detection Kit, MitoSciences, containing antibodies against SDH30 subunit of complex II (5 ⁇ g / ml) and Core2 subunit of complex III (0.2 ⁇ g / PCK ⁇ / ⁇ -p, PKC ⁇ -p (Phospho-PKC)), COXII subunit of complex IV (2 ⁇ g / ml) and subunit ⁇ of F1-ATPase of complex V Antibody Sampler Kit, Cell Signaling Technology), PKC ⁇ , PCK ⁇ , PKC ⁇ (Life Technologies), and ⁇ -Actin (Sigma). Measurements were performed using horseradish peroxygenase-conjugated secondary antibodies (Zymed) and ECL (Pierce). The results were visualized using an autoradiographic film (Image Reader, LAS-3000Fujifilm, Japan).
- Example 22 Measurement of the amount of calcium in a cell
- the amount of calcium in the cells was measured using Fluo-4 (5 uM), a calcium-labeled fluorescent material that passes through cells well. Incubated at 37 ° C for 30 minutes, shaded at room temperature for de-esterification of intracellular AM ester, and left for 30 minutes. The remaining fluorescent material was removed with HBSS supplemented with 20 mM HEPES (pH 7.4), and 100 ul of HBSS was added to each cell well. The excitation wavelength was measured at 494 nm and the emission wavelength at 516 nm using a multi-well fluorescence plate spectrophotometer (Varian, California, USA) [14]. Results were expressed as relative fluorescence units (RFUs).
- Example 24 Structural staining of mitochondria using MitoTracker Red (Immunofluorescence)
- CMXRos MitoTracker Red CMXRos (50 nM) was treated for 30 min at 37 ° C. This dye is used as an indicator of function by marking mitochondria with the transmembrane potential of intracellular mitochondria. After incubation, the cells were washed with PBS and fixed with 4% paraformaldehyde at 4 ° C overnight. The next day, the cells were treated with blocking solution (2% bovine serum albumin in PBS) for 1 hour at room temperature and DAPI stained at room temperature for 10 minutes. Washed, covered with cover slip, and visualized by fluorescence microscopy.
- blocking solution 2% bovine serum albumin in PBS
- DDS as an antibiotic is well known. It is well known that DDS competitively binds to the active site of the DHPS enzyme required for bacterial folic acid synthesis and PABA to inhibit bacterial growth. However, since eukaryotic cells do not have DHPS, this functional mechanism of DDS can not be found in eukaryotes. However, in order to explain the oxidative stress and antioxidant effects of DDS, as we can see from the results of cell experiments and pretty nematodes, we want to identify the target protein of DDS in eukaryotes. The structure of DDS binding to DHPS is well known (58), and we analyzed the protein structure to find a candidate protein with a structure similar to the binding pocket of DHPS.
- cytochrome P450 is a protein with the best structure for DDS.
- This cytochrome P450 is well known as a substance that binds to and breaks down in living organisms, and DDS is recognized and cleaved by P450 even in pretty little nematodes.
- pyruvate kinase is a candidate substance (Figs. 14 and 15).
- hemolytic anemia is seen in patients with PK deficiency, which is a major side effect of DDS in leprosy patients (60, 61). Increased pyruvate content has been reported to extend life (62).
- DDS inhibits the action of other enzymes in the TCA cycle and lowers the consumption of pyruvate.
- the mitochondrial complex V level and oxygen consumption rate are then reduced by DDS.
- inhibition of PK activity can modulate the inhibition of the TCA cycle in terms of compensatory mechanisms. This possibility can be explained by the fact that the pyruvate content is maintained high in the isp-1 mutant islet- lengthened islet- life-lengthening deficient in the mitochondrial complex III (Fig. 20). These results indicate that the amount of pyruvate is important in prolonging the life span.
- DDS improves PQ-induced cytotoxicity
- Human fibroblasts were treated with various concentrations of DDS (0.1, 1, 5, 20, and 50 uM), DPI (5 uM), and NAC (2 mM) to evaluate the effect of DDS on cytotoxicity by PQ Pretreated, and then PQ 1 mM was treated for 48 hours.
- DPI well known as an inhibitor of NOX
- NAC a well - known antioxidant
- Cell viability was measured using a Cell Counting Kit (CCK-8).
- Human fibroblasts treated with PQ without any pretreatment decreased cell viability by about 58.8% compared to the control without PQ treatment.
- human fibroblasts treated with DDS had improved viability compared to cells with PQ toxicity.
