WO2009151356A1 - Antibodies against extracellular domains 2 and 3 or her2 - Google Patents

Antibodies against extracellular domains 2 and 3 or her2 Download PDF

Info

Publication number
WO2009151356A1
WO2009151356A1 PCT/SE2008/000694 SE2008000694W WO2009151356A1 WO 2009151356 A1 WO2009151356 A1 WO 2009151356A1 SE 2008000694 W SE2008000694 W SE 2008000694W WO 2009151356 A1 WO2009151356 A1 WO 2009151356A1
Authority
WO
WIPO (PCT)
Prior art keywords
cancer
affinity ligand
her2
amino acid
seq
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SE2008/000694
Other languages
English (en)
French (fr)
Inventor
Mathias Uhlen
Johan Rockberg
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Atlas Antibodies AB
Original Assignee
Atlas Antibodies AB
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Atlas Antibodies AB filed Critical Atlas Antibodies AB
Priority to US12/997,823 priority Critical patent/US20110158988A1/en
Priority to EP08874636A priority patent/EP2294088A1/en
Priority to CN2008801297639A priority patent/CN102099376A/zh
Priority to CA2727941A priority patent/CA2727941A1/en
Priority to AU2008357729A priority patent/AU2008357729A1/en
Priority to KR1020127017264A priority patent/KR20130026418A/ko
Publication of WO2009151356A1 publication Critical patent/WO2009151356A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • CCHEMISTRY; METALLURGY
    • C07ORGANIC CHEMISTRY
    • C07KPEPTIDES
    • C07K16/00Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
    • C07K16/18Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/32Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against translation products of oncogenes
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K39/395Antibodies; Immunoglobulins; Immune serum, e.g. antilymphocytic serum
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • A61P35/04Antineoplastic agents specific for metastasis
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00Medicinal preparations containing antigens or antibodies
    • A61K2039/505Medicinal preparations containing antigens or antibodies comprising antibodies

