WO2009125804A1 - Procédé de criblage - Google Patents

Procédé de criblage Download PDF

Info

Publication number
WO2009125804A1
WO2009125804A1 PCT/JP2009/057229 JP2009057229W WO2009125804A1 WO 2009125804 A1 WO2009125804 A1 WO 2009125804A1 JP 2009057229 W JP2009057229 W JP 2009057229W WO 2009125804 A1 WO2009125804 A1 WO 2009125804A1
Authority
WO
WIPO (PCT)
Prior art keywords
protein
gpr120
cells
partial peptide
epc
Prior art date
Application number
PCT/JP2009/057229
Other languages
English (en)
Japanese (ja)
Inventor
信津 塚田
俊文 喜多
孝之 浅原
治史 増田
Original Assignee
武田薬品工業株式会社
学校法人東海大学
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 武田薬品工業株式会社, 学校法人東海大学 filed Critical 武田薬品工業株式会社
Publication of WO2009125804A1 publication Critical patent/WO2009125804A1/fr

Links

Images

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/566—Immunoassay; Biospecific binding assay; Materials therefor using specific carrier or receptor proteins as ligand binding reagents where possible specific carrier or receptor proteins are classified with their target compounds
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • A61K38/177—Receptors; Cell surface antigens; Cell surface determinants
    • A61K38/1796—Receptors; Cell surface antigens; Cell surface determinants for hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5044—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics involving specific cell types
    • G01N33/5064—Endothelial cells
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/68—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids
    • G01N33/6893—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving proteins, peptides or amino acids related to diseases not provided for elsewhere
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
    • G01N2333/435—Assays involving biological materials from specific organisms or of a specific nature from animals; from humans
    • G01N2333/705—Assays involving receptors, cell surface antigens or cell surface determinants
    • G01N2333/72—Assays involving receptors, cell surface antigens or cell surface determinants for hormones
    • G01N2333/726—G protein coupled receptor, e.g. TSHR-thyrotropin-receptor, LH/hCG receptor, FSH
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • the present invention relates to a novel screening method for substances involved in the regulation of differentiation / proliferation of vascular endothelial precursor cells.
  • Endothelial progenitor cells are bone marrow-derived cells that are mobilized from the bone marrow to peripheral blood and circulate in the body as part of the mononuclear cell fraction to form blood vessels. It is involved in new vasculogenesis through engraftment at the site and proliferation / differentiation / migration at the site (see Non-Patent Documents 1 and 2). Normally, EPC is always mobilized from the bone marrow to the periphery at a constant rate, and the peripheral blood EPC and bone marrow EPC are numerically balanced unless there is any stimulus in the living body.
  • EPC is mobilized from the bone marrow by the action of various cytokines, growth factors, hormones, etc., and the number of EPCs in peripheral blood increases. Utilizing this mechanism, clinical trials of autologous EPC transplantation treatment for severe ischemic diseases including coronary artery disease and limb ischemia disease have been started and good results are being reported. On the other hand, it has been pointed out that the amount and quality of EPC of patients are reduced due to basic diseases such as diabetes, and a sufficient therapeutic effect cannot be obtained even after transplantation.
  • Non-Patent Document 6 In patients with ischemic heart disease, the number of EPCs and angiogenic ability are decreased (see Non-Patent Document 6), and the mortality after a cardiovascular event is increased when the blood EPC number is decreased (Non-Patent Document 7). It is known that a decrease in bone marrow cells and progenitor cells contributes to the progression of arteriosclerosis (see Non-Patent Document 8). Furthermore, the number of EPCs in blood is reduced in patients with cerebral infarction (see Non-Patent Document 9), the survival rate increases when EPC is transplanted into a cirrhosis model animal (see Non-Patent Document 10), and bone marrow cells are transplanted. It has been reported that the fibrosis of the liver is suppressed (see Non-Patent Document 11).
  • GPR120 is a G protein-coupled receptor (GPCR) that is highly expressed in the pituitary gland, intestinal tract, adipose tissue, and the like.
  • GPCR G protein-coupled receptor
  • Patent Document 1 describes that the ligand of GPR120 is a fatty acid, and also screens for agonists / antagonists using GPR120 and the ligand, agonists, etc. (GPR120, DNA, ligand) / antagonists, etc.
  • Patent Document 2 discloses a compound having agonist activity with respect to GPR120, and describes that it is useful for the prevention and treatment of arteriosclerosis, angina pectoris, myocardial infarction, cardiovascular disease and the like.
  • Non-patent Document 12 When GPR120 is knocked down by siRNA in enteroendocrine cells (STC-1), GLP-1 production induced by free fatty acids decreases, so in the intestine, GPR120 agonists stimulate GLP-1 production. It has been suggested that it exhibits an obesity-suppressing action (Non-patent Document 13).
  • the present inventors first made various receptors (GPCR, tyrosine kinase type receptor, nuclear receptor) in two types of EPCs having different differentiation stages (large EPC and small EPC) in mice.
  • GPCR tyrosine kinase type receptor
  • nuclear receptor tyrosine kinase type receptor
  • GPR120 the expression of which was most increased in large EPC, and further studied.
  • GPR120 is specifically expressed in small and large EPCs derived from mouse bone marrow cells and peripheral blood mononuclear cells, and small and large EPCs derived from human bone marrow cells, but not in bone marrow cells or endothelial cells. I found out.
  • the present invention [1] Use of a protein comprising the same or substantially the same amino acid sequence as shown in SEQ ID NO: 2, 4 or 6, or a partial peptide thereof, or a cell producing the protein or the partial peptide.
  • a method for regulating differentiation / proliferation of vascular endothelial progenitor cells or a method for screening a substance for increasing vascular endothelial cells in peripheral blood [2] A nucleic acid encoding a protein containing the same or substantially the same amino acid sequence as shown in SEQ ID NO: 2, 4 or 6, or a partial polynucleotide thereof, or an antibody against the protein or the partial peptide is further used.
  • the method according to [1] above characterized in that [3] The method according to [1] above, further comprising using a fatty acid or a low molecular weight compound that changes the binding property between the fatty acid and the protein, or a salt thereof. [4] The method according to [1] above, wherein the cells are vascular endothelial progenitor cells or progenitor cells thereof, [5] The method according to [1] above, for selecting a prophylactic / therapeutic substance for a disease whose regulation of angiogenic ability can exhibit a prophylactic / therapeutic effect [6] An agent for promoting differentiation / proliferation of vascular endothelial progenitor cells, comprising any of the following substances: (A) a protein comprising the same or substantially the same amino acid sequence as shown in SEQ ID NO: 2, 4 or 6, or a partial peptide thereof (b) a base sequence encoding the protein of (a) or a partial peptide thereof (C) a compound that enhances the expression of the
  • GPR120 is involved in differentiation from bone marrow cells to EPC and proliferation of EPC, GPR120 or cells producing it are brought into contact with a test substance, and the expression or activity of the receptor (eg, ligand binding activity, signal transduction activity, etc.) ) Can be screened for drugs that modulate EPC differentiation / proliferation. Moreover, since suppression of GPR120 promotes the mobilization of EPC to peripheral blood, drugs that increase EPC in peripheral blood can also be screened by the same technique. Since GPR120 is highly expressed specifically in EPC in hematopoietic cells and peripheral blood cells, it can be used as a marker for EPC in the diagnosis of diseases associated with EPC selection / quantification and abnormal EPC amount.
  • the receptor eg, ligand binding activity, signal transduction activity, etc.
  • FIG. 4 shows changes in (A) body weight (BW), (B) plasma glucose concentration (PG), and (C) glycated hemoglobin value (GHB) in C57BL / 6J mice and GPR120 KO mice.
  • BW body weight
  • PG plasma glucose concentration
  • mice glycated hemoglobin value
  • EPC differentiation / proliferation regulation or screening method for EPC increasing substance in peripheral blood uses GPR120 protein or a partial peptide thereof, or a cell that produces the protein or a partial peptide thereof.
  • screening method of the present invention a method for screening an EPC-increasing substance in peripheral blood.
  • GPR120 used in the screening method of the present invention is a receptor protein containing the same or substantially the same amino acid sequence as the amino acid sequence shown in SEQ ID NO: 2, 4 or 6.
  • GPR120 protein is a cell of humans or other warm-blooded animals (eg, monkeys, cows, horses, pigs, sheep, goats, rabbits, mice, rats, guinea pigs, hamsters, chickens, etc.) [eg, hepatocytes, spleen cells, Nerve cells, glial cells, pancreatic ⁇ cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells (eg, vascular endothelial cells), goblet cells, endothelial cells, smooth muscle cells, fibroblasts, fibers Cells, muscle cells, adipocytes, immune cells (eg macrophages, T cells, B cells, natural killer cells, mast cells, neutrophils,
  • it may be a chemically synthesized protein or a biochemically synthesized protein using a cell-free protein synthesis system.
  • transduced may be sufficient.
  • amino acid sequence substantially identical to the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 is about 60% or more, preferably about 70% or more, More preferred is an amino acid sequence having a homology of about 80% or more, more preferably about 90% or more, particularly preferably about 95% or more, and most preferably about 97% or more.
  • homology refers to an optimal alignment when two amino acid sequences are aligned using a mathematical algorithm known in the art (preferably, the algorithm uses a sequence of sequences for optimal alignment). The ratio of the same amino acid residue and similar amino acid residues to all overlapping amino acid residues in the case of introducing a gap into one or both).
  • Similar amino acids means amino acids that are similar in physicochemical properties, such as aromatic amino acids (Phe, Trp, Tyr), aliphatic amino acids (Ala, Leu, Ile, Val), polar amino acids (Gln, Asn). ), Basic amino acids (Lys, Arg, His), acidic amino acids (Glu, Asp), amino acids with hydroxyl groups (Ser, Thr), amino acids with small side chains (Gly, Ala, Ser, Thr, Met), etc. Examples include amino acids classified into groups. It is expected that substitution with such similar amino acids will not change the phenotype of the protein (ie, is a conservative amino acid substitution).
  • the amino acid sequence substantially identical to the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 is about 60% or more, preferably about 70%, with the amino acid sequence shown in SEQ ID NO: 2, 4 or 6. More preferably, it is an amino acid sequence having an identity of about 80% or more, more preferably about 90% or more, particularly preferably about 95% or more, and most preferably about 97% or more.
  • Protein comprising an amino acid sequence substantially identical to the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 means the above-mentioned “amino acid substantially identical to the amino acid sequence shown in SEQ ID NO: 2, 4 or 6”. It means a protein having an activity substantially equivalent to that of a protein comprising the “sequence” and comprising the amino acid sequence shown in SEQ ID NO: 2, 4 or 6.
  • the substantially homogeneous activity includes, for example, ligand (eg, physiological ligand such as fatty acid, agonist / antagonist (eg, see Patent Document 2)) binding activity, signal transduction activity (eg, activation of phospholipase C ⁇ (PLC ⁇ )) , Intracellular Ca 2+ concentration increase, protein kinase C (PKC) activation, etc.), EPC differentiation promoting activity, EPC proliferation promoting activity, and the like.
  • ligand eg, physiological ligand such as fatty acid, agonist / antagonist (eg, see Patent Document 2) binding activity
  • signal transduction activity eg, activation of phospholipase C ⁇ (PLC ⁇ )
  • PLC protein kinase C
  • EPC differentiation promoting activity e.g, EPC proliferation promoting activity
  • EPC proliferation promoting activity e.g, EPC proliferation promoting activity, and the like.
  • the activities such as ligand binding activity, signal transduction activity, and EPC differentiation / proliferation promoting activity are equivalent (for example, about 0.5 to about 2 times), but the amount of these activities and the amount of protein such as molecular weight
  • the target elements may be different.
  • Ligand binding activity, signal transduction activity, and EPC differentiation / proliferation can be measured according to a method known per se.
  • the GPR120 in the present invention includes, for example, (1) one or more of the amino acid sequences represented by SEQ ID NO: 2, 4 or 6 (for example, about 1 to 100, preferably about 1 to 50, More preferably, about 1 to 30, more preferably about 1 to 10, particularly preferably 1 to several (2, 3, 4, or 5) amino acid sequences, (2) SEQ ID NO: 2 1 or 2 or more (for example, about 1 to 100, preferably about 1 to 50, more preferably about 1 to 30, more preferably about 1 to 10) in the amino acid sequence shown in 4 or 6; Particularly preferred is an amino acid sequence to which 1 to several (2, 3, 4 or 5) amino acids are added, (3) one or more amino acids in the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 (for example, 1 About 50, preferably about 1-30, more preferably about 1-10, and even more preferably 1-number ( 2, 3, 4 or 5) amino acid sequence inserted, (4) one or more of the amino acid sequences shown in SEQ ID NO: 2, 4 or 6 (for example, about 1
  • the GPR120 in the present invention is preferably a human GPR120 protein consisting of the amino acid sequence shown in SEQ ID NO: 2 (GenBank accession number: NP_859529) and a mouse GPR120 protein consisting of the amino acid sequence shown in SEQ ID NO: 4 (GenBank accession number: NP_861413), rat GPR120 protein consisting of the amino acid sequence shown in SEQ ID NO: 6 (GenBank accession number: NP_001040553), or an ortholog thereof in other mammals (for example, a dog ortholog registered in GenBank as accession number XP_534968) (Mouse, rat and dog GPR120 have about 83%, about 81% and about 85% amino acid identity to human GPR120, respectively).
  • proteins and peptides are described with the N-terminus (amino terminus) at the left end and the C-terminus (carboxyl terminus) at the right end according to the convention of peptide designation.
  • the GPR120 of the present invention including a protein comprising the amino acid sequence shown in SEQ ID NO: 2, has a C-terminal carboxyl group (—COOH), carboxylate (—COO ⁇ ), amide (—CONH 2 ) or ester (— COOR).
  • R in the ester for example, a C 1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl, n-butyl; for example, a C 3-8 cycloalkyl group such as cyclopentyl, cyclohexyl; C 6-12 aryl groups such as ⁇ -naphthyl; phenyl-C 1-2 alkyl groups such as benzyl and phenethyl; C 7- such as ⁇ -naphthyl-C 1-2 alkyl groups such as ⁇ -naphthylmethyl; 14 aralkyl group; pivaloyloxymethyl group is used.
  • a C 1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl, n-butyl
  • a C 3-8 cycloalkyl group such as cyclopentyl, cyclohexyl
  • GPR120 has a carboxyl group (or carboxylate) other than the C-terminus
  • those in which the carboxyl group is amidated or esterified are also included in the GPR120 of the present invention.
  • the ester in this case, for example, the above C-terminal ester or the like is used.
  • the amino group of the N-terminal amino acid residue is protected with a protecting group (for example, a C 1-6 acyl group such as C 1-6 alkanoyl such as formyl group, acetyl group, etc.).
  • N-terminal glutamine residue that can be cleaved in vivo is pyroglutamine oxidized, a substituent on the side chain of an amino acid in the molecule (eg, —OH, —SH, amino group, imidazole group, indole group, guanidino group, etc.) a suitable protecting group (e.g., formyl group, those protected by C 1-6 an acyl group) such as C 1-6 alkanoyl group such as acetyl group, or a sugar chain-binding Also included are complex proteins such as so-called glycoproteins.
  • a substituent on the side chain of an amino acid in the molecule eg, —OH, —SH, amino group, imidazole group, indole group, guanidino group, etc.
  • a suitable protecting group e.g., formyl group, those protected by C 1-6 an acyl group
  • C 1-6 alkanoyl group such as acetyl
  • partial peptide of GPR120 is a peptide containing the partial amino acid sequence of GPR120 described above and has substantially the same activity as GPR120, Any one may be used.
  • substantially the same quality of activity has the same meaning as described above. Further, “substantially the same quality of activity” can be measured in the same manner as in the case of GPR120.
  • a region involved in binding to a fatty acid that is a ligand for example, in the case of human GPR120, for example, SEQ ID NO: 2.
  • a region involved in signal transduction through interaction with the ligand for example, three Those having a partial amino acid sequence containing a region (hereinafter also referred to as “G ⁇ activation domain”) having the activity of binding to the ⁇ subunit of the monomeric G protein and promoting its GDP / GTP exchange reaction are used. It is done.
  • the partial peptide of the present invention is not particularly limited in size as long as it includes a region involved in binding to the above ligand and a region involved in signal transduction, but preferably contains a partial amino acid sequence of 100 or more. Preferably, those containing 200 or more partial amino acid sequences are included.
  • the partial amino acid sequence may be a single continuous partial amino acid sequence, or may be a concatenation of a plurality of discontinuous partial amino acid sequences.
  • the C-terminus may be any of a carboxyl group (—COOH), a carboxylate (—COO ⁇ ), an amide (—CONH 2 ), or an ester (—COOR).
  • R in the ester include the same as those described above for GPR120.
  • the partial peptide of the present invention has a carboxyl group (or carboxylate) in addition to the C-terminus, those in which the carboxyl group is amidated or esterified are also included in the partial peptide of the present invention.
  • the ester in this case, for example, the same ester as the C-terminal ester is used.
  • the amino group of the N-terminal amino acid residue is protected with a protecting group
  • the N-terminal glutamine residue is pyroglutamine oxidized
  • Examples include those in which a substituent on the side chain of the amino acid is protected with an appropriate protecting group, or a complex peptide such as a so-called glycopeptide to which a sugar chain is bound.
  • GPR120 or a partial peptide thereof used in the present invention may be in the form of a salt.
  • a salt with a physiologically acceptable acid eg, inorganic acid, organic acid
  • base eg, alkali metal
  • a physiologically acceptable acid addition salt is particularly preferable.
  • Such salts include, for example, salts with inorganic acids (eg hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid) or organic acids (eg acetic acid, formic acid, propionic acid, fumaric acid, maleic acid, succinic acid). Acid, tartaric acid, citric acid, malic acid, succinic acid, benzoic acid, methanesulfonic acid, benzenesulfonic acid) and the like.
  • inorganic acids eg hydrochloric acid, phosphoric acid, hydrobromic acid, sulfuric acid
  • organic acids eg acetic acid, formic acid, propionic acid, fumaric acid, maleic acid
  • GPR120 can be produced from the aforementioned mammalian cells or tissues by a known protein purification method. Specifically, after homogenizing mammalian tissue or cells and removing cell debris by low-speed centrifugation, the supernatant is centrifuged at high speed to precipitate a cell membrane-containing fraction (if necessary, cell membrane fractionation by density gradient centrifugation or the like). GPR120 or a salt thereof can be prepared by subjecting the fraction to chromatography such as reverse phase chromatography, ion exchange chromatography, affinity chromatography, and the like.