- DPI and NAC which were used as positive control, showed PQ-induced cytotoxicity inhibition effect by about 80-90% compared to the control group without any treatment (FIG. 23).
- DHE dihydroethidium
- a superoxide anion was produced by PQ in human fibroblasts and that the produced excess oxide anion was reduced in dependence on the concentration of DDS.
- DPI and NAC used as positive control also inhibited the formation of excess oxide anion (Fig. 24A).
- MitoTracker Red fluorescent material was used to actively breathe into cells that do not fluoresce. However, when the mitochondria are oxidized by the excess oxide anion, they enter the mitochondria and fluoresce, thereby measuring the amount of the excess oxide anion [13].
- Human fibroblasts treated with DDS showed concentration-dependent inhibition of the production of excess oxide anion of mitochondria (Fig. 24B).
- DPI and NAC which were also used as positive control, also inhibited the production of excess oxide anion of mitochondria.
- DDS has the function as an antioxidant
- the present inventors first examined the effect on DPPH, which is a well-known stable free radical.
- DDS showed no improvement in ROS removal activity on DPPH as tested in vitro.
- Trolox water-soluble vitamin E used as an antioxidant control showed strong ROS removal activity (FIG. 25A).
- SOD1 and SOD2 are ROS removal enzymes
- DDS increases the amount or activity of enzymes that remove ROS.
- DDS rather reduced the amount of SOD1 and SOD2 (Fig. 25B).
- DDS inhibits the expression of NOX4, which is increased by PQ
- NOX4 is the major isomer of the NADPH oxidase gene in fibroblasts of human skin [18, 19], and the expression of NOX4 primarily determines the amount of ROS produced. Therefore, inhibition of NOX4 expression may be responsible for the reduction of ROS production [20].
- RT-PCR analysis of NOX4 and GAPDH was performed in human fibroblasts treated with 1 mM PQ for 5 minutes. The amount of NOX4 was increased in human fibroblasts treated with PQ.
- DDS reduced the expression of NOX4 by treating human fibroblasts with various concentrations of DDS.
- DPI can also be used to confirm that NOX4 is required for the production of superoxide anions by PQ in human fibroblasts ( Figure 26).
- DDS can regulate the amount of calcium in the cells [21].
- the present inventors measured the amount of calcium under various conditions using a fluorescent substance called Fluo-4. The amount of calcium increased by PQ was reduced at a concentration showing an inhibitory effect on the oxidative reaction of DDS (FIG. 27).
- PKC PKC isomers are involved in the activity of NOX.
- Conventional PKC cPKC
- calcium dependent isomers such as PKC ⁇ , ⁇ -I, ⁇ -II, and ⁇
- DDS calcium dependent isomers
- Mitochondrial dysfunction is characterized by excess oxide anion production, membrane potential breakdown, mitochondrial DNA damage, and structural changes.
- the present inventors investigated the change of the membrane potential of mitochondria using DiOC6 fluorescent substance.
- the mitochondrial membrane potential of human fibroblasts treated with PQ 1 mM for 24 hours was reduced to 76.8% as compared to the control.
- the PQ-induced reduction in membrane potential of mitochondria was significantly maintained (FIG. 29B).
- the present inventors have examined the structural changes of mitochondria using mitotracker fluorescent materials.
- the mitochondria appear elongated ( Figure 30, first).
- Mitochondria can be observed in mitochondria-positive (MT +) fluorescence in cells, and cloudy staining in mitochondria (MT-) in cytosol staining [24].
- Treatment of human fibroblasts with 1 mM of PQ for 24 hours results in a small dot-like stain with the disappearance of the MT + portion of mitochondria (Fig. 30, second).
- the mitochondria of human fibroblasts pretreated with DDS and DPI and treated with PQ partially restored their original shape (Fig. 30, third and fourth).
- DDS is consistently used as a powerful remedy for many skin diseases.
- DDS is also recommended by WHO to be used as a treatment for leprosy. These DDS have been commonly used since the 1940s and have been used by leprosy patients for more than 30-40 years [25, 26].
- Very few or clinically insignificant adverse events have been reported with long-term DDS standard doses (100 mg / day) in general patients [4].
- Long-term DDS doses are distributed throughout all organs at concentrations similar to plasma concentrations [27].
- a typical leprosy patient has a plasma concentration of 1-20 ⁇ M when taking 100 mg / day of DDS for 6 to 28 days.