Definitions

  • the present invention generally relates to amino acid subsets of the extracellular domain of HER2, antibodies targeting such subsets and related methods and uses, such as therapeutic methods and uses.
  • the human epidermal growth factor receptor 2 (HER2 or erbB-2) is a member of the epidermal growth factor receptor family (EGFR, HER2, HER3 and HER4) a family of transmembrane receptor tyrosine kinases. These receptors have an over all sequence identity of between 40-50% and have similar domains. They all contain an extracellular ligand-binding domain, a single, transmembrane spanning domain, and intracellular tyrosine kinase and regulatory domains.
  • HER2 has been studied in a variety of human carcinomas and have been found to be upregulated in a number of tumors, in particular in breast, lung, pancreatic and colorectal cancer and Wilm's tumor, but also in ovarian, bladder, endometrial, renal, head and neck, gastric, esophageal and prostate cancer (Menard et al (2001) Annals of Oncology 12 (Suppl. 1) S 15-S 19).
  • Cancer is one of the most common causes of disease and death in the western world. In general, incidence rates increase with age for most forms of cancer. As human populations continue to live longer, due to an increase of the general health status, cancer may affect an increasing number of individuals. The cause of most common cancer types is still largely unknown, although there is an increasing body of knowledge providing a link between environmental factors (dietary, tobacco smoke, UV radiation etc) as well as genetic factors (germ line mutations in "cancer genes" such as p53, APC, BRCA1 , XP etc) and the risk for development of cancer. No definition of cancer is entirely satisfactory from a cell biological point of view, despite the fact that cancer is essentially a cellular disease and defined as a transformed cell population with net cell growth and anti-social behavior.
  • Malignant transformation represents the transition to a malignant phenotype based on irreversible genetic alterations. Although this has not been formally proven, malignant transformation is believed to take place in one cell, from which a subsequently developed tumor originates (the "clonality of cancer" dogma).
  • Carcinogenesis is the process by which cancer is generated and is generally accepted to include multiple events that ultimately lead to growth of a malignant tumor. This multi-step process includes several rate-limiting steps, such as addition of mutations and possibly also epigenetic events, leading to formation of cancer following stages of precancerous proliferation.
  • the stepwise changes involve accumulation of errors (mutations) in vital regulatory pathways that determine cell division, asocial behavior and cell death.
  • a malignant tumor does not only necessarily consist of the transformed tumor cells themselves but also surrounding normal cells which act as a supportive stroma.
  • This recruited cancer stroma consists of connective tissue, blood vessels and various other normal cells, e.g., inflammatory cells, which act in concert to supply the transformed tumor cells with signals necessary for continued tumor growth.
  • cancers arise in somatic cells and are predominantly of epithelial origin, e.g., prostate, breast, colon, urothelial and skin, followed by cancers originating from the hematopoetic lineage, e.g., leukemia and lymphoma, neuroectoderm, e.g., malignant gliomas, and soft tissue tumors, e.g., sarcomas.
  • epithelial origin e.g., prostate, breast, colon, urothelial and skin
  • cancers originating from the hematopoetic lineage e.g., leukemia and lymphoma
  • neuroectoderm e.g., malignant gliomas
  • soft tissue tumors e.g., sarcomas.
  • Cancer treatments include, for example, surgery, radiation therapy, chemotherapy, targeted therapies, immunotherapy, hormonal therapy and angiogenesis inhibitors.
  • a targeted therapy is treatment with therapeutic antibodies (antibody therapy), which may be an attractive approach as it targets tumor cells, in contrast to e.g. selective estrogen receptor modulators (SERMs) and chemotherapies which are normally systemic treatments.
  • antibody therapy may be an attractive approach as it targets tumor cells, in contrast to e.g. selective estrogen receptor modulators (SERMs) and chemotherapies which are normally systemic treatments.
  • SERMs selective estrogen receptor modulators
  • breast-conserving therapy combining breast conserving surgery and postoperative radiotherapy, has become the primary treatment of choice in women where radical removal of the tumor can be combined with a good cosmetic result.
  • Mastectomy is still preferable in some patients, i.e., women with small breasts, large tumors (> 4 cm) or multifocal/multicentric disease.
  • Axillary dissection is primarily performed for diagnostic purposes and removal of at least 10 lymph nodes gives a good staging guidance with 97- 98% sensitivity (Axelsson CK et al. (1992) Eur J Cancer 28A:1415-8; Israel A and Houlihan MJ (1995) Cancer 6(9):1491-1512).
  • the next step towards minimal surgery in the treatment of primary cancer has been the introduction of the sentinel node biopsy technique with mapping of axillary lymph nodes instead of axillary lymph node clearance, which is associated with a high complication rate.
  • Adjuvant polychemotherapy has often been the standard treatment for hormone-receptor negative patients with high risk of recurrence, irrespective of nodal status. A beneficial effect on both overall- and relapse- free survival has been demonstrated, especially in premenopausal patients (EBCTCG (1998) Lancet 352(9132): 930-42).
  • EBCTCG 1998 Lancet 352(9132): 930-412.
  • adjuvant polychemotherapy has been delivered in combination with endocrine therapy as sequential chemo-endocrine therapy.
  • adjuvant chemotherapy generally induces amenorrhea, causing a secondary endocrine effect in addition to the cytotoxic (Pagani O et al. (1998) Eur J Cancer 34(5):632-40). Endocrine therapy is recommended for patients with hormone receptor positive tumors irrespective of age, stage and menopausal status.
  • ovarian ablation by surgery or irradiation, or ovarian suppression by LHRH agonists have been shown to be efficient adjuvant treatment modalities (Emens LA and Davidson NA (2003) Clin Ca Res (1 Pt 2): 468S-94S).
  • ovarian ablation has no place, since the primary source of estrogen is not from ovarian synthesis but from the conversion of androstenedione to estrone and estradiol in peripheral tissues including the breast.
  • Tamoxifen is a selective estrogen receptor modulator (SERM) with an agonistic effect on the ER, making it a suitable treatment for advanced breast cancer in both pre- and postmenopausal women.
  • SERM selective estrogen receptor modulator
  • AIs Aromatase inhibitors
  • AIs can be given as adjuvant treatment to postmenopausal women, either alone or following tamoxifen treatment and they have been shown to significantly reduce mortality, possibly even more if given alone (Howell A et al. (1995) Lancet 345(8941)29-30; Ellis MJ and Rigden CE (2006) Curr Med Res Opin 22(12):2479-87; Coates AS et al. (2007) J Clin Oncol 25(5):486- 92).
  • this therapy is relatively new and the long-term side effects are not yet fully known (Buzdar A et al. (2006) Lancet Oncol 7(8):633-43), but the most important are cardiovascular complications and osteoporosis.
  • ER- ER negative
  • ERa- ERa negative tumors respond to tamoxifen treatment
  • Her2 gene is overexpressed in about 20% of all, and in up to 70% of lowly differentiated, breast cancers (Berger MS et al. (1988) Cancer Res 48(5): 1238-43; Borg A et al. (1990) Cancer Res 50(14): 4332-7).
  • HER2 status may be assessed routinely, primarily by immunohistochemistry (IHC) and in cases with moderate expression, gene amplification status may be determined by fluorescence in situ hybridization (FISH) analysis.
  • FISH fluorescence in situ hybridization
  • Objects of other aspects of the present disclosure are to provide affinity ligands capable of interaction with the subsets and compositions comprising such affinity ligands.
  • Further objects of certain other aspects of the present disclosure are to provide uses and methods utilizing the subsets as targets, e.g. for therapeutic purposes.
  • an affinity ligand capable of selective interaction with a subset of 37 consecutive amino acid residues or less from extracellular domains 2 and 3 of HER2 (SEQ ID NO:7), said subset comprising the amino acid sequence LQVF (SEQ ID NO:8) and/or ESFDGD (SEQ ID NO:9).
  • extracellular domains 2 and 3 of HER2 refers to the part of the HER2 sequence which consists of the amino acid residues of SEQ ID NO:7.
  • consecutive amino acid residues from extracellular domains 2 and 3 of HER2 refers to a continuous part of the amino acid sequence of SEQ ID NO:7.
  • selective interaction with a subset of amino acid residues refers to selective interaction with the amino acid residues contained in the subset.
  • an affinity ligand capable of selective interaction with a subset of amino acid residues may be capable of selective interaction with a fragment consisting of the amino acid residues of the subset, which fragment may be present free in solution or immobilized, e.g. bound to a bead. Also, such fragment may be bound to reporter moieties for detection of interaction.
  • affinity ligand capable of selective interaction with a subset of amino acid residues may refer to the case wherein the subset is comprised in a longer polypeptide, provided that it is established that the affinity ligand interacts with the amino acid residues of the subset and not the surrounding amino acid residues.
  • affinity ligand capable of selective interaction with a subset of amino acid residues
  • specific or “selective” interaction of e.g., an affinity ligand with its target or antigen means that the interaction is such that a distinction between specific and non-specific, or between selective and non-selective, interaction becomes meaningful.
  • the interaction between two proteins is sometimes measured by the dissociation constant.
  • the dissociation constant describes the strength of binding (or affinity) between two molecules.
  • the dissociation constant between an antibody and its antigen is from 10 '7 to 10 '11 M.
  • high specificity does not necessarily require high affinity.
  • Molecules with low affinity (in the molar range) for its counterpart have been shown to be as specific as molecules with much higher affinity.
  • a specific or selective interaction refers to the extent to which a particular method can be used to determine the presence and/or amount of a specific protein, the target protein or a fragment thereof, under given conditions in the presence of other proteins in a tissue sample or fluid sample of a naturally occurring or processed biological fluid.
  • specificity or selectivity is the capacity to distinguish between related proteins. Specific and selective are sometimes used interchangeably in the present description.
  • the specificity or selectivity of an antibody may be determined as in Examples, section 4, below, wherein analysis is performed using a protein array set-up, a suspension bead array and a multiplexed competition assay, respectively. Specificity and selectivity determinations are also described in Nilsson P et al. (2005) Proteomics 5:4327-4337.
  • This first aspect of the present invention is based on, but not limited to, that the inventors have found that affinity ligands binding to polypeptides consisting of amino acid sequences within extracellular domains 2 and 3 of HER2, in particular polypeptides comprising the sequences LQVF (SEQ ID NO:8) and/or ESFDGD (SEQ ID NO:9), have a growth inhibiting effect on human breast cancer cells.
  • a polypeptide fragment of 26 amino acid residues (SEQ ID NO:16), and shorter fragments, such as a fragment of 21 amino acid residues (SEQ ID NO: 19), a fragment of 12 amino acid residues (SEQ ID NO:20), two fragments of 9 amino acid residues (SEQ ID NO: 15 and 18) and two fragments of 8 amino acid residues (SEQ ID NO:11 and 17), have been found to interact with antibodies exhibiting a growth inhibiting effect (see also Figure
  • the subset may consist of 30 amino acid residues or less, such as 26 amino acid residues or less. Further, the subset may for example consist of 21 amino acid residues or less, such as 16 amino acid residues or less, such as 12 amino acid residues or less, such as 9 amino acid residues or less, such as 8 amino acid residues or less.
  • a sufficient interaction between the affinity ligand and the subset may in some cases require amino acid sequences of various lengths. Accordingly, in embodiments of the first aspect, the subset may consist of 6 amino acid residues or more, such as 8 amino acid residues or more, such as 10 amino acid residues or more.
  • the subset comprises the sequence LQVF, it may have 2 amino acid residues or less on the C-terminal side of LQVF, such as no amino acid residues on the C- terminal side of LQVF. That is, in some embodiments, the C-terminal of the subset may consist of ... LQVFET (two amino acid residues on the C-terminal side of LQVF), ... LQVFE (one amino acid residue on the C-terminal side of LQVF) or ...
  • LQVF no amino acid residues on the C-terminal side of LQVF.