  • chromatography such as reverse phase chromatography, ion exchange chromatography, affinity chromatography, and the like.
  • GPR120 or a partial peptide thereof can also be produced according to known peptide synthesis methods.
  • the peptide synthesis method may be, for example, either a solid phase synthesis method or a liquid phase synthesis method.
  • the target protein can be produced by removing the protecting group.
  • the condensation and the removal of the protecting group are carried out according to a method known per se, for example, the method described in the following (1) to (5). (1) M.
  • the GPR120 thus obtained can be isolated and purified by a known purification method.
  • the purification method include solvent extraction, distillation, column chromatography, liquid chromatography, recrystallization, and combinations thereof.
  • GPR120 obtained by the above method is a free form
  • the free form can be converted to an appropriate salt by a known method or a method according thereto, and conversely, when GPR120 is obtained as a salt.
  • the salt can be converted into a free form or other salt by a known method or a method analogous thereto.
  • resins for protein synthesis include chloromethyl resin, hydroxymethyl resin, benzhydrylamine resin, aminomethyl resin, 4-benzyloxybenzyl alcohol resin, 4-methylbenzhydrylamine resin, PAM resin, 4-hydroxymethylmethyl.
  • an amino acid having an ⁇ -amino group and a side chain functional group appropriately protected is condensed on the resin in accordance with the sequence of the intended GPR120 according to various condensation methods known per se.
  • proteins and the like are cut out from the resin, and at the same time, various protecting groups are removed, and an intramolecular disulfide bond forming reaction is carried out in a highly diluted solution to obtain the target GPR120 or its amide.
  • carbodiimides are particularly preferable.
  • the carbodiimide DCC, N, N′-diisopropylcarbodiimide, N-ethyl-N ′-(3-dimethylaminoprolyl) carbodiimide and the like are used.
  • a protected amino acid is added directly to the resin together with a racemization inhibitor (eg, HOBt, HOOBt), or the protected amino acid is activated in advance as a symmetric anhydride, HOBt ester or HOOBt ester. Can then be added to the resin.
  • a racemization inhibitor eg, HOBt, HOOBt
  • the solvent used for the activation of the protected amino acid and the condensation with the resin can be appropriately selected from solvents known to be usable for the protein condensation reaction.
  • acid amides such as N, N-dimethylformamide, N, N-dimethylacetamide, N-methylpyrrolidone, halogenated hydrocarbons such as methylene chloride and chloroform, alcohols such as trifluoroethanol, dimethyl sulfoxide, etc.
  • Examples include sulfoxides, amines such as pyridine, ethers such as dioxane and tetrahydrofuran, nitriles such as acetonitrile and propionitrile, esters such as methyl acetate and ethyl acetate, and appropriate mixtures thereof.
  • the reaction temperature is appropriately selected from a range that is known to be usable for protein bond forming reaction, and is usually selected from the range of about -20 ° C to 50 ° C.
  • the activated amino acid derivative is usually used in an excess of 1.5 to 4 times.
  • the unreacted amino acid can be acetylated using acetic anhydride or acetylimidazole.
  • the protection of the functional group that should not be involved in the reaction of the raw material, the protection group, the removal of the protective group, the activation of the functional group involved in the reaction, etc. can be appropriately selected from known groups or known means.
  • the protective group for the amino group of the raw material include Z, Boc, tertiary pentyloxycarbonyl, isobornyloxycarbonyl, 4-methoxybenzyloxycarbonyl, Cl-Z, Br-Z, adamantyloxycarbonyl, trifluoroacetyl. , Phthaloyl, formyl, 2-nitrophenylsulfenyl, diphenylphosphinothioyl, Fmoc, etc. are used.
  • the carboxyl group is, for example, alkyl esterified (eg, linear, branched or cyclic alkyl ester such as methyl, ethyl, propyl, butyl, tertiary butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl).
  • alkyl esterified eg, linear, branched or cyclic alkyl ester such as methyl, ethyl, propyl, butyl, tertiary butyl, cyclopentyl, cyclohexyl, cycloheptyl, cyclooctyl, 2-adamantyl.
  • Aralkyl esterification eg, benzyl ester, 4-nitrobenzyl ester, 4-methoxybenzyl ester, 4-chlorobenzyl ester, benzhydryl esterification
  • phenacyl esterification eg, benzyloxycarbonyl hydrazide, tertiary butoxy It can be protected by carbonyl hydrazation, trityl hydrazation or the like.
  • the hydroxyl group of serine can be protected, for example, by esterification or etherification.
  • groups suitable for esterification include groups derived from carbonic acid such as lower alkanoyl groups such as acetyl groups, aroyl groups such as benzoyl groups, benzyloxycarbonyl groups, and ethoxycarbonyl groups.
  • groups suitable for etherification include a benzyl group, a tetrahydropyranyl group, and a t-butyl group.
  • Examples of the protecting group for the phenolic hydroxyl group of tyrosine include Bzl, Cl 2 -Bzl, 2-nitrobenzyl, Br-Z, tertiary butyl and the like.
  • Examples of the protecting group for imidazole of histidine include Tos, 4-methoxy-2,3,6-trimethylbenzenesulfonyl, DNP, benzyloxymethyl, Bum, Boc, Trt, Fmoc, and the like.
  • Examples of methods for removing (eliminating) protecting groups include catalytic reduction in a hydrogen stream in the presence of a catalyst such as Pd-black or Pd-carbon, and anhydrous hydrogen fluoride, methanesulfonic acid, trifluoro.
  • a catalyst such as Pd-black or Pd-carbon
  • anhydrous hydrogen fluoride methanesulfonic acid, trifluoro.
  • Acid treatment with romethanesulfonic acid, trifluoroacetic acid or a mixture thereof, base treatment with diisopropylethylamine, triethylamine, piperidine, piperazine, etc., reduction with sodium in liquid ammonia, and the like are also used.
  • the elimination reaction by the acid treatment is generally performed at a temperature of about ⁇ 20 ° C. to 40 ° C.
  • Examples of the activated carboxyl group of the raw material include a corresponding acid anhydride, azide, active ester [alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, And esters thereof with cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBt) and the like.
  • active ester alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, And esters thereof with cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide, HOBt) and the like.
  • active ester alcohol (eg, pentachlorophenol, 2,4,5-trichlorophenol, 2,4-dinitrophenol, And esters thereof with cyanomethyl alcohol, paranitrophenol, HONB, N-hydroxysuccinimide, N-hydroxyphthalimide,
  • an amide form of GPR120 for example, first, the ⁇ -carboxyl group of the carboxy terminal amino acid is amidated and protected, and then the peptide chain is extended to the desired chain length on the amino group side and then the peptide A protein (peptide) from which only the protecting group of the ⁇ -amino group at the N-terminus of the chain is removed and a protein (peptide) from which only the protecting group of the carboxyl group at the C-terminal has been removed are prepared. Condensation in a mixed solvent as described above. The details of the condensation reaction are the same as described above.
  • the ester form of GPR120 can be obtained in the same manner as in the case of the amide form of GPR120, for example, after condensing the ⁇ -carboxyl group of the carboxy terminal amino acid with a desired alcohol to form an amino acid ester.
  • the partial peptide of the present invention can also be produced by cleaving the full-length protein of GPR120 with an appropriate peptidase.
  • GPR120 can also be produced by culturing a transformant containing the nucleic acid encoding it, and separating and purifying GPR120 from the resulting culture.
  • the nucleic acid encoding GPR120 or a partial peptide thereof may be DNA or RNA, or may be a DNA / RNA chimera.
  • DNA is used.
  • the nucleic acid may be double-stranded or single-stranded. In the case of a double strand, it may be a double-stranded DNA, a double-stranded RNA or a DNA: RNA hybrid.
  • a single strand it may be a sense strand (ie, a coding strand) or an antisense strand (ie, a non-coding strand).
  • DNA encoding GPR120 or a partial peptide thereof genomic DNA, human or other warm-blooded animals (eg, monkeys, cows, horses, pigs, sheep, goats, rabbits, mice, rats, guinea pigs, hamsters, chickens, etc.) Cells [eg, hepatocytes, spleen cells, neurons, glial cells, pancreatic ⁇ cells, bone marrow cells, mesangial cells, Langerhans cells, epidermal cells, epithelial cells, endothelial cells (eg, vascular endothelial cells), goblet cells, endothelium Cells, smooth muscle cells, fibroblasts, fibrocytes, muscle cells, adipocytes, immune cells (eg macrophages, T cells, B cells
  • Genomic DNA and cDNA encoding GPR120 or its partial peptides are prepared using Polymerase Chain Reaction (hereinafter referred to as “PCR method”) using the genomic DNA fraction and total RNA or mRNA fraction prepared from the cells and tissues as templates. (Abbreviated) and Reverse Transcriptase-PCR (hereinafter abbreviated as “RT-PCR method”).
  • PCR method Polymerase Chain Reaction
  • RT-PCR method Reverse Transcriptase-PCR
  • genomic DNA and cDNA encoding GPR120 or a partial peptide thereof can be prepared by inserting a genomic DNA prepared from the cells and tissues described above and a total RNA or mRNA fragment into an appropriate vector and It can also be cloned from a cDNA library by colony or plaque hybridization method or PCR method, respectively.
  • the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like.
  • DNA encoding GPR120 for example, DNA containing the base sequence shown in SEQ ID NO: 1, 3 or 5 or hybridized with the base sequence shown in SEQ ID NO: 1, 3 or 5 under highly stringent conditions And a DNA encoding a protein having substantially the same quality as GPR120 described above (eg, ligand binding activity, signal transduction activity, EPC differentiation / proliferation promoting activity, etc.).
  • DNA capable of hybridizing under high stringency conditions with the base sequence shown in SEQ ID NO: 1, 3 or 5 include, for example, about 60% or more, preferably about A DNA containing a base sequence having a homology of 70% or more, more preferably about 80% or more, further preferably about 90% or more, particularly preferably about 95% or more is used.
  • NCBI BLAST National Center for Biotechnology Information Basic Local Alignment Search Tool
  • the above-mentioned algorithm for calculating homology of amino acid sequences is also preferably exemplified.
  • Hybridization is carried out according to a method known per se or a method analogous thereto, for example, the method described in Molecular Cloning 2nd edition (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). Can do.
  • hybridization can be performed according to the method described in the attached instruction manual.
  • Hybridization can be preferably performed according to stringent conditions. High stringent conditions include, for example, a hybridization reaction at 45 ° C. in 6 ⁇ SSC (sodium chloride / sodium citrate), followed by one or more washings at 65 ° C. in 0.2 ⁇ SSC / 0.1% SDS. Can be mentioned.
  • a person skilled in the art may appropriately change the salt concentration of the hybridization solution, the temperature of the hybridization reaction, the probe concentration, the length of the probe, the number of mismatches, the time of the hybridization reaction, the salt concentration of the washing solution, the washing temperature, etc.
  • the desired stringency can be easily adjusted.
  • the DNA encoding GPR120 preferably encodes a mouse GPR120 protein shown in SEQ ID NO: 3, which is a DNA containing the base sequence encoding human GPR120 protein shown in SEQ ID NO: 1 (GenBank accession number: NM_181745) DNA containing the nucleotide sequence (GenBank accession number: NM_181748), DNA containing the nucleotide sequence encoding the rat GPR120 protein shown in SEQ ID NO: 5 (GenBank accession number: NM_001047088), or its ortholog in other mammals ( For example, a dog ortholog registered as an accession number XM_534968 in GenBank).
  • Orthologs in other mammals can be searched using BLAST or FASTA, for example, by querying the genome and / or cDNA database of mammals other than humans by querying the base sequence shown in SEQ ID NO: 1.
  • Mouse Genome Informatics provided by Jackson Laboratories (http://www.informatics.jax.org/) is searched using the accession number or gene symbol / gene name as a keyword, and Mammalian Orthology of the hit data
  • the array information can be acquired by accessing the information.
  • the DNA encoding the partial peptide of the present invention includes a base sequence encoding a peptide having the same or substantially the same amino acid sequence as part of the amino acid sequence shown in SEQ ID NO: 2, 4 or 6 It can be anything.
  • the DNA encoding the partial peptide of the present invention for example, (1) DNA having a partial base sequence of the base sequence shown in SEQ ID NO: 1, 3 or 5, or (2) SEQ ID NO: 1, It has a base sequence that hybridizes with DNA having the base sequence shown in 3 or 5 under highly stringent conditions, and has substantially the same activity as GPR120 described above (eg, ligand binding activity, signal transduction activity, EPC DNA encoding a peptide having differentiation / proliferation promoting activity) is used.
  • a DNA encoding GPR120 or a partial peptide thereof is amplified by PCR using a synthetic DNA primer having a part of a base sequence encoding the GPR120 or a partial peptide thereof, or DNA incorporated into an appropriate expression vector is used.
  • Cloning can be carried out by hybridization with a DNA fragment encoding a part or the entire region of GPR120 protein or a labeled synthetic DNA. Hybridization can be performed, for example, according to the method described in Molecular Cloning Second Edition (described above). When a commercially available library is used, hybridization can be performed according to the method described in the instruction manual attached to the library.
  • the DNA base sequence is determined using a known kit such as Mutan TM -super Express Km (Takara Shuzo), Mutan TM -K (Takara Shuzo), etc., using the ODA-LA PCR method, the Gapped duplex method, Conversion can be performed according to a method known per se such as the Kunkel method or a method analogous thereto.
  • the cloned DNA can be used as it is depending on the purpose, or after digestion with a restriction enzyme or addition of a linker as desired.
  • the DNA may have ATG as a translation initiation codon on the 5 'end side and TAA, TGA or TAG as a translation termination codon on the 3' end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.
  • An expression vector containing DNA encoding GPR120 or a partial peptide thereof is produced, for example, by excising a target DNA fragment from DNA encoding GPR120 and ligating the DNA fragment downstream of a promoter in an appropriate expression vector. can do.
  • Expression vectors include plasmids derived from E.
  • coli eg, pBR322, pBR325, pUC12, pUC13
  • plasmids derived from Bacillus subtilis eg, pUB110, pTP5, pC194
  • yeast-derived plasmids eg, pSH19, pSH15
  • insect cell expression Plasmid eg, pFast-Bac
  • animal cell expression plasmid eg, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo
  • bacteriophage such as ⁇ phage
  • insect virus vector such as baculovirus ( Examples: BmNPV, AcNPV); animal virus vectors such as retroviruses, lentiviruses, vaccinia viruses, adenoviruses, adeno-associated viruses, herpes viruses, etc.
  • the promoter may be any promoter as long as it is appropriate for the host used for gene expression.
  • SR ⁇ promoter SV40 promoter, LTR promoter, CMV (cytomegalovirus) promoter, RSV (rous sarcoma virus) promoter, MoMuLV (Moloney murine leukemia virus) LTR, HSV-TK (herpes simplex) Virus thymidine kinase) promoter or the like is used.
  • CMV promoter, SR ⁇ promoter and the like are preferable.
  • trp promoter When the host is Escherichia, trp promoter, lac promoter, recA promoter, ⁇ P L promoter, lpp promoter, T7 promoter and the like are preferable.
  • SPO1 promoter When the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter and the like are preferable.
  • yeast When the host is yeast, the PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable.
  • the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.
  • an expression vector containing an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40 ori), etc. is used as desired.
  • the selection marker include a dihydrofolate reductase gene (hereinafter abbreviated as dhfr, methotrexate (MTX) resistance), an ampicillin resistance gene (hereinafter abbreviated as amp r ), a neomycin resistance gene ( hereinafter sometimes abbreviated as neo r, include G418 resistance) and the like.
  • the target gene can also be selected using a medium that does not contain thymidine. If necessary, a base sequence (signal codon) encoding a signal sequence suitable for the host is added (or replaced with a native signal codon) to the 5 ′ end of DNA encoding GPR120 or a partial peptide thereof. May be.
  • insulin signal sequence, ⁇ -interferon signal sequence, antibody molecule / signal sequence, etc. are used respectively.
  • GPR120 or a partial peptide thereof can be produced by transforming a host with an expression vector containing a DNA encoding GPR120 or a partial peptide thereof and culturing the resulting transformant.
  • a host for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used.
  • the genus Escherichia include, for example, Escherichia coli K12 • DH1 [Procedures of the National Academy of Sciences of the USA (Proc. Natl. Acad. Sci. USA).
  • Bacillus examples include Bacillus subtilis MI114 [Gene, 24, 255 (1983)], Bacillus subtilis 207-21 [Journal of Biochemistry, 95, 87 (1984)].
  • yeast examples include Saccharomyces cerevisiae AH22, AH22R ⁇ , NA87-11A, DKD-5D, 20B-12, Schizosaccharomyces pombe NCYC1913, NCYC2036, Pichia pastoris (Pichia pastoris (Pichia pastoris) KM71 etc. are used.
  • Insect cells include, for example, when the virus is AcNPV, larvae-derived cell lines (Spodoptera frugiperda cells; Sf cells), MG1 cells derived from the midgut of Trichoplusia ni, High Five TM cells derived from eggs of Trichoplusia ni , Cells derived from Mamestra brassicae, cells derived from Estigmena acrea, and the like are used.
  • larvae-derived cell lines Spodoptera frugiperda cells; Sf cells
  • MG1 cells derived from the midgut of Trichoplusia ni
  • High Five TM cells derived from eggs of Trichoplusia ni
  • Cells derived from Mamestra brassicae cells derived from Estigmena acrea, and the like are used.
  • BmNPV moth-derived cell lines (Bombyx mori N cells; BmN cells) and the like are used as insect cells.
  • Sf cells examples include Sf9 cells (ATCC CRL 1711), Sf21 cells (Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like.
  • insects examples include silkworm larvae [Maeda et al., Nature, 315, 592 (1985)].
  • animal cells examples include monkey COS-7 cells, monkey Vero cells, Chinese hamster ovary cells (hereinafter abbreviated as CHO cells), dhfr gene-deficient CHO cells (hereinafter abbreviated as CHO (dhfr ⁇ ) cells), mouse L Cells, mouse AtT-20 cells, mouse myeloma cells, rat GH3 cells, human FL cells, HeLa cells, HepG2 cells, HEK293 cells and the like are used.
  • CHO cells Chinese hamster ovary cells
  • CHO (dhfr ⁇ ) cells) cells examples include monkey L Cells, mouse AtT-20 cells, mouse myeloma cells, rat GH3 cells, human FL cells, HeLa cells, HepG2 cells, HEK293 cells and the like are used.
  • Transformation can be performed according to a known method depending on the type of host.
  • Escherichia bacteria for example, Proc. Natl. Acad. Sci. USA, 69, 2110 (1972) and Gene ( Gene), 17, 107 (1982), and the like.
  • Bacillus can be transformed according to the method described in, for example, Molecular & General Genetics, 168, 111 (1979).
  • Yeast is, for example, Methods in Enzymology, 194, 182-287 (1991), Proceedings of the National Academy of Sciences of USA ( Proc. Natl. Acad. Sci. USA), 75, 1929 (1978).
  • Insect cells and insects can be transformed according to the method described in, for example, Bio / Technology, Vol. 6, 47-55 (1988).
  • Animal cells should be transformed according to the method described in, for example, Cell Engineering Annex 8 New Cell Engineering Experimental Protocol, 263-267 (1995) (published by Shujunsha), Virology, 52, 456 (1973). Can do.
  • the culture of the transformant can be performed according to a known method depending on the type of the host. For example, when culturing a transformant whose host is an Escherichia or Bacillus genus, a liquid medium is preferable as a medium used for the culture. Moreover, it is preferable that a culture medium contains a carbon source, a nitrogen source, an inorganic substance, etc. which are required for the growth of a transformant.
