WO2009155373A1 - Séquence nucléotide et protéinique de cochons d'inde il-6 et procédés d'utilisation - Google Patents

Séquence nucléotide et protéinique de cochons d'inde il-6 et procédés d'utilisation Download PDF

Info

Publication number
WO2009155373A1
WO2009155373A1 PCT/US2009/047705 US2009047705W WO2009155373A1 WO 2009155373 A1 WO2009155373 A1 WO 2009155373A1 US 2009047705 W US2009047705 W US 2009047705W WO 2009155373 A1 WO2009155373 A1 WO 2009155373A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
polypeptide
antibody
antibodies
guinea pig
Prior art date
Application number
PCT/US2009/047705
Other languages
English (en)
Inventor
Linda Chen
Mary Brodey
Neil Stollar
Hans Beernink
Kevin Reagan
Original Assignee
Life Technologies Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Life Technologies Corporation filed Critical Life Technologies Corporation
Publication of WO2009155373A1 publication Critical patent/WO2009155373A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/52—Cytokines; Lymphokines; Interferons
    • C07K14/54—Interleukins [IL]
    • C07K14/5412—IL-6

Definitions

  • the present invention relates to guinea pig IL-6 nucleic acid and polypeptide sequences, as well as reagents and assays for detecting and/or measuring IL-6 expression, including antibodies specific for guinea pig IL-6.
  • the invention also relates to detection panels and methods useful for detection, diagnosis and/or monitoring of a disease, disorder or condition involving IL-6 such as chronic obstructive pulmonary disease (COPD).
  • COPD chronic obstructive pulmonary disease
  • COPD chronic obstructive pulmonary disease
  • the obstruction generally is permanent and progressive over time.
  • COPD encompasses chronic bronchitis, emphysema and a range of other lung disorders. It is typically caused by smoking, inhalation of airborne pollutants (such as cadmium and silica), as well as some congenital conditions (such as a genetic deficiency of alpha-1 antitrypsin).
  • airborne pollutants such as cadmium and silica
  • congenital conditions such as a genetic deficiency of alpha-1 antitrypsin
  • the symptoms of COPD include shortness of breath (dyspnea), wheezing, a persistent cough, and sputum production.
  • the production of sputum can cause further obstruction of the airways and may contain blood due to damaged blood vessels of the airways (hemoptysis).
  • Severe COPD could lead to cyanosis (bluish decolorization usually in the lips and fingers) caused by a lack of oxygen in the blood, pulmonary hypertension, and cor pulmonale (also known as right heart failure) due to the extra work required by the heart to get blood to flow through the lungs.
  • the present invention is directed to guinea pig IL-6 polypeptide sequences, polynucleotide sequences encoding guinea pig IL-6, as well as reagents and assays for detecting and/or measuring IL-6 expression, including antibodies specific for guinea pig IL-6.
  • Such polypeptides, polynucleotides, reagents and assays of the present invention are of use in detection, diagnosis and/or monitoring of a conditions involving IL-6, such as chronic obstructive pulmonary disease (COPD) or other inflammatory conditions or diseases.
  • COPD chronic obstructive pulmonary disease
  • the amino acid sequence for guinea pig IL-6 polypeptide is provided herein as SEQ ID NO:2.
  • the invention is directed to an isolated polypeptide comprising an amino acid sequence having at least 75% homology with SEQ ID NO:2. In another embodiment, the invention is directed to an isolated polypeptide comprising at least 50 contiguous amino acids of SEQ ID NO:2. In another embodiment, the invention is directed to an isolated polypeptide comprising the amino acid sequence of SEQ ID NO:2.
  • the invention is directed to a nucleic acid molecule comprising a polynucleotide sequence encoding an amino acid sequence having at least 75% homology with SEQ ID NO:2. In another embodiment, the invention is directed to nucleic acid molecule comprising a polynucleotide sequence encoding a polypeptide containing at least 50 contiguous amino acids of SEQ ID NO:2. In another embodiment, the invention is directed to a nucleic acid molecule which includes a polynucleotide sequence encoding a polypeptide comprising the amino acid sequence of SEQ ID NO:2. In another embodiment, the invention is directed to vectors comprising such nucleic acid molecules.
  • the invention is directed to an antibody able to selectively bind the polypeptide, or a fragment comprising an epitope thereof, of the invention. In one embodiment, the invention is directed to an antibody able to selectively bind the polypeptide, or a fragment comprising an epitope thereof, comprising an amino acid sequence having at least 75% homology with SEQ ID NO:2.
  • the invention is directed to a biomarker detection panel comprising one or more antibodies able to selectively bind a polypeptide of the invention, or fragment comprising an epitope thereof.
  • the one or more antibodies are immobilized on a solid support.
  • the biomarker detection panel further comprises at least a second antibody, wherein said second antibody is able to selectively bind at least one polypeptide, or fragment comprising an epitope thereof, selected from the group consisting of IL- 1 beta, RANTES, MlP-alpha, MCP-1 , IL-8 or TNF-alpha.
  • the invention is directed to methods of detecting the presence of one or more target antigens in a test sample of an individual suspected of having COPD.
  • Such methods include contacting the test sample with one or more antibodies able to selectively bind a polypeptide of the invention, or fragment comprising an epitope thereof, and detecting binding of the antibody(ies) to the target antigen(s), thereby detecting the presence of target antigen(s) in the sample.
  • the method further includes correlating the binding of the antibody(ies) to the target antigen(s) with a diagnosis of COPD.
  • FIG. 1 shows gel separation of PCR results from reactions using RNA and mRNA from guinea pig liver and spleen and gp IL-6 primers.
  • FIG. 2 shows gel separation of PCR results from reactions using RNA and mRNA from guinea pig liver and spleen and gp IL-6 nested primers.
  • FIG. 3 shows gel separation of the purified PCR fragments.
  • FIG. 4 depicts an amino acid sequence alignment of IL-6 family members.
  • FIG. 5 shows the purification and identification of His-tagged gp IL-6 fusion protein on SDS-PAGE gels.
  • FIG. 6 shows thrombin digestion of the His-tagged gp IL-6 fusion protein separated on a gel.
  • FIG. 7 shows thrombin digestion of His-tagged gp IL-6 fusion protein with increasing concentrations of thrombin.
  • FIG. 8 shows western blot analysis of His-tagged gp IL-6 fusion protein digested with increasing concentrations of thrombin.
  • FIG. 9 shows gel separation of fractions from reverse phase column purification of gp
  • FIG. 10 is a graph depicting results of a cell proliferation bioassay with gp IL-6 ( ⁇ ) and mouse IL-6 (O).
  • the guinea pig (Cavia porcellus) is an animal research model for a variety of inflammatory diseases and disorders such as chronic obstructive pulmonary disease (COPD), ulcerative colitis, inflammatory bowel disease, cholelithiasis (gallstones), asthma and allergy.
  • COPD chronic obstructive pulmonary disease
  • IL-6 protein is a key inflammatory biomarker and the expression profiles of the inflammatory mediators in the lung, for example, are poorly understood.
  • IL-6 detection reagents has been hampered.
  • the present invention provides the amino acid sequence for guinea pig IL-6, a biologically active recombinant guinea pig IL-6 protein, as well as the DNA sequence encoding the IL-6 protein.
  • the present invention also provides reagents and assays for detecting and/or measuring IL-6 expression, including antibodies specific for guinea pig IL-6, as well as detection panels and methods useful for detection, diagnosis and/or monitoring of a condition involving IL-6, such as COPD or other inflammatory conditions or diseases.
  • biomarker is meant a biochemical characteristic that can be used to diagnose, or to measure the progress of a disease or condition, or the effects of treatment of a disease or condition.
  • a biomarker can be, for example, the presence of a nucleic acid, protein, or antibody associated with the presence of a disease in an individual.
  • the present invention provides biomarkers for COPD that may be present in the sera or tissue of subjects diagnosed with COPD. Established biomarkers vary widely in the frequency with which they are observed. Importantly, biomarkers need not be expressed in a majority of disease individuals to have clinical value.
  • the receptor tyrosine kinase Her2 is known to be over- expressed in approximately 25% of all breast cancers (Ross et al. (2004) MoI. Cell
  • Proteomics 3:379-98 is a clinically important indicator of disease progression as well as specific therapeutic options.
  • Antibody refers to a polypeptide ligand substantially encoded by an immunoglobulin gene or immunoglobulin genes, or fragments thereof, which specifically recognizes and binds a molecule or a region or domain of a molecule (an epitope).
  • the recognized immunoglobulin genes include the kappa and lambda light chain constant region genes, the alpha, gamma, delta, epsilon and mu heavy chain constant region genes, and the myriad immunoglobulin variable region genes.
  • Antibodies exist, e.g., as intact immunoglobulins or as a number of well characterized fragments produced by digestion with various peptidases. This includes, e.g., Fab' and F(ab)' 2 fragments.
  • antibody also includes antibody fragments either produced by the modification of whole antibodies or those synthesized de novo using recombinant DNA methodologies. It also includes polyclonal antibodies, monoclonal antibodies, chimeric antibodies, humanized antibodies, or single chain antibodies. "Fc" portion of an antibody refers to that portion of an immunoglobulin heavy chain that comprises one or more heavy chain constant region domains, CH1 , CH2 and CH3, but does not include the heavy chain variable region.
  • an “antibody to an antigen” or an “antibody that recognizes an antigen” is an antibody that specifically binds the antigen.
