WO2009131665A1 - Borrelia burgdorferi cell envelope protein array - Google Patents

Borrelia burgdorferi cell envelope protein array Download PDF

Info

Publication number
WO2009131665A1
WO2009131665A1 PCT/US2009/002474 US2009002474W WO2009131665A1 WO 2009131665 A1 WO2009131665 A1 WO 2009131665A1 US 2009002474 W US2009002474 W US 2009002474W WO 2009131665 A1 WO2009131665 A1 WO 2009131665A1
Authority
WO
WIPO (PCT)
Prior art keywords
proteins
protein
cell envelope
antibodies
test sample
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2009/002474
Other languages
English (en)
French (fr)
Inventor
Benjamin J. Luft
Yun Xu
John F. Bruno
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Research Foundation of the State University of New York
Original Assignee
Research Foundation of the State University of New York
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Research Foundation of the State University of New York filed Critical Research Foundation of the State University of New York
Priority to JP2011506284A priority Critical patent/JP2011518338A/ja
Priority to US12/989,003 priority patent/US20110105355A1/en
Priority to EP09733687A priority patent/EP2274616A1/en
Publication of WO2009131665A1 publication Critical patent/WO2009131665A1/en
Priority to US12/784,584 priority patent/US20100292096A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/569Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
    • G01N33/56911Bacteria
    • GPHYSICS
    • G01MEASURING; TESTING
    • G01NINVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/195Assays involving biological materials from specific organisms or of a specific nature from bacteria
    • G01N2333/20Assays involving biological materials from specific organisms or of a specific nature from bacteria from Spirochaetales (O), e.g. Treponema, Leptospira
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • Lyme disease is the most common vector-borne disease in North America and Europe, and its range and incidence are increasing. Human Lyme disease is caused by several members of a group of closely related spirochetes belonging to the Borrelia burgdorferi sensu lato species complex. The spirochete is transmitted to humans via ticks of the genus Ixodes (Steere, A. C, N. Engl. J.Med. 1989; 321 :586- 96). It is a progressive multisystem disorder characterized by an initial cutaneous infection that can spread early in infection to secondary sites that include the nervous system, heart and joints (Masuzawa, T. et al, Microbiol. Immunol. 1996; 40:539-45; Stanek, G.Jnfection 1991; 19:263-7). The accurate diagnosis and treatment of Lyme disease depends on correlating objective clinical abnormalities with serological evidence of exposure to B. burgdorferi.
  • the present invention is drawn to methods of assessing -a test sample from an individual for antibodies to one or more cell envelope proteins of Borrelia burgdorferi, such as one or more of the proteins shown in Table 1 or in Table 2.
  • the methods can include the use of a microarray of cell envelope proteins of B. burgdorferi, such as a microarray including the proteins shown in Table 1 or in Table 2, or subsets thereof.
  • the invention is further drawn to methods of diagnosing Lyme disease in an individual, by assessing a test sample from the individual for antibodies to one or more cell envelope proteins of B. burgdorferi, wherein the presence of the antibodies is diagnostic for disease.
  • the invention is additionally drawn to microarrays of cell envelope proteins of B. burgdorferi, such as microarrays useful in the methods.
  • one or more cell envelope proteins are used.
  • a set of two or more cell envelope proteins are used.
  • Representative sets include the set of proteins shown in Table 2, and the set of proteins shown in Table 1.
  • Other representative sets of cell envelope proteins include the set of all known and putative cell envelope proteins of B. burgdorferi. Such a set can further include homologs and paralogs of the cell envelope proteins.
  • Other sets include sets of two or more, three or more, four or more, five or more, six or more, seven or more, eight or more, or other groups of cell envelope proteins (e.g., selected from those set forth in Table 2 or in Table 1).
  • the set consists essentially of the proteins set forth in Table 2.
  • the set consists essentially of the proteins set forth in Table 1.
  • a test sample from an individual is assessed for the presence of antibodies to one or more cell envelope proteins of B. burgdorferi