  • the carbon source for example, glucose, dextrin, soluble starch, sucrose, etc .
  • the nitrogen source for example, ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean cake, Inorganic or organic substances such as potato extract; examples of inorganic substances include calcium chloride, sodium dihydrogen phosphate, magnesium chloride, and the like.
  • yeast extract, vitamins, growth promoting factors and the like may be added to the medium.
  • the pH of the medium is preferably about 5 to about 8.
  • a medium for culturing a transformant whose host is an Escherichia bacterium for example, an M9 medium containing glucose and casamino acids [Miller, Journal of Experiments in Molecular Genetics ( Journal of Experiments in Molecular Genetics), 431-433, Cold Spring Harbor Laboratory, New York 1972].
  • an agent such as 3 ⁇ -indolylacrylic acid may be added to the medium in order to make the promoter work efficiently.
  • Culturing of a transformant whose host is an Escherichia bacterium is usually performed at about 15 to about 43 ° C. for about 3 to about 24 hours. If necessary, aeration or agitation may be performed.
  • Culturing of the transformant whose host is Bacillus is usually performed at about 30 to about 40 ° C. for about 6 to about 24 hours. If necessary, aeration or agitation may be performed.
  • a medium for culturing a transformant whose host is yeast for example, a Burkholder minimum medium [Bostian, KL et al., Proceedings of the National Academy of Sciences of Science The USA (Proc. Natl. Acad. Sci. USA), 77, 4505 (1980)] and SD medium containing 0.5% casamino acid [Bitter, GA, et al., Proceedings of the National Academy ⁇ Of Sciences of the USA (Proc. Natl. Acad. Sci. USA), 81, 5330 (1984)].
  • the pH of the medium is preferably about 5 to about 8.
  • the culture is usually performed at about 20 ° C. to about 35 ° C. for about 24 to about 72 hours. Aeration and agitation may be performed as necessary.
  • a medium for culturing a transformant whose host is an insect cell or an insect for example, 10% bovine serum deactivated in Grace's Insect Medium [Grace, TCC, Nature, 195, 788 (1962)] The thing etc. which added additives, such as these, etc. suitably are used.
  • the pH of the medium is preferably about 6.2 to about 6.4.
  • the culture is usually performed at about 27 ° C. for about 3 to about 5 days. You may perform ventilation
  • a medium for culturing a transformant whose host is an animal cell for example, a minimum essential medium (MEM) containing about 5 to about 20% fetal bovine serum [Science, 122, 501 (1952 ], Dulbecco's Modified Eagle Medium (DMEM) [Virology, Vol. 8, 396 (1959)], RPMI 1640 Medium [The Journal of the American Medical Association, 199, 519 (1967)], 199 medium [Proceeding of the Society for the Biological Medicine, 73, 1 (1950)] Used.
  • the pH of the medium is preferably about 6 to about 8.
  • the culture is usually performed at about 30 ° C. to about 40 ° C. for about 15 to about 60 hours. You may perform ventilation
  • GPR120 or a partial peptide thereof can be produced inside or outside the transformant.
  • GPR120 or a partial peptide thereof can be separated and purified from a culture obtained by culturing the transformant according to a method known per se.
  • a method known per se For example, when GPR120 or a partial peptide thereof is extracted from cultured cells or cytoplasm of cells, the cells or cells collected from the culture by a known method are suspended in an appropriate buffer, and are subjected to ultrasound, lysozyme and / or freezing.
  • a method of obtaining a crude extract of soluble protein by centrifugation or filtration after disrupting cells or cells by thawing or the like is appropriately used.
  • the buffer solution may contain a protein denaturant such as urea or guanidine hydrochloride and a surfactant such as Triton X-100 TM .
  • a protein denaturant such as urea or guanidine hydrochloride
  • a surfactant such as Triton X-100 TM .
  • the cell debris is precipitated and removed by low-speed centrifugation, and the supernatant is centrifuged at high speed to obtain the cell membrane-containing fraction.
  • a method such as precipitation (purifying a cell membrane fraction by density gradient centrifugation or the like as required) is used.
  • GPR120 or a partial peptide thereof When GPR120 or a partial peptide thereof is secreted outside the cells (cells), a method of separating the culture supernatant from the culture by centrifugation or filtration is used. Isolation and purification of GPR120 or a partial peptide thereof contained in the thus obtained soluble fraction, membrane fraction or culture supernatant can be performed according to a method known per se. Examples of such methods include the use of solubilities such as salting out and solvent precipitation; mainly the differences in molecular weight such as dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis.
  • a method utilizing a difference in charge such as ion exchange chromatography; a method utilizing a specific affinity such as affinity chromatography; a method utilizing a difference in hydrophobicity such as reverse phase high performance liquid chromatography; A method using a difference in isoelectric point, such as point electrophoresis, is used. These methods can be combined as appropriate.
  • the free form can be converted into a salt by a method known per se or a method analogous thereto, and when the protein or peptide is obtained as a salt, The salt can be converted into a free form or other salt by a method known per se or a method analogous thereto.
  • the GPR120 produced by the transformant or a partial peptide thereof can be arbitrarily modified or the polypeptide can be partially removed by applying an appropriate protein modifying enzyme before or after purification.
  • the protein modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like.
  • the presence of GPR120 or a partial peptide thereof thus obtained can be confirmed by enzyme immunoassay or Western blotting using an antibody against GPR120.
  • GPR120 or a partial peptide thereof uses a cell-free protein translation system comprising a rabbit reticulocyte lysate, a wheat germ lysate, an Escherichia coli lysate, etc., using an RNA corresponding to the DNA encoding the GPR120 or the partial peptide as a template. It can be synthesized in vitro.
  • a cell-free transcription / translation system further containing RNA polymerase can be used to synthesize a DNA encoding GPR120 or a partial peptide thereof as a template.
  • the cell-free protein transcription / translation system can be a commercially available one, or a known method, specifically, Escherichia coli extract is Pratt JM et al., “Transcription and Tranlation”, Hames BD and Higgins SJ, IRL It can also be prepared according to the method described in Press, Oxford 179-209 (1984).
  • Examples of commercially available cell lysates include E. coli S30 extract system (Promega) and RTS 500 Rapid Tranlation System (Roche) derived from E. coli, and Rabbit Reticulocyte Lysate System derived from rabbit reticulocytes. Examples of those derived from wheat germ include Proteios TM (manufactured by TOYOBO).
  • wheat germ lysate those using wheat germ lysate are preferred.
  • a method for producing wheat germ lysate for example, the method described in Johnston FB et al., Nature, 179, 160-161 (1957) or Erickson AH et al., Meth. Enzymol., 96, 38-50 (1996), etc. should be used. Can do.
  • a system or apparatus for protein synthesis a batch method (Pratt, JM et al. (1984) mentioned above) or a continuous cell-free protein synthesis system (Spirin AS et al.
  • cells producing GPR120 or a partial peptide thereof include cells that naturally express GPR120 (eg, EPC (large EPC, small EPC), adipocytes, enteroendocrine cells, etc.) and progenitor cells thereof ( For example, bone marrow cells, preadipocytes, etc.), and transformed cells into which a nucleic acid encoding GPR120 or a partial peptide thereof has been introduced.
  • EPC large EPC, small EPC
  • progenitor cells thereof For example, bone marrow cells, preadipocytes, etc.
  • the promoter and / or enhancer / suppressor that regulates the expression of the nucleic acid encoding GPR120 or the partial peptide is used as an endogenous GPR120 gene.
  • promoters and / or enhancer / suppressor sequences are preferred to use.
  • Such a regulatory sequence of GPR120 gene can be isolated and cloned from genomic DNA extracted from mammalian cells and tissues by a method known per se.
  • the cells that produce GPR120 or a partial peptide thereof preferably include EPC (large EPC, small EPC) and its precursor cells (bone marrow cells). Using these cells, not only can EPC differentiation / proliferation regulation or EPC increase in peripheral blood be screened using the activity or expression of endogenous GPR120 as an index, but differentiation from bone marrow cells to EPC, It is also possible to verify whether the growth rate can be adjusted.
  • bone marrow cells include all EPC progenitor cells present in bone marrow unless otherwise specified.
  • typical EPC progenitor cells can be obtained from fractions characterized by c-kit + , Sca-1 + , and lineage marker ⁇ for the expression of various cell surface antigen markers.
  • Such compounds include (a) GPR120 binding to cell stimulating activity (eg, GTP-GDP exchange reaction acceleration in conjugated G ⁇ , PLC ⁇ activation, regulation of inositol phosphate production, intracellular Ca 2+ uptake, PKC activity) , EPC differentiation promotion, EPC proliferation promotion, insulin secretion promotion, hypoglycemia, ACTH secretion suppression, growth hormone secretion regulation, etc.) (b) A compound that binds to GPR120 but exhibits cell-stimulating activity A compound that does not have (antagonist), (c) a compound that enhances the binding force between GPR120 and the ligand, or (d) a compound that decreases the binding force between GPR120 and the ligand.
  • cell stimulating activity eg, GTP-GDP exchange reaction acceleration in conjugated G ⁇ , PLC ⁇ activation, regulation of inositol phosphate production, intracellular Ca 2+ uptake, PKC activity
  • EPC differentiation promotion EPC proliferation promotion
  • insulin secretion promotion hypogly
  • GPR120 has an action of promoting differentiation of bone marrow cells to EPC (in the present specification, “differentiation of EPC” simply means differentiation of bone marrow cells to EPC) and proliferation of EPC
  • a compound that enhances the binding force between an agonist or GPR120 and a ligand can promote differentiation and proliferation of EPC.
  • an antagonist of GPR120 or a compound that decreases the binding force between GPR120 and a ligand can suppress the differentiation / proliferation of EPC.
  • an antagonist of GPR120 or a compound that decreases the binding force between GPR120 and a ligand is also useful for increasing EPC in peripheral blood.
  • the present invention includes GPR120 or a partial peptide thereof and a known low-molecular compound (hereinafter sometimes referred to as “surrogate ligand”) that changes the binding property of fatty acid that is a physiological ligand or fatty acid and GPR120.
  • EPC differentiation / proliferation regulation (promotion or suppression) or EPC in peripheral blood characterized by contacting in the presence and absence of a test compound and comparing the activity of GPR120 or its partial peptide under both conditions
  • a method for screening increased substances is provided. In the screening method described above, the activity of GPR120 or a partial peptide thereof is measured using the binding amount of a ligand (fatty acid or surrogate ligand) to the protein or peptide, or the cell stimulating activity as an index.
  • the present invention provides: (1) Binding amount of labeled fatty acid or surrogate ligand to GPR120 or its partial peptide when the labeled fatty acid or surrogate ligand is contacted with GPR120 or its partial peptide in the presence or absence of the test compound EPC differentiation / proliferation regulation or screening method for EPC increasing substance in peripheral blood, characterized by measuring and comparing (2) A labeled fatty acid or surrogate ligand when the labeled fatty acid or surrogate ligand is contacted with a cell producing GPR120 or a partial peptide thereof or a membrane fraction thereof in the presence and absence of a test compound A method of screening for a substance that regulates differentiation / proliferation of EPC or an EPC-increasing substance in peripheral blood, which comprises measuring and comparing the binding amount of the cells to the cell or membrane fraction, (3) A labeled fatty acid or surrogate ligand and the protein or peptide expressed on the cell membrane by culturing a transformant containing
  • GPR120 or a partial peptide thereof used in the screening method of the present invention may be any as long as it contains GPR120 or the partial peptide described above, but physiological conformation of the extracellular region. Is preferably a cell membrane fraction of a mammalian organ that produces GPR120 or a partial peptide thereof. However, since human-derived organs are particularly difficult to obtain, human-derived GPR120 or a partial peptide thereof expressed in large quantities using a recombinant is suitable for use in screening.
  • GPR120 or a partial peptide thereof In order to produce GPR120 or a partial peptide thereof, the above-mentioned method is used, but it is preferable to carry out expression in mammalian cells or insect cells of DNA encoding GPR120 or a partial peptide thereof.
  • CDNA is used as a DNA fragment encoding a target protein portion, but is not necessarily limited thereto. For example, gene fragments or synthetic DNA may be used.
  • the DNA fragment can be expressed using an SV40-derived promoter, a retroviral promoter, a metallothionein promoter, human It is preferably incorporated downstream of a heat shock promoter, a cytomegalovirus promoter, an SR ⁇ promoter, a polyhedrin promoter of a nuclear polyhedrosis virus (NPV) belonging to baculoviruses with insect hosts.
  • SV40-derived promoter a retroviral promoter, a metallothionein promoter, human It is preferably incorporated downstream of a heat shock promoter, a cytomegalovirus promoter, an SR ⁇ promoter, a polyhedrin promoter of a nuclear polyhedrosis virus (NPV) belonging to baculoviruses with insect hosts.
  • NPV nuclear polyhedrosis virus
  • the cells when cells that produce GPR120 or a partial peptide thereof are used, the cells may be fixed with glutaraldehyde, formalin or the like.
  • the immobilization method can be performed according to a method known per se.
  • a cell that produces GPR120 or a partial peptide thereof refers to a host cell that expresses GPR120 or a partial peptide thereof. Examples of the host cell include animal cells and insect cells.
  • the cell membrane fraction refers to a fraction containing a lot of cell membranes obtained by a method known per se after disrupting cells.
  • Cell disruption methods include crushing cells with a Potter-Elvehjem homogenizer, disrupting with a Waring blender or polytron (manufactured by Kinematica), disrupting with ultrasonic waves, and pressurizing with a French press while ejecting cells from a thin nozzle. Crushing by things.
  • a fractionation method using centrifugal force such as a fractional centrifugation method or a density gradient centrifugation method is mainly used.
  • the cell lysate is centrifuged at low speed (500 rpm to 3000 rpm) for a short time (usually about 1 to 10 minutes), and the supernatant is further centrifuged at high speed (15000 rpm to 30000 rpm) for usually 30 minutes to 2 hours.
  • the membrane fraction is rich in the expressed GPR120 or a partial peptide thereof and membrane components such as cell-derived phospholipids and membrane proteins.
  • GPR120 obtained as described above in an artificial lipid bilayer prepared by a conventional method from a solution in which various lipids are mixed at an appropriate ratio, preferably a ratio close to that in the cell membrane of a eukaryotic cell.
  • the reconstituted partial peptide can be used as the cell membrane fraction.
  • the lipid constituting the artificial lipid bilayer include phosphatidylcholine (PC), phosphatidylserine (PS), cholesterol (Ch), phosphatidylinositol (PI), phosphatidylethanolamine (PE), etc., one or two of these What mixed the above by the appropriate ratio is used preferably.
  • an artificial lipid bilayer (proteoliposome) incorporating GPR120 or a partial peptide thereof can be prepared by the following method.
  • An appropriate amount of the purified fusion protein is added thereto, incubated for about 20 to 30 minutes with occasional stirring in ice, and then dialyzed against an appropriate buffer.
  • the desired proteoliposome can be obtained by collecting the sediment by centrifugation at about 100,000 ⁇ g for 30 to 60 minutes.
  • the amount of GPR120 or its partial peptide in a cell producing GPR120 or its partial peptide or its membrane fraction is preferably 10 3 to 10 8 molecules, more preferably 10 5 to 10 7 molecules per cell. More preferred.
  • the higher the expression level the higher the ligand binding activity (specific activity) per membrane fraction, making it possible not only to construct a highly sensitive screening system, but also to measure a large amount of samples in the same lot. .
  • an appropriate GPR120 or a partial peptide-containing membrane fraction thereof is used.
  • a labeled fatty acid or surrogate ligand is desirable.
  • GPR120 or a partial peptide-containing membrane fraction thereof a natural GPR120 or a partial peptide-containing membrane fraction thereof, or a recombinant GPR120 having a similar activity or a partial peptide-containing membrane fraction thereof is desirable.
  • the equivalent activity indicates an equivalent ligand binding activity and the like.
  • the fatty acid may be any fatty acid as long as it can serve as a ligand for GPR120 or a partial peptide thereof. Acid) and the like. Among them, palmitoleic acid, linoleic acid, and ⁇ -linolenic acid are preferably used.
  • the fatty acid may be a free form or a salt form.
  • Preferred examples of the fatty acid salts include salts with bases (eg, alkali metal salts such as sodium salts and potassium salts, alkaline earth metal salts such as calcium salts and magnesium salts, ammonium salts and alkanolamine salts). However, it is not limited to them.
  • Examples of the “low molecular weight compound that changes the binding property between fatty acid and GPR120”, that is, the surrogate ligand include, for example, the formula:
  • ring A represents an aromatic ring which may have a substituent
  • ring B represents an aromatic ring which may further have a substituent other than —Y—COOH
  • X and Y each represent a spacer.
  • -Y-COOH is substituted at any position on ring B.
  • the fatty acid or surrogate ligand can be labeled with, for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance and the like according to a conventional method.
  • a radioisotope for example, [ 125 I], [ 131 I], [ 3 H], [ 14 C] and the like are used.
  • the enzyme those which are stable and have high specific activity are preferable.
  • ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used.
  • the fluorescent substance for example, fluorescamine, fluorescein isothiocyanate and the like are used.
  • luminescent substance for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
  • GPR120 or a partial peptide preparation thereof is prepared by suspending in a buffer.
  • the buffer may be any buffer that does not inhibit the binding of GPR120 or a partial peptide thereof and a fatty acid (or surrogate ligand), such as a phosphate buffer having a pH of 4 to 10 (preferably pH 6 to 8) or a Tris-HCl buffer.
  • a surfactant such as CHAPS, Tween-80 TM (Kao-Atlas), digitonin, deoxycholate and the like can be added to the buffer.
  • a surfactant such as CHAPS, Tween-80 TM (Kao-Atlas), digitonin, deoxycholate and the like
  • protease inhibitors such as PMSF, leupeptin, E-64 (manufactured by Peptide Institute) and pepstatin can be added for the purpose of suppressing the degradation of the receptor by the protease.
  • the solution is filtered with a glass fiber filter or the like, washed with an appropriate amount of the same buffer, and then the radioactivity remaining on the glass fiber filter is measured with a liquid scintillation counter or ⁇ -counter.
  • the specific binding amount (B-NSB) is, for example, Therefore, a test compound that is 50% or less can be selected as a candidate compound for EPC differentiation / proliferation regulation or an EPC increasing substance in peripheral blood.
  • an appropriate buffer that is not toxic to fresh medium or cells in advance eg, HEPES buffer, phosphate buffer, phosphate buffered saline, Tris-HCl buffer, borate buffer, acetic acid