- the DDS concentration at 50% inhibition (IC50) of human fibroblasts is about 745 uM (data not shown).
- Cytotoxicity through ROS generation of PQ has been studied mainly in phagocytes [28].
- human fibroblasts which are not phagocytic cells, also show PQ-induced cytotoxicity, and DDS inhibited such cytotoxicity (FIG. 23).
- the present inventors have demonstrated that DDS has an effect of inhibiting PQ-induced cytosolic and extraoxide anion production of mitochondria (Fig. 24).
- Antioxidants are substances that remove produced ROS, inhibit new production, and restore oxidative damage [29].
- Superoxide anions which are not removed, can be converted into more active hydroxyl radicals, which can directly induce damage to DNA, proteins and lipids.
- Some antioxidants show antioxidant properties through the removal of excess oxide anion radicals [30, 31], but substances that strongly inhibit the production of superoxide anions can also be used as antioxidants.
- DDS of antioxidant function is not directly related to the radical elimination system (elimination of direct radicals or indirectly of radical elimination enzymes). Therefore, the present inventors focused on antioxidant functions that inhibit the generation of radicals rather than the elimination of radicals produced by DDS.
- NOX NADPH oxidase
- NOX4 a major form of dermal fibroblasts, produces a significant amount of ROS and is increased by stimulation of TGF ⁇ [35, 36].
- DDS is involved in the regulation of calcium [21].
- PQ increases intracellular calcium and increased calcium is inhibited by DDS
- Increased calcium increases the activity of calcium-dependent PKC, which is required for the activation of NOX.
- PKC calcium-dependent PKC
- the increase of the anion of superoxide by PQ is related to PKC [7, 8]. Therefore, the present inventors have examined whether DDS can regulate the activity of PKC. In the results of the present inventors, DDS inhibited PQ-induced PKC beta phosphorylation in human fibroblasts (Fig. 27B).
- DDS suggests that PQ-treated human fibroblasts restore the amount of intracellular calcium and inhibit the production of superoxide anions by reducing the active NOx mediated by PKC .
- DDS restores the abnormal properties of mitochondria induced by PQ in human fibroblasts. Unexpectedly, it has been reported that DPI inhibits NOX and at the same time has the function of inhibiting mitochondrial oxidase [34]. The results of the present inventors also inhibit mitochondrial toxicity induced by PQ. Thus, DDS may prove to be an effective inhibitor of PQ toxicity in human fibroblasts.
- DDS inhibits PQ-induced oxidative stress and mitochondrial toxicity in human fibroblasts. These results were obtained through inhibition of NOX4 and inhibition of mitochondrial changes by controlling the activity of calcium and PKC in DDS.
- DDS can be a new drug that can mitigate or minimize oxidative stress by inhibiting the generation of new radicals, not elimination of the resulting radicals.
- the present inventors expect that the leprosy patients who have used DDS for a long time will be able to guarantee the safety of the drug and provide evidence that DDS contributes to the disease for a long time without being affected by the disease.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Animal Behavior & Ethology (AREA)
- General Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Communicable Diseases (AREA)
- Oncology (AREA)
- Engineering & Computer Science (AREA)
- Biochemistry (AREA)
- Dermatology (AREA)
- Toxicology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Steroid Compounds (AREA)
- Cosmetics (AREA)
Abstract
Description
Claims (12)
- 뎁손(dapsone)를 유효성분으로 함유하는 노화조절용 또는 수명연장용 조성물.
- 제 1 항에 있어서, 상기 조성물은 미토콘드리아의 낮은 에너지 수준을 유지하는 것을 특징으로 하는 조성물.
- 제 1 항에 있어서, 상기 조성물은 Duox의 수준을 감소시키는 것을 특징으로 하는 조성물.
- 제 1 항의 조성물을 원료로 하는 노화 완화용 식품 또는 음료.
- 제 1 항의 조성물을 원료로 하는 피부 세포의 노화 완화용 화장료 조성물.
- 제 1 항의 조성물을 원료로 하는 개체의 노화 완화 또는 노화 세포의 생물학적 기능회복용 약학적 조성물.
- 제 1 항의 조성물을 세포에 처리하는 단계를 포함하는 세포의 노화조절방법.
- 제 1 항의 조성물을 세포 노화에 기인하는 증상 또는 질환을 완화 또는 예방하기 위해서 대상에 적용시키는 방법.
- 뎁손의 유효량을 개체에 적용하는 단계를 포함하는 개체의 수명연장 방법.