  • the "test sample” is a sample of blood, serum, cerebrospinal fluid, or other appropriate biological fluid from the individual.
  • the test sample is assessed for the presence of antibodies to one or more cell envelope proteins using routine methods established in the art.
  • the assessment is performed using a microarray of cell envelope proteins.
  • a microarray as described below, or a cell envelope protein or set of cell envelope proteins as described herein is exposed to the test sample from the individual, and any resultant binding of antibodies (if present in the test sample) to the proteins is assessed.
  • the presence of binding of antibodies to one or more cell envelope proteins is indicative of antibodies to one or more cell surface proteins of B. burgdorferi.
  • the presence of such antibodies is diagnostic for Lyme disease in the individual from whom the test sample was obtained.
  • the present invention also pertains to microarrays of cell envelope proteins of B. burgdorferi.
  • the microarray consists essentially of all known and putative cell envelope proteins of B. burgdorferi.
  • the microarray comprises a subset of all known and putative cell envelope proteins of B. burgdorferi, such as the set the proteins set forth in Table 2.
  • the microarray comprises a subset of the proteins set forth in Table 2 (e.g., the set of proteins set forth in Table 1).
  • other microarrays include various subsets of cell envelope proteins of B.
  • the microarray consists essentially of the proteins set forth in Table 2.
  • the microarray consists essentially of the proteins set forth in Table 1.
  • methods are now available for assessment of cell surface proteins of B. burgdorferi as potential candidates for development of a diagnostic test for Lyme disease, and also for assessment of cell surface proteins of B. burgdorferi as potential candidates for development of vaccines to protect against Lyme disease. In both of these methods, one or more cell surface proteins of B.
  • burgdorferi such as sets of cell surface proteins as described herein (e.g., in a microarray as described above), are exposed to sera from one or more individuals known to have Lyme disease, and the proteins to which antibodies from the sera bind are then determined.
  • Cy5 intensity/Cy3 intensity ratio of fluorescence as described in the Exemplification, can be used.
  • the ratio of any proteins greater than the mean ratio of the reactivity of the Lyme sera to a negative control plus three times the standard deviation indicates significant interactions between antibodies present in the Lyme sera and the B. burgdorferi protein.
  • Such proteins are proteins which can be used in diagnostic tests for Lyme disease (e.g., in the methods described above), as well as in microarrays as described herein, and also can be used as potential vaccine candidates.
  • the cell envelope proteins identified herein as reacting with sera of individuals with Lyme disease are useful as vaccine immunogens against Borrelia infection.
  • the present invention is also drawn to pharmaceutical compositions which can be used to vaccinate and/or treat Borrelia infection in an animal or human.
  • the pharmaceutical composition comprises a Borrelia burgdorferi cell envelope protein, such as one shown in Table 1 or 2, or a protein derived from such a cell envelope protein (e.g., a cell envelope protein having modifications such as insertions, deletions, or other alterations, or a cell envelope protein that forms part of a chimeric protein, such as those described in US patents 6,248,562; 7,008,625; 7,060,281 ; and 7,179,448, the entire teachings of which are incorporated herein by reference).
  • the pharmaceutical composition can also be administered together with a physiologically-acceptable carrier, an excipient and/or an adjuvant.
  • Suitable adjuvants are well known in the art (see for example PCT Publication WO 96/40290, the entire teachings of which are incorporated herein by reference), and can be used, for example, to enhance immunogenicity, potency or half-life of the proteins in the treated animal.
  • the pharmaceutical compositions used to vaccinate and/or treat Borrelia infection can be prepared using methods for preparing vaccines which are well known in the art.
  • the cell envelope proteins described herein can be isolated and/or purified by known techniques, such as by size exclusion chromatography, affinity chromatography, ion exchange chromatography, preparative electrophoresis, selective precipitation or combinations thereof.