  • the solution is exchanged with a buffer solution, etc., and a ligand, a test compound, etc. are added and incubated for a certain period of time.
  • the cells are extracted or the supernatant is collected, and the produced product is quantified according to each method.
  • an assay may be performed with an inhibitor for the degrading enzyme added.
  • test compounds include peptides, proteins, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts and the like, and these compounds may be novel compounds. It may be a known compound.
  • a screening kit for a compound or a salt thereof that alters the binding property between GPR120 or a partial peptide thereof and a fatty acid or a surrogate ligand contains GPR120 or a partial peptide thereof, a cell that produces GPR120 or a partial peptide thereof, a membrane fraction thereof, or the like Is.
  • Examples of the screening kit of the present invention include the following. 1. Screening reagents (a) Buffer for measurement and buffer for washing Hanks' Balanced Salt Solution (Gibco) plus 0.05% bovine serum albumin (Sigma). The solution is sterilized by filtration through a 0.45 ⁇ m filter and stored at 4 ° C. or may be prepared at the time of use.
  • GPR120 or its partial peptide preparation CHO cells expressing GPR120 or its partial peptide are passaged to a 12-well plate at 5 ⁇ 10 5 cells / well, 37 ° C., 5% CO 2 , 95% air Cultured for 2 days.
  • Labeled fatty acid or surrogate ligand A commercially available fatty acid or surrogate ligand aqueous solution labeled with [ 3 H], [ 125 I], [ 14 C] or the like is stored at 4 ° C. or ⁇ 20 ° C., Dilute to 1 ⁇ M with buffer for measurement.
  • Fatty acid or surrogate ligand standard solution Fatty acid or surrogate ligand is dissolved to 1 mM in PBS containing 0.1% bovine serum albumin (manufactured by Sigma) and stored at -20 ° C.
  • cells that express GPR120 or a partial peptide thereof on the cell membrane further express conjugated G ⁇ .
  • the family of G ⁇ conjugated to GPR120 or its partial peptide is G ⁇ q / 11 .
  • the cells expressing GPR120 or a partial peptide thereof and its conjugated G ⁇ include transformed cells co-transfected with DNA encoding GPR120 or its partial peptide and DNA encoding G ⁇ q / 11 .
  • G ⁇ activation domain of the receptor interacts with the receptor binding region of conjugated G ⁇ , resulting in a conformational change of G ⁇ , and a GTP / GDP binding region GDP dissociates from GTP and quickly binds GTP.
  • G ⁇ -GTP acts on the effector PLC ⁇ to promote its activity.
  • the antagonist binds, the conformation of the receptor does not occur and the G ⁇ activation domain is in an inactivated state, so that the activated G ⁇ -GTP level is decreased and the action on PLC ⁇ is inhibited.
  • GTP for example, if a GTP analog that does not undergo hydrolysis due to GTPase activity of G ⁇ such as 35 S-labeled GTP ⁇ S is added to the system, the membrane in the presence and absence of the test compound can be used. By measuring and comparing the radioactivity bound to G ⁇ , the effect of the test compound on the GDP-GTP exchange reaction in G ⁇ can be evaluated, and screening for substances having agonist / antagonist activity of GPR120 or its partial peptides Can do.
  • GTP for example, if a GTP analog that does not undergo hydrolysis due to GTPase activity of G ⁇ such as 35 S-labeled GTP ⁇ S is added to the system, the membrane in the presence and absence of the test compound can be used. By measuring and comparing the radioactivity bound to G ⁇ , the effect of the test compound on the GDP-GTP exchange reaction in G ⁇ can be evaluated, and screening for substances having agonist / antagonist activity of GPR120 or its partial peptides Can do.
  • the test compound has an agonist activity against GPR120 or a partial peptide thereof, and if the radioactivity decreases, the test compound has an antagonist activity against GPR120 or a partial peptide thereof.
  • the activity of PLC ⁇ that interacts with G ⁇ is compared in the presence and absence of a test compound.
  • a screening method is provided. Therefore, cells expressing GPR120 or its partial peptide and its conjugated G ⁇ also express PLC ⁇ that receives signals from the G ⁇ .
  • the PLC ⁇ activity is determined, for example, by adding [ 3 H] -labeled phosphatidylinositol-4,5-diphosphate to the PLC ⁇ -containing membrane fraction, and determining the amount of inositol-1,4,5-triphosphate produced by a known amount. It can evaluate by measuring using a method.
  • PLC ⁇ activity is measured and compared in the presence and absence of the test compound, and if the enzyme activity increases in the presence of the test compound, the test compound has agonist activity against GPR120 or its partial peptide, and conversely PLC ⁇ If the activity decreases, the test compound is evaluated as having antagonist activity against GPR120 or a partial peptide thereof.
  • the action of G ⁇ on PLC ⁇ is measured by adding [ 3 H] -labeled inositol to the cells and measuring the radioactivity of the generated [ 3 H] -labeled inositol phosphate, It can also be evaluated by measuring the amount of intracellular Ca 2+ .
  • intracellular Ca 2+ levels incubate the cells for an appropriate time in the presence and absence of the test compound, and then use a fluorescent probe (fura-2, indo-1, fluor-3, Calcium-Green I, etc.) It can be measured spectroscopically or using aequorin, which is a calcium-sensitive photoprotein, but any other known method may be used.
  • An apparatus suitable for spectroscopic measurement using a fluorescent probe is a FLIPR (Molecular Devices) system.
  • a reporter gene under the control of a TPA (12-O-tetradecanoylphorbol-13-acetate) response element (TRE) that is up-regulated by Ca 2+
  • TRE TPA (12-O-tetradecanoylphorbol-13-acetate) response element
  • a method for evaluating the amount of Ca 2+ That is, eukaryotic cells into which a vector containing an expression cassette linked with a DNA encoding a reporter protein (eg, luciferase, GFP, peroxidase, alkaline phosphatase, etc.) is introduced downstream of a promoter containing TRE in the presence of a test compound.
  • a reporter protein eg, luciferase, GFP, peroxidase, alkaline phosphatase, etc.
  • the amount of Ca 2+ in the cell is evaluated by measuring and comparing the expression of the reporter gene in the extract obtained by culturing for an appropriate time in the absence and disrupting the cells using a known method. Is. Therefore, if the intracellular Ca 2+ level (or the expression level of the reporter gene under TRE control) increases in the presence of the test compound, the test compound has agonist activity for GPR120 or its partial peptide, and conversely If the intracellular Ca 2+ level (or reporter gene expression level) decreases, the test compound has antagonist activity against GPR120 or a partial peptide thereof.
  • GPR120 or GPR120 when cells producing GPR120 or a partial peptide thereof are cultured in the presence and absence of a test compound without contacting with a fatty acid or a surrogate ligand.
  • a compound that promotes or suppresses the activity of GPR120 can be selected regardless of whether or not the binding property to the ligand is changed.
  • a fusion protein in which conjugated G ⁇ is linked to the C-terminal side of GPR120 or a partial peptide thereof is used in mammalian cells, insect cells, and the like.
  • GPR120 or a partial peptide thereof can be constitutively activated.
  • yeast eg, baker's yeast
  • Yeast has STE2, which is the receptor for mating pheromone alpha factor, as the only GPCR.
  • GPA1 is a conjugated G ⁇
  • G ⁇ dissociates from G ⁇ / G ⁇ .
  • Kinase cascade signals from dissociated G ⁇ / G ⁇ induce FUS1 expression and conjugation occurs.
  • GPR120 or a partial peptide thereof is expressed in yeast instead, and GPR120 or a conjugated G ⁇ of the partial peptide is co-expressed under the control of the GPA1 promoter, a fatty acid (or an agonist of GPR120) GPR120 or a partial peptide thereof mediates intracellular signal transduction as if by STE2.
  • G ⁇ coupled to GPR120 or its partial peptide is co-expressed under the control of the GPA1 promoter, and a gene supplementing an auxotrophic mutation or a reporter gene (for example, LacZ) is fused to FUS1. Signal activation can be detected. Details of this method are described in, for example, Yeast, 16: 11-22 (2000).
  • the cell producing GPR120 or a partial peptide thereof is provided in the form of a non-human mammal individual.
  • the state of the individual animal is not particularly limited.
  • it is a model animal of a disease (obesity, diabetes, hypertension, arteriosclerosis, etc.) such as db / db mouse, ob / ob mouse, KKAy mouse, Zuckerfatty rat, and WHHL rabbit. May be.
  • a disease ovale.g., diabetes, hypertension, arteriosclerosis, etc.
  • db / db mouse ob / ob mouse
  • KKAy mouse KKAy mouse
  • Zuckerfatty rat and WHHL rabbit.
  • WHHL rabbit WHHL rabbit
  • the administration route is not particularly limited, and examples thereof include intravenous administration, intraarterial administration, subcutaneous administration, intradermal administration, intraperitoneal administration, oral administration, intratracheal administration, and rectal administration.
  • the dose is not particularly limited. For example, a dose of about 0.5 to 20 mg / kg can be administered 1 to 5 times a day, preferably 1 to 3 times a day for 1 to 14 days.
  • the contact of the ligand with the cell can be replaced by the action of a fatty acid that is a physiological ligand inherent in the animal individual.
  • the agonist for GPR120 or its partial peptide obtained by using the above screening method has the same action as the physiological activity of fatty acid for GPR120 or its partial peptide. It is useful as a safe and low-toxic drug that enhances differentiation / proliferation promoting action. Since antagonists to GPR120 or its partial peptide can suppress the physiological activity of fatty acids for GPR120 or its partial peptide, it suppresses GPR120-mediated signal transduction and EPC differentiation / proliferation-promoting effects, as well as peripheral blood. It is useful as a safe and low-toxic drug that exhibits an increase in EPC.
  • a compound that enhances the binding force between GPR120 or a partial peptide thereof and a fatty acid is useful as a safe and low toxic pharmaceutical for enhancing the physiological activity of the fatty acid for GPR120 or a partial peptide thereof.
  • a compound that decreases the binding force between GPR120 or a partial peptide thereof and a fatty acid is useful as a safe and low-toxic pharmaceutical for reducing the physiological activity of fatty acids for GPR120 or a partial peptide thereof.
  • GPR120 has an action of promoting differentiation and proliferation of EPC, and suppression of GPR120 promotes mobilization of EPC to peripheral blood.
  • a compound that changes the expression level of GPR120 can regulate differentiation and proliferation of EPC and increase EPC in peripheral blood. Therefore, the present invention is also characterized in that the expression of the protein or peptide (or gene encoding it) in cells producing GPR120 or a partial peptide thereof is compared in the presence and absence of the test compound.
  • the present invention provides a screening method for EPC differentiation / proliferation regulation or EPC increasing substance in peripheral blood.
  • the cells used in this method, the type of test compound, the mode of contact between the test compound and the cells, and the like are the same as those described above using the activity of GPR120 or a partial peptide thereof as an index.
  • the expression level of GPR120 or a partial peptide thereof is a nucleic acid that can hybridize with the above-described DNA encoding GPR120 or the partial peptide under high stringency conditions, that is, the nucleotide sequence represented by SEQ ID NO: 1, 3, or 5 or GPR120 or a partial peptide thereof using a nucleic acid capable of hybridizing under high stringency conditions with a DNA comprising the partial base sequence or the complementary strand sequence (hereinafter sometimes referred to as “the nucleic acid for detection of the present invention”) Can be measured at the RNA level.
  • the expression level is measured at the protein level by detecting the protein or peptide using an antibody against GPR120 or a partial peptide thereof (hereinafter sometimes referred to as “the detection antibody of the present invention”). You can also. Therefore, more specifically, the present invention (A) Cells that produce GPR120 or a partial peptide thereof are cultured in the presence and absence of a test compound, and the amount of mRNA encoding the protein or peptide under both conditions is determined using the nucleic acid for detection of the present invention. A method of screening for EPC differentiation / proliferation or screening for an EPC-increasing substance in peripheral blood, and (b) cells that produce GPR120 or a partial peptide thereof in the presence or absence of a test compound. EPC differentiation / proliferation regulation or increase of EPC in peripheral blood, characterized by measuring and comparing the amount of the protein or peptide under both conditions using the detection antibody of the present invention. A method for screening a substance is provided.
  • the measurement of the amount of mRNA or protein (peptide) of GPR120 or a partial peptide thereof can be specifically performed as follows.
  • Normal or disease model non-human mammal eg, mouse, rat, rabbit, sheep, pig, cow, cat, dog, monkey, etc.
  • obese mouse, diabetic mouse, hypertensive rat, arteriosclerosis Rabbits, etc. are given drugs (eg, anti-obesity drugs, anti-diabetic drugs, antihypertensive drugs, vasoactive drugs, etc.) or physical stress (eg, water stress, electric shock, light / dark, low temperature, etc.)
  • drugs eg, anti-obesity drugs, anti-diabetic drugs, antihypertensive drugs, vasoactive drugs, etc.
  • physical stress eg, water stress, electric shock, light / dark, low temperature, etc.
  • peripheral blood or a specific organ for example, bone marrow, organ lesion local area, etc.
  • tissue for example, bone marrow tissue, diseased tissue, etc.
  • the mRNA of GPR120 contained in the obtained cells and the like can be quantified by, for example, extracting mRNA from cells and the like by a normal method, for example, using a technique such as RT-PCR, or a known Northern per se It can also be quantified by blot analysis.
  • the amount of GPR120 protein can be quantified using Western blot analysis or various immunoassay methods described in detail below.
  • a transformant into which a nucleic acid encoding GPR120 or a partial peptide thereof has been introduced is prepared according to the method described above, and GPR120 or a partial peptide thereof or mRNA encoding the transformant contained in the transformant is prepared as described in (i) Quantitative analysis can be performed in the same manner.
  • the amount of mRNA encoding GPR120 contained in cells isolated from the animal After 30 minutes (30 minutes to 3 days, preferably 1 hour to 2 days, more preferably 1 hour to 24 hours), the amount of mRNA encoding GPR120 contained in cells isolated from the animal, Alternatively, by quantifying and analyzing the amount of GPR120 protein, or (ii) when culturing a transformant according to a conventional method, a test compound is added to a medium or a buffer, and incubated for a certain period of time (after 1 to 7 days, Preferably after 1 to 3 days, more preferably 2 days 1-3 days after), mRNA quantity encoding GPR120 or its partial peptide contained in the transformant, or protein (peptide) amount quantitation can be carried out by analyzing.
  • the detection antibody of the present invention used in the screening method (b) is not particularly limited as long as it is an antibody that specifically recognizes GPR120 or a partial peptide thereof, and may be either a polyclonal antibody or a monoclonal antibody. .
  • the isotype of the antibody is not particularly limited, but preferably IgG, IgM or IgA, particularly preferably IgG.
  • the antibody is not particularly limited as long as it has at least a complementarity determining region (CDR) for specifically recognizing and binding a target antigen.
  • CDR complementarity determining region
  • Fab, Fab ′, F (ab ') 2 such as fragments, scFv, scFv-Fc, conjugation molecules prepared by genetic engineering such as minibodies and diabodies, or molecules having protein stabilizing action such as polyethylene glycol (PEG) They may be modified derivatives thereof.
  • An antibody against GPR120 or a partial peptide thereof can be produced according to a known method for producing an antibody or antiserum using GPR120 or a partial peptide thereof as an antigen.
  • a method for preparing an immunogen of the antibody of the present invention and a method for producing the antibody will be described.
  • Antigen used for preparing the antibody includes GPR120 or a partial peptide thereof (in the following description relating to the production of antibody, unless otherwise specified, these are simply referred to as “GPR120”). Or a (synthetic) peptide having one or more of the same antigenic determinants (hereinafter, these may be simply referred to as the antigen of the present invention).
  • GPR120 is prepared by, for example, (a) preparing from a mammalian tissue or cell using a known method or a method equivalent thereto, and (b) chemically using a known peptide synthesis method using a peptide synthesizer or the like.
  • GPR120 can be used as an immunogen as it is, or a partial peptide can be prepared by limited degradation using a peptidase or the like and used as an immunogen.
  • the synthetic peptide is, for example, one having the same structure as GPR120 purified from a natural material using the method (a) described above, specifically, In the GPR120 amino acid sequence, a peptide containing one or two or more amino acid sequences identical to the amino acid sequence of any position consisting of at least 3 amino acids, preferably 6 amino acids or more, is used.
  • C When the antigen of the present invention is produced using a transformant containing DNA, the DNA can be obtained by known cloning methods [for example, Molecular Cloning 2nd ed. (J. Sambrook et al., Cold Spring Harbor Lab The method described in Press, 1989)].
  • the cloning method includes (1) isolating DNA encoding the antigen from a human cDNA library by hybridization using a DNA probe designed based on the gene sequence encoding GPR120, or (2) Examples include a method of preparing a DNA encoding the antigen by a PCR method using a cDNA primer designed based on the gene sequence to be encoded as a template and inserting the DNA into an expression vector suitable for the host. It is done.
  • a desired antigen can be obtained by culturing a transformant obtained by transforming a host with the expression vector in an appropriate medium.
  • GPR120 or a partial peptide thereof, or a peptide having a shorter partial amino acid sequence can be used as an immunogen.
  • the partial amino acid sequence include those consisting of 3 or more consecutive amino acid residues, preferably 4 or more, more preferably 5 or more, and even more preferably 6 or more consecutive amino acid residues. It is done.
  • the amino acid sequence is composed of, for example, 20 or less consecutive amino acid residues, preferably 18 or less, more preferably 15 or less, and even more preferably 12 or less consecutive amino acid residues. Is mentioned. Some of these amino acid residues (eg, 1 to several) may be substituted with a substitutable group (eg, Cys, hydroxyl group, etc.).
  • the peptide used as an immunogen has an amino acid sequence containing 1 to several such partial amino acid sequences.
  • mammalian cells that express GPR120 can also be used directly as the antigen of the present invention.
  • mammalian cells natural cells as described in the above section (a), cells transformed by the method as described in the above section (c), and the like can be used.
  • the host used for transformation may be any cell collected from humans, monkeys, rats, mice, hamsters, chickens, etc., HEK293, COS7, CHO-K1, NIH3T3, Balb3T3, FM3A, L929, SP2 / 0, P3U1, B16, or P388 is preferably used.
  • Natural mammalian cells expressing GPR120 or transformed eukaryotic cells are suspended in a medium used for tissue culture (eg, RPMI1640) or buffer (eg, Hanks' Balanced Salt Solution). Can be injected into immunized animals.
  • tissue culture eg, RPMI1640
  • buffer eg, Hanks' Balanced Salt Solution
  • Any method can be used as long as it can promote antibody production, and intravenous injection, intraperitoneal injection, intramuscular injection, subcutaneous injection, and the like are preferably used.