- 제 9항에 있어서, 상기 개체는 동물인 것을 특징으로 하는 방법.
- 제 9항에 있어서, 상기 동물은 인간인 것을 특징으로 하는 방법.
- 제 9항에 있어서, 상기 동물은 예쁜꼬마선충인 것을 특징으로 하는 방법.
Priority Applications (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
US12/737,553 US20110152379A1 (en) | 2008-07-25 | 2009-07-24 | Composition for control of aging and/or extension of life, containing dapsone as active ingredient |
EP09800592A EP2364698A2 (en) | 2008-07-25 | 2009-07-24 | Composition for control of aging and / or extension of life, containing dapsone as active ingredient |
Applications Claiming Priority (2)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
KR20080072762 | 2008-07-25 | ||
KR10-2008-0072762 | 2008-07-25 |
Publications (3)
Publication Number | Publication Date |
---|---|
WO2010011111A2 WO2010011111A2 (ko) | 2010-01-28 |
WO2010011111A3 WO2010011111A3 (ko) | 2010-03-25 |
WO2010011111A4 true WO2010011111A4 (ko) | 2010-05-14 |
Family
ID=41570754
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
PCT/KR2009/004148 WO2010011111A2 (ko) | 2008-07-25 | 2009-07-24 | 뎁손을 유효성분으로 함유하는 노화조절용 및/또는 수명연장용 조성물 |
Country Status (4)
Country | Link |
---|---|
US (1) | US20110152379A1 (ko) |
EP (1) | EP2364698A2 (ko) |
KR (1) | KR20110049808A (ko) |
WO (1) | WO2010011111A2 (ko) |
Families Citing this family (6)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
EP2538931B1 (en) * | 2010-02-26 | 2016-08-03 | University Of Durham | Products and methods |
KR20130063962A (ko) * | 2011-12-07 | 2013-06-17 | 가천대학교 산학협력단 | 디아미노디페닐술폰을 포함하는 골량 저하 질환의 예방 또는 치료용 약학적 조성물 |
KR101875705B1 (ko) * | 2011-12-07 | 2018-07-06 | 삼성전자주식회사 | 디아미노디페닐술폰을 포함하는 근육 소모 관련 질환의 예방 또는 치료용 약학적 조성물 |
AU2015270090A1 (en) | 2014-06-06 | 2016-12-22 | Glaxosmithkline Intellectual Property (No.2) Limited | Nicotinamide riboside analogs and pharmaceutical compositions and uses thereof |
KR102276424B1 (ko) | 2014-10-06 | 2021-07-12 | 삼성전자주식회사 | 로-키나제 저해제를 포함하는 세포의 노화를 감소시키기 위한 조성물 및 그의 용도 |
CN112043828A (zh) * | 2020-09-23 | 2020-12-08 | 南京大学 | 卟啉porphyrin类物质在光照下延长线虫寿命中的应用 |
Family Cites Families (5)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6071543A (en) * | 1997-06-02 | 2000-06-06 | Cellegy Pharmaceuticals, Inc. | Pyridine-thiols reverse mucocutaneous aging |
US20040086469A1 (en) * | 2002-10-30 | 2004-05-06 | Osborne David W. | Protectant for UV-induced skin damage |
US20070244195A1 (en) * | 2004-05-18 | 2007-10-18 | Burkhart Craig N | Treatment methods with peroxides and tertiary amines |
US20110294896A1 (en) * | 2007-11-07 | 2011-12-01 | Garret John S | Topical Treatment With Dapsone In G6PD-Deficient Patients |
US8586010B2 (en) * | 2008-02-27 | 2013-11-19 | Allergan, Inc. | Dapsone to treat rosascea |
-
2009
- 2009-07-24 US US12/737,553 patent/US20110152379A1/en not_active Abandoned
- 2009-07-24 EP EP09800592A patent/EP2364698A2/en not_active Withdrawn
- 2009-07-24 KR KR1020117003866A patent/KR20110049808A/ko not_active Application Discontinuation
- 2009-07-24 WO PCT/KR2009/004148 patent/WO2010011111A2/ko active Application Filing
Also Published As
Publication number | Publication date |
---|---|
US20110152379A1 (en) | 2011-06-23 |
KR20110049808A (ko) | 2011-05-12 |
WO2010011111A2 (ko) | 2010-01-28 |
WO2010011111A3 (ko) | 2010-03-25 |
EP2364698A4 (en) | 2011-09-14 |
EP2364698A2 (en) | 2011-09-14 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
WO2010011111A4 (ko) | 뎁손을 유효성분으로 함유하는 노화조절용 및/또는 수명연장용 조성물 | |
Santos et al. | Effect of naturally occurring flavonoids on lipid peroxidation and membrane permeability transition in mitochondria | |
Thirunavukkarasu et al. | Protective effect of fenugreek (Trigonella foenum graecum) seeds in experimental ethanol toxicity | |
WO2017030410A1 (ko) | 검정콩잎 추출물 및 이로부터 분리한 플라보놀배당체를 유효성분으로 함유하는 대사증후군의 예방 또는 치료용, 또는 항산화용 조성물 | |
WO2014088326A1 (ko) | 포스포디에스테라제 타입 5 저해제를 포함하는 신경세포의 아폽토시스 억제용 조성물 | |
WO2019182370A1 (ko) | Cox2 아세틸화제를 유효성분으로 포함하는 퇴행성 신경질환의 예방 또는 치료용 약학적 조성물 | |
Martín‐Romero et al. | Inhibition of oxidative stress produced by plasma membrane NADH oxidase delays low‐potassium‐induced apoptosis of cerebellar granule cells | |
WO2020171364A1 (ko) | 님트리 잎 추출물을 포함하는 화장료 조성물 | |
WO2011136573A2 (ko) | 비만 치료 및 항산화 활성을 갖는 효모 가수분해물 | |
WO2015037778A1 (ko) | 리그난 화합물을 유효 성분으로 포함하는 암의 예방 또는 치료용 조성물 | |
WO2011093559A1 (ko) | 우루소데옥시콜린산을 유효 성분으로 함유하는 위암의 예방 또는 치료용 조성물 | |
WO2015111832A1 (ko) | 지실 추출물을 포함하는 전립선 관련 질환의 예방 또는 치료용 조성물 | |
WO2014003232A1 (ko) | 황칠나무 추출물을 유효성분으로 포함하는 발모 촉진용 조성물 | |
WO2020122391A1 (ko) | 호모해링토닌을 유효성분으로 함유하는 세포노화 관련 질환 예방 또는 치료용 조성물 | |
Gupta et al. | Protective nature of Murraya Koenigii leaves against hepatosupression through antioxidant status in experimental rats | |
WO2014182078A1 (ko) | 장 면역활성 조절용 조성물 및 이의 용도 | |
WO2019045467A9 (ko) | 항산화 및 항고혈압 효과를 가지는 광어 연육 및 이의 제조방법 | |
WO2014157965A1 (ko) | P34의 발현 억제제 또는 활성 억제제를 유효성분으로 포함하는 암의 치료 또는 전이 억제용 조성물 | |
WO2020122392A1 (ko) | 조타로리무스를 유효성분으로 함유하는 세포노화 관련 질환 예방 또는 치료용 조성물 | |
WO2021167262A1 (ko) | 뉴클레오사이드 가수분해효소 억제제, 이를 포함하는 병원성 미생물의 독성 억제용 조성물, 이를 포함하는 병원성 미생물의 독성 억제 방법 및 뉴클레오사이드 가수분해효소 억제제의 스크리닝 방법 | |
WO2016032127A2 (ko) | Tlr4에 lps와의 경쟁적 결합을 통한 항산화 및 항염증 활성을 갖는 신규 화합물 및 이의 의학적 용도 | |
WO2022225259A1 (ko) | 세포 노화 및 세포사멸을 유도하는 항암 조성물 | |
WO2019083286A2 (ko) | 아이론을 유효성분으로 포함 하는 탈모 방지 또는 발모 촉진용 조성물 | |
WO2018038539A2 (ko) | Eprs 단백질 또는 이의 단편을 포함하는 항rna-바이러스용 조성물 | |
WO2024117701A1 (en) | Food and drug composition containing novel aldehyde dehydrogenase for suppressing tremor or movement disorder |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09800592 Country of ref document: EP Kind code of ref document: A2 |
|
NENP | Non-entry into the national phase |
Ref country code: DE |
|
ENP | Entry into the national phase |
Ref document number: 20117003866 Country of ref document: KR Kind code of ref document: A |
|
WWE | Wipo information: entry into national phase |
Ref document number: 2009800592 Country of ref document: EP |
|
WWE | Wipo information: entry into national phase |
Ref document number: 12737553 Country of ref document: US |