  • the prepared cell envelope proteins can be mixed with suitable other reagents as described herein, such that the cell envelope protein is at a suitable concentration.
  • the dosage of the cell envelope protein will vary and depends upon the age, weight and/or physical condition of the animal, e.g., mammal, human, to be treated. The optimal dosage can be determined by routine optimization techniques, using suitable animal models.
  • Administration of the pharmaceutical composition to be used as a vaccine can be by any suitable technique.
  • suitable techniques for administration of the pharmaceutical composition include, but are not limited to, injection, e.g., subcutaneous injection, intramuscular injection, intravenous injection, intra peritoneal injection; mucosal administration, e.g., exposing nasal mucosa to nose drops containing the cell envelope proteins of the present invention; oral administration; and DNA immunization.
  • the present invention is also drawn to diagnostic kits which comprise the cell envelope proteins described herein (e.g., in a microarray as described above).
  • the kit also includes reagents for detecting antibody-antigen complexes that are formed between the cell envelope protein and antibodies that are present in a sample, e.g., a user-supplied host sample.
  • MATERIALS AND METHODS Serum samples Serum samples. Sera were obtained from patients who participated in multicenter clinical trials conducted by the Lyme Disease Center at Stony Brook University. The serum samples were obtained singly from different subjects and all serum samples were obtained from physician-characterized patients under established guidelines with prior approval by the Committee on Research Involving Human Subjects, Stony Brook University. The samples used included a total of 13 sera from patients with late Lyme disease (Lyme arthritis or neuroborreliosis) and all tested positive for B. burgdorferi antibodies by ELISA. Normal control sera were obtained from 4healthy donors.
  • B. burgdorferi B31 early passage strain containing all 21 known circular and linear plasmids was used as the source of total genomic DNA (Xu Y. et al.,. Microb. Path. 2003; 35:269-78). Spirochetes were cultivated at 34 0 C to the mid-logarithmic phase in complete B arbour- Stoenner- Kelly (BSK-H) medium. B. burgdorferi genomic DNA was isolated from late- logarithmic phase B31 by using the Qiagen Genomic-tip 500 DNA purification columns (Dunn, JJ. et al, Protein Expr. Purif 1990; 1 : 159-68). In addition, B.
  • OspC types OspC phyletic group
  • the 3' primer (5'- GGATCGCGGCCGCTACTCGAG +15mer ORF specific) (SEQ ID NO:2) contained a Notl recognition sequence (bold).
  • primer sets were designed to amplify coding regions without a membrane anchoring signal sequence (Dunn, J.J. et al, Protein Expr. Purif. 1990; 1 :159-68). PCR amplification was performed under stringent conditions using
  • amplified products were cleaved with Ncol and Notl and inserted between the Ncol and Notl sites of pET-30 for N-terminal His-tagged proteins.
  • Ligation reactions were transformed into E.coli GC5 competent cells and plasmids were purified using Eppendorf Perfectprep Plasmid 96 VAC Direct Bind Kit.
  • N-terminal poly His-tagged proteins were purified on nickel-Sepharose columns under either native conditions (soluble proteins) or strong denaturing conditions (insoluble proteins) using RoboPop Ni-NTA His » Bind Purification Kit (Novagen).
  • the kit is designed for filtration-based 96-well format purification of His»Tag fusion proteins.
  • Protein concentration was determined by the measurement of the absorbance shift when Coomassie brilliant blue G-250 reacted with protein (Bio-Rad). Protein purity was checked by SDS-PAGE.
  • Microarray For microarray, proteins were printed onto nitrocellulose-coated FAST glass slides using a Microcaster 8-pin Microarray Printer. Each slide in the arrays contained 10 immobilized BSA spots for background determination and 8 immobilized His-tagged hGS2 spots, a human lipase protein, for use as a negative control. Proteome chips were probed with serum from B. burgdorferi infected patients (positive for Bb by ELISA) using the Fast Pak protein array kit. Briefly, slides were first blocked overnight at 4°C in protein array-blocking buffer before incubation in primary Antibody (human sera and mouse anti His-Tag for quantitation) for 2 h.
  • primary Antibody human sera and mouse anti His-Tag for quantitation