  • the antigen of the present invention can be directly immunized as long as it has immunogenicity, but it has a low molecular weight (for example, a molecular weight of about 3,000 or less) having only one or several antigenic determinants in the molecule.
  • Antigens ie, partial peptides of GPR120
  • these antigens are usually hapten molecules with low immunogenicity, they can be immunized as a complex bound or adsorbed to a suitable carrier (carrier).
  • carrier can.
  • a natural or synthetic polymer can be used as the carrier.
  • Examples of natural polymers include serum albumin of mammals such as cows, rabbits and humans, and thyroglobulin of mammals such as cows and rabbits, such as chicken ovalbumin, such as mammals such as cows, rabbits, humans and sheep. Hemoglobin, keyhole limpet hemocyanin (KLH), etc. are used.
  • Examples of the synthetic polymer include various latexes such as polymers or copolymers such as polyamino acids, polystyrenes, polyacryls, polyvinyls, and polypropylenes.
  • the mixing ratio of the carrier and the hapten is such that any antibody can be bound or adsorbed at any ratio as long as an antibody against the antigen bound or adsorbed to the carrier is efficiently produced.
  • the above-mentioned natural or synthetic polymer carrier which is commonly used in the production of the above, can be bound or adsorbed at a ratio of 0.1 to 100 with respect to hapten 1 by weight.
  • various condensing agents can be used for coupling of the hapten and the carrier.
  • diazonium compounds such as bisdiazotized benzidine that crosslinks tyrosine, histidine, and tryptophan, dialdehyde compounds such as glutaraldehyde that crosslink amino groups, diisocyanate compounds such as toluene-2,4-diisocyanate, and thiol groups
  • dimaleimide compound such as N, N′-o-phenylene dimaleimide, a maleimide active ester compound that crosslinks an amino group and a thiol group, a carbodiimide compound that crosslinks an amino group and a carboxyl group, and the like are advantageously used.
  • an active ester reagent having a dithiopyridyl group on one amino group for example, N-succinimidyl (SPDP) 3- (2-pyridyldithio) propionate
  • SPDP N-succinimidyl
  • a maleimide group into the other amino group with a maleimide active ester reagent, and then react both.
  • the antigen of the present invention is administered to a warm-blooded animal by itself at a site where antibody production is possible by administration methods such as intraperitoneal injection, intravenous injection, subcutaneous injection, and intradermal injection. Or, it is administered together with a carrier and a diluent. Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance antibody production ability upon administration. Administration is usually once every 1 to 6 weeks, for a total of 2 to 10 times. Examples of warm-blooded animals used include monkeys, rabbits, dogs, guinea pigs, mice, rats, hamsters, sheep, goats, donkeys, and chickens. In order to avoid the problem of anti-Ig antibody production, it is preferable to use a mammal of the same species as that to be administered, but in general, mice and rats are preferably used for production of monoclonal antibodies.
  • antibody-producing hybridomas can be prepared by isolating antibody-producing cells and fusing them with myeloma cells.
  • the antibody titer in serum can be measured, for example, by reacting a labeled antigen with antiserum and then measuring the activity of the labeling agent bound to the antibody.
  • the myeloma cell is not particularly limited as long as it can produce a hybridoma that secretes a large amount of antibody, but it does not itself produce or secrete an antibody, and more preferably has high cell fusion efficiency.
  • a HAT hyperxanthine, aminopterin, thymidine
  • mouse myeloma cells include NS-1, P3U1, SP2 / 0, AP-1, etc.
  • rat myeloma cells include R210.RCY3, Y3-Ag 1.2.3
  • human myeloma cells include SKO- 007, GM 1500-6TG-2, LICR-LON-HMy2, UC729-6 and the like.
  • the fusion operation can be performed according to a known method, for example, the method of Kohler and Milstein [Nature, 256, 495 (1975)].
  • the fusion promoter include polyethylene glycol (PEG) and Sendai virus.
  • PEG polyethylene glycol
  • the molecular weight of PEG is not particularly limited, but PEG1000 to PEG6000 having low toxicity and relatively low viscosity are preferable.
  • the PEG concentration include about 10 to 80%, preferably about 30 to 50%.
  • various buffer solutions such as serum-free medium (eg RPMI1640), complete medium containing about 5 to 20% serum, phosphate buffered saline (PBS), Tris buffer, etc. may be used. it can.
  • DMSO eg, about 10 to 20%
  • the pH of the fusion solution is, for example, about 4 to 10, preferably about 6 to 8.
  • the preferred ratio between the number of antibody-producing cells (spleen cells) and the number of bone marrow cells is usually about 1: 1 to 20: 1, and is usually incubated at 20 to 40 ° C., preferably 30 to 37 ° C. for usually 1 to 10 minutes. Cell fusion can be carried out efficiently.
  • Monoclonal antibody-producing hybridomas are prepared, for example, by adding the hybridoma culture supernatant to a solid phase (eg, microplate) on which an antigen is adsorbed directly or with a carrier, and then anti-immunoglobulin antibodies (cells) labeled with radioactive substances or enzymes.
  • a solid phase eg, microplate
  • an antigen is adsorbed directly or with a carrier
  • anti-immunoglobulin antibodies cells labeled with radioactive substances or enzymes.
  • anti-mouse immunoglobulin antibody When mouse used for fusion is mouse, anti-mouse immunoglobulin antibody is used) or protein A is added to detect monoclonal antibody bound to the solid phase; solid phase adsorbed with anti-immunoglobulin antibody or protein A
  • the method can be screened by adding a hybridoma culture supernatant, adding a protein labeled with a radioactive substance or an enzyme, and detecting a monoclonal antibody bound to the solid phase.
  • the selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto.
  • the selection of the monoclonal antibody can be usually performed in a medium for animal cells to which HAT (hypoxanthine, aminopterin, thymidine) is added. Any medium may be used as the monoclonal antibody selection and breeding medium as long as the hybridoma can grow.
  • HAT hyperxanthine, aminopterin, thymidine
  • a medium for example, RPMI 1640 medium containing 1 to 20%, preferably 10 to 20% fetal calf serum, GIT medium containing 1 to 10% fetal calf serum (Wako Pure Chemical Industries, Ltd.) Or a serum-free medium for hybridoma culture (SFM-101, Nissui Pharmaceutical Co., Ltd.) or the like.
  • the culture temperature is usually 20-40 ° C, preferably about 37 ° C.
  • the culture time is usually 5 days to 3 weeks, preferably 1 to 2 weeks. Culturing can usually be performed under 5% carbon dioxide gas.
  • the antibody titer of the hybridoma culture supernatant can be measured in the same manner as the antibody titer in the above antiserum.
  • the monoclonal antibody thus obtained can be obtained by a method known per se, for example, an immunoglobulin separation and purification method [eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis method, ion exchanger (eg, , DEAE) adsorption / desorption method, ultracentrifugation, gel filtration, antigen-binding solid phase or specific purification method to obtain antibody by dissociating the binding using active adsorbent such as protein A or protein G ] Can be separated and purified according to the above.
  • an immunoglobulin separation and purification method eg, salting out method, alcohol precipitation method, isoelectric point precipitation method, electrophoresis method, ion exchanger (eg, , DEAE) adsorption / desorption method, ultracentrifugation, gel filtration, antigen-binding solid phase or specific purification method to obtain antibody by dissociating the binding using active adsorbent such as protein A or protein
  • Polyclonal antibodies for example, immunize warm-blooded animals in the same manner as the above-mentioned monoclonal antibody production method, by creating an immune antigen (protein or peptide antigen) itself or a complex thereof with a carrier protein. From the immunized animal, an antibody-containing product against GPR120 or a partial peptide thereof, such as blood, ascites, milk, egg, etc., can be preferably collected from blood. Separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as that of the monoclonal antibody.
  • the measurement of the amount of GPR120 or a partial peptide thereof in the screening method of (b) above is, for example, (I) A sample solution by competitively reacting the detection antibody of the present invention with the sample solution and labeled GPR120 or a partial peptide thereof, and detecting the labeled protein or peptide bound to the antibody A method for quantifying GPR120 or a partial peptide thereof, (Ii) The sample solution, the detection antibody of the present invention insolubilized on the carrier, and another labeled detection antibody of the present invention are reacted simultaneously or successively, and then the labeling agent on the insolubilized carrier A method for quantifying GPR120 or a partial peptide thereof in a sample solution by measuring the amount (activity) of the above is mentioned.
  • the two types of antibodies recognize different portions of GPR120.
  • one antibody recognizes the N-terminal part of the protein
  • one that reacts with the C-terminal part of the protein can be used as the other antibody.
  • a labeling agent used in a measurement method using a labeling substance for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like is used.
  • the radioisotope include [ 125 I], [ 131 I], [ 3 H], [ 14 C], [ 32 P], [ 33 P], [ 35 S] and the like.
  • the enzyme is preferably stable and has a large specific activity.
  • ⁇ -galactosidase ⁇ -glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used.
  • fluorescent substance for example, fluorescamine, fluorescein isothiocyanate, cyanine fluorescent dye and the like are used.
  • luminescent substance for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
  • a biotin- (strept) avidin system can be used for binding of an antibody or antigen to a labeling agent.
  • the method for quantifying GPR120 or its partial peptide using the detection antibody of the present invention is not particularly limited, and the amount of antibody, antigen or antibody-antigen complex corresponding to the amount of antigen in the sample solution is chemically determined.
  • Any measurement method may be used as long as it is a measurement method that is detected by a standard or physical means and calculated from a standard curve prepared using a standard solution containing a known amount of antigen.
  • nephrometry, competition method, immunometric method and sandwich method are preferably used.
  • the sandwich method described later is preferably used.
  • the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, or glass.
  • a sample solution is reacted with the insolubilized detection antibody of the present invention (primary reaction), and another labeled detection antibody of the present invention is reacted (secondary reaction), and then on the insolubilized carrier.
  • primary reaction By measuring the amount or activity of the labeling agent, GPR120 or its partial peptide in the sample solution can be quantified.
  • the primary reaction and the secondary reaction may be performed in the reverse order, may be performed simultaneously, or may be performed at different times.
  • the labeling agent and the insolubilization method can be the same as those described above.
  • the antibody used for the immobilized antibody or the labeled antibody is not necessarily one type, and a mixture of two or more types of antibodies is used for the purpose of improving measurement sensitivity. May be.
  • the detection antibody of the present invention can also be used in measurement systems other than the sandwich method, such as a competitive method, an immunometric method, or nephrometry.
  • a competitive method GPR120 or a partial peptide thereof in a sample solution and labeled GPR120 or a partial peptide thereof are reacted competitively with an antibody, and then an unreacted labeled antigen (F) and a label bound to the antibody.
  • F labeled antigen
  • B B / F separation
  • a soluble antibody is used as an antibody
  • B / F separation is performed using polyethylene glycol or a secondary antibody against the antibody (primary antibody)
  • a solid phase is used as the primary antibody.
  • GPR120 or its partial peptide in the sample solution and the immobilized GPR120 or its partial peptide are allowed to compete with a certain amount of labeled antibody, and then the solid phase and the liquid phase are separated.
  • GPR120 or its partial peptide in the sample solution is reacted with an excess amount of labeled antibody, and then immobilized GPR120 or its partial peptide is added to bind the unreacted labeled antibody to the solid phase. Thereafter, the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to quantify the amount of antigen in the sample solution. In nephrometry, the amount of insoluble precipitate produced as a result of antigen-antibody reaction in a gel or solution is measured. Laser nephrometry using laser scattering is preferably used even when the amount of GPR120 or its partial peptide in the sample solution is small and only a small amount of precipitate is obtained.
  • a measurement system for GPR120 or a partial peptide thereof may be constructed by adding the usual technical considerations of those skilled in the art to the usual conditions and procedures in each method.
  • a measurement system for GPR120 or a partial peptide thereof may be constructed by adding the usual technical considerations of those skilled in the art to the usual conditions and procedures in each method.
  • Hiroshi Irie “Radioimmunoassay” Karlsha, published in 1974
  • Hiroshi Irie “Sequel Radioimmunoassay” published in Kodansha, 1979
  • Enzyme Immunoassay edited by Eiji Ishikawa et al.
  • the test compound when the expression level of GPR120 or a partial peptide thereof (mRNA level or protein (peptide level)) in the presence of the test compound is in the absence of the test compound is increased by about 20% or more, preferably about 30% or more, more preferably about 50% or more, the test compound is selected as a candidate for GPR120 expression promoting substance, and therefore, for EPC differentiation / proliferation promoting substance. can do.
  • the expression level of the protein or peptide in the presence of the test compound was reduced by about 20% or more, preferably about 30% or more, more preferably about 50% or more, compared to the case in the absence of the test compound.
  • the test compound can be selected as a GPR120 expression-suppressing substance, and thus a candidate for EPC differentiation / proliferation inhibition and / or an EPC increasing substance in peripheral blood.
  • a substance that promotes the activity of GPR120 obtained by the screening method of (1a) (a compound that enhances the binding property between an agonist of GPR120 or GPR120 and a ligand), and the expression of GPR120 obtained by the screening method of (1b) above.
  • the substance that promotes promotes differentiation from bone marrow cells to EPC and proliferation of EPC. Therefore, prevention and / or treatment of diseases that can have preventive and / or therapeutic effects by enhancing the ability of angiogenesis through the action of EPC Useful as a medicine.
  • Such diseases include, for example, diabetes and its complications (eg, neuropathy, nephropathy, foot lesions, blood flow disorders), obesity, arteriosclerosis, obstructive arteriosclerosis, Buerger's disease, pulmonary hypertension, myocardium Examples include infarction, cerebral infarction, hepatitis, cirrhosis, chronic obstructive pulmonary disease, wound, bone fracture, osteoporosis, periodontal disease, dementia and the like. Furthermore, these substances can also be used for the purpose of increasing the number of mononuclear cells that can be collected in autologous peripheral blood mononuclear cell transplantation or promoting the differentiation of transplanted bone marrow cells in bone marrow transplant patients.
  • a substance that suppresses the activity of GPR120 obtained by the screening method of (1a) (a compound that decreases the binding property between an agonist of GPR120 or GPR120 and a ligand), and GPR120 obtained by the screening method of (1b) above. Since the substance that suppresses the expression can increase the number of EPCs in peripheral blood, prevention and / or therapeutic effect can be obtained by enhancing the ability of angiogenesis through the action of EPC. • It is equally useful as a therapeutic agent. Furthermore, these substances can also be used for the purpose of increasing the number of mononuclear cells that can be collected in autologous peripheral blood mononuclear cell transplantation.
  • a substance that suppresses the activity or expression of GPR120 suppresses differentiation from bone marrow cells to EPC and proliferation of EPC, it has a preventive and / or therapeutic effect by suppressing the ability of angiogenesis through the action of EPC. It is useful as a preventive / therapeutic agent for diseases that can be obtained, for example, chronic inflammation such as cancer, diabetic retinopathy, rheumatism, osteoarthritis and the like.
  • GPR120 modulator A drug containing a substance that regulates (enhances or suppresses) the expression or activity of GPR120 obtained by the screening method of the present invention (hereinafter sometimes referred to as “GPR120 modulator”) has low toxicity and is used as a solution as it is or Suitable pharmaceutical forms of pharmaceutical compositions include oral or parenteral (eg, intravascular) for humans or mammals (eg, mice, rats, rabbits, sheep, pigs, cattle, cats, dogs, monkeys, etc.) Administration, subcutaneous administration, etc.).
  • parenteral eg, intravascular
  • mammals eg, mice, rats, rabbits, sheep, pigs, cattle, cats, dogs, monkeys, etc.
  • Administration subcutaneous administration, etc.
  • the GPR120 modulator may be administered per se, or may be administered as a suitable pharmaceutical composition.
  • the pharmaceutical composition used for administration may contain a GPR120 modulator and a pharmacologically acceptable carrier, diluent or excipient.
  • Such pharmaceutical compositions are provided as dosage forms suitable for oral or parenteral administration.
  • injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included.
  • Such an injection can be prepared according to a known method.
  • the GPR120 modulator can be prepared by dissolving, suspending or emulsifying in a sterile aqueous liquid or oily liquid usually used for injection.
  • an aqueous solution for injection for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)), etc. may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like.
  • Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field.
  • a carrier and excipient for tablets for example, lactose, starch, sucrose, and magnesium stearate are used.
  • the above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dosage of the GPR120 modulator.
  • Examples of the dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories.
  • the GPR120 modulator is usually contained in an amount of 5 to 500 mg per dosage unit form, particularly 5 to 100 mg for injections and 10 to 250 mg for other dosage forms.
  • the dosage of the above-mentioned pharmaceutical containing a GPR120 modulator varies depending on the administration subject, target disease, symptom, administration route, etc., but for example, when used for the treatment and prevention of diabetes in adults, the GPR120 modulator Is usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight, about 1 to 5 times a day, preferably 1 day a day. It is convenient to administer about 3 times by intravenous injection. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
  • GPR120 promotes EPC differentiation / proliferation, and thus includes (a) GPR120 or a partial peptide thereof, and (b) a base sequence encoding GPR120 or a partial peptide thereof.
  • Nucleic acids like (c) compounds that enhance the expression of GPR120 and (d) compounds that enhance the activity of GPR120, have 1) an EPC differentiation / proliferation promoter, 2) an angiogenic ability through the action of EPC. It can be used as a prophylactic / therapeutic agent for diseases that can have a prophylactic / therapeutic effect by promotion.
  • Such diseases include, for example, diabetes and its complications (eg, neuropathy, nephropathy, foot lesions, blood flow disorders), obesity, arteriosclerosis, obstructive arteriosclerosis, Buerger's disease, pulmonary hypertension, myocardium Examples include infarction, cerebral infarction, hepatitis, cirrhosis, chronic obstructive pulmonary disease, wound, bone fracture, osteoporosis, periodontal disease, dementia and the like.