  • Immunoassay is an assay in which an antibody specifically binds an antigen.
  • An immunoassay is characterized by the use of specific binding properties of a particular antibody to isolate, capture, target, and/or quantify the antigen.
  • the phrase “specifically (or selectively) binds” to an antibody or “specifically (or selectively) immunoreactive with,” when referring to a protein or peptide, refers to a binding reaction that is determinative of the presence of the protein in a heterogeneous population of proteins and other biologies.
  • the specified antibodies bind to a particular protein at a level that is statistically significantly different from background, and do not substantially bind in a significant amount to other proteins present in the sample.
  • an antibody is selected for its specificity for a particular protein, and also, in some embodiments, for its ability to specifically bind an antigen that is complexed with an autoantibody.
  • a variety of immunoassay formats may be used to select antibodies specifically immunoreactive with a particular protein.
  • solid-phase ELISA immunoassays are routinely used to select antibodies specifically immunoreactive with a protein (see, e.g., Harlow & Lane, Antibodies, A Laboratory Manual (1988), for a description of immunoassay formats and conditions that can be used to determine specific immunoreactivity).
  • a specific or selective reaction will be at least twice background signal or noise and more typically more than five times the background signal, and can be, for example, 10 to 100 times background.
  • Immunoreactivity means the presence or level of binding of an antibody or antibodies in a sample to one or more target antigens.
  • a “pattern of immune reactivity” refers to the profile of binding of antibodies in a sample to a plurality of target antigens and/or target antibodies. The profile includes the subset of target antigens and/or target antibodies to which the sample specifically binds, and/or the relative or absolute level(s) of binding to members of the subset of target antigens and/or target antibodies to which binding is detected.
  • An “epitope” is a site on an antigen, such as an autoantigen disclosed herein, recognized by an antibody.
  • target antigen refers to a protein, or to a portion, fragment, variant, isoform, processing product thereof having immunoreactivity of the protein, that is used to determine the presence, absence, or amount of an antibody in a sample from a subject.
  • a "test antigen” is a protein evaluated for use as a target antigen. A test antigen is therefore a candidate target antigen, or a protein used to determine whether a portion of a test population has antibodies reactive against it.
  • target antigen is meant to include the complete wild type mature protein, or can also denote a precursor, processed form (including, a proteolytically processed or otherwise cleaved form) unprocessed form, post-translationally modified, or chemically modified form of the protein indicated, in which the target antigen, test antigen, or antigen retains or possesses the specific binding characteristics of the referenced protein to one or more autoantibodies of a test sample.
  • the protein can have, for example, one or more modifications not typically found in the protein produced by normal cells, including aberrant processing, cleavage or degradation, oxidation of amino acid residues, atypical glycosylation pattern, etc.
  • target antigen also include splice isoforms or allelic variants of the referenced proteins, or can be sequence variants of the referenced protein, with the proviso that the "target antigen”, “test antigen”, “autoantigen”, or “antigen” retains or possesses the immunological reactivity of the referenced protein to one or more autoantibodies of a test sample.
  • target antigen specifically encompasses fragments of a referenced protein (“antigenic fragments") that have the antibody binding specificity of the reference protein. The fragment can be provided as part of or attached to a larger molecule or compound.
  • a target antigen in any of the aspects or embodiments of the invention can be an entire protein or polypeptide, or an unprocessed form, processed form, or post-translationally modified form of the protein, or a form of the protein that is not post-translationally modified, or a form of the protein that is partially, atypically, or abnormally post-translationally modified.
  • a target antigen used in the methods or compositions provided herein can be an isoform of the designated polypeptide (e.g., a splice variant), or an allelic variant, or a target antigen can be an epitope-containing fragment of the polypeptide named as a target antigen.
  • target antigen is a molecule that comprises an epitope-containing fragment of the polypeptide named as a target antigen (or a sequence variant thereof), such that the molecule is specifically recognized by an antibody that recognizes the target antigen epitope.
  • a molecule that comprises an epitope-containing fragment can be any type of molecule, and can be a polymer, including a synthetic polymer, or a biomolecule such as a polypeptide, nucleic acid, peptide nucleic acid, etc.
  • a fragment of a protein or polypeptide that includes an epitope recognized by an antibody can be at least 3, 4, 5, 6, 7, 8, 9, 10, 1 1 , 12, 13, 14, 15, 20, 25, 30, 35, 40, 45, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 750, or 1000 amino acids in length, where the amino acids in the fragment correspond to consecutive amino acids in the full length protein sequence.
  • the fragment is at least 15 amino acids in length.
  • a fragment that includes an epitope recognized by an antibody can be greater than 1000 amino acids in length.
  • the fragment can also be between 5, 10, 15, 20, 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 600, 700, 800, 900, 1000, or 2000 amino acids and one amino acid less than the entire length of an autoantigen.
  • epitopes are characterized in advance such that it is known that autoantibodies for a given antigen recognize the epitope.
  • Methods for epitope mapping are well known in the art.
  • one or more diagnostic (or prognostic) biomarkers are correlated to a condition or disease by the presence or absence of the biomarker(s).
  • threshold level(s) of a diagnostic or prognostic biomarker(s) can be established, and the level of the biomarker(s) in a sample can be compared to the threshold level(s).
  • Levels can be relative or absolute, and are preferably normalized with respect to one or more controls.
  • Detection can be by an immunological assay, such as radioimmune assay or ELISA performed in any of a wide variety of formats, or by detecting binding on a solid support or semi-solid support using labeled reagents, which can be signal-generating reagents.
  • Detection of binding of a biomarker to a solid support can be detection on or in a gel, matrix, filter, strip, sheet, strip, membrane, slide, plate (for example, a multiwell plane), well, dish, bead, particle, filament, rod, fiber, chip, or array.
  • binding of target antigens present in the sample to antibodies or antibody capture molecules on a protein array is detected.
  • the protein array can have proteins other than antibodies or antibody capture molecules bound to the array, such as, but not limited to, negative or positive control proteins, proteins used for normalization of signal intensity, and proteins (including but not limited to antibodies) whose reactivity or binding status to a test sample is unknown.
  • protein refers to a full-length protein, a portion of a protein, or a peptide.
  • the term protein includes antibodies. Proteins can be produced via fragmentation of larger proteins, or chemically synthesized. Proteins may, for example, be prepared by recombinant overexpression in a species such as, but not limited to, bacteria, yeast, insect cells, and mammalian cells. Proteins to be placed in a protein microarray of the invention, may be, for example, are fusion proteins, for example with at least one affinity tag to aid in purification and/or immobilization. In certain aspects of the invention, at least 2 tags are present on the protein, one of which can be used to aid in purification and the other can be used to aid in immobilization.
  • the tag is a His tag, a FLAG tag, a GST tag, or a biotin tag. These examples are non-limiting.
  • the tag can be associated with a protein in vitro or in vivo using commercially available reagents (Invitrogen Corporation, Carlsbad, CA). In aspects where the tag is associated with the protein in vitro, a BioEaseTM tag can be used (Invitrogen Corporation).
  • peptide As used herein, the terms “peptide,” “oligopeptide,” and “polypeptide” are used interchangeably with protein herein and refer to a sequence of contiguous amino acids linked by peptide bonds.
  • protein refers to a polypeptide that can also include post-translational modifications that include the modification of amino acids of the protein and may include the addition of chemical groups or biomolecules that are not amino acid-based. The terms apply to amino acid polymers in which one or more amino acid residue is an analog or mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers.
  • Polypeptides can be modified, e.g., by the addition of carbohydrate residues to form glycoproteins.
  • polypeptide include glycoproteins, as well as non-glycoproteins.
  • a variant of a polypeptide retains the antibody-binding property of the referenced protein.
  • a variant of a polypeptide has at least 60% identity to the referenced protein over a sequence of at least 10 amino acids. More preferably a variant of a polypeptide is at least 70% identical to the referenced protein over a sequence of at least 4 amino acids.
  • Protein variants can be, for example, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to referenced polypeptide over a sequence of at least 4 amino acids. Protein variants of the invention can be, for example, at least 80%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99% identical to referenced polypeptide over a sequence of at least 10 amino acids.
  • the variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g., replacement of leucine with isoleucine).