  • Antibodies were visualized with Cy 5 -conjugated goat anti- human IgG/IgM/IgA and Cy3 -conjugated goat anti mouse IgG and the slides were stringently washed and then scanned with an Axon GenePix 4200A microarray scanner and raw data was captured and analyzed with GenePix Pro image analysis software. To minimize the variability among samples, the PMT gain was adjusted to equal 1.0 in all the arrays with power setting at 50%. A global background subtraction method was used to subtract the background from each spot using the average mean intensity value of BSA from each slide.
  • the spot was considered positive and included for further ratio analysis if the median fluorescence intensity of a spot was more than 1000 and the SNR (signal- noise-ratio) of a spot was more than 4.
  • a ratio Cy5 intensity/Cy3 intensity (protein/His-tag) for each protein was then calculated. All experiments were conducted two times, and each proteins Cy5/Cy3 ratios were averaged. The ratio of any proteins greater than the mean ratio of the reactivity of the Lyme sera to the GS2 negative control plus three times the standard deviation indicates significant interactions between antibodies present in the Lyme sera and immobilized B. burgdorferi protein.
  • B. burgdorferi membrane-associated proteins are lipoproteins that represent more than 8% of Borrelia's total coding capacity (Beermann, C. et al., Biochem. Biophys. Res. Commun. 2000; 267:897-905).
  • each ORF was PCR amplified and directionally cloned into the T7 expression vector pET28b. Sequenced-confirmed plasmids were expressed using the overnight expression system, expressed proteins were purified using His resin and printed onto nitrocellulose coated FAST slides. The PCR strategy was designed to subclone a version of each membrane protein without a N-terminal signal sequence. In preliminary studies, full-length gene products appeared to be toxic when over expressed in E. coli. As a result, target proteins did not accumulate to very high levels. The truncated form of each protein lacking a signal sequence proved to be excellent over producers. (Dunn, J.J., et a., Protein Expr. Purif. 1990; 1 :159-68)
  • BBK50 were recognized by 12 of 13 samples. Although seventy-six of the arrayed antigens were recognized by at least one sample, less than half were recognized by more than six patients. Considerable heterogeneity was also noted among arrayed proteins showing the highest seroreactivity. Of those antigens displaying the highest C5/C3 signal intensity ratios, antigens BBA25 (DbpB), BBE31 (putative P35) and BB0383 (bmpA) were recognized by less than half of the individuals. Sera from noninfected humans did not react with any of the antigens on the array (data not shown).
  • Late disseminated sera also recognized the previously established immunogens, export protein A (BBC06), P35 (BBJ41), P37 (BBK50), OspA (BBA15) and OspC (BBB19) (Fikrig, E. et al, Science; 1990:250:553-6; Funhg, B.P. et al, Infect. Immun. 1994; 62:3213-21 ; Champion, C.I. et al, Infect. Immun.
  • This lipoprotein gene family designated MIp lipoproteins are found on both circular and linear plasmids and include BBP28, BBL28, BBO28, BBS30, BBM28 and BBN28 (Table 1).
  • the mlp genes encode a diverse array of lipoproteins that are highly antigenic and may participate in infection processes in the mammalian host (Porcella, S. F. et al, Infect. Immun.
  • BBI42 shown to be immunogenic in a previous study with baboon sera, was highly reactive with human sera (Brooks, CS. et al, Infect. Immun. 2006 JuI; 74:206-304).
  • OspC human antibody response to OspC was type specific
  • recombinant Osp C types A, B, C, D, E, H, I, J, K and U were generated and included as antigens in the protein array.
  • OspC (BBB 19) was highly immunogenic in 9 of 13 sera from Lyme patients. There was no evidence found; however, of OspC type specificity in late-disseminated sera. All OspC types within a given serum sample were recognized with essentially equal signal intensities (Table 2).
  • BBAl 4 lipoprotein
  • BBG23 hyperthetical protein
  • BBO 108 lipoprotein
  • BB0442 inner membrane protein
  • BBQ03 outputative outer membrane protein
  • Table 1 Borrelia burgdorferi cell envelope proteins showing highest reactivity to sera from patients with late disseminated Lyme Disease as shown by protein microarray
  • Table 2 indicates all of the proteins identified by serum antibodies from individuals with Lyme disease.
  • Table 3 indicates B. Burgdorferi arrayed proteins that were negative to sera from Lyme disease patients