  • the substance (a) or (b) is used for the purpose of increasing the number of mononuclear cells that can be collected in autologous peripheral blood mononuclear cell transplantation or promoting the differentiation of transplanted bone marrow cells in bone marrow transplant patients. You can also
  • GPR120 or a partial peptide thereof when used as the above-mentioned prophylactic / therapeutic agent, it can be formulated in the same manner as the above-mentioned GPR120 modulator, and can be administered to humans or mammals (for example, mice, rats, etc.) with the same administration route and dosage , Rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.) orally or parenterally.
  • mammals for example, mice, rats, etc.
  • nucleic acid containing a base sequence encoding GPR120 or a partial peptide thereof When a nucleic acid containing a base sequence encoding GPR120 or a partial peptide thereof is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated and administered according to a method known per se. That is, the nucleic acid is inserted in a functional manner into an appropriate expression vector for mammalian cells such as a retrovirus vector, lentivirus vector, adenovirus vector, adeno-associated virus vector, herpes virus vector, etc. It can be formulated according to the means.
  • the nucleic acid can be administered as it is or together with an auxiliary agent for promoting intake by a gene gun or a catheter such as a hydrogel catheter.
  • the nucleic acid may be formulated (injection) alone or together with a carrier such as a liposome and administered intravenously, subcutaneously, etc. .
  • the nucleic acid containing the base sequence encoding GPR120 or a partial peptide thereof may be administered per se or as an appropriate pharmaceutical composition.
  • the pharmaceutical composition used for administration may contain the nucleic acid and a pharmacologically acceptable carrier, diluent or excipient.
  • Such pharmaceutical compositions are provided as dosage forms suitable for oral or parenteral administration.
  • injections are dosage forms such as intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, infusions, and the like. May be included.
  • Such an injection can be prepared according to a known method.
  • a method for preparing an injection it can be prepared, for example, by dissolving, suspending or emulsifying the nucleic acid in a sterile aqueous liquid or oily liquid usually used for injection.
  • an aqueous solution for injection for example, an isotonic solution containing physiological saline, glucose and other adjuvants, and the like are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)), etc. may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct-of-hydrogenated-castor-oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including dragees and film-coated tablets), pills, granules, powders, capsules (including soft capsules), syrups Agents, emulsions, suspensions and the like.
  • Such a composition is produced by a known method and may contain a carrier, a diluent or an excipient usually used in the pharmaceutical field.
  • a carrier and excipient for tablets for example, lactose, starch, sucrose, and magnesium stearate are used.
  • the above parenteral or oral pharmaceutical composition is conveniently prepared in a dosage unit form suitable for the dose of the active ingredient.
  • dosage form of such a dosage unit include tablets, pills, capsules, injections (ampoules), and suppositories.
  • the nucleic acid containing a base sequence encoding GPR120 or a partial peptide thereof is preferably contained, for example, usually 5 to 500 mg per dosage unit dosage form, particularly 5 to 100 mg for injections and 10 to 250 mg for other dosage forms. .
  • the dosage of the above-mentioned pharmaceutical containing a nucleic acid comprising a base sequence encoding GPR120 or a partial peptide thereof varies depending on the administration subject, target disease, symptom, administration route, etc., but for example for the treatment and prevention of diabetes in adults
  • the above nucleic acid is usually about 0.01 to 20 mg / kg body weight, preferably about 0.1 to 10 mg / kg body weight, more preferably about 0.1 to 5 mg / kg body weight per day. It is convenient to administer by intravenous injection about 5 times, preferably about 1 to 3 times a day. In the case of other parenteral administration and oral administration, an equivalent amount can be administered. If symptoms are particularly severe, the dose may be increased according to the symptoms.
  • EPC differentiation / proliferation inhibition / EPC increasing agent in peripheral blood GPR120 promotes EPC differentiation / proliferation, and suppression of GPR120 increases the number of EPCs in peripheral blood.
  • a neutralizing antibody against GPR120 or a partial peptide thereof a nucleic acid comprising a base sequence complementary to the base sequence encoding GPR120 or a part thereof, (c) a compound that suppresses the expression of GPR120 or (d ) Similar to compounds that suppress GPR120 activity, 1) EPC differentiation / proliferation inhibitor, 2) Prophylactic / therapeutic agent for diseases that can have preventive / therapeutic effects by inhibiting angiogenic ability through the action of EPC, 3) EPC increasing agent in peripheral blood 4) It can be used as a prophylactic / therapeutic agent for diseases that can be prevented or treated by increasing EPC in peripheral blood.
  • diseases that can be prevented or treated by suppressing angiogenic ability through the action of EPC include chronic inflammation such as cancer, diabetic retinopathy, rheumatism, and osteoarthritis.
  • diseases that can be prevented or treated by increasing EPC in peripheral blood include diabetes and its complications (eg, neuropathy, nephropathy, foot lesions, blood flow disorders), obesity, arteriosclerosis , Obstructive arteriosclerosis, Buerger's disease, pulmonary hypertension, myocardial infarction, cerebral infarction, hepatitis, cirrhosis, chronic obstructive pulmonary disease, wound, fracture, osteoporosis, periodontal disease, dementia and the like.
  • the substance (a) or (b) is used for the purpose of increasing the number of mononuclear cells that can be collected in autologous peripheral blood mononuclear cell transplantation or promoting the differentiation of transplanted bone marrow cells in bone marrow transplant patients. You can also
  • a neutralizing antibody against GPR120 or a partial peptide thereof can be produced in the same manner as the detection antibody of the present invention described above.
  • the antibody preferably a monoclonal antibody
  • the antibody exhibits antigenicity when administered to a human.
  • Antibodies with reduced risk specifically, fully human antibodies, humanized antibodies, mouse-human chimeric antibodies and the like, particularly preferably fully human antibodies or humanized antibodies.
  • Humanized antibodies and chimeric antibodies can be produced by genetic engineering according to conventional methods.
  • Fully human antibodies can be produced from human-human (or mouse) hybridomas, but in order to provide a large amount of antibodies stably and at low cost, human antibody-producing mice and phage display methods are used. It is desirable to manufacture using. Whether or not the antibody against the obtained GPR120 or a partial peptide thereof neutralizes the physiological action of GPR120, that is, the differentiation / proliferation promoting activity of EPC, is determined in the presence of the antibody using, for example, a known colony forming assay. Can be performed by culturing EPC or its progenitor cells and measuring EPC proliferation or EPC differentiation ability.
  • a neutralizing antibody against GPR120 or a partial peptide thereof When a neutralizing antibody against GPR120 or a partial peptide thereof is used as the above-mentioned prophylactic / therapeutic agent, it can be formulated in the same manner as the above-mentioned GPR120 modulator, and can be administered to humans or mammals (for example, Mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.) orally or parenterally.
  • mammals for example, Mice, rats, rabbits, sheep, pigs, cows, horses, cats, dogs, monkeys, chimpanzees, etc.
  • base sequence complementary to the base sequence encoding GPR120 or a part thereof is a sequence that can specifically bind to the mRNA of GPR120 and can inhibit the translation of the protein from the mRNA.
  • the length and position are not particularly limited, but from the viewpoint of sequence specificity, a portion complementary or substantially complementary to the target sequence is at least 10 bases or more, preferably about 15 bases or more, more preferably about 20 It contains more than a base.
  • the nucleic acid comprising a base sequence complementary to (or substantially complementary to) the base sequence of mRNA of GPR120 or a part thereof is preferably any of the following (i) to (iii): Illustrated.
  • siRNA against GPR120 mRNA iii) Nucleic acid capable of generating siRNA for GPR120 mRNA
  • Antisense nucleic acid against GPR120 mRNA refers to a nucleic acid comprising a base sequence complementary to or substantially complementary to the base sequence of the mRNA or a part thereof. Thus, it has a function of suppressing protein synthesis by forming a specific and stable double strand with the target mRNA and binding.
  • Antisense nucleic acids are polydeoxyribonucleotides containing 2-deoxy-D-ribose, polyribonucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, Other polymers with non-nucleotide backbones (eg, commercially available protein nucleic acids and synthetic sequence specific nucleic acid polymers) or other polymers containing special linkages (provided that the polymer is a base such as found in DNA or RNA) And a nucleotide having a configuration that allows attachment of a base).
  • They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, unmodified polynucleotides (or unmodified oligonucleotides), known modifications Additions, such as those with labels known in the art, capped, methylated, one or more natural nucleotides replaced with analogs, intramolecular nucleotide modifications Such as those having uncharged bonds (eg methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds or sulfur-containing bonds (eg phosphorothioates, phosphorodithioates, etc.) Such as proteins (eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lysine, etc.
  • proteins eg, nucleases, nuclease inhibitors, toxins, antibodies, signal peptides, poly-L-lys
  • nucleoside may include not only purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles.
  • Modified nucleosides and modified nucleotides may also be modified at the sugar moiety, for example, one or more hydroxyl groups are replaced by halogens, aliphatic groups, etc., or functional groups such as ethers, amines, etc. It may have been converted.
  • the antisense nucleic acid may be DNA or RNA, or may be a DNA / RNA chimera.
  • the antisense nucleic acid is DNA
  • the RNA DNA hybrid formed by the target RNA and the antisense DNA can be recognized by endogenous RNase H and cause selective degradation of the target RNA. Therefore, in the case of antisense DNA directed to degradation by RNase H, the target sequence may be not only the sequence in mRNA but also the sequence of the intron region in the initial translation product of GPR120 gene.
  • the GPR120 gene is present in the 10q23.33 region of chromosome 10, so the homology search such as BLAST and FASTA for the genomic sequence of this region and the human GPR120 cDNA base sequence shown in SEQ ID NO: 1 Intron sequences can be determined by comparison using a program.
  • the length of the target region of the antisense nucleic acid of the present invention is not particularly limited as long as the antisense nucleic acid hybridizes, and as a result, translation into the GPR120 protein is inhibited.
  • the entire sequence or partial sequence of mRNA may be a short sequence of about 10 bases, and a long sequence of mRNA or the initial transcript.
  • an oligonucleotide consisting of about 10 to about 40 bases, particularly about 15 to about 30 bases is preferred, but is not limited thereto.
  • 5 'end hairpin loop of GPR120 gene 5' end 6-base pair repeat, 5 'end untranslated region, translation start codon, protein coding region, ORF translation stop codon, 3' end untranslated region , 3 ′ end palindromic region or 3 ′ end hairpin loop, etc. may be selected as a preferred target region of the antisense nucleic acid, but is not limited thereto.
  • the antisense nucleic acid of the present invention not only hybridizes with mRNA of GPR120 and the initial transcription product and inhibits translation into proteins, but also binds to these genes that are double-stranded DNAs and binds to triplex (tri-stranded). A plex) and can inhibit transcription to RNA (antigene).
  • the nucleotide molecule constituting the antisense nucleic acid may be natural DNA or RNA, but various chemicals may be used to improve stability (chemical and / or enzyme) and specific activity (affinity with RNA). Modifications can be included.
  • the phosphate residue (phosphate) of each nucleotide constituting the antisense nucleic acid is chemically modified, for example, phosphorothioate (PS), methylphosphonate, phosphorodithionate, etc. It can be substituted with a phosphate residue.
  • PS phosphorothioate
  • methylphosphonate methylphosphonate
  • phosphorodithionate etc. It can be substituted with a phosphate residue.
  • the 2′-position hydroxyl group of the sugar (ribose) of each nucleotide is represented by —OR (R is, for example, CH 3 (2′-O-Me), CH 2 CH 2 OCH 3 (2′-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 , CH 2 CH 2 CN and the like may be substituted).
  • R is, for example, CH 3 (2′-O-Me), CH 2 CH 2 OCH 3 (2′-O-MOE), CH 2 CH 2 NHC (NH) NH 2 , CH 2 CONHCH 3 , CH 2 CH 2 CN and the like may be substituted).
  • the base moiety pyrimidine, purine
  • BNA LNA
  • ENA ENA
  • the antisense oligonucleotide of the present invention determines the target sequence of mRNA or initial transcript based on the cDNA sequence or genomic DNA sequence of GPR120, and is a commercially available DNA / RNA automatic synthesizer (Applied Biosystems, Beckman, etc.) ) To synthesize a sequence complementary thereto.
  • any of the above-described antisense nucleic acids containing various modifications can be chemically synthesized by a method known per se.
  • siRNA against GPR120 mRNA a double-stranded RNA consisting of an oligo RNA complementary to GPR120 mRNA and its complementary strand, so-called siRNA, is also complementary or substantially complementary to the base sequence of GPR120 mRNA. Or defined as encompassed by a nucleic acid containing a portion thereof.
  • RNAi RNA interference
  • siRNA can be appropriately designed using commercially available software (eg, RNAi Designer; Invitrogen) based on the base sequence information of the target mRNA.
  • the ribonucleoside molecule constituting siRNA may also be modified in the same manner as in the above-described antisense nucleic acid in order to improve stability, specific activity and the like.
  • siRNA if all ribonucleoside molecules in natural RNA are replaced with a modified form, RNAi activity may be lost, so the introduction of the minimum modified nucleoside that allows the RISC complex to function is necessary. .
  • the siRNA is synthesized by synthesizing a sense strand and an antisense strand of a target sequence on mRNA with a DNA / RNA automatic synthesizer, denatured at about 90 to about 95 ° C. for about 1 minute in an appropriate annealing buffer, It can be prepared by annealing at about 30 to about 70 ° C. for about 1 to about 8 hours. Alternatively, it can be prepared by synthesizing a short hairpin RNA (shRNA) that is a precursor of siRNA and cleaving it with a dicer.
  • shRNA short hairpin RNA
  • nucleic acid capable of generating siRNA for GPR120 mRNA is also complementary to the base sequence of GPR120 mRNA.
  • a nucleic acid comprising a base sequence that is complementary or substantially complementary or a portion thereof.
  • examples of such a nucleic acid include the above-mentioned shRNA and an expression vector constructed so as to express it.
  • shRNA is an oligo containing a base sequence in which the sense and antisense strands of the target sequence on mRNA are linked by inserting a spacer sequence (for example, about 15 to 25 bases) long enough to form an appropriate loop structure.
  • An expression vector containing an shRNA expression cassette can be prepared by preparing a double-stranded DNA encoding the above shRNA by a conventional method and then inserting it into an appropriate expression vector.
  • an shRNA expression vector one having a Pol III promoter such as U6 or H1 can be used.
  • the shRNA transcribed in the animal cell into which the expression vector has been introduced forms a loop by itself, and then is processed by an endogenous enzyme dicer or the like to form a mature siRNA.
  • nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of GPR120 mRNA or a part thereof is a ribozyme capable of specifically cleaving the mRNA within the coding region. It is done. “Ribozyme” refers to RNA having an enzyme activity that cleaves nucleic acids in a narrow sense, but in this specification, it is used as a concept including DNA as long as it has sequence-specific nucleic acid cleavage activity. The most versatile ribozyme is self-splicing RNA found in infectious RNA such as viroid and virusoid, and the hammerhead type and hairpin type are known.
  • the hammerhead type exhibits enzyme activity at about 40 bases, and several bases at both ends (about 10 bases in total) adjacent to the part having the hammerhead structure are made complementary to the desired cleavage site of mRNA. By doing so, it is possible to specifically cleave only the target mRNA.
  • This type of ribozyme has the additional advantage of not attacking genomic DNA because it uses only RNA as a substrate.
  • the target sequence should be made single-stranded by using a hybrid ribozyme linked to an RNA motif derived from a viral nucleic acid that can specifically bind to an RNA helicase.
  • ribozymes when used in the form of expression vectors containing the DNA that encodes them, they should be hybrid ribozymes in which tRNA-modified sequences are further linked in order to promote the transfer of transcripts to the cytoplasm. [Nucleic Acids Res., 29 (13): 2780-2788 (2001)].
  • Nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of GPR120 mRNA or a part thereof is provided in a special form such as liposome or microsphere, applied to gene therapy, or added Can be given in the form of
  • the additional form includes polycationic substances such as polylysine that acts to neutralize the charge of the phosphate group skeleton, lipids that enhance interaction with cell membranes and increase nucleic acid uptake ( Examples include hydrophobic ones such as phospholipid and cholesterol.
  • Preferred lipids for addition include cholesterol and derivatives thereof (eg, cholesteryl chloroformate, cholic acid, etc.).
  • Such can be attached to the 3 ′ or 5 ′ end of the nucleic acid and can be attached via a base, sugar, intramolecular nucleoside bond.
  • the other group include a cap group specifically arranged at the 3 ′ end or 5 ′ end of a nucleic acid for preventing degradation by nucleases such as exonuclease and RNase.
  • capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol.
  • the GPR120 protein expression inhibitory activity of these nucleic acids can be examined using a transformant into which the GPR120 gene has been introduced, an in vivo or in vitro GPR120 gene expression system, or an in vivo or in vitro GPR120 protein translation system.
  • nucleic acid containing a base sequence complementary to or substantially complementary to the base sequence of GPR120 mRNA or a part thereof is used as the above preventive / therapeutic agent
  • the base sequence encoding GPR120 or a partial peptide thereof is included. It can be formulated in the same way as a nucleic acid, with a similar route and dose of human or mammal (eg, mouse, rat, rabbit, sheep, pig, cow, horse, cat, dog, monkey, chimpanzee, etc.) Can be administered orally or parenterally.
  • GPR120 is specifically expressed in bone marrow cells and small and large EPCs derived from peripheral blood mononuclear cells, and is differentiated from bone marrow cells and EPCs that are precursor cells of EPC. It is hardly or not expressed in other vascular cells such as cells. Moreover, in mice, GPR120 is highly expressed in large EPC that is further differentiated compared to small EPC. Therefore, by using GPR120 as a surface antigen marker, EPC can be selected from a vascular cell population, and EPC can be further selected into large EPC and small EPC having different differentiation stages.