  • SEQ ID NO:11 and 15-20 have been found to interact with antibodies exhibiting a growth inhibiting effect, i.e. msAb-C (see Examples, section 3).
  • said subset may be selected from the group consisting of SEQ ID NO:11 and 15- 20.
  • the subset may comprise the sequence LQVF.
  • the subset may be selected from the group consisting of SEQ ID NO:16 and 20.
  • SEQ ID NO:16 and 20 respectively, comprises LQVF.
  • the subset may comprise the sequence ESFDGD.
  • the subset may be selected from the group consisting of SEQ ID NO:11 and 15-19.
  • SEQ ID NO:11 and 15-19 comprise ESFDGD.
  • the subset may comprise the sequence PESFDGD (SEQ ID NO:10) or LPESFDGD (SEQ ID NO:11).
  • the subset may comprise the sequence ESFDGDP, such as PESFDGDP, such as LPESFDGDP.
  • the subset may be the sequence of amino acid residues 1-37 of SEQ ID NO:6.
  • affinity ligands of the present disclosure may inhibit growth of breast cancer cells.
  • the affinity ligand may inhibit growth of human breast cancer cells, such as human breast cancer cells in culture.
  • the affinity ligand may inhibit growth of human breast cancer cells in culture by 20-100%, such as by 30-100%, relative to an affinity ligand not capable of selective interaction with the extracellular domain of HER2, such as an antibody capable of selective interaction with the intracellular domain of HER2. It is within the capabilities of those skilled in the art to perform measurements yielding such a relative growth inhibition value and to adapt such measurements to a specific case.
  • the measurement of a relative inhibition may be performed by adding a certain concentration of the affinity ligand to a first culture of human breast cancer cells, such as BT474 breast cancer cells, and the same concentration of an antibody capable of selective interaction with the intracellular domain of HER2, such as HPA001383 (Atlas Antibodies, Sweden), to a second culture of the same type of human breast cancer cells. After a certain time of incubation, such as 4 days, the number of cells in the respective culture is counted. The number of cells in the second culture is considered as the reference, and the growth inhibition value of the affinity ligand is calculated relative that reference.
  • the human breast cancer cells may for example be BT474 breast cancer cells.
  • the growth inhibition may for example be a growth inhibition at a concentration of 500 ng/ml.
  • affinity ligands of the present disclosure may bind their targets at a low concentration. Accordingly, in embodiments of the first aspect, the affinity ligand may bind the subset with an EC50 of less than 100 nM, such as less than 50 nM, such as less than 20 nM, such as less than 10 nM. EC50-measurements may for example be performed according to Examples, section 4c and 4e, below.
  • the affinity ligand may be an antibody or fragment or derivative thereof.
  • Such antibodies may for example be generated according to the Example sections of the present disclosure.
  • affinity ligands are given below ("Affinity ligands").
  • an affinity ligand according to the first aspect for use as a medicament.
  • HER2 there are a number of disorders characterized by the overexpression of HER2, and affinity ligands binding the extracellular domain of HER2 may be used as a medicament for treating, or affecting the progression of, such disorders.
  • an affinity ligand according to the first aspect for treatment of a mammalian subject having, or suspected of having, a disorder characterized by the overexpression of HER2.
  • HER2 disorders Examples of different disorders characterized by the overexpression of HER2 according to the first aspect are discussed below ("HER2 disorders").
  • a mammalian subject having a breast cancer refers to a mammalian subject having a primary or secondary breast tumor or a mammalian subject which has had a tumor removed from the breast, wherein the removal of the tumor refers to killing or removing the tumor by any type of surgery or therapy.
  • Breast tumor includes ductal carcinoma in situ (DCIS).
  • DCIS ductal carcinoma in situ
  • a mammalian subject suspected of having a breast cancer may for example be a subject presenting typical breast cancer syndrome(s) and/or indicators of high risk for breast cancer, such as an earlier breast cancer or hereditary characteristics, e.g. a history of breast cancer in the family.
  • the risk may also be assessed according to a model, such as the Gail model.
  • the subject may have been treated by a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • the disorder characterized by the overexpression of HER2 may for example be a cancer, such as a breast cancer, e.g., a metastatic breast cancer, that has developed resistance to the therapeutic antibody.
  • the therapeutic antibody capable of selective interaction with HER2 may be trastuzumab or pertuzumab.
  • a composition comprising an affinity ligand according to the first aspect and a second affinity ligand capable of selective interaction with a second subset of 73 consecutive amino acid residues or less from extracellular domains 2 and 3 of HER2 (SEQ ID NO:7), said second subset comprising the amino acid sequence of SEQ ID NO:12, SEQ ID NO:13 and/or SEQ ID NO:14.
  • This second aspect is based on, but not limited to, the inventors' insight that a combination of antibodies targeting two different parts of extracellular domains 2 and 3 of HER2 may result in a greater growth inhibiting effect than antibodies targeting only one of the parts. This is further discussed in Examples, section 5d-f, below.
  • the sequences SEQ ID NO:21-34 have been found to interact with msAb-N. Accordingly, in embodiments of the second aspect, the second subset may be selected from the amino acid sequences of the group consisting of SEQ ID NO:21-34.
  • SEQ ID NO:21-34 are 26, 44, 27, 45, 19, 39, 23, 31 , 70, 22, 22, 23, 38 and 23 amino acid residues long, respectively (see also Figure 7). Also, the identified epitopes SEQ ID NO: 12-14 are 8, 10 and 16 amino acid residues long, respectively.
  • the second subset may be 70 amino acid residues or less, such as 55 amino acid residues or less, such as 45 amino acid residues or less, such as 44 amino acid residues or less, such as 39 amino acid residues or less, such as 38 amino acid residues or less, such as 31 amino acid residues or less, such as 27 amino acid residues or less, such as 26 amino acid residues or less, such as 23 amino acid residues or less, such as 22 amino acid residues or less, such as 19 amino acid residues or less, such as 16 amino acid residues or less, such as 10 amino acid residues or less, such as 8 amino acid residues or less.
  • the second subset of the embodiments of the second aspect may for example be 8 amino acid residues or more, such as 10 amino acid residues or more. This is further discussed above.
  • the second subset may consist of amino acid residues 39-111 of the sequence SEQ ID NO:4.
  • the composition may inhibit growth of human breast cancer cells, such as human breast cancer cells in culture.
  • the composition may inhibit growth of human breast cancer cells in culture by 20-100%, such as by 30-100%, relative to an affinity ligand not capable of selective interaction with the extracellular domain of HER2, such as an antibody capable of selective interaction with the intracellular domain of HER2. It is within the capabilities of the skilled artisan to perform measurements yielding such relative growth inhibition value and to adapt such measurements to a specific case.
  • the human breast cancer cells may for example be BT474 breast cancer cells.
  • the growth inhibition may for example be a growth inhibition at a concentration of 500 ng/ml. An example of a growth inhibition measurement is described above in connection with the first aspect.
  • the second affinity ligand may bind the second subset with an EC50 of less than 100 nM, such as less than 50 nM, such as less than 20 nM, such as less than 10 nM.
  • EC50-measurements may for example be performed according to Examples, sections 4c and 4e, below.
  • the second affinity ligand may be an antibody or fragment or derivative thereof. Such an antibody may for example be generated according the Example sections of the present disclosure.
  • affinity ligands suitable for the second affinity ligand of the second aspect are discussed below ("Affinity ligands").
  • affinity ligands In order to strengthen and/or prolong the effect of an affinity ligand according to the first aspect or a composition according to the second aspect or to counteract the development of resistance, the affinity ligand or composition may be combined with a tyrosine kinase inhibitor targeted against HER2.
  • a composition comprising: an affinity ligand according to the first aspect or a composition according to the second aspect; and a tyrosine kinase inhibitor against HER2.
  • the tyrosine kinase inhibitor against HER2 may for example be lapatinib, gefitinib or erlotinib.
  • a composition according to the second aspect for use as a medicament.
  • compositions comprising affinity ligands binding the extracellular domain of HER2 may be used as a medicament for treating, or affecting the progression of, such disorders.
  • composition according to the second aspect for treatment of a mammalian subject having, or suspected of having, a disorder characterized by the overexpression of HER2.
  • HER2 disorders examples of different disorders characterized by the overexpression of HER2 according to the second aspect are discussed below ("HER2 disorders").
  • a composition comprising antibodies targeting other parts of the extracellular domain of HER2 than the anti-HER2 antibody may be suitable for further treatment of patients having such cancers.
  • the subject may have been treated by a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand or the second affinity ligand.
  • the disorder characterized by the overexpression of HER2 may for example be a cancer, such as a breast cancer, e.g., a metastatic breast cancer, that have developed resistance to the therapeutic antibody.
  • a cancer such as a breast cancer, e.g., a metastatic breast cancer, that have developed resistance to the therapeutic antibody.
  • the therapeutic antibody capable of selective interaction with HER2 may be trastuzumab or pertuzumab.
  • an isolated polypeptide consisting of 37 consecutive amino acid residues or less from extracellular domains 2 and 3 of HER2 (SEQ ID NO:7) and comprising the amino acid sequence LQVF (SEQ ID N0:8) and/or ESFDGD (SEQ ID N0:9).
  • This third aspect of the present disclosure is based on, but not limited to, the inventors' insight that certain parts of the extracellular domain of HER2 is particularly interesting, e.g. as a therapeutic target, and that fragments comprising or consisting of such parts may be utilized for production, selection or purification of therapeutic means.
  • a polypeptide fragment of 26 amino acid residues (SEQ ID NO:16), and shorter fragments, such as a fragment of 21 amino acid residues (SEQ ID NO: 19), a fragment of 12 amino acid residues (SEQ ID NO:20), two fragments of 9 amino acid residues (SEQ ID NO:15 and 18) and two fragments of 8 amino acid residues (SEQ ID NO:11 and 17), have been found to interact with antibodies exhibiting a growth inhibiting effect.
  • the polypeptide may consist of 31 amino acid residues or less, such as 26 amino acid residues or less, such as 21 amino acid residues or less, such as 16 amino acid residues or less, such as 12 amino acid residues or less, such as 9 amino acid residues or less, such as 8 amino acid residues or less.
  • an affinity ligand such as an affinity ligand of the first aspect
  • the polypeptide may consist of 6 amino acid residues or more, such as 8 amino acid residues or more, such as 10 amino acid residues or more.
  • SEQ ID NO:1 an antigen in which the last four amino acid residues at the C- terminal end were LQVF.
  • the polypeptide comprises the sequence LQVF, it has 2 amino acid residues or less on the C-terminal side of LQVF, such as no amino acid residues on the C-terminal side of LQVF. That is, in some embodiments, the C-terminal of the polypeptide may consist of ... LQVFET (two amino acid residues on the C- terminal side of LQVF), ... LQVFE (one amino acid residue on the C-terminal side of LQVF) or ... LQVF (no amino acid residues on the C-terminal side of LQVF).
  • polypeptide may be selected from the group consisting of the sequences SEQ ID NO:11 and 15-20.
  • the polypeptide may comprise the sequence LQVF (SEQ ID NO:8).
  • the polypeptide may for example be selected from the group consisting of sequences SEQ ID NO:16 and 20.
  • SEQ ID NO:16 and 20 comprise LQVF.
  • the polypeptide may comprise the sequence ESFDGD (SEQ ID NO:9).
  • the polypeptide may for example be selected from the group consisting of SEQ ID NO:11 and 15-19.
  • polypeptide may comprise the sequence PESFDGD (SEQ ID NO:10) or LPESFDGD (SEQ ID NO:11).
  • the polypeptide may consist of the sequence of amino acid residues 1-37 of SEQ ID NO:6. (That is a 37 amino acid residues-long subsequence of SEQ ID NO:6 ending with LQVF.)
  • a polypeptide according to the third aspect for use as an antigen, such as an antigen for an immunization, e.g. of a non-human mammal.