  • a variant may also have "nonconservative" changes (e.g., replacement of glycine with tryptophan).
  • Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing immunological reactivity may be found using computer programs well known in the art, for example, DNASTAR software.
  • biomarker detection panel or “biomarker panel” refers to a collection of biomarkers that are provided together for detection, diagnosis, prognosis, staging, or monitoring of a disease or condition, based on detection values for the set (panel) of biomarkers.
  • the set of biomarkers is physically associated, such as by being packaged together, or by being reversibly or irreversibly bound to a solid support.
  • the biomarker detection panel can be provided, in separate tubes that are sold and/or shipped together, for example as part of a kit, or can be provided on a chip, membrane, strip, filter, or beads, particles, filaments, fibers, or other supports, in or on a gel or matrix, or bound to the wells of a multiwell plate.
  • a biomarker detection panel can in addition or in the alternative be associated by a list, table, or program provided to a user or potential user that provides an internet address that provides computer-based linkage of the biomarker identities and information stored on a web site.
  • a computer-based program can provide links between biomarker identities, information, and/or purchasing functions for a collection of biomarkers that make up a biomarker detection panel, based on the user's entered selections.
  • a "sample” as used herein can be any type of sample, such as a sample of cells or tissue, or a sample of bodily fluid.
  • the sample can be a tissue sample, such as a swab or smear, or a pathology or biopsy sample of tissue. Samples can also be tissue extracts, for example from tissue biopsy or autopsy material.
  • a sample can be a sample of bodily fluids, such as but not limited to blood, plasma, serum, cerebrospinal-fluid, sputum, semen, urine, lung aspirates, nipple aspirates, tears, or a lavage. Samples can also include, for example, cells or tissue extracts such as homogenates or solubilized tissue obtained from a patient.
  • blood is meant to include whole blood, plasma, serum, or any derivative of blood.
  • a blood sample may be, for example, serum.
  • array refers to an arrangement of entities in a pattern on a substrate. Although the pattern is typically a two-dimensional pattern, the pattern may also be a three-dimensional pattern.
  • the individual entities are localized to particular positions, or loci on the array, sometimes referred to as "spots".
  • the entities are proteins.
  • the array can be a microarray or a nanoarray.
  • a “nanoarray” is an array in which separate entities are separated by 0.1 nm to 10 ⁇ m, for example from 1 nm to 1 ⁇ m.
  • a “microarray” is an array in the density of entities on the array is at least 100 distinct loci /cm 2 .
  • a high density array has at least 400 distinct loci per cm 2 .
  • a high density protein array has at least 400 distinct protein spots per cm 2 .
  • a high density array has at least 1 ,000 distinct loci per cm 2 .
  • a high density protein array has at least 1 ,000 distinct protein spots per cm 2 .
  • On microarrays separate entities can be separated, for example, by more than 1 ⁇ m.
  • protein array refers to a protein array, a protein microarray or a protein nanoarray.
  • a protein array may include, for example, but is not limited to, a "ProtoArrayTM,” human protein high density array (Invitrogen Corporation, available on the Internet at lnvitrogen.com).
  • the ProtoArrayTM high density protein array can be used to screen complex biological mixtures, such as serum, to assay for the presence of autoantibodies directed against human proteins.
  • protein chip is used in the present application synonymously with protein array or microarray.
  • diagnosis refers to methods by which the skilled artisan can estimate and/or determine whether or not a patient is suffering from a given disease or condition.
  • the skilled artisan often makes a diagnosis on the basis of one or more diagnostic indicators, i.e., a marker, the presence, absence, or amount of which is indicative of the presence, severity, or absence of the condition, physical features (lumps or hard areas in or on tissue), or histological or biochemical analysis of biopsied or sampled tissue or cells, or a combination of these.
  • the amino acid sequence of guinea pig IL-6 (gp IL-6) is provided herein along with a DNA sequence encoding the IL-6 protein.
  • the DNA sequence encoding for guinea pig IL-6 protein is as follows (SEQ ID NO:1 ):
  • AACTGAAAAATGAGATGAACAAACATAATGTTGAAAAGGCAATTTTAAAC AATCTGGACCTCCCAAAGTTGAAGCTAGAAGATGGATGCTTCTTCAATG GATACAACTGGGAAACATGCCAGTTGAAAATCACCCCTGGTCTTTTCAAG TTCCAGACCTACCTGCAGTCCATGCAGAACAAGCTTCAGAATGAGTCTG AAAACAAAAAAGCTGCAAACATATACGCTGGTATCAAAAGCTTGAGTCTG
  • amino acid sequence of guinea pig IL-6 protein is as follows (SEQ ID NO:2):
  • the present invention provides an isolated polypeptide comprising an amino acid sequence having at least 75% homology with SEQ ID NO:2.
  • the amino acid sequence has at least 85% homology, more preferably at least 90%, and even more preferably at least 95% homology with SEQ ID NO:2.
  • Another embodiment provides an isolated polypeptide comprising at least 30 contiguous amino acids of SEQ ID NO:2. More preferably, the polypeptide comprises at least 50 contiguous amino, more preferably the polypeptide comprises at least 100 contiguous amino, more preferably at least 150 contiguous amino acids of SEQ ID NO:2.
  • polypeptides of the invention have at least one biological activity of IL- 6.
  • a nucleic acid sequence encoding the gp IL-6 protein (SEQ ID NO:1 ) is provided herein, however, as is understood in the art, additional nucleic acid sequences can encode the same polypeptides and amino acid sequences due to redundancy of the genetic code. It is understood that the present invention encompasses these nucleic acids able to encode the amino acid sequences provided herein. It is also understood that the present invention encompasses nucleic acids encoding amino acid sequences having variations or slight deviations from SEQ ID N0:2 as would be within the skill of one ordinarily skilled in the art. Another embodiment of the present invention comprises vectors comprising one or more of the nucleic acids disclosed herein.
  • guinea pig IL-6 has amino acid sequence homology of less than 40% from any published IL-6 sequences for human, mouse, rat and other species. This observation may explain the reason why there has been no published guinea pig IL-6 sequence to date.
  • Existing monoclonal antibodies to other species gave no reactivity with the gp IL-6 and polyclonal antibodies gave only weak reactivity.
  • the present invention also provides monoclonal and polyclonal antibodies able to selectively bind gp IL-6 protein or IL-6 protein fragments comprising an epitope.
  • the sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90% or 95% of the length of the reference sequence.
  • the amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • amino acid or nucleic acid “identity” is equivalent to amino acid or nucleic acid "homology”).
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two amino acid sequences is determined using the Needleman and Wunsch (J. MoI. Biol. (48):444-453 (1970)) algorithm which has been incorporated into the GAP program in the GCG software package (available online through Accelrys Inc. website (formerly Genetics Computer Group), San Diego, CA), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available online through Accelrys Inc. website (formerly Genetics Computer Group), San Diego, CA), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1 , 2, 3, 4, 5, or 6.
  • the percent identity between two amino acid or nucleotide sequences is determined using the algorithm of Meyers and Miller (Comput. Appl. Biosci. 4:1 1 -17 (1988)) which has been incorporated into the ALIGN program (version 2.0), using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • Nucleic acid and protein sequences can further be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences. Such searches can be performed using the NBLAST and XBLASAT programs (version 2.0) of Altschul et al. (1990) J. MoI. Biol. 215:403-10.
  • Gapped BLAST can be utilized as described in Altschul et al.
  • gp IL-6 nucleotide and polypeptide sequences and antibodies to gp IL-6 disclosed herein have resulted in development of molecular biology reagents, such as RT-PCR, biologically active recombinant gp IL-6 protein and guinea pig specific immunoassay products.
  • the present invention provides a biomarker detection panel comprising an anti-gp IL-6 antibody or a gp IL-6 polypeptide or target antigen for use in detection of gp IL-6 expression.
  • a biomarker detection panel comprising one or more antibodies able to selectively bind a polypeptide, or a fragment comprising an epitope thereof, where the polypeptide has at least 75% homology with SEQ ID NO:2.
  • the polypeptide has at least 80% homology with SEQ ID NO:2, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95% homology.
  • either the one or more antibodies or the polypeptide or polypeptide fragment are immobilized on a solid support, including, but not limited to glass or silica.
  • the detection panel is a protein array or an immunoassay.
  • various cytokines, chemokines and other mediators or markers have been correlated with the diagnosis or progression of various inflammatory diseases.
  • various cytokines, chemokines and other mediators or markers in addition to IL-6 have been correlated with the diagnosis or progression of COPD. See, for example, Kubo et al. (2005) Eur. Respir. J. 26:993-1001 ; Chen et al. (2008) Int. J.
  • COPD 3 359-370. Detection of the expression or expression levels of such markers in a biological sample from an individual can be used as a signature for COPD or for particular phases of COPD, such as acute phase, chronic phase and/or exacerbation.
  • the biomarker detection panel contains additional antibodies, polypeptides or polypeptide fragments believed to be related to, or correlated with, the detection, diagnosis and/or progression of COPD.
  • Biomarker detection panels including more than one such biomarker reagent may be referred to as a multiplex detection panel or a multiplex biomarker detection panel.
  • the detection panel may also include one or more polypeptides of (or antibodies to) mediators and/or markers of COPD including, but not limited to, IL-1 beta, RANTES, MlP-alpha, MCP-1 , IL-8, and TNF-alpha.
  • the biomarker detection panel comprises at least two polypeptides of (or antibodies to) mediators and/or markers of COPD. In certain embodiments, the detection panel comprises at least three, at least four, at least five, at least six, at least seven, or at least eight polypeptides of (or antibodies to) mediators and/or markers of COPD.
  • one of the mediators and/or markers of COPD of the multiplex detection panel is a gp IL-6 polypeptide or antibody thereto.
  • the multiplex detection panel contains gp IL-6 and one of guinea pig IL-1 beta, RANTES, MlP-alpha, MCP- 1 , IL-8, or TNF-alpha polypeptide or antibody thereto.
  • the multiplex detection panel contains gp IL-6 and two of guinea pig IL-1 beta, RANTES, MlP-alpha, MCP- 1 , IL-8, or TNF-alpha polypeptide or antibody thereto.
  • the multiplex detection panel contains gp IL-6 and three of guinea pig IL-1 beta, RANTES, MlP-alpha, MCP-1 , IL-8, or TNF-alpha polypeptide or antibody thereto. In another embodiment, the multiplex detection panel contains gp IL-6 and four of guinea pig IL-1 beta, RANTES, MIP- alpha, MCP-1 , IL-8, or TNF-alpha polypeptide or antibody thereto. In another embodiment, the multiplex detection panel contains gp IL-6 and five of guinea pig IL-1 beta, RANTES, MlP-alpha, MCP-1 , IL-8, or TNF-alpha polypeptide or antibody thereto.
  • the multiplex detection panel contains gp IL-6 and guinea pig IL-1 beta, RANTES, MlP-alpha, MCP-1 , IL-8 and TNF-alpha polypeptides or antibodies thereto.
  • the multiplex detection panel of the invention comprises at least an anti-gp IL-6 antibody and an anti-IL-8 antibody.
  • the multiplex detection panels provided herein comprise at least an anti-gp IL-6 antibody and an anti-IL-1 beta antibody.
  • the multiplex detection panels provided herein comprise at least an anti-gp IL-6 antibody and an anti-MCP-1 beta antibody.
  • the multiplex detection panels provided herein comprise at least an anti-gp IL- 6 antibody, an anti-IL-8 antibody and an anti-TNF-alpha antibody. In other embodiments, the multiplex detection panels provided herein comprise at least an anti-gp IL-6 antibody, an anti-IL-8 antibody, an anti-TNF-alpha antibody and an anti-IL-1 beta antibody. In other embodiments, the multiplex detection panels provided herein comprise at least an anti-gp IL- 6 antibody, an anti-IL-8 antibody, an anti-TNF-alpha antibody, an anti-IL-1 beta antibody and an anti-MCP-1 antibody.
  • Nucleic acid and amino acid sequences for guinea pig inflammation mediators and/or markers other than gp IL-6 are known in the art, as well as antibodies against such polypeptides.
  • sequences for guinea pig IL-1 -beta are found at GenBank Accession numbers AF1 19622 and AAD38502
  • sequences for guinea pig RANTES are found at GenBank Accession number U77037 and AAC53293
  • sequences for guinea pig MCP-1 are found at GenBank Accession numbers L04985 and AAA37047
  • sequences for guinea pig IL-8 are found at GenBank Accession numbers L04986 and AAA37049
  • sequences for guinea pig TNF-alpha are found at GenBank Accession numbers U77036 and AAB19210.
  • Guinea pig MIP-1 alpha (CCL-3 gene) can be detected with anti-human MIP-1 alpha and anti-mouse MIP-1 alpha monoclonal antibodies and
  • Another embodiment of the present invention provides a method of detecting the presence or expression level of one or more target antigens in a test sample of an individual suspected of having COPD.
  • COPD is associated with an increased level of IL-6 in a test sample compared to that in a control sample.
  • test samples include biological fluids or tissues, including but not limited to, sputum, exhaled breath condensate, bronchoalveolar lavage fluid (BALF), lung tissue biopsy, and sera.
  • the method comprises contacting the test sample from the individual with one or more antibodies able to selectively bind a polypeptide, or a fragment comprising an epitope thereof, having at least 75% homology with SEQ ID NO:2; and detecting the binding of the one or more antibodies to the one or more target antigens thereby detecting the presence of the one or more target antigens in the test sample.
  • the polypeptide has at least 80% homology with SEQ ID NO:2, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95% homology.
  • either the one or more antibodies or the target antigens are immobilized on a solid support, including, but not limited to glass or silica.
  • a further embodiment comprises correlating the binding of the one or more antibodies to the one or more target antigens with a diagnosis or progression of COPD.
  • the individual suspected of having COPD may be human or may be a test animal, such as a guinea pig, rat, mouse or other animal used to study COPD.
  • a method of the invention comprises detecting the presence or expression level of one or more target antigens associated with COPD in a test sample of an individual suspected of having COPD.
  • the methods may further comprise detecting one or target antigens associated with COPD, including, but not limited to, IL-1 beta, RANTES, MlP-alpha, MCP-1 , IL-8, and TNF-alpha.
  • methods provided herein comprise detecting the presence or expression level of at least IL-6 and IL-8 in a test sample of an individual suspected of having COPD.
  • methods provided herein comprise detecting the presence or expression level of at least IL-6 and IL-1 beta in a test sample of an individual suspected of having COPD. In certain embodiments, methods provided herein comprise detecting the presence or expression level of at least IL-6 and MCP-1 beta in a test sample of an individual suspected of having COPD. In other embodiments, methods provided herein comprise detecting the presence or expression level of at least IL-6, IL-8 and TNF- alpha in a test sample of an individual suspected of having COPD. In other embodiments, methods provided herein comprise detecting the presence or expression level of at least IL- 6, IL-8, TNF-alpha and IL-1 beta in a test sample of an individual suspected of having COPD. In other embodiments, methods provided herein comprise detecting the presence or expression level of at least IL-6, IL-8, TNF-alpha, IL-1 beta and MCP-1 in a test sample of an individual suspected of having COPD.
  • Immunoassays can be employed in any of the foregoing embodiments. Virtually any immunoassay technique known in the art can be used to detect antibodies that bind an antigen according to methods and kits of the present invention. Such immunoassay methods include, without limitation, radioimmunoassays, immunohistochemistry assays, competitive-binding assays, Western Blot analyses, ELISA assays, sandwich assays, test strip-based assays, assays using immunoprecipitation, assays combining antibody binding with two-dimensional gel electrophoresis (2D electrophoresis) and non-gel based approaches such as mass spectrometry or protein interaction profiling, such as nephelometry, BIAcoreTM, ForetBioTM, all known to those of ordinary skill in the art. These methods may be carried out in an automated manner, as is known in the art. Such immunoassay methods may also be used to detect the binding of antibodies in a sample to a target antigen.
  • the method includes incubating a sample with a target protein and incubating the reaction product formed with a binding partner, such as a secondary antibody (for example, an anti-species specific antibody), that binds to the reaction product by binding to an antibody from the sample that associated with the target protein to form the reaction product.
  • a binding partner such as a secondary antibody (for example, an anti-species specific antibody)
  • these may comprise two separate steps, in others, the two steps may be simultaneous, or performed in the same incubation step.
  • methods of detection of the binding of the target protein to an antibody include the use of an anti-human IgG (or other isotype specific) antibody or protein A.
  • This detection antibody may be fluorescently labeled, or directly or indirectly linked to a moiety that functions as a reporter, for example, an alkaline phosphatase or a peroxidase, such as horseradish peroxidase.
  • a reporter for example, an alkaline phosphatase or a peroxidase, such as horseradish peroxidase.
  • the CARD technique, tyramide signal amplification can optionally be employed to enhance the signal generated by a substrate converted by a peroxidase enzyme (Bobrow et al. (1989) J. Immunol. Methods 125: 279-285; Bhattacharya et al. (1999) J. Immunol. Methods 227 : 31 -39) .
  • microarrays for immunoassays allows the simultaneous analysis of multiple proteins. For example, target antigens or antibodies that recognize biomarkers that may be present in a sample are immobilized on microarrays. Then, the biomarker antibodies or proteins, if present in the sample, are captured on the cognate spots on the array by incubation of the sample with the microarray under conditions favoring specific antigen-antibody interactions. The binding of protein or antibody in the sample can then be determined using secondary antibodies or other binding labels, proteins, or analytes. Comparison of proteins or antibodies found in two or more different samples can be performed using any means known in the art. For example, a first sample can be analyzed in one array and a second sample analyzed in a second array that is a replica of the first array.
  • binding reagents which are typically antibodies.
  • the first binding reagent/antibody is attached to a surface and the second binding reagent/antibody comprises a detectable moiety or label.
  • labels include, for example and without limitation: fluorophores, chromophores, enzymes that generate a detectable signal, or epitopes for binding a second binding reagent (for example, when the second binding reagent/antibody is a mouse antibody, which is detected by a fluorescently- labeled anti-mouse antibody), for example an antigen or a member of a binding pair, such as biotin.
  • the surface may be a planar surface, such as in the case of a typical grid-type array (for example, but without limitation, 96-well plates and planar microarrays), as described herein, or a non-planar surface, as with coated bead array technologies, where each "species" of bead is labeled with, for example, a fluorochrome (such as the Luminex technology described herein and in U.S. Pat. Nos. 6,599,331 , 6,592,822 and 6,268,222), or quantum dot technology (for example, as described in U.S. Pat. No. 6,306,610).
  • a fluorochrome such as the Luminex technology described herein and in U.S. Pat. Nos. 6,599,331 , 6,592,822 and 6,268,222
  • quantum dot technology for example, as described in U.S. Pat. No. 6,306,610.
  • a variety of different solid and semi-solid phase substrates can be used to detect a protein or antibody in a sample, or to quantitate or determine the concentration of a protein or antibody in a sample.
  • the choice of substrate can be readily made by those of ordinary skill in the art, based on convenience, cost, skill, or other considerations.
  • Useful substrates include without limitation: gels, matrices, beads, particles, bottles, surfaces, substrates, fibers, wires, framed structures, tubes, filaments, plates, sheets, filters, strips, and wells.
  • substrates can be made from: polystyrene, polypropylene, polycarbonate, glass, silica, silicon, plastic, metal, alloy, ceramics, cellulose, cellulose derivatives, nylon, coated surfaces, acrylamide or its derivatives and polymers thereof, agarose, or latex, or combinations thereof. This list is illustrative rather than exhaustive.
  • biomarker detection panels using antibodies after contacting the sample with a biomarker detection panel, the panel is incubated under conditions of temperature, ionic strength, and pH compatible with antibody-antigen binding and for a time sufficient to allow antigen-antibody binding to occur.
  • binding reagents in exemplary embodiments species-specific antibodies
  • binding reagents are applied to the biomarker detection panel and also incubated with the biomarker detection panel under conditions of temperature, ionic strength, and pH compatible with binding and for a time sufficient to allow binding to occur.
  • a single antibody can be coupled to beads or to a well in a microwell plate, and quantitated by immunoassay.
  • a single protein can be detected in each assay.
  • the assays can be repeated with antibodies to many analytes to arrive at essentially the same results as can be achieved using the methods of this invention.
  • Bead assays can be multiplexed by employing a plurality of beads, each of which is uniquely labeled in some manner. For example each type of bead can contain a pre-selected amount of a fluorophore.
  • Types of beads can be distinguished by determining the amount of fluorescence (and/or wavelength) emitted by a bead.
  • fluorescently labeled beads are commercially available from Luminex Corporation (Austin, TX; see www.luminexcorp.com).
  • the Luminex assay is very similar to a typical sandwich ELISA assay, but utilizes Luminex microspheres conjugated to antibodies or proteins (Vignali (2000) J. Immunol. Methods 243:243-255).
  • the methodology and steps of various antibody assays are known to those of ordinary skill in the art. Additional information may be found, for example, in Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory, Chap.
  • the antibodies used to perform the foregoing assays can include polyclonal antibodies, monoclonal antibodies and fragments thereof as described supra.
  • Monoclonal antibodies can be prepared according to established methods (see, e.g., Kohler and Milstein (1975) Nature 256:495; and Harlow and Lane (1988) Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, N. Y.)).
  • An antibody can be a complete immunoglobulin or an antibody fragment.
  • Antibody fragments used herein typically are those that retain their ability to bind an antigen.
  • Antibodies subtypes include IgG, IgM, IgA, IgE, or an isotype thereof (e.g., IgGI , lgG2a, lgG2b or lgG3).
  • Antibody preparations can by polyclonal or monoclonal, and can be chimeric, humanized or bispecific versions of such antibodies.
  • Antibody fragments include but are not limited to Fab, Fab', F(ab)' 2 , Dab, Fv and single-chain Fv (ScFv) fragments.
  • Bifunctional antibodies sometimes are constructed by engineering two different binding specificities into a single antibody chain and sometimes are constructed by joining two Fab' regions together, where each Fab' region is from a different antibody (e.g., U.S. Patent No. 6,342,221 ).
  • Antibody fragments often comprise engineered regions such as CDR-grafted or humanized fragments.
  • Antibodies sometimes are derivitized with a functional molecule, such as a detectable label (e.g., dye, fluorophore, radioisotope, light scattering agent (e.g., silver, gold)) or binding agent (e.g., biotin, streptavidin), for example.
  • a detectable label e.g., dye, fluorophore, radioisotope, light scattering agent (e.g., silver, gold)
  • binding agent e.g., biotin, streptavidin
  • Detection can use any means compatible with the label and format employed.
  • a scanner can be used to detect the signal, such as a fluorescent signal, from arrays, filters, plate, or bead assays.
  • a plate reader can also be used for ELISAs that use chromogenic reagents.
  • Detection can also use scintillation counters or autoradiography/densitometry where the signal is generated by a radioisotope label.
  • Automated systems for performing immunoassays are widely known and used in preclinical and medical diagnostics.
  • random-mode or batch analyzer immunoassay systems can be used, as are known in the art. These can utilize magnetic particles or non-magnetic particles or microparticles and can utilize a fluorescence or chemiluminescence readout, for example.
  • the automated system can be the Beckman ACCESS® paramagnetic-particle, chemiluminescent immunoassay, the Bayer ACS:180 chemiluminescent immunoassay or the Abbott AxSYM® microparticle enzyme immunoassay.
  • Such automated systems can be designed to perform methods provided herein for an individual antigen or for multiple antigens without multiple user interventions.
  • the methods, detection panels, assays and systems provided herein include target antigens, which typically are protein antigens.
  • target antigens typically are protein antigens.
  • known methods can be used for making and isolating viral, prokaryotic or eukaryotic proteins in a readily scalable format, which are amenable to high-throughput analysis.
  • methods include synthesizing and purifying proteins in an array format compatible with automation technologies.
  • proteins are expressed from gene constructs using in vitro synthesis systems or cell culture systems. Any expression construct having an inducible promoter to drive protein synthesis can be used in accordance with the methods of the invention.
  • the expression construct may be, for example, tailored to the cell type to be used for transformation. Compatibility between expression constructs and host cells are known in the art, and use of variants thereof are also encompassed by the invention.
  • the present protein microarrays provide a method for making and isolating eukaryotic proteins comprising the steps of growing a cell transformed with a vector having a heterologous sequence operatively linked to a regulatory sequence, contacting the regulatory sequence with an inducer that enhances expression of a protein encoded by the heterologous sequence, lysing the cell, contacting the protein with a binding agent such that a complex between the protein and binding agent is formed, isolating the complex from cellular debris, and isolating the protein from the complex, wherein each step is conducted in a 96-well format.
  • bacterial, yeast, mammalian, or insect cells can be used for the production of proteins.
  • eukaryotic proteins can be made and purified in a 96-array format ⁇ i.e., each site on the solid support where processing occurs is one of 96 sites), e.g., in a 96-well microtiter plate.
  • the solid support does not bind proteins ⁇ e.g., a non-protein-binding microtiter plate).
  • proteins are synthesized by in vitro translation according to methods commonly known in the art. For example, a wheat germ expression (WGE) system can be used to synthesize proteins used as autoantibody capture molecules.
  • WGE wheat germ expression
  • a variety of commercial WGE systems are available, the majority of this work has been performed using Cell Free Sciences WGE system (Yokahama Japan).
  • proteins used as autoantibody capture molecules can be synthesized in other in vitro synthesis systems or in cell culture.
  • E. coli in vitro translation systems or reticulocyte lysate in vitro translation systems can be used for synthesis of autoantibody capture molecules.
  • Proteins used as autoantibody capture molecules can also be isolated from organisms, for example, from sera.
  • proteins are synthesized in vitro or in culture systems as glutathione S (GST)-fusion constructs, and are purified from cell culture or a cell- free expression system using GST-beads or columns. Invitrogen's UltimateTM ORF clone collection is an ideal platform to generate a large number of antigens in a facile manner.
  • GST glutathione S
  • the fusion proteins have GST tags and are affinity purified by contacting the proteins with glutathione beads.
  • the glutathione beads, with fusion proteins attached can be washed in a 96-well box without using a filter plate to ease handling of the samples and prevent cross contamination of the samples.
  • fusion proteins can be eluted from the binding compound (e.g., glutathione bead) with elution buffer to provide a desired protein concentration.
  • binding compound e.g., glutathione bead
  • fusion proteins are eluted from the glutathione beads with elution buffer to provide a desired protein concentration.
  • the glutathione beads are separated from the purified proteins.
  • all of the glutathione beads are removed to avoid blocking of the microarrays pins used to spot the purified proteins onto a solid support.
  • the glutathione beads are separated from the purified proteins using a filter plate, for example, comprising a non-protein-binding solid support. Filtration of the eluate containing the purified proteins should result in greater than 90% recovery of the proteins.
  • the elution buffer may, for example, comprise a liquid of high viscosity such as, for example, 15% to 50% glycerol, for example, about 40% glycerol.
  • the glycerol solution stabilizes the proteins in solution, and prevents dehydration of the protein solution during the printing step using a microarrayer.
  • Purified proteins may, for example, be stored in a medium that stabilizes the proteins and prevents desiccation of the sample.
  • purified proteins can be stored in a liquid of high viscosity such as, for example, 15% to 50% glycerol, for example, in about 40% glycerol.
  • samples may be aliquoted containing the purified proteins, so as to avoid loss of protein activity caused by freeze/thaw cycles.
  • the purification protocol can be adjusted to control the level of protein purity desired.
  • isolation of molecules that associate with the protein of interest is desired.
  • dimers, trimers, or higher order homotypic or heterotypic complexes comprising an overproduced protein of interest can be isolated using the purification methods provided herein, or modifications thereof.
  • associated molecules can be individually isolated and identified using methods known in the art ⁇ e.g., mass spectroscopy).
  • the protein antigens once produced can be used in the biomarker panels, methods and kits provided herein as part of a "positionally addressable" array.
  • the array includes a plurality of target antigens, with each target antigen being at a different position on a solid support.
  • the array can include, for example, 1 , 2, 3, 4, 5, 8, 9, 10, 1 1 , 12, 13, 14, 15, 16, 17,
  • the protein array is a bead-based array. In another aspect, the protein array is a planar array. Methods for making protein arrays, such as by contact printing, are well known.
  • the detection is performed on a protein array, which can be a microarray, and can optionally be a microarray that includes proteins at a concentration of at least 100/cm 2 or 1000/cm 2 , or greater than 400/cm 2 .
  • Example 1 Guinea pig liver, blood and spleen tissue processing
  • LPS lipopolysaccharide
  • Tissue processing Each of the tissue samples were processed as follows: The tissue was finely minced (approximately 1 mm 3 cubes) using a razor blade in sterile PBS. The tissue fragments were divided equally among two T75 tissue culture flasks, each containing approximately 30 ml of complete RPMI. Inspection of the materials added to the T75 flasks under a microscope revealed the presence of numerous free cells in each culture. The LPS solution, as described above, was added to one of the T75 flasks while the second flask was left unstimulated to serve as a control. The flasks were incubated at 37° C. After 4.5 hours, the cells and tissue fragments were collected by centrifugation at 3500 rpm for 10 minutes at 4° C and snap frozen in liquid N 2 .
  • Example 2 Isolation of guinea pig spleen and liver total RNA RNA isolation was performed using PurelinkTM Micro-to-MidiTM Total RNA Purification System (Invitrogen Corporation, Carlsbad, CA). Two hundred milligrams of frozen guinea pig liver or spleen tissue, prepared as described above, were ground thoroughly using an RNase-free pestle. The ground tissue was then transferred to an RNase-free 2 ml microcentrifuge tube that was pre-cooled with liquid nitrogen. One hundred milligrams of the ground tissue was mixed with 1 .2 ml of RNA lysis buffer with 1 % (v/v) 2-mercaptoethanol and the solution centrifuged 12,000 X g for 2 minutes at 4° C.
  • the supernatant was transferred to a new RNase-free tube and 1 ml of ice-cold 70% ethanol in RNase-free water was added. Approximately 700 ⁇ l of the sample, including any precipitate, was transferred to a RNA spin cartridge pre-inserted in a collection tube. The sample was centrifuged at 12,000 X g for 15 seconds at room temperature (RT). The flow through was discarded and the cartridge was re-inserted in the tube. Approximately 700 ⁇ l of wash buffer I was added to the spin cartridge and the sample centrifuged again at 12,000 X g for 15 seconds. The flow through was discarded and the spin cartridge was placed into a clean RNA wash tube.
  • RNA recovery tube supplied with the kit.
  • To elute the RNA 50 ⁇ l of RNase-free water was added to the cartridge and incubated at RT for 1 minute. The sample was centrifuged for 2 minutes at 12,000 X g at RT. This elution step was repeated using 25 ⁇ l of RNase-free water. The elute was combined and the collected material analyzed for quantity and quality.
  • Example 3 Analyzing RNA yield and quality
  • a sample of approximately 70 ⁇ l of total RNA was isolated from guinea pig spleen tissue and liver tissue as described above. Five ⁇ l of the total RNA was taken and added with 245 ⁇ l of RNase-free water (a 1 :50 dilution). The 250 ⁇ l sample was transferred and analyzed by spectrometer (OD 26 O and OD 28 o)- Typically, an OD ratio of 260 vs. 280 greater than 1 .8 indicates that the sample is of good quality and generally free of protein contaminants. The total RNA amount was calculated using the following formula:
  • RNA samples of 50 ⁇ g of total RNA from guinea pig liver and spleen were prepared as described above. Isolation of the mRNA was performed using FastTrack® MAG RNA Isolation Kit (Invitrogen Corporation).
  • RNA samples 50 ⁇ g of total RNA, 50 ⁇ g of FastTrack® MAG Bead were needed. The beads were thoroughly resuspended in a microcentrifuge tube. The microcentrifuge tube was inserted into a magnetic particle separator (MPS) and allowed to stand for 1 minute until the beads were clearly separated from the liquid. The liquid was removed from the tube using a pipette and discarded. Immediately after, 100 ⁇ l of Wash Buffer W7 was added. The microcentrifuge tube was allowed to stand in the MPS until the beads separated from the liquid, and the liquid was removed. The washing step was repeated a second time and the tube was capped and placed at RT for 5 minutes.
  • MPS magnetic particle separator
  • the B6 binding buffer was pre-heated in a 65-70° C water bath and 200 ⁇ l were mixed with 50 ⁇ l of FastTrack® beads and 50 ⁇ g of the total RNA sample.
  • the tube was capped and placed in a heat block for 5 minutes at 65-70° C.
  • the sample was transferred to a rotator and rotated for 10 minutes at RT.
  • the tube was then inserted into the MPS and allowed to stand for 1 -2 minutes. When the beads separated from the liquid, the supernatant was removed.
  • the beads were then resuspended in 200 ⁇ l of Wash Buffer W7.
  • the tube was returned to the MPS and the liquid removed after the beads and liquid separated. This washing step was repeated three more times.
  • the tube was removed from the MPS and 50 ⁇ l of RNase-free water was added to the tube. The tube was then placed in a heat block and heated at 37 °C for 5 minutes. The tube was inserted into the MPS. When the beads clearly separated from the liquid, the supernatant, which now contains the isolated mRNA, was removed and saved. This step was repeated with 10 ⁇ l RNase-free water and the supernatant removed and combined with the previous mRNA supernatant. Approximately 10 ⁇ l of the RNA supernatant solution were transferred to labeled tubes and frozen at -80° C.
  • RNA sample was transferred to an RNase-free tube with 198 ⁇ l of TE buffer (Tris-HCI, pH 8.0, 1 OmM and 0.1 mM EDTA), a dilution factor of 1 :100.
  • TE buffer Tris-HCI, pH 8.0, 1 OmM and 0.1 mM EDTA
  • the sample was measure with a UV/visible spectrophotometer at 260 nm.
  • Example 6 Primers Design In order to perform RT-PCR on the mRNA encoding the novel IL-6 protein of the present invention, most of the published IL-6 genes were mapped and the homologies aligned. The sequence alignment from various species, such as human, pig, sheep, rabbit, dog, chimp, mink, and cow, gave several conservative regions useful for generating PCR primers. 5' - UTR alignment of IL-6
  • Two sets of primers at both 5'- UTR and 3'- UTR regions were desired. Then, the nested PCR could be performed to amplify the potential IL-6 nucleic acid sequence in guinea pig spleen or liver mRNA. Two pairs of potential RT-PCR primers were obtained (shown below). The Tm of these primers are all above 56° C, making it easy to obtain high fidelity annealing temperature.
  • PCR (Invitrogen Corporation) was used.
  • the primers 50 ⁇ M olig(dT) 20 or 50 nq/ ⁇ l random hexamer primer
  • dNTP RNA or isolated mRNA
  • the volume adjusted to 12 ⁇ l with DEPC-treated water for a total of 8 reactions (summarized below).
  • reaction mixture was denatured at 65° C for 5 minutes and placed on ice.
  • a master reaction mixture was prepared on ice as follows:
  • the 5X cDNA Synthesis Buffer was vortexed for 5 seconds just prior to use, and the master reaction mixture vortexed gently to mix the components. Approximately 8 ⁇ l of the master reaction mixture was transferred by pipette into each reaction tube and kept on ice. Each reaction sample was transferred to a thermal cycler for priming. For reactions with the 50 ⁇ M olig(dT) 20 primer, the reaction sample was primed at 50° C for 50 minutes. For reactions with the 50 nq/ ⁇ l random primer, the reaction sample was primed at 25° C for 10 minutes followed by 50° C for 50 minutes. The cDNA synthesis reactions were then terminated at 85° C for 5 minutes. One ⁇ l of RNase H was added to each reaction tube and the samples incubated at 37° C for 20 minutes. The reaction samples were stored at -20° C until PCR.
  • Example 8 - Polymerase Chain Reaction (PCR) PCR was performed using reactions A-H (described above) in a thermal cycler (MJ Research, Inc., PTC-100 programmable thermal controller).
  • the first pair of PCR primers were: gp IL-6 5'-UTR-p1 (10 ⁇ l) and gp IL-6 3'-UTR-p1 (10 ⁇ l) as described above.
  • PCR was performed using mixture containing: 10 X KOD PCR buffer (5 ⁇ l per reaction) dNTP mix, 2 mM (5 ⁇ l per reaction) MgSO 4 , 25 mM (2.5 ⁇ l per reaction) 5' - Primer, 10 ⁇ M (2 ⁇ l per reaction) 3' - Primer, 10 ⁇ M (2 ⁇ l per reaction) cDNA Templates (3 ⁇ l per reaction)
  • Step 1 of the PCR program was at 94° C for 2 minutes.
  • Step 2 was at 98 0 C for 10 seconds, followed by 55 0 C for 10 seconds, and 71 0 C for 1 minute.
  • Step 2 was repeated for a total of 25 cycles.
  • Step 3 reduced the temperature to 4° C.
  • Lane 1 PCR using guinea pig liver total RNA, primed olig(dT) 20 cDNA template
  • Lane 2 PCR using guinea pig liver total RNA, primed with random hexamer template
  • Lane 3 PCR using guinea pig liver mRNA, primed olig(dT) 20 cDNA template
  • Lane 4 PCR using guinea pig liver mRNA, primed random hexamer cDNA template
  • Lane 5 Kb Plus DNA ladder size (from bottom to top) 100, 200, 300, 400, 500, 650, 850, 1000, 1650, 2000 bp
  • Lane 6 PCR using guinea pig spleen total RNA, primed olig(dT) 20 cDNA template
  • Lane 7 PCR using guinea pig spleen total RNA, primed with random hexamer template
  • Lane 8 PCR using guinea pig spleen mRNA, primed olig(dT) 20 cDNA template
  • Lane 9 PCR using guinea pig spleen mRNA, primed random hexamer cDNA template
  • Example 9 Nested Polymerase Chain Reaction (PCR) A nested PCR was performed substantially as described in Example 8, except that the primers used were: gp IL-6 5'-NP2 and gp IL-6 3'-UTR NP2. PCR was performed using mixture containing:
  • Step 1 of the PCR program was at 94° C for 2 minutes.
  • Step 2 was at 98 ° C for 10 seconds, followed by 58 ° C for 10 seconds, and 71 0 C for 1 minute.
  • Step 2 was repeated for a total of 25 cycles.
  • Step 3 reduced the temperature to 4° C.
  • Lanes 1 , 3, 5 and 7 used olig(dT) 20 primed cDNA template PCR and lanes 2, 4, 6 and 8 used random hexamer primed cDNA template PCR.
  • Lane 1 through lane 4 are nested PCR results using guinea pig liver total RNA (lanes 1 and 2) or mRNA (lanes 3 and 4) cDNA templates.
  • Lane 5 through lane 8 are nested PCR results using guinea pig spleen total RNA (lanes 5 and 6) or mRNA (lanes 7 and 8) cDNA templates. Selected areas of the gel were cut and purified by Qiagen QIA quick gel kit.
  • Isolated gp IL-6 fragments were purified using Qiagen QIA quick PCR purification kit.
  • the DNA fragment was extracted from the agarose gel and weighed.
  • the Buffer QG was added to the gel fragment (3:1 by volume) and incubated at 50° C for 10 minutes while vortexing every 2-3 minutes. After the gel slice dissolved completely, 1 gel volume of isopropanol was mixed with the sample.
  • a QIAquick spin column is placed in a 2 ml collection tube. The sample was added to the column and centrifuged for 1 minute. The flow-through was discarded, the column washed with 0.75 ml of Buffer PE, and centrifuged for 1 minute.
  • SEQ ID NO: 1 is the DNA sequence presented 5' to 3';
  • SEQ ID N0:31 is the complementary sequence of SEQ ID N0:1 presented 3' to 5';
  • SEQ ID N0:2 is the amino acid sequence of the open reading frame (line 1)):
  • Mature gp IL-6 is 182 amino acids in length and shares only 37% identity with other rodent IL-6 proteins and 34% identity with human IL-6 protein.
  • FIG. 4 depicts the alignment of gp IL-6 protein with human IL-6 and mouse IL-6, along with a concensus sequence deduced from the three IL-6 sequences. The alignment and the concensus sequence were generated with the algorithms provided in Vector NTI.
  • Example 1 1 - Production of a tagged recombinant protein fragment
  • FIG. 5 Two SDS-Page profiles of the gp IL-6 protein are shown in FIG. 5 (the second SDS- Page profile shows the purified protein produced according to the above procedure).
  • Example 12 Thrombin digestion of tagged recombinant protein
  • His-tagged protein described above referred to in this example as His tag-gplL-
  • lane 1 contained His tag-gplL-6 with thrombin (1/4 ratio)
  • lane 2 contained His tag -gplL-6 with thrombin (1 /500 ratio)
  • lane 3 contained His tag- gplL-6 with no thrombin
  • lane 4 contained a molecular weight marker.
  • Each well was loaded with 10 ⁇ l of the protein or marker. The gel was run at 200 volts for 42 minutes. The molecular weight of His tag-gplL-6 protein is approximately 29 kDa. As shown in FIG.
  • thrombin digestion produced a His tag fusion fragment (the tag) at approximately 17 kDa and the gplL-6 protein (the protein absent the His tag) at the expected molecular weight of 12.5 kDa.
  • the His tag-gplL-6 protein was digested with varying thrombin ratios (shown in the table below).
  • Gel lane 1 1 contains a molecular weight marker and lane 12 is His tag-gplL-6 with no thrombin added.
  • Each well was loaded with 10 ⁇ l of the protein or marker (approximately 5 ⁇ g). As shown in FIG.
  • His tag-gplL-6 protein was treated with varying levels of thrombin and then detected with antibodies (FIG. 8). Each well was loaded with 10 ⁇ l of the protein or marker. A solution of 5% milk + PBST was used as a blocking buffer (15 minutes) and then the lanes were treated with a primary antibody (M1 (mouse 1 )-M5 (mouse 5)) for approximately 2 hours. A secondary antibody (Goat anti-mouse alkaline phosphatase conjugate) was added for 45 minutes. In FIG. 8, the lanes in the gel contained the following (lanes with "no thrombin" are uncut His tag-gplL-6 protein):
  • Example 13 Production of a tagged recombinant full-length qp IL-6 Using procedures generally known to those in the art and conditions outlined in
  • Examples 1 1 and 12 a polynucleotide sequence encoding full length gp IL-6 protein was cloned into an E. coli expression vector containing a His tag sequence and used to produce a recombinant full length gp IL-6 polypeptide. The resulting polypeptide contained a His tag and was subsequently purified. Transformed E. coli cells were grown to OD 600 of approximately 0.7 and expression induced with IPTG for 3 hours.
  • the gp IL-6 fusion protein was eluted in 100 mM imidazole-HCI, 3M Urea, 5OmM MOPS, 0.5M NaCI, 10 mM ⁇ -mercaptoethanol, pH 6.5, fractions were collected and the pooled fractions dialyzed against 4 liters of PBS, pH 7.4. Based on the SDS-PAGE analysis, the pooled fractions had more than 80% purity of target fusion protein.
  • the gp IL-6 was cleaved from the fusion protein by incubation with thrombin protease in PBS at RT for over 16 hours.
  • Thrombin digest gp IL-6 was refolded by formation of disulfide bonds as follows. Thrombin digested gp IL-6 (1 .8 ml) was diluted in 16.8 ml buffer containing 7 M urea, 40 mM sodium phosphate, 0.5 M NaCI. The final total volume of the refolding reaction was 20 mL (1 :10 dilution, final protein concentration was about 0.1 mg/ml), then 20 mM reduced glutathione and 2 mM oxidized glutathione was added and the pH adjusted to 8.3.
  • the gp IL-6 was transferred to dialysis tubing (3.5 kDa MWCO) and dialyzed against 1000 mL "refolding solution" containing: 40 mM Tris HCI, pH 8.3, 1 M urea overnight at 4 °C. After two days of dialysis at 4 °C (with 3 changes of refolding solution, the protein in the dialysis tubing was transferred to a clean tube and the pH adjusted to 3.8 with glacial acetic acid.
  • Refolded gp IL-6 protein was then further purified by reverse phase chromatography.
  • the refolded protein was loaded (2 ml per minute) onto Resource RPC column (1 ml, GE lifesciences) and the column washed through the lines with 20 column volumes of buffer A (0.1 % Trifluoroacetic acid (TFA).
  • the elution profile was 0 to 100% acetonitrile in 0.1 % TFA and fractions were collected a 1 ml per minute.
  • the purified gp IL-6 protein was eluted out at 45% acetonitrile in 0.1 % TFA.
  • the pooled gp IL-6 fractions B9, B1 1 and B12 fractions (FIG. 9) were quantified by using Quant-iTTM Protein Assay Kit and QubitTM Fluorometer
  • Lane 1 molecular weight marker (188, 98, 62, 49, 38, 28, 17, 14 and 6 kDa)
  • Lane 2 Cleavage reaction (fusion protein, bottom band; gp IL-6, upper band)
  • Lane 3 Blank
  • Example 14 -Guinea pig IL-6 analysis
  • N-terminus amino acid sequence analysis was performed on the purified and refolded gp IL-6 protein (UTMB Protein Chemistry Laboratory, Galveston, TX (www2.utmb.edu/proch)).
  • the sequencing results confirmed that the N-terminal five amino acids are methionine, threonine, threonine, alanine, and glutamic acid and that the gp IL-6 recombinant protein contains the full-length amino acid sequence (SEQ ID NO:2).
  • Biological activity of the purified gp IL-6 protein was assessed in B cell proliferation assay to confirm that the novel gp IL-6 protein shares the functional activity of the other IL-6 family members.
  • the bioassay measured proliferation of murine B-9 hybridoma cells with a heterodimeric IL-6 receptor complex in response to IL-6 stimulation.
  • a 96-well plate 1 x 10 4 B9 cells were mixed with varying dilutions of gp IL6 or mouse IL-6 and incubated for approximately 60 hours at 37 s C. After the incubation, cell proliferation was determined using a standard MTS bioassay. Results of this bioassay are shown in FIG.
  • the ED 50 of the gp IL-6 is about 2 pg/ml and the ED 50 of the mouse IL-6 is about 5 pg/ml, both similar to the biological activity to most IL-6 family members.
  • the ED 50 for this cell proliferation effect for most of the IL-6 family members is about 1 to 5 pg/ml.
  • Gp IL-6 protein expressed in guinea pig spleen tissue was examined by western blot analysis.
  • Monoclonal antibodies specific for gp IL-6 were prepared using standard methods known in the art and were used in this analysis of IL-6 from this primary tissue.
  • Lipopolysaccharide (LPS) was added to one flask to a concentration of 10 ⁇ g/ml and the other flask was left untreated as a control.
  • GolgiStopTM (monensin, BD Biosciences) was added at a concentration of 4 ⁇ L per 6 ml of medium to the LPS stimulated flask and the two flasks were incubated for another 6 to 12 hours at 37 s C. Following incubation, the cells were collected, washed with PBS and cell pellets were frozen at -80 s C. Protein concentration was analyzed by Bradford assay and 50 ⁇ g of total cell lysate was subjected to gel electrophoresis under reducing conditions and transfer for western analysis.
  • the western analysis was performed with an anti-gp IL-6 monoclonal antibody as primary antibody and a 17 kDa band was detected on the western blot.
  • the same result was obtained with three different antibodies and this data is very similar to the predicted size of the novel gp IL-6 protein.
  • This novel gp IL-6 protein has biological activity and is the size of most IL-6 family members.

Landscapes

  • Chemical & Material Sciences (AREA)
  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Biochemistry (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Toxicology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne une séquence d'acides aminés IL-6 pour cochons d'Inde, une protéine IL-6 de cochons d'Inde recombinante biologiquement active, ainsi que la séquence ADN encodant la protéine IL-6. L'invention concerne également de nouveaux biomarqueurs, anticorps et polypeptides relatifs à la protéine IL-6 du cochon d'Inde. L’invention concerne également des panneaux de détection pour détecter des biomarqueurs relatifs à la protéine IL-6 du cochon d'Inde et des procédés de détection ou de diagnostic d'états inflammatoires tels qu'une maladie pulmonaire obstructive chronique.
PCT/US2009/047705 2008-06-17 2009-06-17 Séquence nucléotide et protéinique de cochons d'inde il-6 et procédés d'utilisation WO2009155373A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US7330408P 2008-06-17 2008-06-17
US61/073,304 2008-06-17

Publications (1)

Publication Number Publication Date
WO2009155373A1 true WO2009155373A1 (fr) 2009-12-23

Family

ID=40996656

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/047705 WO2009155373A1 (fr) 2008-06-17 2009-06-17 Séquence nucléotide et protéinique de cochons d'inde il-6 et procédés d'utilisation

Country Status (1)

Country Link
WO (1) WO2009155373A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002072788A2 (fr) * 2001-03-14 2002-09-19 Centocor, Inc. Proteines provenant de l'immunoglobuline associees a la bronchopneumopathie chronique obstructive, compositions, procedes et utilisations

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002072788A2 (fr) * 2001-03-14 2002-09-19 Centocor, Inc. Proteines provenant de l'immunoglobuline associees a la bronchopneumopathie chronique obstructive, compositions, procedes et utilisations

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
LI DANIEL H ET AL: "Woodchuck interleukin-6 gene: structure, characterization, and biologic activity.", GENE 10 NOV 2004, vol. 342, no. 1, 10 November 2004 (2004-11-10), pages 157 - 164, XP004622457, ISSN: 0378-1119 *
SCAROZZA A M ET AL: "Spontaneous cytokine gene expression in normal guinea pig blood and tissues.", CYTOKINE NOV 1998, vol. 10, no. 11, November 1998 (1998-11-01), pages 851 - 859, XP008111331, ISSN: 1043-4666 *
SIN DON D ET AL: "Interleukin-6: a red herring or a real catch in COPD?", CHEST JAN 2008, vol. 133, no. 1, January 2008 (2008-01-01), pages 4 - 6, XP002543767, ISSN: 0012-3692 *

Similar Documents

Publication Publication Date Title
US20090047689A1 (en) Autoantigen biomarkers for early diagnosis of lung adenocarcinoma
CN105793439B (zh) 以生物样品进行的针对igfbp7的具有改进的性能的测定
US20090169575A1 (en) Proteins
RU2650778C2 (ru) Композиции и способы применения для определения не4а
KR102549704B1 (ko) Pivka-ii의 측정 방법, 및 pivka-ii 면역측정 시약 또는 키트의 제조 방법
WO2008064336A9 (fr) Biomarqueurs de maladies auto-immunes
KR20050108389A (ko) 모노클로날 항체 및 이것을 생산하는 하이브리도마
EP2673646B1 (fr) Méthode de diagnostic d'une infection des voies urinaires
EP2823311B1 (fr) Biomarqueurs pour le lupus érythémateux disséminé
JP2007502837A (ja) 小型エピトープ抗体を使用するサンプルの複雑さを低減するための方法
TW202219062A (zh) 用於特性化ｍｈｃｉ肽結合的測定及試劑
JP5484549B2 (ja) 中皮腫診断キット
WO2022007283A1 (fr) Kit et méthode de diagnostic d'une maladie associée à une expression de fap anormale, et support de stockage lisible par ordinateur
WO2009155373A1 (fr) Séquence nucléotide et protéinique de cochons d'inde il-6 et procédés d'utilisation
JP6760562B2 (ja) 卵巣明細胞癌患者の予後を予測するための情報提供方法
EP2957571B1 (fr) Anticorps anti-pvhl monoclonaux et leurs utilisations
KR102131860B1 (ko) 아르기닌이 메틸화된 ggt1에 특이적으로 결합하는 대장암 진단용 바이오마커 조성물
JP4829961B2 (ja) プロスタシン部分ペプチド及び抗プロスタシン抗体
JP2009263353A (ja) 抗ラットオステオカルシンモノクローナル抗体
WO2015006710A1 (fr) Anticorps miox et dosage
JP6607436B2 (ja) 難治性血管炎の病態を特定する新規なｍｐｏ−ａｎｃａ検査法
CN114075280A (zh) 抗ngal的单克隆抗体及其应用和检测试剂盒
JP2002308900A (ja) 抗ヒト肝性トリグリセリドリパーゼ抗体
JP2006238844A (ja) 網膜周皮細胞由来の細胞増殖抑制因子

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09767682

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09767682

Country of ref document: EP

Kind code of ref document: A1