  • the substance capable of detecting and quantifying GPR120 expressed on the cell surface of EPC is preferably the above-described detection antibody of the present invention.
  • the substance capable of detecting and quantifying the expression of the GPR120 gene in EPC at the RNA level is preferably the above-described detection nucleic acid of the present invention.
  • the present invention also provides an EPC selection reagent comprising (a) an antibody against GPR120 or a partial peptide thereof, or (b) a nucleic acid containing a base sequence encoding GPR120 or a partial polynucleotide thereof.
  • the antibody can be provided in a dissolved state in water or a suitable buffer (eg, phosphate buffered saline).
  • the nucleic acid can be provided as a solid in a dry state or in a state of alcohol precipitation, or can be provided in a state dissolved in water or a suitable buffer (eg, TE buffer).
  • a suitable buffer eg, TE buffer
  • the antibody and the nucleic acid can be provided in a state of being previously labeled with a labeling substance, or can be provided separately from the labeling substance, and can be used after labeling.
  • the cell-containing sample is not particularly limited as long as it contains a vascular system cell population, and examples thereof include peripheral blood, umbilical cord blood, and bone marrow fluid.
  • the EPC can be selected by labeling the above-described selection reagent by a conventional method (eg, fluorescent labeling using FITC, etc.), and separating GPR120 positive cells and negative cells using a cell sorter. Further, large EPC and small EPC can be selected by comparing the expression levels of GPR120. The selected EPC fraction can be collected and used, for example, for EPC transplantation therapy.
  • GPR120 is specifically expressed in small and large EPCs derived from bone marrow cells and peripheral blood mononuclear cells.
  • the amount of EPC contained in the sample can be evaluated by measuring the amount of protein or mRNA of GPR120 in the sample containing.
  • the cell-containing sample derived from the subject animal as the sample is not particularly limited as long as it contains a vascular system cell population, and examples thereof include peripheral blood, umbilical cord blood, and bone marrow fluid.
  • the detection target is mRNA encoding GPR120
  • the total RNA or poly (A) + RNA fraction may be extracted and purified from the collected peripheral blood or the like using a conventional method.
  • the expression level of GPR120 in a sample can be examined by detecting the protein or mRNA encoding the same using a conventionally known method. For example, when GPR120 protein is detected, gel electrophoresis (eg, SDS-PAGE, two-dimensional gel electrophoresis, etc.) and various separation and purification methods (eg, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography).
  • gel electrophoresis eg, SDS-PAGE, two-dimensional gel electrophoresis, etc.
  • separation and purification methods eg, ion exchange chromatography, hydrophobic chromatography, gel filtration chromatography.
  • the GPR120 protein is detected and quantified by various immunoassays and Western blot analysis described in detail in the above-described screening for substances that regulate the expression of GPR120, using the detection antibody of the present invention. It is also possible to measure the number of EPCs in a sample by performing immunohistochemical staining using a fluorescently labeled antibody without homogenizing the cells in the sample and measuring the number of stained cells under a fluorescence microscope. it can.
  • the antibody is immobilized on the surface of a probe that can be adapted to a mass spectrometer described later, the test sample is brought into contact with the antibody on the probe.
  • Examples include a method in which a component captured by an antibody is subjected to mass spectrometry to detect a peak of GPR120 protein.
  • a chromatographic carrier eg, cation exchanger, anion exchanger, hydrophobic chromatographic carrier
  • TOF-MS time-of-flight mass spectrometry
  • the washing can be performed using water or a buffer solution.
  • the pH is appropriately selected according to the isoelectric point of the target protein.
  • a Tris-HCl buffer solution having a pH of 4 to 8, a phosphate buffer solution, a borate buffer solution, an acetate buffer solution, or the like is used.
  • Mass spectrometry is preferably performed by a MALDI method using an appropriate matrix (MALDI-TOFMS).
  • matrix molecules used include sinapinic acid (SPA), saturated 2,5-dihydroxybenzoic acid (DHB), and indole acrylic. Examples include acid (IAA) and cinnamic acid.
  • a nucleic acid that can hybridize with the mRNA under highly stringent conditions, a part of the mRNA, It can be carried out by Northern hybridization, RT-PCR, etc., using a set of oligonucleotides (that is, the above-described detection nucleic acid of the present invention) that can function as a primer for amplifying the whole.
  • the nucleic acid used as the probe may be DNA or RNA, or may be a DNA / RNA chimera. Preferably, DNA is used.
  • the nucleic acid may be double-stranded or single-stranded.
  • a double strand it may be a double-stranded DNA, a double-stranded RNA or a DNA: RNA hybrid.
  • the length of the nucleic acid is not particularly limited as long as it can specifically hybridize with the target mRNA, and is, for example, about 15 bases or more, preferably about 30 bases or more.
  • the nucleic acid is preferably labeled with a labeling agent in order to enable detection and quantification of the target mRNA.
  • a labeling agent for example, a radioisotope, an enzyme, a fluorescent substance, a luminescent substance, or the like is used.
  • the radioisotope for example, [ 32 P], [ 3 H], [ 14 C] and the like are used.
  • the enzyme those which are stable and have high specific activity are preferable.
  • ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase, peroxidase, malate dehydrogenase and the like are used.
  • fluorescent substance for example, fluorescamine, fluorescein isothiocyanate and the like are used.
  • luminescent substance for example, luminol, luminol derivatives, luciferin, lucigenin and the like are used.
  • biotin- (strept) avidin can also be used for binding between the probe and the labeling agent.
  • the set of oligonucleotides used as primers can specifically hybridize with the base sequence (sense strand) of mRNA encoding GPR120 and the base sequence complementary to it (antisense strand).
  • the DNA fragment is not particularly limited as long as it can amplify the DNA fragment.
  • each DNA fragment has a length of about 15 to about 100 bases, preferably about 15 to about 50 bases, and about 100 bp to several kbp.
  • RT-PCR is a method in which a known amount of another template nucleic acid that can be amplified by a set of primers that can amplify the target DNA is used as a competitor in the reaction solution to cause an amplification reaction competitively.
  • an amplification product that is amplified by the primer set and can be distinguished from the target DNA for example, an amplification product having a different size from the target DNA, a restriction enzyme
  • Nucleic acids that produce amplification products that exhibit different migration patterns upon processing can be further included.
  • the competitor nucleic acid may be DNA or RNA.
  • PCR may be performed by adding a competitor after synthesizing cDNA from an RNA sample by a reverse transcription reaction.
  • RT-PCR can be performed by adding it to the RNA sample from the beginning.
  • the efficiency of the reverse transcription reaction is taken into consideration, so that the absolute amount of the original mRNA can be estimated.
  • real-time RT-PCR can monitor the amount of PCR amplification in real time, electrophoresis is unnecessary and GPR120 gene expression can be analyzed more quickly. Usually, monitoring is performed using various fluorescent reagents.
  • a nucleic acid that can be used as the probe in addition to a reagent (intercalator) that emits fluorescence by binding to double-stranded DNA such as SYBR Green I and ethidium bromide, a nucleic acid that can be used as the probe (provided that the nucleic acid is an amplification region) In which both ends of the target nucleic acid are modified with a fluorescent substance (eg, FAM, HEX, TET, FITC, etc.) and a quencher (eg, TAMRA, DABCYL, etc.).
  • a fluorescent substance eg, FAM, HEX, TET, FITC, etc.
  • a quencher eg, TAMRA, DABCYL, etc.
  • the nucleic acid used as the probe may be a cDNA encoding GPR120 or a fragment thereof, or based on the base sequence information (for example, the base sequence shown in SEQ ID NO: 1 in the case of human GPR120), It may be obtained by chemically synthesizing using an automatic RNA synthesizer or the like.
  • the oligonucleotide set used as the primer may be chemically synthesized using a commercially available DNA / RNA automatic synthesizer or the like based on the base sequence information. Can be obtained by:
  • EPC Using EPC with various known cell numbers, measure the protein amount or mRNA amount of GPR120 by any of the above measurement methods, create a calibration curve, and compare the measured values in EPC-containing samples with unknown cell numbers Thus, EPC in the sample can be quantified.
  • EPC measurement method it is possible to diagnose the presence or severity of a disease associated with abnormalities in EPC amount such as diabetes, arteriosclerosis, brain / cardiovascular disease, etc. in a test animal. . That is, when the expression charge of GPR120 in a sample collected from a test animal is measured, the EPC amount is calculated, and compared with that of a normal animal, the EPC amount is significantly reduced compared to that of a normal animal.
  • EPC levels are diseases associated with abnormal EPC levels, such as diabetes and its complications (eg, neuropathy, nephropathy, foot lesions, blood flow disorders), obesity, arteriosclerosis, obstructive arteriosclerosis, Buerger's disease, It can be diagnosed that the patient is suffering from pulmonary hypertension, myocardial infarction, cerebral infarction, hepatitis, cirrhosis, chronic obstructive pulmonary disease, wound, fracture, osteoporosis, periodontal disease, dementia, etc. .
  • Bone marrow cells were isolated from mice according to the original paper (Tamarat R et al., Am J Pathol. 2004; 164: 457-466.) did. Bone marrow cells were extruded from the femur and tibia of the left lower limb of male C57BL / 6J mice with HBSS medium (Gibco) containing 1% FBS. Bone marrow cells were collected by centrifugation, resuspended in EDTA-PBS, removed the mass through a cell strainer, and centrifuged again.
  • HBSS medium Gibco
  • Hemolysis was performed by resuspension with 0.8% ammonium chloride. After centrifugation, the cells were suspended in IMDM (Gibco) and the number of cells was counted.
  • the culture method was modified from the original paper (Masuda H et al., Circ Res. 2007; 101 (6): 598-606., 71st Annual Meeting of the Japanese Circulation Society OJ-063-H). It was.
  • MethoCult SF M3236 (Stemcell technologies) containing 10% FBS and nutrient factors was used (20 ng / ml stem cell factor (SCF), 50 ng / ml vascular endothelial growth factor (VEGF), 20 ng / ml interleukin-3 (IL-3), 50 ng / ml basic fibroblast growth factor (bFGF), 50 ng / ml epidermal growth factor receptor (EGFR), 50 ng / ml insulin-like growth factor-1, (IGF-1) 2 U / ml heparin).
  • SCF stem cell factor
  • VEGF vascular endothelial growth factor
  • IL-3 interleukin-3
  • bFGF basic fibroblast growth factor
  • EGFR epidermal growth factor receptor
  • IGF-1 insulin-like growth factor-1
  • the cell suspension was placed in MethoCult SF medium and mixed well so that the cell density was 3 ⁇ 10 4 cells / dish, seeded in 1 mL each in a 35 mm dish, and cultured for 8 days.
  • Cells cultured after 8 days were reacted with 0.4 ⁇ g / mL acLDL-DiI and 2 ⁇ g / mL FITC-conjugated BS-1 lectin, fixed with 2% PFA, washed with PBS, and observed under a fluorescence microscope.
  • DiI-LDL uptake and BS-1 lectin staining were confirmed, confirming that it was EPC.
  • Reference Example 2 Culture of mouse peripheral blood mononuclear cells by EPC colony forming assay of mouse peripheral blood mononuclear cells
  • Original paper Kerka C et al., Proc Natl Acad Sci US A. 2000; 97: 3422- 3427.
  • peripheral blood mononuclear cells were isolated from mice. Blood collected from the carotid artery of male C57BL / 6J mice was diluted 2-fold with physiological saline, then double-diluted blood was layered on 1/2 vol of Histopaque 1088 (Sigma) for blood cell separation, and concentration gradient centrifugation was performed. .
  • Mononuclear cells collected at the interface were collected, suspended in PBS / EDTA, collected by centrifugation, then hemolyzed by resuspension with 0.8% ammonium chloride, centrifuged again, and the cells were suspended in IMDM. Counted the number.
  • the culture by the colony forming assay was performed according to Reference Example 1. The seeding density of mononuclear cells in peripheral blood was 7 ⁇ 10 5 cells / dish.
  • Human cell culture medium was MethoCult SF H4236 (Stemcell technologies) containing 30% FBS and nutrient factors (20 ng / ml stem cell factor (SCF), 50 ng / ml vascular endothelial growth factor (VEGF), 20 ng / ml Interleukin-3 (IL-3), 50 ng / ml basic fibroblast growth factor (bFGF), 50 ng / ml epidermal growth factor receptor (EGFR), 50 ng / ml insulin-like growth factor-1, (IGF -1) 2 U / ml heparin).
  • SCF stem cell factor
  • VEGF vascular endothelial growth factor
  • IL-3 Interleukin-3
  • bFGF basic fibroblast growth factor
  • EGFR epidermal growth factor receptor
  • IGF -1) 2 U / ml heparin
  • Human CD133 positive bone marrow cells were suspended in IMDM, mixed well in MethoCult SF medium so that the cell density would be 1 ⁇ 10 3 cells / dish, seeded in 1 mL each in a 35 mm dish, and cultured for 21 days. After 21 days, when observing under a microscope ( ⁇ 40 lens), two types of colonies are formed in the dish. A colony composed of cells having a small cell size was determined as small EPC.
  • Mouse bone marrow cells, mouse peripheral blood mononuclear cells, and human CD133-positive bone marrow derived large EPC and small EPC RNA extraction Using colony forming assay, mouse bone marrow cells or peripheral blood mononuclear cells, and Human CD133 positive bone marrow cells were cultured, and differentiated small EPCs were collected using a pipette under a microscope. Small EPC was washed with PBS and then dissolved with RLT buffer. The culture dish was washed with PBS, RLT buffer was added to large EPC that was adhered, and the cells were scraped and lysed with a cell scraper, and RNA of each cell was extracted using RNeasy Mini Kit (Qiagen).
  • Reference Example 5 Setting up an expression analysis system for GPR120 using TaqMan PCR TaqMan PCR conditions were set in order to perform detailed expression analysis of GPR120 in mouse cells.
  • the primers used were Forward Primer (5'-TCCGAGTGTCCCAACAAGACTAC-3 '; SEQ ID NO: 7) and Reverse Primer (5'-GACTCCACATGATGAAGAAGGAAA-3'; SEQ ID NO: 8), and the probe used for detection was 5'-Fam-CCGCACGCTCTTCCTGCTCATG- Tamra (SEQ ID NO: 9).
  • TaqMan PCR is mixed with TaqMan Universal Mixture and cDNA synthesized using Forward Primer 900 nM, Reverse Primer 900 nM, Probe 250 nM, and 25 ng of total RNA as a template, and 40 cycles of 95 ° C for 15 seconds and 60 ° C for 60 seconds.
  • the mouse GPR120 gene was quantified by real-time PCR. Standard calibration (CCAGATCCGAGTGTCCCAACAAGACTACCGACTCTTCCGCACGCTCTTCCTGCTCATGGTTTCCTTCTTCATCATGTGGAGTCCCATC; SEQ ID NO: 10) was used to draw a standard curve and quantified, and a typical standard curve pattern is shown in FIG. 2A.
  • TaqMan PCR conditions were set for detailed expression analysis of GPR120 in human cells.
  • the primers used were Forward Primer (5'-GCGCCGACCAGGAAATTT-3 '; SEQ ID NO: 11) and Reverse Primer (5'-CAAAAGAGACATCCCACGAGATC-3'; SEQ ID NO: 12), and the probe used for detection was 5'-Fam-TTGCACACTGATTTGGCCCACCATT- Tamra (SEQ ID NO: 13).
  • TaqMan PCR is mixed with TaqMan Universal Mixture and cDNA synthesized using Forward Primer 900 nM, Reverse Primer 900 nM, Probe 250 nM, and 25 ng of total RNA as a template, and 40 cycles of 95 ° C for 15 seconds and 60 ° C for 60 seconds.
  • the human GPR120 gene was quantified by real-time PCR.
  • a standard oligo (CCCCGGCGCCGACCAGGAAATTTCGATTTGCACACTGATTTGGCCCACCATTCCTGGAGAGATCTCGTGGGATGTCTCTTTTGTTACT; SEQ ID NO: 14) was drawn and quantified, and a typical calibration curve pattern is shown in FIG. 2B.
  • Example 1 Examination of GPR120 mRNA Expression in Mouse Bone Marrow Cell-Derived and Peripheral Blood Mononuclear Cell-Derived EPC
  • Mouse bone marrow cells were cultured by EPC colony forming assay as in Reference Examples 1, 4, and 5 and differentiated large EPC And small EPC were isolated, and the expression level of GPR120 mRNA in mouse bone marrow cell-derived EPC was quantified using the TaqMan PCR method.
  • FIG. 3 GPR120 was found to be low in mouse bone marrow cells and highly expressed in bone marrow cell-derived EPCs. In mice, higher expression of GPR120 was observed in large EPC than in small EPC.
  • Mouse peripheral blood mononuclear cells are cultured by EPC colony forming assay as in Reference Examples 2, 4 and 5, and differentiated large EPC and small EPC are isolated.
  • the expression level of GPR120 mRNA in was quantified using the TaqMan PCR method. As a result, as shown in FIG. 3, it was found that GPR120 was not expressed in mouse peripheral blood mononuclear cells, but was expressed in peripheral blood mononuclear cell-derived EPCs.
  • mouse peripheral blood mononuclear cells showed higher expression of GPR120 in large EPCs than in small EPCs.
  • Example 2 Examination of expression of GPR120 mRNA in EPC derived from human CD133-positive bone marrow cells Human CD133-positive bone marrow cells were cultured by EPC colony forming assay as in Reference Examples 3, 4 and 5, and differentiated large EPC and small EPC By isolation, the expression level of GPR120 mRNA in human CD133-positive bone marrow cell-derived EPC was quantified using the TaqMan PCR method. As a result, as shown in FIG. 4, GPR120 is not expressed in human CD133-positive bone marrow cells or aortic endothelial cells (HAEC, KURABO), and is specific only in EPC derived from human CD133-positive bone marrow cells. It was found that
  • Example 3 Examination of differentiation ability of bone marrow cells into large EPC in GPR120 KO mice GPR120 KO mice were subjected to EPC colony forming assay of bone marrow cells, and the number of differentiated large EPC colonies and small EPC colonies were counted. We evaluated the ability of bone marrow cells to differentiate into large EPCs in KO mice. Bone marrow cells were collected from 12-week-old male GPR120 KO mice as described in Reference Example 1 and subjected to EPC colony forming assay.
  • Example 4 Examination of EPC Count in Peripheral Blood in GPR120 KO Mouse Using GPR120 KO mouse, EPC differentiation assay of peripheral blood mononuclear cells was performed, and EPC count in peripheral blood mononuclear cells in GPR120 KO mice Evaluation was performed.
  • Peripheral blood mononuclear cells were collected from 16-week-old male GPR120 KO mice as described in Reference Example 2, and the cells were collected as EGM2 (EBM-2 / 5% FCS / EGM-2 supplemented factor medium, Cambrex). And suspended in a fibronectin-coated 96-well plate at 1 ⁇ 10 5 cells / well.
  • GHB was significantly increased in the GPR120 KO mice although there was no change in body weight as compared to the wild type C57BL / 6J. Plasma glucose concentration tended to increase in GPR120 KO mice, and a significant increase was observed at 12 and 18 weeks of age.
  • a substance that regulates EPC differentiation and proliferation and a substance that increases the number of EPCs in peripheral blood can be selected. Therefore, prevention and treatment can be achieved by regulating angiogenic ability via EPC. It is useful for searching for candidate compounds for prophylactic / therapeutic agents for various diseases that can be effective. Since GPR120 can be used as a surface antigen marker for EPC, it is useful for EPC selection / quantification and diagnosis of diseases associated with abnormal EPC levels.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Urology & Nephrology (AREA)
  • Hematology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Cell Biology (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Biotechnology (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)
  • Microbiology (AREA)
  • Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Endocrinology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Zoology (AREA)
  • Neurology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Organic Chemistry (AREA)
  • Toxicology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Peptides Or Proteins (AREA)