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Hematology (AREA)
  • Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Biomedical Technology (AREA)
  • Molecular Biology (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Biotechnology (AREA)
  • Virology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Food Science & Technology (AREA)
  • Medicinal Chemistry (AREA)
  • Cell Biology (AREA)
  • Analytical Chemistry (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • General Physics & Mathematics (AREA)
  • Pathology (AREA)
  • Peptides Or Proteins (AREA)
PCT/US2009/002474 2008-04-22 2009-04-21 Borrelia burgdorferi cell envelope protein array Ceased WO2009131665A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
JP2011506284A JP2011518338A (ja) 2008-04-22 2009-04-21 ボレリア・ブルグドルフェリ(borreliaburgdorferi)の細胞エンベロープタンパク質のアレイ
US12/989,003 US20110105355A1 (en) 2008-04-22 2009-04-21 Borrelia burgdorferi cell envelope protein array
EP09733687A EP2274616A1 (en) 2008-04-22 2009-04-21 Borrelia burgdorferi cell envelope protein array
US12/784,584 US20100292096A1 (en) 2008-04-22 2010-05-21 Strain and species-specific borrelia protein array

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US12504008P 2008-04-22 2008-04-22
US61/125,040 2008-04-22

Related Child Applications (1)

Application Number Title Priority Date Filing Date
US12/784,584 Continuation-In-Part US20100292096A1 (en) 2008-04-22 2010-05-21 Strain and species-specific borrelia protein array

Publications (1)

Publication Number Publication Date
WO2009131665A1 true WO2009131665A1 (en) 2009-10-29

Family

ID=40933495

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2009/002474 Ceased WO2009131665A1 (en) 2008-04-22 2009-04-21 Borrelia burgdorferi cell envelope protein array

Country Status (4)

Country Link
US (2) US20110105355A1 (https=)
EP (1) EP2274616A1 (https=)
JP (1) JP2011518338A (https=)
WO (1) WO2009131665A1 (https=)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8623375B2 (en) 2010-05-14 2014-01-07 Baxter International Inc. Chimeric OspA genes, proteins, and methods of use thereof
US9023367B2 (en) 2012-07-27 2015-05-05 Baxter International Inc. Compositions comprising chimeric OSPA molecules and methods of use thereof
US10983121B2 (en) 2015-09-25 2021-04-20 Qiagen Sciences Llc Compositions and methods for diagnosing Lyme disease and for predicting Lyme disease spirochete elimination after treatment
US11061028B2 (en) 2014-09-24 2021-07-13 Defined Diagnostics, Llc Compositions and methods for the diagnosis of lyme disease

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110105355A1 (en) * 2008-04-22 2011-05-05 Research Foundation Of State University Of New York Borrelia burgdorferi cell envelope protein array
CN103229055A (zh) 2010-09-27 2013-07-31 康奈尔大学 莱姆病的诊断方法
WO2018017998A1 (en) 2016-07-22 2018-01-25 The Research Foundation For The State University Of New York Recombinant borrelia proteins and methods of use thereof

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1996040290A1 (en) 1995-06-07 1996-12-19 Connaught Laboratories, Inc. Immunological combination compositions and methods
US6248562B1 (en) 1993-11-01 2001-06-19 Research Foundation State University Of New York Chimeric proteins comprising borrelia polypeptides and uses therefor
US7008625B2 (en) 1993-11-01 2006-03-07 Research Foundation Of The State University Of New York Recombinant constructs of Borrelia burgdorferi
US7060281B1 (en) 1999-06-18 2006-06-13 Research Foundation Of The State University Of New York Groups of barrelia burgdorferi and borrelia afzelii that cause lyme disease in humans
WO2009033163A2 (en) * 2007-09-07 2009-03-12 The Regents Of The University Of California Borrelia diagnostics and screening methods

Family Cites Families (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH01259258A (ja) * 1988-04-08 1989-10-16 Tokuyama Soda Co Ltd ライム病抗体検出用凝集反応試薬
US6221363B1 (en) * 1991-07-11 2001-04-24 Baxter Aktiengesellschaft Vaccine for the prevention of lyme disease
JP2001516458A (ja) * 1998-01-08 2001-09-25 ビオメリュー インコーポレイテッド 診断試薬としての組換えP37/FlaA
WO2004058181A2 (en) * 2002-12-20 2004-07-15 Board Of Regents, The University Of Texas System Vmp-like sequences of pathogenic borrelia species and strains
JP2010503384A (ja) * 2006-09-15 2010-02-04 インターセル アーゲー ボレリア(Borrelia)抗原
US20110105355A1 (en) * 2008-04-22 2011-05-05 Research Foundation Of State University Of New York Borrelia burgdorferi cell envelope protein array

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6248562B1 (en) 1993-11-01 2001-06-19 Research Foundation State University Of New York Chimeric proteins comprising borrelia polypeptides and uses therefor
US7008625B2 (en) 1993-11-01 2006-03-07 Research Foundation Of The State University Of New York Recombinant constructs of Borrelia burgdorferi
US7179448B2 (en) 1993-11-01 2007-02-20 Research Foundation Of The State Of New York Recombinant constructs of Borrelia burgdorferi
WO1996040290A1 (en) 1995-06-07 1996-12-19 Connaught Laboratories, Inc. Immunological combination compositions and methods
US7060281B1 (en) 1999-06-18 2006-06-13 Research Foundation Of The State University Of New York Groups of barrelia burgdorferi and borrelia afzelii that cause lyme disease in humans
WO2009033163A2 (en) * 2007-09-07 2009-03-12 The Regents Of The University Of California Borrelia diagnostics and screening methods

Non-Patent Citations (10)

* Cited by examiner, † Cited by third party
Title
FRASER, CM. ET AL., NATURE, vol. 390, no. 6660, 1997, pages 580 - 6
MASUZAWA, T. ET AL., MICROBIOL. IMMUNOL., vol. 40, 1996, pages 539 - 45
NOWALK AJ.; GILMORE JR RD.; CARROLL JA.: "Serologic Protein analysis of Borrelia burgdoferi membrane-associated proteins", INFECTION AND IMMUNITY, vol. 74, no. 7, July 2006 (2006-07-01), pages 3864 - 3873
NOWALK ANDREW J ET AL: "Serologic proteome analysis of Borrelia burgdorferi membrane-associated proteins", INFECTION AND IMMUNITY, vol. 74, no. 7, July 2006 (2006-07-01), pages 3864 - 3873, XP002540832, ISSN: 0019-9567 *
See also references of EP2274616A1 *
STANEK, G., INFECTION, vol. 19, 1991, pages 263 - 7
STEERE, A. C, N. ENGL. J.MED., vol. 321, 1989, pages 586 - 96
XU Y ET AL: "Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays", MICROBIAL PATHOGENESIS, ACADEMIC PRESS LIMITED, NEW YORK, NY, US, vol. 45, no. 5-6, 1 November 2008 (2008-11-01), pages 403 - 407, XP025693260, ISSN: 0882-4010, [retrieved on 20081011] *
XU Y., BRUNO J., LUFT B.: "A cell envelope protein array of Borrelia burgdorferi to profile the humoral response of patients with Lyme disease", EUROPEAN CONGRESS OF CLINICAL MICROBIOLOGY AND INFECTIOUS DISEASES, 19 April 2008 (2008-04-19), Barcelona, Spain, XP002540831, Retrieved from the Internet <URL:http://www.blackwellpublishing.com/eccmid18/abstract.asp?id=70040> [retrieved on 20090811] *
XU Y.; BRUNO J.; LUFT B.: "A cell envelope protein array of Borrelia burgdoferi to profile the humoral response of patients with Lyme disease", EUROPEAN CONGRESS OF CLINICAL MICROBIOLOGY AND INFECTIOUS DISEASES, 19 April 2008 (2008-04-19)

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8623375B2 (en) 2010-05-14 2014-01-07 Baxter International Inc. Chimeric OspA genes, proteins, and methods of use thereof
US8623376B2 (en) 2010-05-14 2014-01-07 Baxter International Inc. Chimeric OspA genes, proteins, and methods of use thereof
US9303073B2 (en) 2010-05-14 2016-04-05 Baxalta Incorporated Chimeric OspA proteins and methods of use thereof
US9334311B2 (en) 2010-05-14 2016-05-10 Baxalta Incorporated Chimeric OspA genes, proteins and methods of use thereof
US9895434B2 (en) 2010-05-14 2018-02-20 Research Foundation Of The State University Of New York Chimeric OspA genes, proteins and methods of use thereof
US11305000B2 (en) 2010-05-14 2022-04-19 Brookhaven Science Associates, Llc Chimeric OspA genes, proteins and methods of use thereof
US9023367B2 (en) 2012-07-27 2015-05-05 Baxter International Inc. Compositions comprising chimeric OSPA molecules and methods of use thereof
US11061028B2 (en) 2014-09-24 2021-07-13 Defined Diagnostics, Llc Compositions and methods for the diagnosis of lyme disease
US10983121B2 (en) 2015-09-25 2021-04-20 Qiagen Sciences Llc Compositions and methods for diagnosing Lyme disease and for predicting Lyme disease spirochete elimination after treatment
US12066436B2 (en) 2015-09-25 2024-08-20 Qiagen Sciences Llc Compositions and methods for diagnosing Lyme disease and for predicting Lyme disease spirochete elimination after treatment

Also Published As

Publication number Publication date
JP2011518338A (ja) 2011-06-23
US20110105355A1 (en) 2011-05-05
US20100292096A1 (en) 2010-11-18
EP2274616A1 (en) 2011-01-19

Similar Documents

Publication Publication Date Title
Xiong et al. Potential serodiagnostic markers for Q fever identified in Coxiella burnetii by immunoproteomic and protein microarray approaches
WO2009131665A1 (en) Borrelia burgdorferi cell envelope protein array
US20120142023A1 (en) Proteins and method for detection of lyme disease
JP2015504420A (ja) ライム病抗体の検出のためのペプチドおよび方法
Xu et al. Profiling the humoral immune response to Borrelia burgdorferi infection with protein microarrays
JP2009185037A (ja) EhrlichiacanisおよびEhrlichiachaffeensis抗体の検出のための組成物および方法
CA2920417C (en) Method for the detection of an immune response against flid and its use as a biomarker for h. pylori infection
US20130164759A1 (en) Compositions and methods for screening for lyme disease
WO2016057562A1 (en) Recombinant borrelia proteins and methods of use thereof
US20200348300A1 (en) Mycobacterium avium subspecies paratuberculosis immunodiagnostic antigens, methods, and kits comprising same
WO2014078270A1 (en) In vitro assays for detecting salmonella enterica serotype typhi
Hansen Laboratory diagnostic methods in Lyme borreliosis
CN1361828A (zh) 肠炎沙门氏菌的检测
US8431135B2 (en) Polypeptides and methods for the specific detection of antibodies in patients with a borrelia infection
RU2546246C2 (ru) Химерный белок, используемый для диагностики лайм-боррелиоза.
US20170212114A1 (en) Recombinant Borrelia Proteins And Methods Of Use Thereof
US6045804A (en) Method for detecting B. burgdorferi infection
WO2018017998A1 (en) Recombinant borrelia proteins and methods of use thereof
DK2396655T4 (en) Device for serologically detecting yersinia infections and / or their sequelae, and using the proteins MyfA and PsaA of Y.Enterocolitica and Y.Pseudotuberculosis as recombinant antigens
Ghazal Development of improved diagnostic tests for Lyme disease
Cutler et al. Pitfalls in the laboratory diagnosis of Lyme borreliosis
BR102018073888A2 (pt) Proteína recombinante, sequência de dna sintético, cassete de expressão, vetor de expressão, célula hospedeira, método para produzir uma proteína recombinante, método e kit para detecção de escherichia coli enterotoxigênica (etec) em uma amostra biológica, e, uso de uma proteína recombinante
Cutler Department of Medical Microbiology Charing Cross Hospital
ITTO950545A1 (it) Vaccino/composizioni terapautica di helycobacter pylori, loro preparazione ed impiego.
WO2007070996A2 (en) Liga and ligb proteins (leptospiral ig-like (lig) domains) for vaccination and diagnosis

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09733687

Country of ref document: EP

Kind code of ref document: A1

WWE Wipo information: entry into national phase

Ref document number: 2011506284

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

REEP Request for entry into the european phase

Ref document number: 2009733687

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2009733687

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12989003

Country of ref document: US