  • an antigen such as an antigen for an immunization, e.g. of a non-human mammal.
  • a polypeptide according to the third aspect for use in the preparation of therapeutic antibodies, e.g. therapeutic antibodies for treatment of disorders characterized by overexpression of HER2. Examples of different disorders characterized by the overexpression of HER2 according to the third aspect are discussed below ("HER2 disorders").
  • a polypeptide according to the third aspect as an antigen, such as an antigen for an immunization, e.g., an immunization of a non-human mammal.
  • an antigen for an immunization e.g., an immunization of a non-human mammal.
  • a polypeptide according to the third aspect in the preparation of a therapeutic antibody, such as a therapeutic monoclonal antibody, e.g., a therapeutic chimeric or humanized monoclonal antibody.
  • monoclonal antibodies may be made by fusing the spleen cells from a mouse that has been immunized with the polypeptide with myeloma cells. Further, rabbit B-cells may also be used for this purpose. This mixture of cells may then be diluted, and clones may be grown from single parent cells. The antibodies secreted by the different clones may then be tested for their ability to bind to the polypeptide. Subsequently, a stable and/or productive clone may be grown in culture medium to a high volume. For example, the DNA that encodes the binding portion of the monoclonal mouse antibodies from the stable clone may be merged with human antibody encoding DNA.
  • Mammalian cell cultures may then be used to express the genetically engineered DNA and produce mouse-human antibodies. Depending on the size of the mouse antibody part, one talks about chimeric antibodies or humanized antibodies. As another example, mice genetically engineered to produce more human-like antibodies may be involved.
  • the chimeric antibodies or humanized antibodies may then be used as therapeutic antibodies, e.g. for treatment of disorders characterized by overexpression of HER2.
  • HER2 disorders As a second configuration of the fourth aspect, there is provided the use of a polypeptide according to the third aspect for the selection or purification of an therapeutic affinity ligand for treatment of a disorder characterized by the overexpression of HER2. Examples of different disorders characterized by the overexpression of HER2 according to the fourth aspect are discussed below ("HER2 disorders").
  • such use may comprise affinity purification on a solid support onto which the polypeptide has been immobilized.
  • the solid support may for example be arranged in a column.
  • the use may comprise selection of affinity ligands having specificity for a polypeptide according to the third aspect using a solid support onto which the polypeptide has been immobilized.
  • Such solid support may be 96 well plates, magnetic beads, agarose beads or sepharose beads.
  • the use may comprise analysis of affinity ligands on a soluble matrix for example using a dextran matrix or use in a surface plasmon resonance instrument, such as a BiacoreTM instrument, were the analysis may for example comprise monitoring the affinity for the immobilized polypeptide and a number of potential affinity ligands.
  • an affinity ligand according to the first aspect as a medicament.
  • an affinity ligand according to first aspect for the manufacture of a medicament for treatment of a mammalian subject having, or suspected of having, a disorder characterized by the overexpression of HER2.
  • HER2 disorders examples of different disorders characterized by the overexpression of HER2 according to the fifth aspect are discussed below ("HER2 disorders").
  • the subject may have been treated by a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • the disorder characterized by the overexpression of HER2 may be a cancer, such as a breast cancer, e.g., a metastatic breast cancer, that has developed resistance to the therapeutic antibody.
  • a cancer such as a breast cancer, e.g., a metastatic breast cancer, that has developed resistance to the therapeutic antibody.
  • a method for identification of an affinity ligand for treatment of a disorder characterized by the overexpression of HER2 comprising the steps of: a) contacting a polypeptide comprising a subset according to the first aspect with a putative affinity ligand; and b) determining whether the putative affinity ligand binds to the subset.
  • step a) may be: contacting a polypeptide according to the third aspect with a putative affinity ligand in conditions that enable binding; and step b) may be: determining whether the putative affinity ligand binds to the polypeptide.
  • HER2 disorders examples of different disorders characterized by the overexpression of HER2 according to the sixth aspect are given below ("HER2 disorders").
  • affinity ligands examples are given below ("Affinity ligands"). This sixth aspect is based on, but not limited to, the inventors' insight that protein fragments corresponding to the identified target sequences of the extracellular domain of HER2 may be useful for identification or selection of therapeutic affinity ligands.
  • the method may further comprise the step: c) determining whether the putative affinity ligand inhibits growth or induces apoptosis of cancer cells, such as breast cancer cells, e.g., BT474 breast cancer cells.
  • the criterion of step c) may be that the putative affinity ligand inhibits growth by 20 % or more, such as 30 % or more, as compared to an antibody targeting the intracellular part of HER2.
  • the putative affinity ligand may inhibit growth at a concentration of 250 or 500 ng/ml.
  • a method for identification of one or more affinity ligands for treatment of a disorder characterized by the overexpression of HER2 comprising the steps of: a) contacting a polypeptide according to the third aspect with one or more putative affinity ligands; and b) identifying affinity ligands that bind to the polypeptide.
  • a method for producing a clone e.g., a clone expressing a therapeutic antibody for treatment of a disorder characterized by the overexpression of HER2, comprising: a) providing cells obtained from a mammal which has been immunized with an antigen comprising a subset according to the first aspect, which cells comprise DNA encoding an antibody capable of selective interaction with the subset; and b) fusing said cells with myeloma cells to obtain at least one clone.
  • a clone refers to a group of identical cells that share a common ancestry, i.e. are derived from the same mother cell.
  • step b) may comprise culturing.
  • the method further comprises the step: a') immunizing the mammal with the antigen, wherein step a') precedes step a).
  • the mammal of step a) may be a non-human mammal.
  • the cells provided in step a) may for example be spleen cells.
  • the mammal of step a) may for example be a mouse. Consequently, the cells provided in step a) may for example be spleen cells from a mouse.
  • the cells provided in step a) may for example be B-cells.
  • the mammal of step a) may for example be a rabbit. Consequently, the cells provided in step a) may for example be rabbit B-cells.
  • the method may further comprise the step: c) selecting a clone from step b) which secretes antibodies capable of selective interaction with the subset.
  • the antigen may consist of a polypeptide according to the third aspect.
  • a clone which secretes antibodies capable of selective interaction with the antigen is selected, if the method comprises step c).
  • the method may further comprise the step: d) providing a clone obtained in step b) or selected in step c), and merging DNA from the clone, which DNA encodes at least the part of an antibody expressed by the clone that selectively interacts with the subset, with human antibody encoding DNA; and e) incorporating the merged DNA from step d) in cells to obtain a clone for expression of a therapeutic antibody for treatment of a disorder characterized by the overexpression of HER2.
  • step e) may comprise culturing.
  • the clone of step e) may for example be a mammalian cell line.
  • the therapeutic antibodies expressed by the clone of step e) may for example be chimeric or humanized antibodies.
  • an affinity ligand such as an antibody, e.g. a therapeutic antibody
  • a method of producing an affinity ligand comprising: identifying an affinity ligand using the method according to the sixth aspect; and producing said identified affinity ligand. It is within the capabilities of the skilled person, especially if guided by the teachings of the present disclosure, to produce such identified affinity ligand.
  • a method of producing an affinity ligand, such as an antibody, e.g. a therapeutic antibody comprising: producing a clone using the method according to the second configuration of the sixth aspect; and obtaining said affinity ligand from said clone.
  • obtaining said affinity ligand from the clone may comprise initiating expression of the affinity ligand, e.g. an antibody, and harvesting of the subsequently secreted affinity ligand (e.g. antibody).
  • obtaining said affinity ligand from the clone may comprise initiating expression of the affinity ligand, e.g. an antibody, and harvesting of the subsequently secreted affinity ligand (e.g. antibody).
  • obtaining said affinity ligand from the clone may comprise initiating expression of the affinity ligand, e.g. an antibody, and harvesting of the subsequently secreted affinity ligand (e.g. antibody).
  • a method of treatment of a mammalian subject having, or suspected of having, a disorder characterized by the overexpression of HER2 comprising administering an effective amount of an affinity ligand according to the first aspect or a composition according to the second aspect to the subject. Examples of different disorders characterized by the overexpression of
  • HER2 according to the seventh aspect are discussed below ("HER2 disorders").
  • the method may further comprise administering a tyrosine kinase inhibitor against HER2 to the subject.
  • the treatment may be a pre-surgical treatment. Consequently, e.g., a subject suspected of having a breast cancer or having a high risk of breast cancer recurrence or a subject having a breast cancer surgery scheduled may be treated according to the seventh aspect.
  • the treatment may be a post-surgical treatment.
  • the treatment may be pre- and post-surgical treatment, e.g., a first effective amount of the affinity ligand or composition may be administered to the subject before surgical removal of a breast cancer tumor and a second effective amount of the affinity ligand or composition may be administered to the subject after the surgical removal of the breast cancer tumor.
  • the subject may have been treated by a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • Such therapeutic antibody may for example be trastuzumab or pertuzumab.
  • the disorder characterized by the overexpression of HER2 may be a cancer, such as a breast cancer, that has developed resistance to the therapeutic antibody.
  • an article of manufacture comprising: a container; a composition within the container comprising an affinity ligand according to the first aspect or a composition according to the second aspect; and a label on or associated with the container that indicates that said composition can be used for treating a disorder characterized by the overexpression of HER2.
  • the container may be a bottle, vial or syringe.
  • the container may be formed from a variety of materials such as glass or plastic.
  • the container holds an affinity ligand or composition which is effective for treating the disorder and may have a sterile access port.
  • the container may be an intravenous solution bag or a vial having a stopper pierceable by a hypodermic injection needle.
  • the article of manufacture may further comprise a second container comprising a pharmaceutically acceptable buffer, such as phosphate-buffered saline, Ringer's solution or dextrose solution.
  • a pharmaceutically acceptable buffer such as phosphate-buffered saline, Ringer's solution or dextrose solution.
  • the article of manufacture may further include other materials desirable from a commercial and user standpoint, including other buffers, diluents, filters, needles, and syringes.
  • the article of manufacture may, in addition, comprise a package insert with instructions for use. This may for example be instructions for pre- and/or post-surgical use and/or instructions for administration to a subject having a cancer which has developed resistance to a therapeutic anti-HER2 antibody.
  • an affinity ligand which is the second affinity ligand of the second aspect.
  • an affinity ligand according to the ninth aspect for use as a medicament.
  • disorders characterized by the overexpression of HER2 and affinity ligands binding the extracellular domain of HER2 may be used as a medicament for treating, or affecting the progression of, such disorders.
  • the affinity ligand according to the ninth aspect for treatment of a disorder characterized of overexpression of HER2.
  • HER2 disorders examples of different disorders characterized by the overexpression of HER2 according to the ninth aspect are discussed below ("HER2 disorders").
  • the subject may have been treated by a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand according to the ninth aspect.
  • the disorder characterized by the overexpression of HER2 may for example be a cancer, such as a breast cancer, e.g., a metastatic breast cancer, that have developed resistance to the therapeutic antibody.
  • the therapeutic antibody capable of selective interaction with HER2 may be trastuzumab or pertuzumab.
  • an isolated polypeptide consisting of 73 consecutive amino acid residues or less from extracellular domains 2 and 3 of HER2 (SEQ ID NO:7) and comprising the amino acid sequence of SEQ ID NO:12, SEQ ID NO:13 and/or SEQ ID NO:14.
  • This tenth aspect of the present disclosure is based on, but not limited to, the inventors' insight that certain parts of the extracellular domain of HER2 is particularly interesting, e.g. as a therapeutic target, and that fragments comprising or consisting of such parts may be utilized for production, selection or purification of therapeutic means.
  • the polypeptide may consist of a amino acid sequence selected from the group consisting of SEQ ID NO:21- 34.
  • polypeptides SEQ ID NO:21-34 which have been found to interact with msAb-N, are 26, 44, 27, 45, 19, 39, 23, 31 , 70, 22, 22, 23, 38 and 23 amino acid residues long, respectively (see also Figure 7). Also, the identified epitopes SEQ ID NO: 12-14 are 8, 10 and 16 amino acid residues long, respectively.
  • the polypeptide may consist of 70 amino acid residues or less, such as 55 amino acid residues or less, such as 45 amino acid residues or less, such as 44 amino acid residues or less, such as 39 amino acid residues or less, such as 38 amino acid residues or less, such as 31 amino acid residues or less, such as 27 amino acid residues or less, such as 26 amino acid residues or less, such as 23 amino acid residues or less, such as 22 amino acid residues or less, such as 19 amino acid residues or less, such as 16 amino acid residues or less, such as 10 amino acid residues or less, such as 8 amino acid residues or less.
  • an affinity ligand such as an affinity ligand of the ninth aspect
  • the polypeptide may in some cases require amino acid sequences of various lengths. Accordingly, in embodiments of the tenth aspect, the polypeptide may consist of 6 amino acid residues or more, such as 8 amino acid residues or more, such as 10 amino acid residues or more.
  • the polypeptide may comprise the sequence SEQ ID NO:12.
  • the polypeptide may for example consist of any one of the sequences SEQ ID NO21-34 that comprises SEQ ID NO:12.
  • the polypeptide may comprise the sequence SEQ ID NO:13.
  • the polypeptide may for example consist of any one of the sequences SEQ ID NO:21-34 that comprises SEQ ID NO:13.
  • the polypeptide may comprise the sequence SEQ ID NO: 14.
  • the polypeptide may for example consist of any one of the sequences SEQ ID NO:21-34 that comprises SEQ ID NO:14.
  • the polypeptide may consist of amino acid residues 39-111 of the sequence SEQ ID NO:4.
  • a polypeptide according to the tenth aspect for use as an antigen, such as an antigen for an immunization, e.g. of a non-human mammal.
  • HER2 disorders As a related configuration thereof, there is provided a polypeptide according to the tenth aspect for use in the preparation of therapeutic antibodies, e.g. therapeutic antibodies for treatment of disorders characterized by overexpression of HER2. Examples of different disorders characterized by the overexpression of HER2 according to the tenth aspect are discussed below ("HER2 disorders").
  • a polypeptide according to the tenth aspect as an antigen, such as an antigen for an immunization, e.g., an immunization of a non-human mammal.
  • an antigen for an immunization e.g., an immunization of a non-human mammal.
  • a polypeptide according to the tenth aspect in the preparation of a therapeutic antibody, such as therapeutic monoclonal antibody, e.g., a therapeutic chimeric or humanized monoclonal antibody. This is further discussed above in connection with the first configuration of the fourth aspect.
  • a polypeptide according to the tenth aspect for the selection or purification of a therapeutic affinity ligand for treatment of a disorder characterized by the overexpression of HER2.
  • HER2 disorders examples of different disorders characterized by the overexpression of HER2 according to the eleventh aspect are discussed below ("HER2 disorders").
  • such use may comprise affinity purification on a solid support onto which the polypeptide has been immobilized.
  • the solid support may for example be arranged in a column.
  • the use may comprise selection of affinity ligands having specificity for a polypeptide according to the tenth aspect using a solid support onto which the polypeptide has been immobilized.
  • Such solid support may be 96 well plates, magnetic beads, agarose beads or sepharose beads.
  • the use may comprise analysis of affinity ligands on a soluble matrix for example using a dextran matrix or use in a surface plasmon resonance instrument, such as a BiacoreTM instrument, were the analysis may for example comprise monitoring the affinity for the immobilized polypeptide and a number of potential affinity ligands.
  • an affinity ligand according to the ninth aspect as a medicament.
  • an affinity ligand according to ninth aspect for the manufacture of a medicament for treatment of a mammalian subject having, or suspected of having, a disorder characterized by the overexpression of HER2. Examples of different disorders characterized by the overexpression of HER2 according to the twelfth aspect are discussed below ("HER2 disorders").
  • the subject may have been treated by an therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • the disorder characterized by the overexpression of HER2 may be a cancer, such as a breast cancer, e.g., a metastatic breast cancer, that has developed resistance to the therapeutic antibody.
  • a method for identification of an affinity ligand for treatment of a disorder characterized by the overexpression of HER2 comprising the steps of: a) contacting a Polypeptide comprising a second subset according to the second aspect with a putative affinity ligand; and b) determining whether the putative affinity ligand binds to the second subset.
  • step a) may be: contacting a polypeptide according the tenth aspect with a putative affinity ligand in conditions that enable binding; and step b) may be: determining whether the putative affinity ligand binds to the polypeptide.
  • HER2 disorders examples of different disorders characterized by the overexpression of HER2 according to the thirteenth aspect are given below ("HER2 disorders”). Further, examples of affinity ligands according to the thirteenth aspect are given below ("Affinity ligands").
  • This thirteenth aspect is based on, but not limited to, the inventors' insight that protein fragments corresponding to the identified target sequences of the extracellular domain of HER2 may be useful for identification or selection of therapeutic affinity ligands.
  • the method may further comprise the step: c) determining whether the putative affinity ligand inhibits growth or induces apoptosis of cancer cells, such as breast cancer cells, e.g., BT474 breast cancer cells.
  • the criterion of step c) may be that the putative affinity ligand inhibits growth more than an antibody targeting the intracellular part of HER2.
  • the putative affinity ligand may inhibit growth at a concentration of 250 or 500 ng/ml.
  • a method for identification of one or more affinity ligands for treatment of a disorder characterized by the overexpression of HER2 comprising the steps of: a) contacting a polypeptide according to the tenth aspect with one or more putative affinity ligands; and b) identifying affinity ligands that bind to the polypeptide.
  • a method for producing a clone e.g., a clone expressing a therapeutic antibody for treatment of a disorder characterized by the overexpression of HER2, comprising: a) providing cells obtained from a mammal which has been immunized with an antigen comprising the second subset according to the second aspect, which cells comprise DNA encoding an antibody capable of selective interaction with the subset; and b) fusing said cells with myeloma cells to obtain at least one clone.
  • step b) may comprise culturing.
  • the method further comprises the step: a') immunizing the mammal with the antigen, wherein step a') precedes step a).
  • the mammal of step a) may be a non-human mammal.
  • the cells provided in step a) may for example be spleen cells.
  • the mammal of step a) may for example be a mouse. Consequently, the cells provided in step a) may for example be spleen cells from a mouse.
  • the cells provided in step a) may for example be B-cells.
  • the mammal of step a) may for example be a rabbit. Consequently, the cells provided in step a) may for example by rabbit B-cells.
  • the method may further comprise the step: c) selecting a clone from step b) which secretes antibodies capable of selective interaction with the subset.
  • the antigen may consist of a polypeptide according to the tenth aspect.
  • a clone which secretes antibodies capable of selective interaction with the antigen is selected, if the method comprises step c).
  • the method may further comprise the step: d) providing a clone obtained in step b) or selected in step c), and merging DNA from the clone, which DNA encodes at least the part of an antibody expressed by the clone that selectively interacts with the subset, with human antibody encoding DNA; and f) incorporating the merged DNA from step d) in cells to obtain a clone for expression of a therapeutic antibody for treatment of a disorder characterized by the overexpression of HER2.
  • step e) may comprise culturing.
  • the clone of step e) may for example be a mammalian cell line.
  • the therapeutic antibodies expressed by the clone of step e) may for example be chimeric or humanized antibodies.
  • an affinity ligand such as an antibody, e.g. a therapeutic antibody
  • a method of producing an affinity ligand comprising: identifying an affinity ligand using the method according to the thirteenth aspect; and producing said identified affinity ligand. It is within the capabilities of the skilled person, especially if guided by the teachings of the present disclosure, to produce such identified affinity ligand.
  • a method of producing an affinity ligand, such as an antibody, e.g. a therapeutic antibody comprising: producing a clone using the method according to the second configuration of the thirteenth aspect; and obtaining said affinity ligand from said clone.
  • obtaining said affinity ligand from the clone may comprise initiating expression of the affinity ligand, e.g. an antibody, and harvesting of the subsequently secreted affinity ligand (e.g. antibody).
  • a fourteenth aspect of the present disclosure there is provided a method of treatment of a mammalian subject having, or suspected of having, a disorder characterized by the overexpression of HER2, comprising administering an effective amount of an affinity ligand according to the ninth aspect to the subject.
  • the method may further comprise administering a tyrosine kinase inhibitor against HER2 to the subject.
  • the treatment may be a pre-surgical treatment. Consequently, e.g., a subject suspected of having a breast cancer or having a high risk of breast cancer recurrence or a subject having a breast cancer surgery scheduled may be treated according to the fourteenth aspect.
  • the treatment may be a post-surgical treatment.
  • the treatment may be pre- and post-surgical treatment, e.g., a first effective amount of the affinity ligand may be administered to the subject before surgical removal of a breast cancer tumor and a second effective amount of the affinity ligand may be administered to the subject after the surgical removal of the breast cancer tumor.
  • the subject may have been treated by a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • a therapeutic antibody capable of selective interaction with HER2, such as the extracellular domain of HER2, which therapeutic antibody is different from the affinity ligand.
  • Such therapeutic antibody may for example be trastuzumab or pertuzumab.
  • the disorder characterized by the overexpression of HER2 may be a cancer, such as a breast cancer, that has developed resistance to the therapeutic antibody.
  • an article of manufacture comprising: a container; a composition within the container comprising an affinity ligand according to the ninth aspect; and a label on or associated with the container that indicates that said composition can be used for treating a disorder characterized by the overexpression of HER2.
  • HER2 disorders Examples of different disorders characterized by the overexpression of HER2 according to the fifteenth aspect are discussed below ("HER2 disorders").
  • the affinity ligands according to the various embodiments of the above aspects of the present disclosure may independently be any type of affinity ligands.
  • the affinity ligands may be independently selected from the group consisting of antibodies, fragments thereof and derivatives thereof, i.e., affinity ligands based on an immunoglobulin scaffold.
  • the antibodies may be isolated and/or mono-specific.
  • Antibodies comprise monoclonal and polyclonal antibodies of any origin, including murine, rabbit, human and other antibodies, as well as chimeric antibodies comprising sequences from different species, such as partly humanized antibodies or humanized antibodies, such as partly humanized or humanized mouse antibodies.
  • antibodies are produced by immunization of animals with the antigen of choice; polyclonal antibodies are then purified from blood/sera, whereas monoclonal antibodies of defined specificity can be produced using the hybridoma technology developed by K ⁇ hler and Milstein (Kohler G and Milstein C (1976) Eur. J. Immunol. 6:511- 519).
  • Antibody fragments and derivatives comprise Fab fragments, consisting of the first constant domain of the heavy chain (CH 1), the constant domain of the light chain (CL), the variable domain of the heavy chain (VH) and the variable domain of the light chain (VL) of an intact immunoglobulin protein; Fv fragments, consisting of the two variable antibody domains VH and VL (Skerra A and Pl ⁇ ckthun A (1988) Science 240:1038-1041); single chain Fv fragments (scFv), consisting of the two VH and VL domains linked together by a flexible peptide linker (Bird RE and Walker BW (1991) Trends Biotechnol. 9:132-137); Bence Jones dimers (Stevens FJ et al.
  • Antibodies as well as their fragments and derivatives, represent the traditional choice of affinity ligands in therapeutic applications.
  • those of skill in the art know that, e.g., due to the increasing demand of high throughput generation of selective binding ligands and low cost production systems, new biomolecular diversity technologies have been developed during the last decade. This has enabled a generation of novel types of affinity ligands of both immunoglobulin and non-immunoglobulin origin that may be useful as binding ligands in e.g. therapeutic applications and can be used instead of, or together with, immunoglobulins.
  • the biomolecular diversity needed for selection of affinity ligands may be generated by combinatorial engineering of one of a plurality of possible scaffold molecules, and specific and/or selective affinity ligands are then selected using a suitable selection platform.
  • the scaffold molecule may be of immunoglobulin protein origin (Bradbury AR and Marks JD (2004) J. Immunol. Meths. 290:29-49), of non-immunoglobulin protein origin (Nygren PA and Skerra A (2004) J. Immunol. Meths. 290:3-28), or of an oligonucleotide origin
  • non-immunoglobulin protein scaffolds have been used as supporting structures in development of novel binding proteins.
  • Non-limiting examples of such structures, useful for generating affinity ligands against the relevant HER2 subsets are staphylococcal protein A and domains thereof and derivatives of these domains, such as protein Z (Nord K et al.
  • protease inhibitors such as Knottin proteins (Wentzel A et al.
  • non-immunoglobulin protein scaffolds include scaffold proteins presenting a single randomized loop used for the generation of novel binding specificities, protein scaffolds with a rigid secondary structure where side chains protruding from the protein surface are randomized for the generation of novel binding specificities, and scaffolds exhibiting a non-contiguous hyper-variable loop region used for the generation of novel binding specificities.
  • oligonucleotides may also be used as affinity ligands.
  • oligonucleotide ligands can be either RNA or DNA and can bind to a wide range of target molecule classes.
  • Selection platforms include, but are not limited to, phage display (Smith GP (1985) Science 228:1315-1317), ribosome display (Hanes J and Pl ⁇ ckthun A (1997) Proc. Natl. Acad. Sci. U.S.A.
  • yeast two- hybrid system Yields S and Song O (1989) Nature 340:245-246
  • yeast display Gai SA and Wittrup KD (2007) Curr Opin Struct Biol 17:467-473
  • mRNA display Robotts RW and Szostak JW (1997) Proc. Natl. Acad. Sci. U.S.A. 94:12297-12302
  • bacterial display Daugherty PS (2007) Curr Opin Struct Biol 17:474-480, Kronqvist N et al. (2008) Protein Eng Des Se1 1-9, Harvey BR et al.
  • the affinity ligands may each independently be a non-immunoglobulin affinity ligand derived from any of the protein scaffolds listed above, or an oligonucleotide molecule.
  • the disorder characterized by the overexpression of HER2 may be a cancer.
  • the cancer may be selected from the group consisting of breast cancer, squamos cell cancinoma, lung cancer, such as small cell or non-small cell lung cancer, pancreatic cancer, glioblastoma, cervical cancer, ovarian cancer, vulval cancer, liver cancer, hepatoma, colorectal cancer, such as colon cancer, endometrial carcinoma, salivary gland carcinoma, kidney cancer, thyroid cancer, Wilm's tumor, bladder cancer, endometrial cancer, renal cancer, head and neck cancer, gastric cancer, esophageal cancer and prostate cancer.
  • the cancer may be selected from the group consisting of breast cancer, lung cancer, pancreatic cancer, colorectal cancer and Wilm's tumor.
  • the HER2 protein has been reported to be overexpressed in about 20% of all, and in up to 70% of lowly differentiated, breast cancers. Also, the efficiency of anti-HER2 treatment of breast cancer subjects, e.g. subjects having metastatic breast cancer, have been well studied.
  • the disorder characterized by the overexpression of HER2 may be a breast cancer.
  • the breast cancer may be a metastatic breast cancer.
  • Figure 1 shows affinity purification and specificity analyses.
  • 1a shows a schematic drawing of the setup for serial selective affinity purification.
  • Polyclonal antibodies raised against the full-length antigen, here denoted 866 (SEQ ID NO:1) were split into four specific populations: an anti- C-terminal fraction (Ab-C); an anti-M (middle) fraction (Ab-M); anti-N-terminal fraction (Ab-N); and finally a full-length antigen column were connected to collect possible antibodies binding structural epitopes (Ab-S).
  • 1c shows a Luminex bead array competition assay used for estimation of relative affinities of the purified mono-specific antibodies.
  • the interaction between mono-specific antibody and the full antigen (i.e., 866 (SEQ ID NO:1)) immobilized on the bead surface was challenged using an increasing concentration of soluble full-length antigen (i.e., 866 (SEQ ID NO:1)) as competitor protein fragment.
  • FIG. 2 shows the result of Fluorescence Activated Cell Sorting (FACS) of BT474 cells.
  • FACS Fluorescence Activated Cell Sorting
  • Figure 3 shows a dose-response study where BT474 cells were treated with an increasing amount of msAb-866.
  • Figure 4 shows a growth inhibition study of BT474 cells using 500ng/ml of msAb-lntra, msAb-M, msAb-N, msAb-C, msAb-CNM, msAb-866 and msAb-NC, respectively.
  • the presented "Effect" values are relative to cultures treated with msAb-lntra.
  • msAb-N, msAb-C, msAb-CNM, msAb-866 and msAb-NC showed between 14% and 39% cell growth inhibition effect.
  • Figure 5 shows a growth inhibition study of BT474 cells using 500ng/ml of msAb-M, msAb-lntra, msAb-N, trastuzumab, msAb-C and msAb-866, respectively.
  • the presented "Effect" values are relative to cultures treated with msAb-lntra.
  • Figure 6 shows an amino acid alignment of a selection of HER2 fragments (SEQ ID NO:11 and 15-20) each comprising one or more of the C- epitopes (SEQ ID NO:8-11) identified through epitope mapping. Some of the sequences start at the upper half of the figure and continue at the lower half.
  • Figure 7 shows an amino acid alignment of a selection of HER2 fragments (SEQ ID NO:21-34) each comprising one or more of the N- epitopes (SEQ ID NO:12-14) identified through epitope mapping. Some of the sequences start at the upper half of the figure and continue at the lower half.
  • a suitable fragment of the target protein encoded by the EnsEMBL Gene ID ENSG00000141736 was selected using bioinformatic tools with the human genome sequence as template (Lindskog M et al (2005) Biotechniques 38:723-727, EnsEMBL, www.ensembl.org). The fragment was used as template for the production of a 127 amino acid long fragment corresponding to amino acid residues 274-400 (SEQ ID NO:1) of the HER2 protein (SEQ ID N0:2; EnsEMBL entry no. ENSP00000269571).
  • the protein fragment was designed to consist of a unique sequence with low sequence similarity to other human proteins, to minimize unwanted cross reactivity of generated affinity reagents, and still be of a suitable size to allow formation of conformational epitopes and allow efficient expression in bacterial systems.
  • Flanking restriction sites Notl and Ascl were introduced into the fragment through the PCR amplification primers to allow in-frame cloning into the expression vector (forward primer: TAC AACACAG ACACGTTTGAG, biotinylated reverse primer: AAACACTTGGAGCTGCTCTG). Resulting biotinylated PCR product was immobilized onto Dynabeads M280 Streptavidin (Dynal Biotech) (Larsson M et al (2000) J. Biotechnol.
  • Not-Ascl digestion New England Biolabs
  • Not-Ascl digestion New England Biolabs
  • solid support by Notl-Ascl digestion, ligated into the pAff ⁇ c vector (Larsson M et al, supra) in frame with a N-terminal dual affinity tag consisting of a hexahistidyl tag for immobilized metal ion chromatography (IMAC) purification and an immunopotentiating albumin binding protein (ABP) from streptococcal protein G (Sj ⁇ lander A et al (1997) J. Immunol.
  • IMAC immobilized metal ion chromatography
  • the His ⁇ -tagged fusion protein was purified by immobilized metal ion affinity chromatography (IMAC) on columns with 1 ml Talon® metal (Co2+) affinity resin (BD Biosciences Clontech) using an automated protein purification procedure (Steen J et al (2006) Protein Expr. Purif. 46:173-178) on an ASPEC XL4TM (Gilson).
  • the resin was equilibrated with 20 ml denaturing washing buffer (6 M guanidine hydrochloride, 46.6 mM Na2HPO4, 3.4 mM NaH2PO4, 300 mM NaCI, pH 8.0-8.2). Clarified cell lysates were then added to the column.
  • the resin was washed with a minimum of 31.5 ml washing buffer prior to elution in 2.5 ml elution buffer (6 M urea, 50 mM NaH2PO4, 100 mM NaCI, 30 mM acetic acid, 70 mM Na-acetate, pH 5.0).
  • the eluted material was fractioned in three pools of 500, 700 and 1300 ⁇ l.
  • the 700 ⁇ l fraction, containing the antigen, and the pooled 500 and 1300 ⁇ l fractions were stored for further use.
  • the antigen fraction was diluted to a final concentration of 1 M urea with phosphate buffered saline (PBS; 1.9 mM NaH2PO4, 8.1 mM Na2HPO4, 154 mM NaCI) followed by a concentration step to increase the protein concentration using Vivapore 10/20 ml concentrator with molecular weight cut off at 7500 Da (Vivascience AG).
  • the protein concentration was determined using a bicinchoninic acid (BCA) micro assay protocol (Pierce) with a bovine serum albumin standard according to the manufacturer's recommendations.
  • BCA bicinchoninic acid
  • the protein quality was analyzed on a Bioanalyzer instrument using the Protein 50 or 200 assay (Agilent Technologies).
  • a gene fragment corresponding to nucleotides 1058-1438 of the long transcript (SEQ ID NO:3) of the HER2 gene and encoding a peptide (SEQ ID NO:1) consisting of amino acid residues 274-400 of the target protein HER2 (SEQ ID NO:2) was successfully isolated by RT-PCR from a human RNA pool using primers specific for the protein fragment.
  • a clone encoding the correct amino acid sequence was identified, and, upon expression in E. coli, a single protein of the correct size was produced and subsequently purified using immobilized metal ion chromatography. After dilution of the eluted sample to a final concentration of 1 M urea and concentration of the sample to 1 ml, the concentration of the protein fragment was determined to be 8.6 mg/ml and was 99.5 % pure according to purity analysis.
  • the purified HER2 fragment as obtained above was used as antigen to immunize a rabbit in accordance with the national guidelines (Swedish permit no. A 84-02).
  • the rabbit was immunized intramuscularly with 200 ⁇ g of antigen in Freund's complete adjuvant as the primary immunization, and boosted three times in four weeks intervals with 100 ⁇ g antigen in Freund's incomplete adjuvant.
  • Antiserum from the immunized animal was purified by a three-step immunoaffinity based protocol (Agaton C et al (2004) J. Chromatogr. A 1043:33-40; Nilsson P et al (2005) Proteomics 5:4327-4337).
  • the flow-through, depleted of antibodies against the dual affinity tag His6-ABP was loaded at a flow rate of 0.5 ml/min on a 1 ml Hi-Trap NHS-activated HP column (GE Healthcare) coupled with the HER2 protein fragment used as antigen for immunization (SEQ ID NO:1).
  • the His6-ABP protein and the protein fragment antigen were coupled to the NHS activated matrix as recommended by the manufacturer. Unbound material was washed away with 1x PBST (1x PBS, 0.1 % Tween20, pH 7.25), and captured antibodies were eluted using a low pH glycine buffer (0.2 M glycine, 1 mM EGTA, pH 2.5).
  • the eluted antibody fraction was collected automatically, immediately after elution, relevant fractions were pooled and pH adjusted to 7.25 using 1 M Tris-HCI and 1OxPBS. The pooled fraction was denoted msAb-866. b) Results
  • Antibodies were loaded on to the columns at a speed of 0.5 ml/min and unbound material was washed away with 20 column volumes of washing buffer. Bound antibodies were fractionated into 25OuI fractions after separate elution under low pH (Larsson et al., 2006). Immediately after elution relevant fractions were pooled and pH adjusted to 7.25 using 1 M Tris-HCI and 1 OxPBS. No glycerol or NaN3 was added in order to not interfere with subsequent studies.
  • the pooled fractions from respective column were denoted respectively: antibodies eluted from C-terminal column (SEQ ID NO:6) were denoted msAb-C, antibodies eluted from middle column (SEQ ID NO:5) were denoted msAb-M, antibodies eluted from, N-terminal (SEQ ID NO:4) were denoted msAb-N and antibodies eluted from full antigen column (SEQ ID NO:1) were denoted msAb-S.
  • the specificity and selectivity of the affinity purified antibody fraction were analyzed by binding analysis against the antigen itself, including the protein fragment used for immunization (SEQ ID NO:1) and protein fragments overlapping it (SEQ ID NO:4-6), and against 92 other human protein fragments in a protein array set-up (Nilsson P et al (2005) Proteomics 5:4327- 4337).
  • the protein fragments were diluted to 40 ⁇ g/ml in 0.1 M urea and 1x PBS (pH 7.4) and 50 ⁇ l of each were transferred to the wells of a 96-well spotting plate.
  • the protein fragments were spotted in duplicate and immobilized onto epoxy slides (SuperEpoxy, TeleChem) using a pin-and-ring arrayer (Affymetrix 427). The slide was washed in 1x PBS (5 min) and the surface was then blocked (SuperBlock®, Pierce) for 30 minutes. An adhesive 16-well silicone mask (Schleicher & Schuell) was applied to the glass before the mono-specific antibodies were added (diluted 1 :5000 in 1x PBST to appr. 50 ng/ml) and incubated on a shaker for 60 min. Affinity tag-specific IgY antibodies were co-incubated with the mono-specific antibodies in order to quantify the amount of protein in each spot.
  • the slide was washed with 1x PBST and 1x PBS twice for 10 min each. Secondary antibodies (goat anti- rabbit antibody conjugated with Alexa 647 and goat anti-chicken antibody conjugated with Alexa 555, Molecular Probes) were diluted 1 :60000 to 30 ng/ml in 1x PBST and incubated for 60 min. After the same washing procedure, as for the first incubation, the slide was spun dry and scanned (G2565BA array scanner, Agilent); thereafter images were quantified using image analysis software (GenePix 5.1 , Axon Instruments).
  • Measurements were performed using Luminex LX200 instrumentation with Luminex IS 2.3 software. For each experiment 100 events per bead ID were counted and the median fluorescence intensity (MFI) was chosen to display interactions. Data analysis and graphical representations were performed with R, a language and environment for statistical computing and graphics (lhaka and Gentleman, 1996).
  • a protein microarray analysis was performed using both planar arrays and Luminex suspension bead array technology. The analysis validated a successful depletion of antibodies directed against His6-tag and ABP-tag (results not shown) as well as ensured highly specific antibodies possessing low potential unspecific interactions with other protein fragments immobilized (Fig 1 b).
  • a two-color dye labeling system was used, with a combination of primary and secondary antibodies.
  • Tag-specific IgY antibodies generated in hen were detected with a secondary goat anti-hen antibody labeled with Alexa 555 fluorescent dye.
  • the specific binding of the rabbit msAb to its antigen on the array was detected with a fluorescently Alexa 647 labeled goat anti-rabbit antibody.
  • Each protein fragment was spotted in duplicates.
  • the protein array analysis using planar and suspension bead array showed that the affinity purified mono-specific antibodies; msAb-866, msAb-N, msAb-M, msAb-C, ms-Ab-S against HER2, were highly selective to the correct protein fragments and have a very low background to all other protein fragments analyzed.
  • relative affinities were determined using a competition assay, where the interaction between mono-specific antibody and immobilized full antigen (SEQ ID NO:1) protein fragment on bead is challenged using an increasing concentration of soluble full antigen (SEQ ID NO:1) competitor protein fragment (Fig 1c, table 1).
  • BT474 breast cancer cells were purchased from the American Type Culture Collection (ATCC, Manassas, VA) and maintained in RPMI supplemented with 10% FCS and 1 % Bovine Insulin and kept in 37°C at 5% CO2 humidified atmosphere. b) Cell binding assay
  • PBS:HSA PBS pH 7.2 supplemented with 1 % Human Serum Albumin
  • 150000 cells were labelled for 45min with 0.35 microgram antibody (msAb-N, msAb-M, msAb-C and msAb-866) in a reaction volume of 75 microlitre in a 96-wellplate in room temperature. Unbound antibodies was washed away using 2x100 microlitre PBS:HSA as washing agent.
  • msAb-intra rabbit mono-specific antibody targeting the intracellular part of HER2 (HPA001383, Atlas Antibodies AB 1 Sweden) was used as negative control along with cells labelled only with secondary antibodies.
  • Trastuzumab Herceptin, Roche was used as positive cell labeling control using Alexa 488 goat anti-human monoclonal antibodies (Invitrogen) as secondary reagent.
  • BT474 cells were seeded at 5 x10 4 cells/well in 24-well dishes. After 24 h, cells were treated in triplicate dilutions of msAb-866 in concentrations ranging from 1 ng/ml to 1000 ng/ml. Cells treated with PBS pH 7.2 was used as control. After 5 days, cells were trypsinized and counted three times each.
  • BT474 cells were seeded at 5 x 10 4 cells/well in 24-well dishes at day 0. Two reconstitution mixes of antibodies were made using fraction ratios obtained in 3b): msAb-N and msAb-C were mixed at 18:39 ratio denoted msAb-NC; and msAb-N, msAb-M and msAb-C were mixed at a 18:35:39 ratio denoted msAb-NMC. After 24h, cells were treated in triplicate dilutions of msAb-866, msAb-N, msAb-M, msAb-C, msAb-NC and msAb-NMC using a final antibody concentration of 500 ng/ml. msAb-intra and PBS pH 7.2 were used as controls. After 5 days, cells were trypsinized and counted three times each. Growth inhibition was calculated as percentage of cells as compared to cultures treated with the control antibody msAb-intra.
  • BT474 cells were seeded at day 1 in triplicates at 5 x 10 4 cells/well together with dilutions of msAb-866, msAb-C, and Trastuzumab using a final antibody concentration of 500 ng/ml.
  • msAb-intra and PBS pH 7.2 were used as controls. After 4 days, cells were trypsinized and counted three times each. Growth inhibition was calculated as percentage of cells as compared to cultures treated with the control antibody msAb-intra.
  • msAb-M showed 1% growth inhibition effect
  • msAb-N showed 14% growth inhibition effect
  • msAb-C showed 30% growth inhibition effect
  • msAb-NMC showed 33% growth inhibition effect
  • msAb-866 showed 36% growth inhibition effect
  • msAb-NC showed 39 % growth inhibition effect (Fig 4).
  • an antibody targeting the HER2 subset of amino acid residues 1-37 of SEQ ID NO:6, or a composition comprising antibodies targeting the HER2 subset of amino acid residues 1-37 of SEQ ID NO:6 and the HER2 subset of amino acid residues 39-111 of SEQ ID NO:4, respectively, may be used for treatment of disorders characterized by the overexpression of HER2.
  • the cells were pelleted by centrifugation (3500xg, 4 0 C, 6 min) and resuspended in 100 ⁇ l PBSP containing antibody (i.e. the antibody used for epitope mapping; typically at a concentration around 100 nM) and incubated at room temperature with gentle mixing for 1 hour to reach equilibrium binding. The cells were thereafter washed with 1 ml of ice-cold
  • the cells were sorted directly into 0.5 ml B2 medium (Lofblom, J., Kronqvist, N., Uhlen, M., Stahl, S. & Wernerus, H. Optimization of electroporation- mediated transformation: Staphylococcus carnosus as model organism. J Appl Microbiol 102, 736-747 (2007)) and spread onto blood agar base
  • ENSP00000269571 or bp 317-2196 ENST00000269571 was amplified by PCR using vector pAY593 as template.
  • the amplified DNA was fragmentized to various lengths (approximately 50-350 bp) by sonication, followed by ligation into the staphylococcal display vector (pSCEMI) and transformed into S. Camosus yielding around 30000 transformants.
  • In-frame DNA fragments were displayed as peptides on the staphylococcal surface.
  • positive and negative cells were separately sorted using flow cytometry in order to isolate epitope and non-epitope presenting cells. Isolated cells were sequenced by pyrosequencing and sequences finally aligned to the HER2 antigen for identification of epitopes.
  • SEQ ID NO:11 A second round of epitope mapping was undertaken for msAb-C revealing one additional epitope (SEQ ID NO:11).
  • the epitopes SEQ ID NO:8 and SEQ ID NO:11 including the variants of the latter SEQ ID NO:9- 10, are located on the C-fragment whereas the epitopes SEQ ID NO: 12-14 are located on the N-fragment.
  • the interactions of e.g., fragments SEQ ID NO:11 and 15-20 were utilized in the establishment of the epitopes SEQ ID NO:8 and SEQ ID NO:11 , including it's variants SEQ ID NO:9-10 (Fig 6).
  • Monoclonal antibodies may be produced based on the hybridoma technology developed by Kohler and Milstein (Kohler, G and Milstein, C, 1973, Nature 256, 495-497). The inventors give here a brief description on how to develop monoclonal antibodies against HER2 epitopes according to the present disclosure.
  • the monoclonal antibody should be capable of selective interaction with amino acid sequences LQVF (SEQ ID NO:8) or ESFDGD (SEQ ID NO:9).
  • SEQ ID NO: 1 may be used as the antigen and its production is explained in Examples, section 1.
  • An alternative approach is to synthesize a peptide including the inventive epitopes, e.g. a peptide consisting of the amino acid sequence
  • CAFLPESFDGDPASNTAPLQPEQLQVFET use this peptide as the antigen.
  • Antigen is injected subcutaneously into BALB/c mice (4-6 weeks old, female) at three-week intervals. Prior to immunization the antigen is mixed with complete Freund's adjuvant for the first injection and incomplete Freund's adjuvant for the following injections. Three days before fusion, the mouse is last challenged with antigen intravenously.
  • Hybridomas are generated by fusion of splenocytes from the immunized mice with a Sp2/0 myeloma cell line. Then, several hybridoma cell lines are screened using ELISA, and cell lines that secrete antibodies specific for one or more fragment(s) comprising LQVF (SEQ ID NO:8) and/or ESFDGD (SEQ ID NO:9) are identified and selected for further characterization.
  • LQVF LQVF
  • SEQ ID NO:9 ESFDGD
  • further characterization involves testing of antibodies in cell supernatants from the selected hybridoma cell lines in cell binding assays as presented in Example section 5b.
  • Cell lines with antibodies that bind to the HER2 receptor expressed on the surface of BT474 cells are selected for subcloning and expansion.
  • Further characterization may include growth inhibition studies in line with the results presented in Example section 5d-5e, to confirm that the monoclonal antibodies exhibit the therapeutically interesting growth inhibition effect.
  • epitope mapping as presented in Example section 6a-d may be done, to confirm that the monoclonal antibodies from the selected cell lines interact with the expected eptiope(s).
  • Murine monoclonal antibodies Prior to introduction of the monoclonal antibody as a therapeutic agent, its immunogenicity may be reduced.
  • Murine monoclonal antibodies may be engineered to become chimeric or humanized, thereby removing at least part of their immunogenic content and increasing their immunologic efficiency.
  • fully human monoclonal antibodies may be produced using transgenic mice or phage display libraries.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Organic Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Molecular Biology (AREA)
  • Engineering & Computer Science (AREA)
  • Immunology (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Biomedical Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Oncology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Microbiology (AREA)
  • General Engineering & Computer Science (AREA)
  • General Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Wood Science & Technology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biotechnology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Epidemiology (AREA)
  • Mycology (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines Containing Material From Animals Or Micro-Organisms (AREA)
PCT/SE2008/000694 2008-06-13 2008-12-12 Antibodies against extracellular domains 2 and 3 or her2 Ceased WO2009151356A1 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
US12/997,823 US20110158988A1 (en) 2008-06-13 2008-12-12 Antibodies against extracellular domains 2 and 3 or her2
EP08874636A EP2294088A1 (en) 2008-06-13 2008-12-12 Antibodies against extracellular domains 2 and 3 or her2
CN2008801297639A CN102099376A (zh) 2008-06-13 2008-12-12 针对her2的细胞外结构域2和3的抗体
CA2727941A CA2727941A1 (en) 2008-06-13 2008-12-12 Antibodies against extracellular domains 2 and 3 or her2
AU2008357729A AU2008357729A1 (en) 2008-06-13 2008-12-12 Antibodies against extracellular domain 2 and 3 of HER2
KR1020127017264A KR20130026418A (ko) 2008-06-13 2008-12-12 Her2 의 세포외 도메인 2 및 3 에 대한 항체

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
JP2008-155676 2008-06-13
JP2008155676A JP2010006705A (ja) 2008-06-13 2008-06-13 Her2サブセット
US7635208P 2008-06-27 2008-06-27
US61/076352 2008-06-27

Publications (1)

Publication Number Publication Date
WO2009151356A1 true WO2009151356A1 (en) 2009-12-17

Family

ID=40427661

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SE2008/000694 Ceased WO2009151356A1 (en) 2008-06-13 2008-12-12 Antibodies against extracellular domains 2 and 3 or her2

Country Status (8)

Country Link
US (1) US20110158988A1 (https=)
EP (1) EP2294088A1 (https=)
JP (1) JP2010006705A (https=)
KR (2) KR20110036534A (https=)
CN (1) CN102099376A (https=)
AU (1) AU2008357729A1 (https=)
CA (1) CA2727941A1 (https=)
WO (1) WO2009151356A1 (https=)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011147982A3 (en) * 2010-05-27 2012-03-15 Genmab A/S Monoclonal antibodies against her2 epitope
US8609095B2 (en) 2010-03-04 2013-12-17 Symphogen A/S Anti-HER2 antibodies and compositions
AU2016201799B2 (en) * 2010-05-27 2017-09-07 Genmab A/S Monoclonal antibodies aganst HER2 epitope
US9862769B2 (en) 2010-05-27 2018-01-09 Genmab A/S Monoclonal antibodies against HER2
WO2019116089A3 (en) * 2017-12-11 2019-09-06 Medizinische Universitaet Wien A method of producing a vaccine composition and uses thereof
US11578141B2 (en) 2011-04-20 2023-02-14 Genmab A/S Bispecific antibodies against HER2 and CD3

Families Citing this family (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
KR101759209B1 (ko) 2010-01-22 2017-07-19 성균관대학교산학협력단 Her-2 과발현 유방암 세포 또는 조직에 특이적으로 결합할 수 있는 핵산 압타머 및 그 용도
CN105017425B (zh) * 2014-04-30 2018-02-16 京天成生物技术(北京)有限公司 抗her2中和活性单克隆抗体及其应用
EP3567049A4 (en) 2016-12-28 2020-08-26 Green Cross Lab Cell Corporation CHEMERICAL ANTIGENIC RECEPTOR AND NATURAL KILLER CELLS EXPRESSING THE SAME
US11649294B2 (en) 2017-11-14 2023-05-16 GC Cell Corporation Anti-HER2 antibody or antigen-binding fragment thereof, and chimeric antigen receptor comprising same
KR102774451B1 (ko) 2017-11-14 2025-02-28 앱클론(주) 항-her2 항체 또는 그의 항원 결합 단편, 및 이를 포함하는 키메라 항원 수용체
US12172108B2 (en) 2018-08-16 2024-12-24 Emd Millipore Corporation Closed bioprocessing device
EP3842460A1 (en) * 2019-03-01 2021-06-30 RemeGen Co., Ltd. Antibody for her2 concomitant diagnosis immunohistochemical detection and application thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001041787A1 (en) * 1999-12-10 2001-06-14 Epimmune Inc. INDUCING CELLULAR IMMUNE RESPONSES TO HER2/neu USING PEPTIDE AND NUCLEIC ACID COMPOSITIONS
CN1410127A (zh) * 2001-10-10 2003-04-16 北京迪威华宇生物技术有限公司 一种卡介苗热休克蛋白65和多表位her-2抗原融合蛋白重组蛋白疫苗
WO2004052917A2 (en) * 2002-12-10 2004-06-24 Epimmune Inc. Hla-a1, a2 -a3,-a24,-b7,and -b44 tumor associated antigen peptides and compositions
US20050147612A1 (en) * 2001-06-20 2005-07-07 Avner Yayon Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
WO2007146959A2 (en) * 2006-06-12 2007-12-21 Receptor Biologix Inc. Pan-cell surface receptor- specific therapeutics

Family Cites Families (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5801005A (en) * 1993-03-17 1998-09-01 University Of Washington Immune reactivity to HER-2/neu protein for diagnosis of malignancies in which the HER-2/neu oncogene is associated
US6514942B1 (en) * 1995-03-14 2003-02-04 The Board Of Regents, The University Of Texas System Methods and compositions for stimulating T-lymphocytes
US5783404A (en) * 1995-04-13 1998-07-21 Amgen Inc. Methods and compositions for determining HER-2/neu expression using monoclonal antibodies
US7767792B2 (en) * 2004-02-20 2010-08-03 Ludwig Institute For Cancer Research Ltd. Antibodies to EGF receptor epitope peptides
GT200500155A (es) * 2004-06-16 2006-05-15 Terapia del càncer resistente al platino
DK1771482T3 (da) * 2004-07-22 2014-10-20 Genentech Inc HER2-antistofsammensætning
ES2348312T3 (es) * 2006-04-13 2010-12-02 Bio Life Science Forschungs- Und Entwicklungsges.M.B.H. Vacuna her-2/neu a base de múltiples péptidos.
CN101165068B (zh) * 2006-10-18 2011-09-21 上海复旦张江生物医药股份有限公司 抗HER2/ErbB2抗原的单克隆抗体及其制备方法和药物组合物

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001041787A1 (en) * 1999-12-10 2001-06-14 Epimmune Inc. INDUCING CELLULAR IMMUNE RESPONSES TO HER2/neu USING PEPTIDE AND NUCLEIC ACID COMPOSITIONS
US20050147612A1 (en) * 2001-06-20 2005-07-07 Avner Yayon Antibodies that block receptor protein tyrosine kinase activation, methods of screening for and uses thereof
CN1410127A (zh) * 2001-10-10 2003-04-16 北京迪威华宇生物技术有限公司 一种卡介苗热休克蛋白65和多表位her-2抗原融合蛋白重组蛋白疫苗
WO2004052917A2 (en) * 2002-12-10 2004-06-24 Epimmune Inc. Hla-a1, a2 -a3,-a24,-b7,and -b44 tumor associated antigen peptides and compositions
WO2007146959A2 (en) * 2006-06-12 2007-12-21 Receptor Biologix Inc. Pan-cell surface receptor- specific therapeutics

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
ROCKBERG JOHAN ET AL: "Epitope mapping of antibodies using bacterial surface display", NATURE METHODS DEC 2008, PUBLISHED ONLINE 23 NOVEMBER 2008, vol. 5, no. 12, 1 December 2008 (2008-12-01), pages 1039 - 1045, XP002516298 *
WERNERUS HENRIK ET AL: "Biotechnological applications for surface-engineered bacteria", BIOTECHNOLOGY AND APPLIED BIOCHEMISTRY, ACADEMIC PRESS, US, vol. 40, no. Part 3, 1 December 2004 (2004-12-01), pages 209 - 228, XP008095181, ISSN: 0885-4513 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8609095B2 (en) 2010-03-04 2013-12-17 Symphogen A/S Anti-HER2 antibodies and compositions
WO2011147982A3 (en) * 2010-05-27 2012-03-15 Genmab A/S Monoclonal antibodies against her2 epitope
US9714294B2 (en) 2010-05-27 2017-07-25 Genmab A/S Monoclonal antibodies against HER2 epitope
AU2016201799B2 (en) * 2010-05-27 2017-09-07 Genmab A/S Monoclonal antibodies aganst HER2 epitope
US9862769B2 (en) 2010-05-27 2018-01-09 Genmab A/S Monoclonal antibodies against HER2
US10793640B2 (en) 2010-05-27 2020-10-06 Genmab A/S Monoclonal antibodies against HER2 epitope
US11046771B2 (en) 2010-05-27 2021-06-29 Genmab A/S Monoclonal antibodies against HER2
US11091553B2 (en) 2010-05-27 2021-08-17 Genmab A/S Monoclonal antibodies against HER2
US11578141B2 (en) 2011-04-20 2023-02-14 Genmab A/S Bispecific antibodies against HER2 and CD3
WO2019116089A3 (en) * 2017-12-11 2019-09-06 Medizinische Universitaet Wien A method of producing a vaccine composition and uses thereof

Also Published As

Publication number Publication date
AU2008357729A8 (en) 2011-02-03
KR20110036534A (ko) 2011-04-07
JP2010006705A (ja) 2010-01-14
CA2727941A1 (en) 2009-12-17
US20110158988A1 (en) 2011-06-30
AU2008357729A1 (en) 2009-12-17
KR20130026418A (ko) 2013-03-13
EP2294088A1 (en) 2011-03-16
CN102099376A (zh) 2011-06-15

Similar Documents

Publication Publication Date Title
US20110158988A1 (en) Antibodies against extracellular domains 2 and 3 or her2
JP6823094B2 (ja) Ror1癌の治療および転移の阻害に使用するための抗体およびワクチン
CN113347994B (zh) 使用her3抗原结合分子治疗和预防癌症
ES2826774T3 (es) Anticuerpo que se une a ERBB-2 y ERBB-3
EP3365373B1 (en) Binding molecules that inhibit cancer growth
TWI765857B (zh) 用於對抗食道癌及其他癌症的新穎胜肽及胜肽的組合物
DK2494359T3 (en) PODXL protein in colorectal cancer
CN104302667A (zh) 外来体检测用单克隆抗体
KR20180026758A (ko) 식도암 및 기타 암에 대한 면역요법에 사용하기 위한 펩티드 및 펩티드의 조합
EP2396346B1 (en) Rbm3 protein in colorectal cancer prognostics
CN106604932A (zh) 人白细胞介素‑2的免疫刺激单克隆抗体
Kim et al. Generation of a human antibody that inhibits TSPAN8-mediated invasion of metastatic colorectal cancer cells
US20250122303A1 (en) Treatment and prevention of cancer using her3 antigen-binding molecules
CN112823168A (zh) 结合her2的四聚体多肽
HK40051469A (en) Her2-binding tetrameric polypeptides
HK40062651A (en) Binding molecules that inhibit cancer growth
CN121773135A (zh) 白细胞介素-13受体亚基α-2结合剂和其用途
CN112010975A (zh) Lag3结合片段及其用途
Panke Fakultät für Chemie Lehrstuhl für Biotechnologie
BR122025017078A2 (pt) Moléculas de ligação que inibem o crescimento do câncer
HK1253914B (en) Binding molecules that inhibit cancer growth

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880129763.9

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08874636

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2727941

Country of ref document: CA

ENP Entry into the national phase

Ref document number: 20107027939

Country of ref document: KR

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2008357729

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2008874636

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 174/DELNP/2011

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2008357729

Country of ref document: AU

Date of ref document: 20081212

Kind code of ref document: A

NENP Non-entry into the national phase

Ref country code: JP