Abstract

L'invention porte sur l'identification d'une molécule qui peut être exprimée de façon spécifique dans une cellule progénitrice endothéliale (EPC) et qui peut influer sur la différenciation/prolifération d'une EPC, le recrutement d'une EPC dans un sang périphérique ou similaire ; sur un procédé permettant le criblage d'un modulateur pour la molécule ; sur un moyen destiné à la prévention/au traitement d'une maladie associée au dysfonctionnement d'une EPC à l'aide du modulateur ; sur un procédé destiné à la sélection/quantification d'une EPC par l'emploi de la molécule en tant qu’indicateur ; et sur une méthode de diagnostic d'une maladie liée aux EPC. De façon spécifique, l'invention porte sur un procédé permettant le criblage d'une substance capable de moduler la différenciation/prolifération d'une EPC ou d'augmenter la quantité d'une EPC dans un sang périphérique, qui est caractérisé par l'utilisation de GPR120 ou d'un peptide partiel de celui-ci ou d'une cellule capable de produire la protéine ou le peptide partiel de celle-ci ; et sur un procédé permettant de déterminer la quantité d'une EPC dans un échantillon contenant des cellules recueillies chez un mammifère, qui est caractérisé par la mesure de la protéine GPR120 ou de l'expression d'un gène pour la protéine GPR120 dans l'échantillon.
PCT/JP2009/057229 2008-04-09 2009-04-08 Procédé de criblage WO2009125804A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2008101961 2008-04-09
JP2008-101961 2008-04-09

Publications (1)

Publication Number Publication Date
WO2009125804A1 true WO2009125804A1 (fr) 2009-10-15

Family

ID=41161935

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2009/057229 WO2009125804A1 (fr) 2008-04-09 2009-04-08 Procédé de criblage

Country Status (1)

Country Link
WO (1) WO2009125804A1 (fr)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2014011926A1 (fr) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comportant des statines, des biguanides et d'autres agents pour réduire un risque cardiométabolique
JP2016530487A (ja) * 2013-06-14 2016-09-29 マース インコーポレーテッドＭａｒｓ Ｉｎｃｏｒｐｏｒａｔｅｄ 方法
JP2016192967A (ja) * 2010-12-31 2016-11-17 ゼウス サイエンティフィック、インク． 血液試料の微生物特異的フィルタ・インサイチュ分析の方法
WO2021241659A1 (fr) * 2020-05-29 2021-12-02 株式会社 Numt Adipocyte hyperexprimant ffar4 et son utilisation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007026874A1 (fr) * 2005-09-02 2007-03-08 Eisai R & D Management Co., Ltd. Méthode pour détecter une substance efficace contre une maladie au moyen de gpr120 et de phospholipase

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007026874A1 (fr) * 2005-09-02 2007-03-08 Eisai R & D Management Co., Ltd. Méthode pour détecter une substance efficace contre une maladie au moyen de gpr120 et de phospholipase

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2016192967A (ja) * 2010-12-31 2016-11-17 ゼウス サイエンティフィック、インク． 血液試料の微生物特異的フィルタ・インサイチュ分析の方法
WO2014011926A1 (fr) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comportant des statines, des biguanides et d'autres agents pour réduire un risque cardiométabolique
JP2016530487A (ja) * 2013-06-14 2016-09-29 マース インコーポレーテッドＭａｒｓ Ｉｎｃｏｒｐｏｒａｔｅｄ 方法
US10222387B2 (en) 2013-06-14 2019-03-05 Mars, Incorporated Methods for increasing palatability of pet foodstuff
US10473673B2 (en) 2013-06-14 2019-11-12 Mars, Incorporated Methods for increasing palatability of pet foodstuff
EP3008082B1 (fr) * 2013-06-14 2020-01-01 Mars, Incorporated Procédés
US10768184B2 (en) 2013-06-14 2020-09-08 Mars, Incorporated Methods for increasing palatability of pet foodstuff
WO2021241659A1 (fr) * 2020-05-29 2021-12-02 株式会社 Numt Adipocyte hyperexprimant ffar4 et son utilisation
JP7411180B2 (ja) 2020-05-29 2024-01-11 株式会社Numt Ｆｆａｒ４を高発現させた脂肪細胞及びその使用

Similar Documents

Publication Publication Date Title
US7419956B2 (en) Isolated physiologically active peptide and use thereof
JP4659736B2 (ja) スクリーニング方法
US20050240008A1 (en) Novel protein, dna thereof and process for producing the same
US20090082303A1 (en) Drug for preventing and treating atherosclerosis
US20060014679A1 (en) Insulin resistance improving agents
WO2009125804A1 (fr) Procédé de criblage
JPWO2007049624A1 (ja) 癌の予防・治療剤
US20070248591A1 (en) Preventive/Therapeutic Drug for Arteriosclerosis
US7972800B2 (en) Screening method for binding property or signal transduction alterations
US20110104705A1 (en) Musclin receptor and use thereof
US20100068208A1 (en) Degranulation inhibitor
JP2012135304A (ja) アミロイドベータ産生制御因子を用いた阻害剤スクリーニング方法
EP1634951B1 (fr) Nouvelle proteine
EP1273657A1 (fr) Nouvelle proteine, son procede de production et d'utilisation
EP2153847A1 (fr) Gène sensible à une maladie des os/articulations et son utilisation
EP1473365A1 (fr) Inhibiteurs d'angiogenese
WO2012029722A1 (fr) Procédé de criblage
EP2016949A1 (fr) Nouvelle utilisation d'un récepteur conjugué à une protéine g et son ligand
JP4761812B2 (ja) マスクリン受容体およびその用途
US20090047282A1 (en) Prophylactic/Therapeutic Agent for Cancer
JP2004340957A (ja) 新規スクリーニング方法
JP2005128010A (ja) インスリン抵抗性改善剤のスクリーニング方法
JP4965776B2 (ja) 新規生理活性ペプチドおよびその用途
US20060035209A1 (en) Screening method
JPWO2008111520A1 (ja) 寿命延長関連遺伝子およびその用途

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 09730031

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 09730031

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP