WO2012029722A1 - Procédé de criblage - Google Patents

Procédé de criblage Download PDF

Info

Publication number
WO2012029722A1
WO2012029722A1 PCT/JP2011/069487 JP2011069487W WO2012029722A1 WO 2012029722 A1 WO2012029722 A1 WO 2012029722A1 JP 2011069487 W JP2011069487 W JP 2011069487W WO 2012029722 A1 WO2012029722 A1 WO 2012029722A1
Authority
WO
WIPO (PCT)
Prior art keywords
impa2
polypeptide
present
seq
polynucleotide
Prior art date
Application number
PCT/JP2011/069487
Other languages
English (en)
Japanese (ja)
Inventor
藤井　亮
直人 犬飼
久美子 波佐間
真人 湯上
壮 坂本
Original Assignee
武田薬品工業株式会社
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by 武田薬品工業株式会社 filed Critical 武田薬品工業株式会社
Publication of WO2012029722A1 publication Critical patent/WO2012029722A1/fr

Links

Images

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/70—Carbohydrates; Sugars; Derivatives thereof
    • A61K31/7088—Compounds having three or more nucleosides or nucleotides
    • A61K31/713—Double-stranded nucleic acids or oligonucleotides
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P13/00—Drugs for disorders of the urinary system
    • A61P13/12—Drugs for disorders of the urinary system of the kidneys
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/5005—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells
    • G01N33/5008—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics
    • G01N33/5011—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving human or animal cells for testing or evaluating the effect of chemical or biological compounds, e.g. drugs, cosmetics for testing antineoplastic activity
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/044—Hyperlipemia or hypolipemia, e.g. dyslipidaemia, obesity
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/16—Ophthalmology
    • G01N2800/164—Retinal disorders, e.g. retinopathy
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/32—Cardiovascular disorders
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/34—Genitourinary disorders
    • G01N2800/347—Renal failures; Glomerular diseases; Tubulointerstitial diseases, e.g. nephritic syndrome, glomerulonephritis; Renovascular diseases, e.g. renal artery occlusion, nephropathy

Definitions

  • the present invention relates to a screening method for a prophylactic / therapeutic agent for IMPA2-related peripheral diseases using IMPA2.
  • Non-patent document 1 Neuropsycho.
  • Non-patent literature 2 JOURNAL OF BIOLOGICAL CHEMISTRY Vol.282, No.1, 637-647
  • Non-patent literature 3 Neurosci Res. 2010 May; 67 (1): 86-94 ).
  • International Publication No. 2004/101779 Patent Document 1 describes a screening method for IMPA2 inhibitors targeting central diseases. This publication describes a measurement system for the activity of IMPA (inositol monophosphatase 1 and / or inositol monophosphatase 2) using radiolabeled inositol.
  • Patent Document 2 relates to a screening method for drugs that induce autophagy based on IMPA inhibitory activity. This publication describes that autophagy is induced by inhibiting IMPA using LiCl and L690330. However, in any of the above documents, there is a report that IMPA2 is related to peripheral diseases (for example, obesity, diabetes, hyperlipidemia, arteriosclerosis, chronic nephritis, diabetic nephropathy, ischemic heart disease, etc.) Not at all.
  • peripheral diseases for example, obesity, diabetes, hyperlipidemia, arteriosclerosis, chronic nephritis, diabetic nephropathy, ischemic heart disease, etc.
  • IMPA2 is a candidate gene involved in intracellular triglyceride accumulation and that expression of IMPA2 is suppressed.
  • TG triglyceride
  • IMPA2 inhibition leads to anti-obesity.
  • the present inventors have also found that the expression level of IMPA2 is involved in the regulation of intracellular mitochondrial metabolic activity.
  • the present inventors have found 6-phosphogluconic acid as a substrate having high specificity for IMPA2. As a result of further studies based on these findings, the present inventors have completed the present invention.
  • the present invention provides the following.
  • [1] The same or substantially the same amino acid sequence as shown in SEQ ID NO: 1 (human IMPA2), 3 (mouse IMPA2), 5 (rat IMPA2), 7 (bovine IMPA2), 9 (dog IMPA2) or 11 (monkey IMPA2)
  • a polypeptide containing the same amino acid sequence sometimes abbreviated as the polypeptide of the present invention in the present specification
  • a partial peptide or salt thereof or a cell producing the polypeptide or the partial peptide
  • a screening method for a prophylactic / therapeutic agent for an IMPA2-related peripheral disease is obesity.
  • Non-human mammal deficient in the expression of a polynucleotide wherein a polynucleotide comprising a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12 is inactivated
  • a method for screening for an agent for promoting fat differentiation characterized in that [6]
  • Use of an exogenous non-human transgenic animal having a polynucleotide comprising a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12 A screening method for a prophylactic / therapeutic agent for IMPA2-related peripheral diseases.
  • a polypeptide comprising an amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11 The method according to any one of [1] to [4] and [6], which is a compound or a salt thereof that promotes or inhibits activity.
  • a polypeptide comprising the same or substantially the same amino acid sequence as shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11, or a partial peptide thereof, or a salt thereof, or the polypeptide or a thereof A method for screening an IMPA2 inhibitor, comprising using a cell that produces a partial peptide, and 6-phosphogluconic acid or a similar compound thereof.
  • a prophylactic / therapeutic agent for IMPA2-related peripheral diseases comprising an IMPA2 inhibitor.
  • a method for preventing and treating an IMPA2-related peripheral disease comprising administering an effective amount of an IMPA2 inhibitor to a mammal.
  • the screening methods [1] to [7] above it is possible to efficiently search for preventive / therapeutic agents for IMPA2-related peripheral diseases (particularly obesity) and fat differentiation promoting agents.
  • the screening method of [8] above it is possible to efficiently search for an IMPA2 inhibitor.
  • the prophylactic / therapeutic agent according to [9] to [11] above containing an IMPA2 inhibitor is useful as a prophylactic / therapeutic agent for IMPA2-related peripheral diseases (particularly obesity).
  • the horizontal axis indicates the number of days from the differentiation induction treatment, and the vertical axis indicates the relative amount of IMPA2 mRNA relative to the amount of 36B4 mRNA.
  • the diamond ( ⁇ ) shows the amount of mRNA (average value ⁇ standard deviation) of IMPA2 in the cells in which differentiation has not been induced, and the triangles ( ⁇ ) in cells in which differentiation has been induced.
  • Pio is 10 ⁇ M Pioglitazone (Pioglitazone), and 10% CS-DMEM is D-MEM medium containing 10% Calf Serum.
  • Fig. 2 shows the intracellular triglyceride accumulation inhibitory effect (Fig. 2a) and the mRNA expression inhibitory effect (Fig.
  • FIG. 2b of IMPA2 by siRNA specific to IMPA2.
  • the horizontal axis represents siRNA introduced into the cells, and the vertical axis represents FIG. 2a: fluorescence intensity (mean value ⁇ standard deviation), FIG. 2b: mRNA amount of IMPA2 (relative to 36B4 mRNA amount).
  • Non-target is Silencer Negative Control # 1 siRNA (Ambion, catalog number AM4611), siRNA1 is siRNA consisting of SEQ ID NOs: 16 and 17, and siRNA2 is siRNA consisting of SEQ ID NOs: 18 and 19.
  • the mouse IMPA2 mRNA expression level in the soleus and gastrocnemius muscles of normal (m + / m +) mice is shown.
  • Non-target is Silencer Negative Control # 1 siRNA (Ambion, catalog number AM4611), siRNA1 is siRNA consisting of SEQ ID NOs: 16 and 17, and siRNA2 is siRNA consisting of SEQ ID NOs: 18 and 19.
  • examples of the “IMPA2-related peripheral disease” include the following. (1) Diseases involving intracellular triglyceride accumulation (eg obesity, diabetes, hyperlipidemia, arteriosclerosis, chronic nephritis, diabetic nephropathy, fatty liver, hypertension, ischemic heart disease, cancer, etc.) (2) Diseases involving intracellular mitochondrial activity (eg obesity, retinal degenerative diseases, diabetic neuropathy, diabetic retinopathy, glomerulosclerosis, nephropathy, diabetic nephropathy, chronic nephropathy, insulin Resistant disease, hypertension, arteriosclerosis, diabetes, oxidative stress, ischemic heart disease, aging, myopathy, neuropathy, hearing loss, blindness, fatty liver, steatohepatitis, viral hepatitis, biliary cirrhosis, ischemia reperfusion Disorders, graft rejection, hemolytic anemia, cancer, etc.) Regarding the relationship between mitochondrial activity and diseases, for example
  • the present invention provides the following screening methods.
  • a polypeptide comprising the same or substantially the same amino acid sequence as shown in SEQ ID NO: 1, 3, 5, 7, 9, or 11, or a partial peptide thereof, or a salt thereof, or the polypeptide or a thereof
  • a screening method for a prophylactic / therapeutic agent for IMPA2-related peripheral diseases characterized by using cells that produce partial peptides.
  • the polypeptide of the present invention and its partial peptide, the polynucleotide of the present invention, the antibody of the present invention and the like used in the screening method of the present invention will be described.
  • the polypeptide of the present invention is preferably a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11, and represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11. More preferred is a polypeptide having an amino acid sequence, that is, IMPA2 of various mammals (human, mouse, rat, cow, dog, monkey). Of these, human IMPA2 (polypeptide having the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1) is preferred.
  • the amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11 includes the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11. About 60% or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more homology or identity
  • NCBI BLAST National Center for Biotechnology Information Basic Local Alignment Search Tool
  • Amino acids are substituted with other amino acids, or (v) amino acid sequences in which (i) to (iv) above are combined.
  • the amino acid sequence is inserted, deleted or substituted as described above, the position of the insertion, deletion or substitution is not particularly limited.
  • polypeptide containing an amino acid sequence substantially the same as the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, or 11 examples include the aforementioned SEQ ID NO: 1, 3, 5, 7, 9, or 11.
  • a polypeptide having substantially the same amino acid sequence as the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, or 11 and having substantially the same activity as the polypeptide comprising the amino acid sequence represented by SEQ ID NO: Peptides are preferred.
  • substantially the same quality of activity include intracellular triglyceride accumulation promoting activity (TG accumulation promoting activity) and phosphatase activity using inositol monophosphate, 6-phosphogluconic acid and the like as substrates.
  • Substantially homogeneous indicates that their properties are qualitatively (eg, physiologically or pharmacologically) homogeneous. Therefore, it is preferable that these activities are equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times).
  • the quantitative factors such as the molecular weight of the polypeptide may be different.
  • the intracellular triglyceride accumulation-promoting activity of an object is measured, for example, by measuring the amount of intracellular triglyceride accumulated when cells (for example, differentiated adipocytes) are cultured in the presence and absence of the object. Can be evaluated (see also the measurement method described in Example 2 described later).
  • Non-Patent Document 1 (Cryns, K. et al., Neuropsycho-pharmacology 32, 881-891, 2007), Patent Document 2 (International Publication No. 2006 / 079792 pamphlet) or a method according thereto.
  • substantially homogeneous activity also includes intracellular mitochondrial metabolic activity or mitochondrial regulation.
  • substantially the same quality means that, as described above, these properties are qualitatively (for example, physiologically or pharmacologically) homogeneous. Therefore, it is preferable that these activities are equivalent (eg, about 0.01 to 100 times, preferably about 0.1 to 10 times, more preferably 0.5 to 2 times).
  • the quantitative factors such as the molecular weight of the polypeptide may be different.
  • the intracellular mitochondrial metabolic activity or the amount of mitochondrial activity of an object is, for example, intracellular mitochondrial metabolic activity when cells (eg, differentiated adipocytes) are cultured in the presence and absence of the object, mitochondrial DNA It can be evaluated by measuring the amount and comparing the measured values.
  • the intracellular mitochondrial metabolic activity a known method, for example, can be measured by the method or methods analogous thereto described in Methods in Cell Biology (Volume 80, Mitochondrai 2 nd edition). The measurement method described in Example 5 or 6 described later can also be referred to.
  • 6-phosphogluconic acid is provided as a substrate having high specificity for the polypeptide of the present invention, preferably IMPA2.
  • 6-phosphogluconic acid or a similar compound can be used as a substrate.
  • 6-phosphogluconic acid is preferably used as a substrate.
  • a similar compound preferably 6-phosphogluconic acid
  • an effective IMPA2-related peripheral disease prophylactic / therapeutic agent with high IMPA2 inhibitory efficiency is obtained.
  • the left end is the N-terminus (amino terminus) and the right end is the C-terminus (carboxyl terminus) according to the convention of peptide designation.
  • the polypeptide of the present invention including the polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, or 11, has a C-terminus having a carboxyl group (—COOH), a carboxylate (—COO - ), Amide (-CONH 2 ) or ester (-COOR).
  • R in the ester for example, a C 1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc., for example, a C 3-8 cycloalkyl group such as cyclopentyl, cyclohexyl, etc., for example, phenyl C 6-12 aryl groups such as ⁇ -naphthyl, C 7- such as phenyl-C 1-2 alkyl groups such as benzyl and phenethyl or ⁇ -naphthyl-C 1-2 alkyl groups such as ⁇ -naphthylmethyl 14 aralkyl group, pivaloyloxymethyl group is used.
  • a C 1-6 alkyl group such as methyl, ethyl, n-propyl, isopropyl, n-butyl, etc.
  • a C 3-8 cycloalkyl group such as
  • the polypeptide of the present invention has a carboxyl group (or carboxylate) in addition to the C-terminus
  • those in which the carboxyl group is amidated or esterified are also included in the polypeptide of the present invention.
  • the ester in this case, for example, the above-mentioned C-terminal ester or the like is used.
  • amino acid residues (eg, methionine residue) of the N-terminal amino group protecting group e.g., formyl group, such as C 1-6 alkanoyl such as acetyl group C 1-6 A group protected by an acyl group, an N-terminal glutamine residue generated by cleavage in vivo, pyroglutamine oxidized, a substituent on the side chain of an amino acid in the molecule (eg, —OH, —SH) Amino group, imidazole group, indole group, guanidino group, etc.) are protected with an appropriate protecting group (for example, C 1-6 acyl group such as C 1-6 alkanoyl group such as formyl group, acetyl group, etc.) Or a complex protein such as a so-called glycoprotein having a sugar chain bound thereto.
  • an appropriate protecting group for example, C 1-6 acyl group such as C 1-6 alkanoyl group such as formyl group,
  • the partial peptide of the polypeptide of the present invention (sometimes abbreviated as the partial peptide of the present invention in the present specification) is the partial peptide of the polypeptide of the present invention described above, preferably the above-described present invention. It has the same property as the polypeptide.
  • the partial peptide of the present invention is used as an antigen for producing the antibody of the present invention described later, at least 20 or more, preferably 50 or more, more preferably among the constituent amino acid sequences of the polypeptide of the present invention.
  • the partial peptide of the present invention is one or more (preferably about 1 to 20, more preferably about 1 to 10, more preferably a number (1) in the amino acid sequence of the corresponding polypeptide of the present invention.
  • amino acids or one or more (preferably about 1 to 20, more preferably about 1 to 10, more preferably a number (1 to 6) in the amino acid sequence.
  • Amino acids or one or more amino acids in the amino acid sequence (preferably about 1 to 20, more preferably about 1 to 10, more preferably a number (1 to 6)).
  • the C-terminus may be any of a carboxyl group (—COOH), a carboxylate (—COO—), an amide (—CONH 2 ), or an ester (—COOR).
  • the partial peptide of the present invention includes those having a carboxyl group (or carboxylate) in addition to the C-terminus, and an N-terminal amino acid residue (eg, methionine residue) as in the above-described polypeptide of the present invention.
  • Examples of the salt of the polypeptide of the present invention or a partial peptide thereof include physiologically acceptable metal salts, ammonium salts, salts with organic bases, salts with inorganic acids, salts with organic acids, basic or acidic amino acids, And the like.
  • Preferable examples of the metal salt include alkali metal salts such as sodium salt and potassium salt; alkaline earth metal salts such as calcium salt, magnesium salt and barium salt; aluminum salt and the like.
  • Preferable examples of the salt with an organic base include, for example, trimethylamine, triethylamine, pyridine, picoline, 2,6-lutidine, ethanolamine, diethanolamine, triethanolamine, cyclohexylamine, dicyclohexylamine, N, N′-dibenzylethylenediamine. And the like.
  • Preferable examples of the salt with inorganic acid include salts with hydrochloric acid, hydrobromic acid, nitric acid, sulfuric acid, phosphoric acid and the like.
  • salts with organic acids include formic acid, acetic acid, trifluoroacetic acid, propionic acid, phthalic acid, fumaric acid, oxalic acid, tartaric acid, maleic acid, citric acid, succinic acid, malic acid, methanesulfonic acid And salts with benzoic acid, benzenesulfonic acid, p-toluenesulfonic acid and the like.
  • salts with basic amino acids include salts with arginine, lysine, ornithine and the like
  • salts with acidic amino acids include salts with aspartic acid, glutamic acid and the like. Can be mentioned.
  • the polypeptide of the present invention or a partial peptide thereof or a salt thereof can be produced from a mammalian cell (human, mouse, rat, etc.) or tissue by a known purification method of the polypeptide, and encodes the polypeptide. It can also be produced by culturing a transformant containing DNA. Moreover, it can also manufacture according to the below-mentioned peptide synthesis method.
  • the polypeptide of the present invention or a partial peptide thereof is produced from mammalian tissues or cells, the tissues or cells of mammals are homogenized, followed by extraction with acid or the like, and the extract is subjected to reverse phase chromatography and ion exchange. It can be purified and isolated by combining chromatography such as chromatography.
  • the polypeptide of the present invention or a partial peptide thereof or a salt thereof can be produced according to a peptide synthesis method known per se.
  • a peptide synthesis method for example, either a solid phase synthesis method or a liquid phase synthesis method may be used. That is, the polypeptide of the present invention is obtained by condensing a partial peptide or amino acid capable of constituting the polypeptide of the present invention or a partial peptide thereof and the remaining part, and removing the protective group when the product has a protective group.
  • a partial peptide thereof can be produced. Examples of known condensation methods and protecting group elimination include the methods described in the following (i) to (v). (I) M.
  • polypeptide of the present invention obtained by the above method or a partial peptide thereof is a free form, it can be converted to an appropriate salt by a known method or a method analogous thereto, and conversely, It can be converted into a free form or other salt by a known method or a method analogous thereto.
  • the polynucleotide of the present invention may be any polynucleotide as long as it contains a nucleotide sequence encoding the above-described polypeptide of the present invention or a partial peptide thereof, and is preferably DNA (herein In some cases, the DNA of the present invention may be abbreviated).
  • the DNA may be any of genomic DNA, genomic DNA library, cDNA derived from cells / tissues described later, cDNA library derived from cells / tissues described later, and synthetic DNA.
  • the vector used for the library may be any of bacteriophage, plasmid, cosmid, phagemid and the like.
  • RNA or mRNA fraction prepared from cells / tissues described later can be directly amplified by reverse transcription polymerase chain reaction (hereinafter abbreviated as RT-PCR method) using a total RNA or mRNA fraction prepared from cells / tissues described later.
  • RT-PCR method reverse transcription polymerase chain reaction
  • examples of the polynucleotide encoding the polypeptide of the present invention include SEQ ID NOs: 2, 4, 6, 8, 10, or 12.
  • a polynucleotide (preferably DNA) comprising the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10 or 12 (preferably DNA), SEQ ID NO: 2. 4.
  • a polynucleotide preferably DNA
  • Hybridization can be performed according to a method known per se or a method analogous thereto, for example, the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989). Moreover, when using a commercially available library, it can carry out according to the method as described in an attached instruction manual. More preferably, it can be carried out according to highly stringent conditions.
  • the highly stringent conditions are, for example, conditions in which the sodium concentration is about 19 to 40 mM, preferably about 19 to 20 mM, and the temperature is about 50 to 70 ° C., preferably about 60 to 65 ° C. In particular, the case where the sodium concentration is about 19 mM and the temperature is about 65 ° C. is most preferable.
  • polynucleotide encoding the polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1 is a polynucleotide (preferably DNA) comprising the base sequence represented by SEQ ID NO: 2
  • the polynucleotide encoding the polypeptide containing the amino acid sequence shown by No. 3 is a polynucleotide (preferably DNA) containing the base sequence shown by SEQ ID No. 4 or the like, and the amino acid shown by SEQ ID No.
  • a polynucleotide (preferably DNA) containing the base sequence shown by SEQ ID NO: 6 encodes a polypeptide containing the amino acid sequence shown by SEQ ID NO: 7.
  • the polynucleotide to be used is a polynucleotide comprising the base sequence represented by SEQ ID NO: 8.
  • a polynucleotide encoding a polypeptide containing the amino acid sequence represented by SEQ ID NO: 9 such as a leotide (preferably DNA)
  • a polynucleotide comprising the base sequence represented by SEQ ID NO: 10 preferably DNA
  • a polynucleotide encoding the polypeptide containing the amino acid represented by SEQ ID NO: 11 is used.
  • Examples of the partial polynucleotide of the polynucleotide encoding the polypeptide of the present invention include a polynucleotide encoding the partial peptide of the present invention.
  • the polynucleotide encoding the partial peptide of the present invention may be any polynucleotide as long as it contains the base sequence encoding the partial peptide of the present invention described above. Further, any of genomic DNA, genomic DNA library, cDNA derived from cells / tissues described later, cDNA library derived from cells / tissues described later, and synthetic DNA may be used.
  • polynucleotide encoding the partial peptide of the present invention for example, a polynucleotide having a part of a polynucleotide (preferably DNA) comprising the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10 or 12 (Preferably DNA), a polynucleotide (preferably DNA) having a part of a polynucleotide (preferably DNA) comprising the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10 or 12, or A polypeptide comprising a nucleotide sequence that hybridizes with the nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12 under highly stringent conditions and having substantially the same quality of activity as the polypeptide of the present invention.
  • a polynucleotide comprising a portion of a polynucleotide (preferably DNA) encoding a peptide (preferably a DNA) DNA) and the like can be used.
  • the polynucleotide (preferably DNA) that hybridizes with the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12 has the same meaning as described above.
  • a part of the base sequence encoding the peptide of the present invention is used.
  • the hybridization method can be performed, for example, according to the method described in Molecular Cloning 2nd (J. Sambrook et al., Cold Spring Harbor Lab. Press, 1989).
  • the DNA base sequence is converted by PCR, a known kit such as Mutan TM -super Express Km (Takara Shuzo), Mutan TM -K (Takara Shuzo), etc., using the ODA-LA PCR method, It can be carried out according to a method known per se such as the Gapped duplex method and the Kunkel method or a method analogous thereto.
  • the DNA encoding the cloned peptide can be used as it is or after digestion with a restriction enzyme or addition of a linker, if desired.
  • the DNA may have ATG as a translation initiation codon on the 5 ′ end side, and may have TAA, TGA or TAG as a translation termination codon on the 3 ′ end side. These translation initiation codon and translation termination codon can be added using an appropriate synthetic DNA adapter.
  • the peptide of the present invention is produced by transforming a suitable host with the expression vector of the peptide of the present invention, culturing the obtained transformant, and then separating and purifying the peptide of the present invention from the obtained culture.
  • the peptide expression vector of the present invention can be obtained by, for example, (i) cutting out the target DNA fragment from the DNA encoding the peptide of the present invention, and (ii) linking the DNA fragment downstream of the promoter in an appropriate expression vector. Can be manufactured.
  • plasmids derived from E. coli eg, pBR322, pBR325, pUC12, pUC13
  • plasmids derived from Bacillus subtilis eg, pUB110, pTP5, pC194
  • yeast-derived plasmids eg, pSH19, pSH15
  • Bacteriophage such as ⁇ phage
  • animal viruses such as retrovirus, vaccinia virus, baculovirus, and the like, pA1-11, pXT1, pRc / CMV, pRc / RSV, pcDNAI / Neo, and the like.
  • Examples of the promoter described above include SR ⁇ promoter, SV40 promoter, LTR promoter, CMV promoter, HSV-TK promoter and the like when animal cells are used as a host. Of these, it is preferable to use a CMV (cytomegalovirus) promoter, SR ⁇ promoter, or the like.
  • CMV cytomegalovirus
  • SR ⁇ promoter or the like.
  • the host is Escherichia, trp promoter, lac promoter, recA promoter, .lambda.P L promoter, lpp promoter, T7 promoter, etc.
  • the host is Bacillus, SPO1 promoter, SPO2 promoter, penP promoter, etc.
  • the host is yeast
  • the PHO5 promoter, PGK promoter, GAP promoter, ADH promoter and the like are preferable.
  • the host is an insect cell, a polyhedrin promoter, a P10 promoter and the like are preferable.
  • an expression vector containing an enhancer, a splicing signal, a poly A addition signal, a selection marker, an SV40 replication origin (hereinafter sometimes abbreviated as SV40ori) and the like is used as desired. it can.
  • selectable markers include dihydrofolate reductase (hereinafter sometimes abbreviated as dhfr) gene [methotrexate (MTX) resistance], ampicillin resistance gene (hereinafter sometimes abbreviated as Amp r ), neomycin resistance gene (hereinafter sometimes abbreviated as Neo r, G418 resistance).
  • the target gene can also be selected by a medium not containing thymidine.
  • a signal sequence suitable for the host is added to the N-terminal side of the peptide of the present invention.
  • the host is Escherichia
  • the host is Bacillus
  • MF ⁇ • signal sequence, SUC2 • signal sequence, etc. can be used.
  • insulin signal sequence, ⁇ -interferon signal sequence, antibody molecule / signal sequence, etc. can be used.
  • a transformant can be produced using a vector containing the DNA encoding the peptide of the present invention thus constructed.
  • Escherichia for example, Escherichia, Bacillus, yeast, insect cells, insects, animal cells and the like are used.
  • Specific examples of the genus Escherichia include, for example, Escherichia coli K12 ⁇ DH1 [Proc. Natl. Acad. Sci. USA, 60, 160 (1968)], JM103 [Nucleic Acids Research, 9, 309 (1981)], JA221 [Journal of Molecular Biology, 120, 517 (1978)], HB101 [Journal of Molecular Biology, 41, 459 (1969)], C600 [Genetics, 39, 440 (1954)] Etc. are used.
  • Bacillus bacterium examples include Bacillus subtilis MI114 [Gene, 24, 255 (1983)], 207-21 [Journal of Biochemistry, 95, 87 (1984)].
  • yeast examples include Saccharomyces cerevisiae AH22, AH22R ⁇ , NA87-11A, DKD-5D, 20B-12, Schizosaccharomyces pombe NCYC1913, NCYC2036, Used.
  • insect cells for example, when the virus is AcNPV, larvae-derived cell lines (Spodoptera frugiperda cells; Sf cells), MG1 cells derived from the midgut of Trichoplusia ni, High Five TM derived from eggs of Trichoplusia ni Cells, cells derived from Mamestra brassicae or cells derived from Estigmena acrea are used.
  • larvae-derived cell lines Spodoptera frugiperda cells; Sf cells
  • MG1 cells derived from the midgut of Trichoplusia ni High Five TM derived from eggs of Trichoplusia ni Cells
  • cells derived from Mamestra brassicae or cells derived from Estigmena acrea are used.
  • BmNPV sputum-derived cell lines (Bombyx mori N cells; BmN cells) and the like are used.
  • Sf cells examples include Sf9 cells (ATCC CRL 1711), Sf21 cells (Vaughn, JL et al., In Vivo, 13, 213-217, (1977)) and the like.
  • insects examples include silkworm larvae [Maeda et al., Nature, 315, 592 (1985)].
  • animal cells examples include monkey cells COS-7, Vero, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr ⁇ ) cells), mouse L Cells, mouse AtT-20, mouse myeloma cells, mouse ATDC5 cells, rat GH3, human FL cells, human 293 cells and the like are used.
  • CHO cells Chinese hamster cells CHO
  • CHO (dhfr ⁇ ) cells examples include monkey cells COS-7, Vero, Chinese hamster cells CHO (hereinafter abbreviated as CHO cells), dhfr gene-deficient Chinese hamster cells CHO (hereinafter abbreviated as CHO (dhfr ⁇ ) cells), mouse L Cells, mouse AtT-20, mouse myeloma cells, mouse ATDC5 cells, rat GH3, human FL cells, human 293 cells and the like are used
  • Transformation of Escherichia can be performed, for example, according to the method described in Proc. Natl. Acad. Sci. USA, 69, 2110 (1972), Gene, 17, 107 (1982). Transformation of Bacillus can be performed, for example, according to the method described in Molecular & General Genetics, 168, 111 (1979). In order to transform yeast, for example, the method described in Methods in Enzymology, 194, 182-287 (1991), Proc. Natl. Acad. Sci. USA, 75, 1929 (1978) and the like can be performed. it can. Insect cells or insects can be transformed, for example, according to the method described in Bio / Technology, 6, 47-55 (1988).
  • a liquid medium is suitable as a medium used for the culture, and a carbon source necessary for the growth of the transformant, Nitrogen sources, inorganic substances, etc. are contained.
  • the carbon source include glucose, dextrin, soluble starch, and sucrose.
  • the nitrogen source include ammonium salts, nitrates, corn steep liquor, peptone, casein, meat extract, soybean cake, and potato extract.
  • inorganic or organic substances and inorganic substances include calcium chloride, sodium dihydrogen phosphate, and magnesium chloride.
  • yeast extract, vitamins, growth promoting factors and the like may be added.
  • the pH of the medium is preferably about 5-8.
  • a medium for culturing Escherichia for example, M9 medium containing glucose and casamino acid (Miller, Journal of Experiments in Molecular Genetics, 431-433, Cold Spring Harbor Laboratory, New York 1972) is preferable. .
  • a drug such as 3 ⁇ -indolylacrylic acid can be added to make the promoter work efficiently if necessary.
  • the host is an Escherichia bacterium
  • the culture is usually performed at about 15 to 43 ° C. for about 3 to 24 hours, and if necessary, aeration or agitation can be added.
  • the host is Bacillus
  • the culture is usually performed at about 30 to 40 ° C.
  • examples of the medium include a Burkholder minimum medium [Bostian, KL et al., Proc. Natl. Acad. Sci. USA, vol. 77, 4505 (1980)]. And SD medium containing 0.5% casamino acid [Bitter, GA et al. Proc. Natl. Acad. Sci. USA, 81, 5330 (1984)].
  • the pH of the medium is preferably adjusted to about 5-8. Cultivation is usually carried out at about 20 ° C. to 35 ° C. for about 24 to 72 hours, with aeration and agitation as necessary.
  • an appropriate medium such as 10% bovine serum that has been immobilized on Grace's Insect Medium (Grace, TCC, Nature, 195,788 (1962)) is used as the medium. Additions etc. are used.
  • the pH of the medium is preferably adjusted to about 6.2 to 6.4.
  • the culture is usually carried out at about 27 ° C. for about 3 to 5 days, and aeration and agitation are added as necessary.
  • examples of the medium include MEM medium (Science, Vol.
  • the peptide of the present invention can be produced in the cell, in the cell membrane or outside of the transformant.
  • Separation and purification of the peptide of the present invention from the culture can be performed, for example, by the following method.
  • the cells or cells are collected by a known method, suspended in an appropriate buffer, and subjected to ultrasound, lysozyme and / or freeze-thaw, etc.
  • a method of obtaining a crude peptide extract by centrifugation or filtration after destroying cells or cells by the method is appropriately used.
  • the buffer may contain a protein (peptide) denaturant such as urea or guanidine hydrochloride, or a surfactant such as Triton X-100 TM .
  • the cells or cells are separated from the supernatant by a method known per se, and the supernatant is collected.
  • the peptide contained in the culture supernatant or the extract thus obtained can be purified by appropriately combining known separation / purification methods.
  • These known separation and purification methods include mainly molecular weights such as methods utilizing solubility such as salting out and solvent precipitation, dialysis, ultrafiltration, gel filtration, and SDS-polyacrylamide gel electrophoresis.
  • Method using difference in charge method using difference in charge such as ion exchange chromatography, method using specific affinity such as affinity chromatography, and difference in hydrophobicity such as reverse phase high performance liquid chromatography
  • a method using a difference in isoelectric point such as a method, isoelectric focusing method, or the like is used.
  • the peptide thus obtained when obtained in a free form, it can be converted into a salt by a method known per se or a method analogous thereto, and conversely, when obtained as a salt, a method known per se or a method analogous thereto Can be converted to the free form or other salts.
  • the peptide produced by the recombinant can be arbitrarily modified or the polypeptide can be partially removed by allowing an appropriate protein modifying enzyme to act before or after purification.
  • the protein modifying enzyme include trypsin, chymotrypsin, arginyl endopeptidase, protein kinase, glycosidase and the like.
  • the presence of the peptide of the present invention thus produced can be measured by enzyme immunoassay or Western blotting using an antibody that specifically binds to the peptide of the present invention.
  • the antibody of this invention is an antibody couple
  • the antibody of the present invention can be produced according to a method for producing an antibody or antiserum known per se, using the peptide of the present invention as an antigen.
  • Monoclonal antibodies can be produced according to a method known per se.
  • the peptide of the present invention is administered to a warm-blooded animal itself or a carrier and a diluent at a site where antibody production is possible by administration.
  • Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance antibody production ability upon administration. Administration is usually once every 2 to 6 weeks, for a total of about 2 to 10 times.
  • Examples of the warm-blooded animal used include monkeys, rabbits, dogs, guinea pigs, mice, rats, sheep, goats and chickens, and mice and rats are preferably used.
  • an individual having an antibody titer is selected from a warm-blooded animal immunized with an antigen, such as a mouse, and spleen or lymph nodes are collected 2 to 5 days after the final immunization, and antibody-producing cells contained therein are collected.
  • Monoclonal antibody-producing hybridomas can be prepared by fusing with myeloma cells from the same or different animals.
  • the antibody titer in the antiserum can be measured, for example, by reacting a labeled peptide described below with the antiserum and then measuring the activity of the labeling agent bound to the antibody.
  • the fusion operation can be carried out according to a known method, for example, the method of Kohler and Milstein [Nature, 256, 495 (1975)].
  • the fusion promoter include polyethylene glycol (PEG) and Sendai virus, and PEG is preferably used.
  • PEG polyethylene glycol
  • myeloma cells include warm-blooded animal myeloma cells such as NS-1, P3U1, SP2 / 0, AP-1, and P3U1 is preferably used.
  • the preferred ratio between the number of antibody-producing cells (spleen cells) and the number of myeloma cells used is about 1: 1 to 20: 1, and PEG (preferably PEG1000 to PEG6000) is added at a concentration of about 10 to 80%.
  • the cell fusion can be efficiently carried out by incubating at 20 to 40 ° C., preferably 30 to 37 ° C. for 1 to 10 minutes.
  • the hybridoma culture supernatant is added to a solid phase (eg, microplate) on which peptide antigens are adsorbed directly or together with a carrier, and then radioactive substances or An anti-immunoglobulin antibody labeled with an enzyme or the like (when the cell used for cell fusion is a mouse, an anti-mouse immunoglobulin antibody is used) or protein A, and a method for detecting a monoclonal antibody bound to a solid phase;
  • a method for detecting a monoclonal antibody bound to a solid phase examples include a method in which a hybridoma culture supernatant is added to a solid phase on which a globulin antibody or protein A is adsorbed, a peptide labeled with a radioactive substance or an enzyme is added, and a monoclonal antibody bound to the solid phase is detected.
  • the selection of the monoclonal antibody can be performed according to a method known per se or a method analogous thereto. Usually, it can be performed in a medium for animal cells supplemented with HAT (hypoxanthine, aminopterin, thymidine).
  • HAT hyperxanthine, aminopterin, thymidine
  • any medium may be used as long as the hybridoma can grow.
  • RPMI 1640 medium containing 1 to 20%, preferably 10 to 20% fetal calf serum, GIT medium (Wako Pure Chemical Industries, Ltd.) containing 1 to 10% fetal calf serum, or serum-free for hybridoma culture A medium (SFM-101, Nissui Pharmaceutical Co., Ltd.) or the like can be used.
  • the culture temperature is usually 20 to 40 ° C., preferably about 37 ° C.
  • the culture time is usually 5 days to 3 weeks, preferably 1 to 2 weeks. Culturing can usually be performed under 5% carbon dioxide gas.
  • the antibody titer of the hybridoma culture supernatant can be measured in the same manner as the antibody titer in the above antiserum.
  • Separation and purification of the monoclonal antibody can be performed by a method known per se, for example, an immunoglobulin separation and purification method (eg, salting out method, alcohol precipitation method, isoelectric precipitation method, electrophoresis method, ion exchanger (eg, DEAE)).
  • an immunoglobulin separation and purification method eg, salting out method, alcohol precipitation method, isoelectric precipitation method, electrophoresis method, ion exchanger (eg, DEAE)
  • an immunoglobulin separation and purification method eg, salting out method, alcohol precipitation method, isoelectric precipitation method, electrophoresis method, ion exchanger (eg, DEAE)
  • a polyclonal antibody can be produced according to a method known per se or a method analogous thereto.
  • an immune antigen peptide antigen
  • a warm-blooded animal is immunized in the same manner as in the case of the above monoclonal antibody. It can be produced by collecting the product and performing separation and purification of the antibody.
  • the type of carrier peptide and the mixing ratio of carrier and hapten are effective for antibodies against hapten immunized by cross-linking to carrier.
  • any substance may be cross-linked at any ratio.
  • bovine serum albumin, bovine thyroglobulin, hemocyanin and the like are about 0.1 to 20, preferably about 1 by weight ratio to hapten 1.
  • a method of coupling at a rate of ⁇ 6 is used.
  • various condensing agents can be used for coupling of the hapten and the carrier, but active ester reagents containing glutaraldehyde, carbodiimide, maleimide active ester, thiol group, and dithiobilidyl group are used.
  • the condensation product is administered to a warm-blooded animal by itself, together with a carrier and a diluent, at a site where antibody production is possible.
  • Complete Freund's adjuvant or incomplete Freund's adjuvant may be administered in order to enhance antibody production ability upon administration. Administration is usually about once every 2 to 6 weeks, about 3 to 10 times in total.
  • Polyclonal antibodies can be collected from blood, ascites, etc., preferably from blood of warm-blooded animals immunized by the above method.
  • the polyclonal antibody titer in the antiserum can be measured in the same manner as the above-described measurement of the antibody titer in the antiserum. Separation and purification of the polyclonal antibody can be performed according to the same immunoglobulin separation and purification method as in the case of the monoclonal antibody described above.
  • a cell producing the polypeptide of the present invention or its partial peptide is used.
  • Such cells include, for example, cells originally having the polypeptide of the present invention or a partial peptide thereof (preferably animal cells), or a vector containing a DNA encoding the polypeptide of the present invention or a partial peptide thereof.
  • a transformed host (transformant) or the like is used.
  • mammalian cells such as brown adipocytes, white adipocytes, hepatocytes, myoblasts, visceral adipocytes, kidney tubules, macrophages, dendritic cells, cardiomyocytes are preferably used.
  • mammalian cells such as brown adipocytes, white adipocytes, hepatocytes, myoblasts, visceral adipocytes, kidney tubules, macrophages, dendritic cells, cardiomyocytes are preferably used.
  • Other cell lines can also be used.
  • test target substances to be screened include peptides, proteins, antibodies, non-peptidic compounds, and synthetic compounds. , Fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like. Whether or not a test compound affects the amount of intracellular triglyceride accumulated can be confirmed, for example, by measuring the amount of intracellular triglyceride accumulated when cells (eg, adipocytes) are cultured in the presence of the test compound. Can be evaluated. For example, the ability of a test compound to change intracellular triglyceride accumulation can be evaluated according to the method described in Example 2 below.
  • the polypeptide of the present invention is involved in fatty acid ⁇ -oxidation through phosphatase activity. By inhibiting this phosphatase activity, intracellular fatty acid ⁇ oxidation can be promoted.
  • the fatty acid ⁇ -oxidation activity of a test compound can be evaluated, for example, by culturing cells (for example, brown adipocytes) in the presence of the test compound and measuring the intracellular fatty acid ⁇ -oxidation activity.
  • the ability of the test compound to change intracellular fatty acid ⁇ -oxidation activity can be evaluated according to the measurement method described in Example 7 described later. It can also be evaluated by measuring the amount of ATP produced by oxidative phosphorylation accompanying the increase in fatty acid ⁇ oxidation in cells, or by increasing the oxygen consumption rate.
  • examples of the active ingredient of the preventive / therapeutic agent for IMPA2-related peripheral diseases include substances that promote or inhibit the activity of IMPA2, and substances that promote or inhibit the expression of IMPA2.
  • a substance that inhibits the activity or expression of IMPA2 (sometimes abbreviated as “IMPA2 inhibitor” in the present specification) is desirable.
  • a test compound that promotes or inhibits the phosphatase activity, intracellular triglyceride accumulation effect or fatty acid ⁇ -oxidation effect possessed by the polypeptide of the present invention preferably IMPA2
  • the test compound obtainable by the screening method of the present invention is useful as a low-toxic preventive or therapeutic agent for the above-mentioned IMPA2-related peripheral diseases (particularly obesity).
  • the compound that suppresses the IMPA2 activity obtained by the screening method of the present invention has a phosphatase inhibitory activity, an intracellular triglyceride accumulation lowering action or a fatty acid ⁇ oxidation promoting action
  • the prophylactic agent for the above-mentioned IMPA2-related peripheral diseases -It is useful as a therapeutic agent.
  • a test compound that promotes or inhibits the effect of regulating the mitochondrial activity or mitochondrial amount possessed by the polypeptide of the present invention, IMPA2 can be obtained. Due to these actions, the compound obtainable by the screening method of the present invention is useful as a low-toxic prophylactic or therapeutic agent for the above-mentioned IMPA2-related peripheral diseases. For example, those skilled in the art can measure the amount of intracellular mitochondrion as described in Example 5 or 6 of the present specification.
  • the compound that suppresses the IMPA2 activity obtained by the screening method of the present invention is useful as a prophylactic or therapeutic agent for the above-mentioned IMPA2-related peripheral diseases due to its action to suppress mitochondrial activity or to reduce the amount of mitochondria.
  • the compound that promotes the IMPA2 activity obtained by the screening method of the present invention is useful as a fat differentiation promoter by, for example, an intracellular triglyceride accumulation promoting action, a mitochondrial activity promoting action, or a mitochondrial amount increasing action.
  • Examples of the substrate used for measuring the activity of the polypeptide of the present invention include 6-phosphogluconic acid having a high substrate specificity for IMPA2, and the above-mentioned analogs of 6-phosphogluconic acid. Of these, 6-phosphogluconic acid is preferable.
  • the screening method of the present invention makes it possible to more efficiently screen for an IMPA2 inhibitor, preferably an IMPA2 inhibitor that specifically inhibits IMPA2, by using 6-phosphogluconic acid or a similar compound of 6-phosphogluconic acid. It shall be Moreover, the screening method of the present invention can make screening for an IMPA2 inhibitor that specifically inhibits IMPA2 more efficient by using IMPA1 as a control.
  • phosphatase activity by IMPA2 and IMPA1 for example, human IMPA1 described in WO 2006/079792 (amino acid sequence: NP — 005527.1, GI: 5031789)
  • a test solution using 6-phosphogluconic acid I
  • the phosphatase activity of the polypeptide of the present invention can be measured by the above-mentioned known methods.
  • Such test compounds can include, for example, analogs of substrates that are highly specific for IMPA2.
  • a substrate having high specificity for IMPA2 is preferably dephosphorylated by IMPA2.
  • An example of a substrate having high specificity for IMPA2 is 6-phosphogluconic acid.
  • the polypeptide of the present invention or a partial peptide thereof or a salt thereof can be obtained by a known method, for example, using the antibody of the present invention, the polypeptide present in a cell extract or the like by Western analysis, ELISA method, particularly sandwich immunization. It can be quantified with high sensitivity according to a method such as a measurement method or a method analogous thereto.
  • one antibody is an antibody that recognizes the N-terminal part of the polypeptide of the present invention or a partial peptide thereof, and the other antibody is the C-terminal part of the polypeptide of the present invention or its partial peptide It is desirable that the antibody be reactive with.
  • the polypeptide of the present invention can be quantified using a monoclonal antibody against the polypeptide of the present invention or a partial peptide thereof (hereinafter sometimes referred to as the monoclonal antibody of the present invention). Polypeptide detection can also be performed.
  • the antibody molecule itself may be used, or F (ab ′) 2 , Fab ′ or Fab fraction of the antibody molecule may be used.
  • the method for quantifying the polypeptide of the present invention using the antibody of the present invention is not particularly limited, and an antibody, antigen or antibody-antigen complex corresponding to the amount of antigen (eg, amount of polypeptide) in the solution to be measured.
  • Any measurement method may be used as long as it is a measurement method in which the amount of the body is detected by a chemical or physical means and calculated from a standard curve prepared using a standard solution containing a known amount of antigen.
  • nephrometry, competition method, immunometric method and sandwich method are preferably used, but the sandwich method described later is particularly preferable in view of sensitivity and specificity.
  • Examples of the labeling agent used for labeling the polypeptide of the present invention or a partial peptide thereof and the antibody of the present invention include radioisotopes (eg, [ 125 I], [ 131 I], [ 3 H], [ 14 C], [ 32 P], [ 33 P], [ 35 S], etc.), fluorescent substance [eg, cyanine fluorescent dye (eg, Cy2, Cy3, Cy5, Cy5.5, Cy7 (made by Amersham Biosciences), etc.) ), Fluorescamine, fluorescein isothiocyanate, NBD (7-nitrobenz-2-oxa-1,3-diazol), etc.], enzymes (eg, ⁇ -galactosidase, ⁇ -glucosidase, alkaline phosphatase, peroxidase, malic acid) Dehydrogenase, etc.), luminescent substances (eg, luminol, luminol derivatives, luciferin, lucigenin, etc.), biotin, lanthanide
  • insolubilization of an antigen or antibody physical adsorption may be used, or a method using a chemical bond usually used to insolubilize or immobilize a polypeptide or an enzyme may be used.
  • the carrier include insoluble polysaccharides such as agarose, dextran, and cellulose, synthetic resins such as polystyrene, polyacrylamide, and silicon, or glass.
  • the test solution is reacted with the insolubilized monoclonal antibody of the present invention (primary reaction), and further labeled with another monoclonal antibody of the present invention (secondary reaction), and then on the insolubilized carrier.
  • the polypeptide of the present invention in the test solution can be quantified.
  • the primary reaction and the secondary reaction may be performed in the reverse order, or may be performed simultaneously or at different times.
  • the labeling agent and the insolubilization method can be the same as those described above.
  • the antibody used for the solid phase antibody or the labeling antibody is not necessarily one type, and two or more types are used for the purpose of improving measurement sensitivity. A mixture of antibodies may be used.
  • the monoclonal antibody of the present invention used for the primary reaction and the secondary reaction is preferably an antibody having a different site to which the polypeptide of the present invention or its partial peptide binds.
  • the antibody used in the secondary reaction recognizes the C-terminal part of the polypeptide of the present invention or a partial peptide thereof
  • the antibody used in the primary reaction preferably has a non-C-terminal part, for example, an N-terminal part. Recognizing antibody.
  • the monoclonal antibody of the present invention can be used for measurement methods other than the sandwich method, for example, competition method, immunometric method, nephrometry and the like.
  • competition method the antigen in the test solution and the labeled antigen are reacted competitively with the antibody, and then the unreacted labeled antigen (F) and the labeled antigen (B) bound to the antibody are separated. (B / F separation), the labeling amount of either B or F is measured, and the amount of antigen in the test solution is quantified.
  • a soluble antibody is used as an antibody
  • B / F separation is performed using polyethylene glycol
  • a liquid phase method using a second antibody against the antibody and a solid-phased antibody is used as the first antibody
  • a soluble method is used, and a solid phase method using a solid phase antibody as the second antibody is used.
  • the antigen in the test solution and the immobilized antigen are competitively reacted with a certain amount of labeled antibody, and then the solid phase and the liquid phase are separated, or After reacting the antigen with an excess amount of labeled antibody, and then adding a solid-phased antigen to bind unreacted labeled antibody to the solid phase, the solid phase and the liquid phase are separated. Next, the amount of label in any phase is measured to quantify the amount of antigen in the test solution.
  • nephrometry the amount of insoluble precipitate produced as a result of antigen-antibody reaction in a gel or solution is measured. Laser nephrometry using laser scattering is preferably used even when the amount of antigen in the test solution is small and only a small amount of precipitate is obtained.
  • the polypeptide of the present invention can be quantified with high sensitivity by using the antibody of the present invention.
  • the screening method of [1] above [1] A polypeptide comprising the same or substantially the same amino acid sequence as shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11, or a partial peptide thereof, or a salt thereof, or the polypeptide or a peptide thereof
  • Examples of the screening method for a prophylactic / therapeutic agent for IMPA2-related peripheral diseases characterized by using cells that produce partial peptides include the following screening methods [1a] to [1d].
  • [1a] The phosphatase activity of a polypeptide comprising the amino acid sequence identical or substantially identical to the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9, or 11 or a partial peptide thereof or a salt thereof (i) (1) The screening method according to [1], comprising measuring in the presence of the test compound and (ii) in the absence of the test compound, and comparing (i) and (ii). [1b] Measuring the amount of triglyceride accumulation or fatty acid ⁇ -oxidation activity in the cells (i) in the presence of the test compound and (ii) in the absence of the test compound, and comparing (i) and (ii) The screening method according to [1].
  • the screening method according to [1] comprising measuring at least one item in (i) administration of a test compound and (ii) non-administration of a test compound, and comparing (i) and (ii) .
  • the phosphatase activity of the polypeptide of the present invention or a partial peptide thereof or a salt thereof can be determined by a known method, for example, the measurement method described in Example 4 or 9 described later, Non-Patent Document 1 (Cryns, K. et al. , Neuropsycho-pharmacology 32, 881-891, 2007), Patent Document 2 (International Publication No. 2006/079792 pamphlet) or a method analogous thereto.
  • the phosphatase activity of the polypeptide of the present invention or a partial peptide thereof or a salt thereof in the presence of a test compound is determined in the presence of (i) the test compound and (ii) the absence of the test compound.
  • a compound that significantly lowers the cases of (i) and (ii) can be selected, preferably about 20% or more, about 30% or more, more preferably about 50% or more, More preferably, a compound that decreases about 60% or more can be selected as an agent for preventing / treating IMPA2-related peripheral diseases.
  • the amount of the polypeptide of the present invention or a partial peptide thereof or a salt thereof can be determined by a known method, for example, Western blotting analysis or enzyme immunoassay method for the polypeptide present in a cell extract using the antibody of the present invention. It can measure according to the method of following or the method according to it.
  • the polypeptide of the present invention or a partial peptide thereof or a salt thereof used in the screening method of the present invention is involved in, for example, intracellular triglyceride accumulation action through phosphatase activity. By inhibiting this phosphatase activity, the amount of intracellular triglyceride accumulation can be reduced.
  • the amount of intracellular triglyceride accumulated in a test compound can be evaluated, for example, by measuring the amount of intracellular triglyceride accumulated when cells (for example, differentiated adipocytes) are cultured in the presence of the test compound. For example, the ability of the test compound to change the amount of intracellular triglyceride accumulation can be evaluated according to the measurement method described in Example 2 described later.
  • the polypeptide of the present invention or a partial peptide thereof or a salt thereof is involved in, for example, fatty acid ⁇ oxidation through phosphatase activity. By inhibiting this phosphatase activity, intracellular fatty acid ⁇ oxidation can be promoted.
  • the fatty acid ⁇ -oxidation activity of the test compound can be determined, for example, by culturing cells (for example, brown adipocytes) that produce the polypeptide of the present invention or a partial peptide thereof, It can be evaluated by measuring in the presence and (ii) in the absence of the test compound and comparing these measurements. For example, the ability of the test compound to change intracellular fatty acid ⁇ -oxidation activity can be evaluated according to the measurement method described in Example 7 described later.
  • test compounds that can be significantly reduced can be selected, preferably test compounds that reduce about 20% or more, about 30% or more, more preferably about 50% or more, and even more preferably about 60% or more of the present invention. It can be selected as a prophylactic / therapeutic agent for IMPA2-related peripheral diseases.
  • intracellular fatty acid ⁇ -oxidation activity is measured in the presence of (i) the test compound and (ii) in the absence of the test compound, and the cases of (i) and (ii) Test compounds that can be significantly elevated relative to each other can be selected, and preferably test compounds that promote about 20% or more, about 30% or more, more preferably about 50% or more, and even more preferably about 60% or more, It can be selected as a prophylactic / therapeutic agent for IMPA2-related peripheral diseases.
  • the expression level of the polypeptide of the present invention or a partial peptide thereof correlates with intracellular mitochondrial metabolic activity or mitochondrial level. Therefore, a prophylactic / therapeutic agent for IMPA2-related peripheral diseases can also be screened by measuring and comparing intracellular mitochondrial metabolic activity or mitochondrial amount in the presence and absence of a test compound.
  • a method for measuring intracellular mitochondrial metabolic activity a known method, for example, Methods in Cell Biology (Volume 80 , Mitochondrai 2 nd edition) is described, the activity of the respiratory chain complexes, ATP, lactic, pyruvic acid production And methods for measuring the amount, enzyme activity of the TCA cycle, oxygen consumption, and the like.
  • intracellular mitochondrial metabolic activity or mitochondrial amount is measured in the presence of (i) the presence of the test compound and (ii) in the absence of the test compound, and (i) and ( A test compound can be selected that significantly increases compared to ii), preferably about 20% or more, about 30% or more, more preferably about 50% or more, even more preferably about 60% or more.
  • the test compound to be reduced can be selected as a prophylactic / therapeutic agent for IMPA2-related peripheral diseases.
  • a test compound is administered to a test animal (mouse, rat, rabbit, dog, pig, monkey, etc.) having cells producing the polypeptide of the present invention or a partial peptide thereof, At least one item selected from the group consisting of triglyceride accumulation amount, body fat amount, blood glucose level, blood lipid level, blood cholesterol level, systemic energy consumption, oxygen consumption, respiratory quotient and blood pressure in the subject animal Can be screened for prophylactic / therapeutic agents for IMPA2-related peripheral diseases.
  • test compound as a prophylactic / therapeutic agent for a disease involving the above-mentioned intracellular triglyceride accumulation amount or a disease involving intracellular mitochondrial activity
  • test compound a test compound
  • a non-administered group or a placebo-administered group can be evaluated by measuring the severity of each disease.
  • Standards known in the art can be used for the severity of each of the above-mentioned diseases and the evaluation method thereof.
  • the systemic energy consumption or oxygen consumption of (i) the test compound administration group and (ii) the test compound non-administration group or placebo administration group is measured,
  • a test compound that significantly increases the i) and (ii) groups can be selected as a prophylactic / therapeutic agent for IMPA2-related peripheral diseases.
  • the amount of triglyceride accumulated, body fat mass, blood glucose level, blood lipid level, blood of (i) test compound administration group and (ii) non-test compound administration group or placebo administration group Test compounds that measure medium cholesterol level, respiratory quotient or blood pressure and significantly lower (i) and (ii) groups can be selected as prophylactic / therapeutic agents for IMPA2-related peripheral diseases .
  • Test compounds that measure medium cholesterol level, respiratory quotient or blood pressure and significantly lower (i) and (ii) groups can be selected as prophylactic / therapeutic agents for IMPA2-related peripheral diseases .
  • a method for administering the test compound to the test animal for example, oral administration, intravenous injection and the like are used, and can be appropriately selected according to the symptoms of the test animal, the properties of the test compound, and the like.
  • the dosage of the test compound can be appropriately selected according to the administration method, the properties of the test compound, and the like.
  • the amount of triglyceride accumulated is determined by measuring the triglyceride concentration in serum with various reagent kits and clinical test kits (for example, Wako Pure Chemicals, “L-type Wako TG / M”, etc.). This can be evaluated.
  • the body fat mass can be measured using, for example, a body fat scale.
  • the blood glucose level can be measured by a dedicated medical blood glucose level measuring device, a blood glucose level measuring kit (for example, glucose CII-Test Wako reagent, etc.) and the like.
  • the blood lipid level and blood cholesterol level can be measured according to a known method, for example, using a commercially available measurement kit.
  • the whole-body energy consumption is measured by, for example, a direct method in which the amount of generated heat is directly measured using water or the like, or an indirect method in which the amount of heat is indirectly estimated from the amount of oxygen consumed in the body.
  • the oxygen consumption is measured, for example, by analysis of exhaled gas.
  • the respiratory quotient is derived, for example, by measuring oxygen consumption and carbon dioxide output by exhaled gas analysis, and the main energy source is one of caloric sources such as carbohydrates, lipids, and polypeptides. Can be estimated indirectly.
  • the blood pressure is measured using, for example, a sphygmomanometer.
  • the present invention also provides the following screening method [5].
  • [5] Non-human mammal deficient in the expression of a polynucleotide, wherein a polynucleotide comprising a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12 is inactivated
  • a method for screening for an agent for promoting fat differentiation characterized in that A polynucleotide comprising the same or substantially the same base sequence as shown in SEQ ID NO: 4, 6, 8, 10 or 12 (in this specification, it may be abbreviated as the non-human polynucleotide of the present invention) ) Is inactivated, and the non-human mammal incapable of expressing the polynucleotide (in the present specification, may be abbreviated as a non-human mammal deficient in the expression of the polynucleotide of the present invention) according to a method known per se For example, introducing a mutation into
  • the non-human polynucleotide of the present invention includes (a) a polynucleotide (preferably DNA) encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 3, 5, 7, 9 or 11, or (b) A polynucleotide (preferably DNA) containing the base sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12 is preferred, and (c) the amino acid sequence represented by SEQ ID NO: 3, 5, 7, 9 or 11 More preferred is a polynucleotide (preferably DNA) encoding a polypeptide consisting of: (d) a polynucleotide comprising the base sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12 (preferably DNA) .
  • polynucleotide containing the nucleotide sequence substantially the same as the nucleotide sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12 include the nucleotide sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12.
  • a polynucleotide preferably DNA. Specifically, it is about 60% or more, about 70% or more, about 80% or more, about 90% or more, about 95% or more, about 99 with the base sequence represented by SEQ ID NO: 4, 6, 8, 10 or 12.
  • a polynucleotide preferably DNA
  • a polynucleotide preferably DNA
  • examples of the non-human mammal used for producing the non-human mammal deficient in polynucleotide expression of the present invention include mouse, rat, guinea pig, hamster, cow, pig, sheep, goat, rabbit, dog and cat. .
  • rodents, especially mice for example, C57BL / 6 strain, DBA2 strain, etc. as pure strains, etc.
  • mice for example, C57BL / 6 strain, DBA2 strain, etc. as pure strains, etc.
  • test compound examples include peptides, proteins, antibodies, non-peptide compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like.
  • the non-human mammal deficient in polynucleotide expression of the present invention can be used for screening for an agent for promoting fat differentiation.
  • the test compound is administered to the non-human mammal deficient in polynucleotide expression of the present invention (the administration method can be appropriately selected according to the symptom of the test animal, the nature of the test compound, etc. , Oral administration, intravenous injection, intramuscular injection, etc.) and observing / measuring changes in the animals (for example, treating the animals with untreated control animals and changes in the symptoms of each organ, tissue, disease, etc.) By comparison), it is possible to screen a fat differentiation promoter.
  • Evaluation as a fat differentiation promoter is, for example, fat compared with a control cell or subject in a cell or an individual that does not express the polypeptide of the present invention or a partial peptide thereof when the test compound of the above screening method is used. It can be evaluated based on the accumulation promoting action, blood glucose level, blood lipid level and / or blood cholesterol level change.
  • the compound obtained by such a method can be obtained by, for example, triglyceride accumulation, body fat mass, blood glucose level, blood lipid level, blood cholesterol level, systemic cholesterol, as described in the above [1d] method for test animals.
  • the ability to change energy consumption, oxygen consumption, respiratory quotient and blood pressure can be evaluated.
  • a fat differentiation promoter increases normal small fat cells and decreases hypertrophic fat cells by promoting differentiation from enlarged fat cells to fat cells. Therefore, it is considered to have a prophylactic / therapeutic effect on lifestyle-related diseases such as diabetes, hyperlipidemia, hypertension, obesity, immune abnormalities, cancer and the like caused by an increase in enlarged fat cells.
  • the present invention also provides the following screening method [6].
  • An exogenous polynucleotide comprising a nucleotide sequence identical or substantially identical to the nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12 (in the present specification, the foreign molecule of the present invention) IMPA2-related peripheral disease, characterized by using a non-human transgenic animal (sometimes abbreviated as a polynucleotide-transferred animal of the present invention) having a non-human transgenic animal having a Screening method for prophylactic / therapeutic agents.
  • the polynucleotide-transferred animal of the present invention can be produced according to a method for producing a non-human transgenic animal known per se.
  • the exogenous polynucleotide of the present invention can be obtained by subjecting an unfertilized egg, a fertilized egg, a sperm, and a starting material thereof by the calcium phosphate method, electric pulse method, lipofection method, aggregation method, microinjection method, particle gun method, DEAE-dextran method, etc.
  • Produced by metastasis preferably to embryonic cells containing cells, preferably at the stage of embryonic development in non-human mammal development (more preferably at the single cell or fertilized egg cell stage and generally prior to the 8-cell stage). can do.
  • the exogenous polynucleotide of the present invention is not a polynucleotide originally possessed by a non-human mammal, but a polynucleotide once isolated and extracted from a mammal.
  • the exogenous polynucleotide of the present invention includes (a) a polynucleotide (preferably DNA) encoding a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11, or ( b) A polynucleotide (preferably DNA) comprising the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10 or 12 is preferred, and (c) SEQ ID NO: 1, 3, 5, 7, 9 or A polynucleotide (preferably DNA) encoding a polypeptide consisting of the amino acid sequence shown by 11 or (d) a polynucleotide consisting of the base sequence shown by SEQ ID NO: 2, 4, 6, 8, 10 or 12 ( Preferably, DNA is more preferable.
  • polynucleotide comprising a nucleotide sequence substantially identical to the nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12
  • the polynucleotide represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12 is used.
  • a nucleotide sequence that hybridizes under high stringency conditions with a nucleotide sequence that is substantially the same as a polypeptide comprising the amino acid sequence represented by SEQ ID NO: 1, 3, 5, 7, 9 or 11 And a polynucleotide (preferably, DNA) encoding a polypeptide having the above.
  • the exogenous polynucleotide of the present invention to be transferred in the polynucleotide-transferred animal of the present invention may be derived from a mammal of the same species as that of the transferred animal or from a heterologous mammal.
  • the polynucleotide-transferred animal of the present invention is produced using a non-human mammal.
  • the non-human mammal to be used is a non-human non-human expression of the polynucleotide of the present invention described in the above screening method [5].
  • the thing similar to what was used with the mammal is mentioned. Examples of the test compound include the same compounds as those described in the above screening method [5].
  • the polynucleotide-transferred animal of the present invention When the polynucleotide-transferred animal of the present invention highly expresses IMPA2, the transferred animal is considered to develop IMPA2 hyperfunction. In that case, the polynucleotide-transferred animal of the present invention can be used as a disease state model animal for an IMPA2-related peripheral disease caused by the enhanced function of IMPA2. Therefore, the polynucleotide-transferred animal of the present invention can be used for screening for preventive / therapeutic agents for IMPA2-related peripheral diseases (particularly obesity). In addition, using the polynucleotide-transferred animal of the present invention, it is also possible to elucidate the pathologic mechanism of IMPA2-related peripheral diseases and to examine methods for treating these diseases.
  • test compound can be administered to the polynucleotide-transferred animal of the present invention, and the prophylactic / therapeutic agent for IMPA2-related peripheral diseases can be screened by observing and measuring changes in the animal.
  • Test compounds selected by such screening can improve the pathology of IMPA2-related peripheral diseases resulting from hyperactivity of IMPA2.
  • an organ, tissue or cell collected from the polynucleotide-transferred animal of the present invention can be used.
  • the present invention also provides the following screening method [8].
  • a polypeptide comprising the same or substantially the same amino acid sequence as shown in SEQ ID NO: 1, 3, 5, 7, 9 or 11, or a partial peptide thereof, or a salt thereof, or the polypeptide or a thereof
  • a method for screening an IMPA2 inhibitor comprising using a cell that produces a partial peptide, and 6-phosphogluconic acid or a similar compound thereof.
  • the screening method [8] can be carried out in the same manner as described in the screening method of the present invention.
  • a prophylactic / therapeutic agent for IMPA2-related peripheral diseases comprising an IMPA2 inhibitor.
  • the prophylactic / therapeutic agent of the present invention is desirably an IMPA2 inhibitor obtained by the screening method of the present invention described above.
  • Examples of the IMPA2 inhibitor obtained from the screening method of the present invention include peptides, proteins, polypeptides, non-peptidic compounds, synthetic compounds, fermentation products, cell extracts, plant extracts, animal tissue extracts, plasma and the like. These compounds may be novel compounds or known compounds.
  • the IMPA2 inhibitor may form a salt, and examples of such a salt include those exemplified as the salt of the polynucleotide of the present invention or a partial peptide thereof.
  • the IMPA2 inhibitor include the following (a) to (e).
  • siRNA is more preferable. The above (a) to (e) will be described in detail below.
  • the compound that binds to the polypeptide of the present invention and inhibits the phosphatase activity of the polypeptide of the present invention includes a compound that binds to IMPA2 obtained by the screening method of the present invention and directly inhibits the activity of IMPA2.
  • Known compounds that bind to IMPA2 and directly inhibit the activity of IMPA2 include lithium or a salt thereof.
  • examples of the lithium salt include lithium carbonate and lithium citrate.
  • the IMPA2 inhibitor preferably used in the present invention is an inhibitor specific to IMPA2. For example, in Example 4 of this specification, 6-phosphogluconic acid is described as a substrate having high specificity for IMPA2.
  • This 6-phosphogluconic acid or its related compounds can be used to screen for IMPA2 inhibitors.
  • an inhibitor specific for IMPA2 can be isolated by using IMPA1 or the like as a control.
  • a novel compound can be designed using a known drug design technique. As such a technique, for example, Japanese Patent No. 3256307, Japanese Patent No. 3669704, Japanese Patent No. 3747048, and the like can be referred to.
  • a compound having advantages such as fewer side effects can be designed.
  • These designed compounds are evaluated by the screening method of the present invention for their ability to accumulate intracellular glycerol, regulate intracellular mitochondrial activity, etc., as well as the degree of specificity of the target polypeptide. be able to.
  • Neutralizing antibody against the polypeptide of the present invention includes, for example, an antibody that binds to the polypeptide of the present invention and neutralizes phosphatase activity.
  • (C) Compound that inhibits the expression of the polypeptide of the present invention includes, for example, an intracellular signal transduction mechanism and an intracellular transport mechanism obtained in the screening method of the present invention. Examples include compounds that inhibit the expression of IMPA2 by inhibiting intracellular expression of IMPA2 via, for example.
  • the compound that inhibits the expression of the polypeptide of the present invention is preferably a compound that inhibits the expression of the gene encoding the polypeptide of the present invention.
  • Examples of the method for evaluating the expression level of IMPA2 include the above-described method for quantifying the polypeptide of the present invention, a method for measuring the mRNA level of IMPA2, and a method for measuring the activity level of IMPA2.
  • the amount of mRNA of IMPA2 is measured by a known method, for example, Northern hybridization using a nucleic acid containing SEQ ID NO: 2, 4, 6, 8, 10, 12 or a part thereof as a probe, or SEQ ID NO: as a primer. : Measured according to a quantitative PCR method using a nucleic acid containing 2, 4, 6, 8, 10, 12, or a part thereof, or a method analogous thereto.
  • the expression level of the polypeptide of the present invention is measured in the presence of (i) the test compound and (ii) in the absence, and (i) and (ii) are compared to about 20% or more, preferably 30 %, More preferably about 50%, even more preferably about 60% or more of the test compound that inhibits the expression can be selected as a compound that inhibits the expression of the polypeptide of the present invention.
  • An antisense polynucleotide for a polynucleotide encoding the polypeptide of the present invention A base sequence complementary to or substantially complementary to the base sequence of the polynucleotide (preferably DNA) of the present invention or a part thereof
  • the antisense polynucleotide having (sometimes abbreviated as the antisense polynucleotide of the present invention in the present specification) is a base sequence complementary to or substantially complementary to the base sequence of the polynucleotide of the present invention
  • any antisense polynucleotide may be used as long as it has a part and has an action capable of suppressing the expression of the polynucleotide, but antisense DNA is preferred.
  • the base sequence substantially complementary to the base sequence of the polynucleotide of the present invention is, for example, all bases of the base sequence complementary to the base sequence of the polynucleotide of the present invention (for example, the complementary strand of the DNA of the present invention). About 70% or more, about 80% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more homology or identity with a sequence or partial base sequence And a nucleotide sequence having the property.
  • the base sequence of the portion encoding the N-terminal site of the polypeptide of the present invention for example, about 70% or more, about 80% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99%
  • the antisense polynucleotide having the above homology or identity is (ii) an antisense polynucleotide directed to RNA degradation by RNase H
  • the antisense polynucleotide has about 70% of the complementary strand of the entire base sequence of the DNA of the present invention including introns.
  • % Or more about 80% or more, about 90% or more, about 95% or more, about 96% or more, about 97% or more, about 98% or more, or about 99% or more of an antisense polynucleotide having homology or identity Each suitable That.
  • a base sequence complementary to or substantially complementary to the base sequence of a polynucleotide containing the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10 or 12, or a part thereof An antisense polynucleotide having a nucleotide sequence, preferably having a nucleotide sequence complementary to the nucleotide sequence of a polynucleotide containing the nucleotide sequence represented by SEQ ID NO: 2, 4, 6, 8, 10, or 12, or a part thereof, for example Antisense polynucleotide (more preferably, an antisense polynucleotide having a base sequence complementary to the base sequence of DNA containing the base sequence represented by SEQ ID NO: 2, 4, 6, 8, 10 or 12 or a part thereof.
  • the antisense polynucleotide is usually composed of about 10 to 40 bases, preferably about 15 to 30 bases.
  • the phosphate residue (phosphate) of each nucleotide constituting the antisense polynucleotide is a chemically modified phosphate residue such as phosphorothioate, methylphosphonate, phosphorodithionate, etc. May be substituted.
  • the sugar (deoxyribose) of each nucleotide may be substituted with a chemically modified sugar structure such as 2′-O-methylation, and the base part (pyrimidine, purine) is also chemically modified. As long as it hybridizes to DNA containing the base sequence represented by SEQ ID NO: 2, 6, 8, 10 or 12, any of them may be used.
  • These antisense polynucleotides can be produced using a known DNA synthesizer.
  • An antisense polynucleotide (nucleic acid) corresponding to the gene capable of inhibiting replication or expression of the gene encoding the polypeptide of the present invention is a cloned or determined DNA sequence encoding the polypeptide Design and synthesize based on information.
  • Such an antisense polynucleotide can hybridize with RNA of a gene encoding the polypeptide of the present invention, and can inhibit the synthesis or function of the RNA.
  • the above-described antisense polynucleotide is useful for regulating / controlling the expression of a gene encoding the polypeptide of the present invention in vivo and in vitro, and also useful for treatment or diagnosis of diseases.
  • corresponding means homologous to or complementary to a specific sequence of nucleotides, base sequences or nucleic acids including genes.
  • Corresponding between a nucleotide, base sequence or nucleic acid and polypeptide usually refers to the amino acid of the polypeptide (instruction) derived from the nucleotide (nucleic acid) sequence or its complement.
  • 5 'end hairpin loop of gene encoding polypeptide 5' end 6-base pair repeat, 5 'end untranslated region, polypeptide translation initiation codon, polypeptide coding region, ORF translation stop codon, 3' end non A translation region, 3′-end palindromic region, 3′-end hairpin loop, or the like can be selected as a preferred target region, but any region in a gene encoding a polypeptide can be selected as a target.
  • the target nucleic acid and a polynucleotide complementary to at least a part of the target region if the target nucleic acid can hybridize to the target region, the target nucleic acid It can be said that it is “antisense”.
  • Antisense polynucleotides include polynucleotides containing 2-deoxy-D-ribose, polynucleotides containing D-ribose, other types of polynucleotides that are N-glycosides of purine or pyrimidine bases, non-polynucleotides, Other polymers with a nucleotide backbone (eg, commercially available polypeptide nucleic acids and synthetic sequence-specific nucleic acid polymers) or other polymers containing special linkages, provided that the polymer is a base as found in DNA or RNA And a nucleotide having a configuration that allows attachment of a base).
  • They may be double-stranded DNA, single-stranded DNA, double-stranded RNA, single-stranded RNA, DNA: RNA hybrids, unmodified polynucleotides (or unmodified oligonucleotides), known modifications Additions, such as those with labels known in the art, capped, methylated, one or more natural nucleotides replaced with analogs, intramolecular nucleotide modifications Such as those having uncharged bonds (eg methylphosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged bonds or sulfur-containing bonds (eg phosphorothioates, phosphorodithioates, etc.) Such as polypeptides (eg, nucleases, nuclease inhibitors, toxins, antibodies, One having a side chain group such as a guanal peptide, poly-L-lysine, etc., sugar (eg, monosaccharide, etc.), one having an intercurrent compound
  • nucleoside may include not only purine and pyrimidine bases but also those having other modified heterocyclic bases. Such modifications may include methylated purines and pyrimidines, acylated purines and pyrimidines, or other heterocycles. Modified nucleotides and modified nucleotides may also be modified at the sugar moiety, eg, one or more hydroxyl groups are replaced by halogens or aliphatic groups, or converted to functional groups such as ethers, amines, etc. May have been.
  • the antisense polynucleotide of the present invention is RNA, DNA or a modified nucleic acid (RNA, DNA).
  • modified nucleic acids include nucleic acid sulfur derivatives, thiophosphate derivatives, polynucleoside amides and oligonucleoside amides that are resistant to degradation.
  • the antisense polynucleotide of the present invention can be designed, for example, as follows. That is, to make the antisense polynucleotide in the cell more stable, to increase the cell permeability of the antisense polynucleotide, to increase the affinity for the target sense strand, and to reduce the toxicity In some cases, the antisense polynucleotide is less toxic.
  • the antisense polynucleotide of the present invention may be altered and may contain modified sugars, bases and bonds, and may be provided in special forms such as liposomes, microspheres, or by gene therapy. It can be applied or given in an added form.
  • the additional form can be used as a polycationic substance such as polylysine that works to neutralize the charge of the phosphate group skeleton, a lipid that enhances the interaction with the cell membrane or increases the uptake of nucleic acid ( Examples include hydrophobic ones such as phospholipid and cholesterol.
  • Preferred lipids for addition include cholesterol and derivatives thereof (eg, cholesteryl chloroformate, cholic acid, etc.). These can be attached to the 3 ′ end or 5 ′ end of the nucleic acid, and can be attached via a base, sugar, intramolecular nucleoside bond.
  • the other group include a cap group specifically arranged at the 3 ′ end or 5 ′ end of a nucleic acid and for preventing degradation by a nuclease such as exonuclease or RNase.
  • capping groups include, but are not limited to, hydroxyl protecting groups known in the art, including glycols such as polyethylene glycol and tetraethylene glycol.
  • Double-stranded RNA containing a part of the RNA encoding the polypeptide of the present invention is publicly known. In accordance with the method (eg, Nature, 411, 494, 2001), it can be designed and produced based on the sequence of the polynucleotide of the present invention.
  • IMPA2 inhibitors are safe and have low toxicity
  • mammals eg, humans, rats, mice, guinea pigs, rabbits, sheep, pigs, cows, horses, cats
  • IMPA2-related peripheral diseases e.g., Dogs, monkeys, etc .; humans are preferred
  • IMPA2 inhibitors are useful for the prevention and / or treatment of IMPA2-related peripheral diseases such as obesity. It is also useful for the prevention and / or treatment of IMPA2-related central diseases (eg, neurodegenerative diseases, schizophrenia).
  • the dose of the IMPA2 inhibitor varies depending on its action, target disease, administration subject, administration route, etc., but when an IMPA2 inhibitor is orally administered for the purpose of treating obesity or the like, generally an adult (with a body weight of 60 kg) In this case, about 0.1 to 100 mg, preferably about 1.0 to 50 mg, more preferably about 1.0 to 20 mg of IMPA2 inhibitor is administered per day.
  • the single dose of the IMPA2 inhibitor varies depending on the administration subject, the target disease, etc.
  • the IMPA2 inhibitor is usually administered in the form of an injection for the purpose of treating obesity or the like.
  • IMPA2 inhibitor When administered (with a body weight of 60 kg), about 0.01 to 30 mg, preferably about 0.1 to 20 mg, more preferably about 0.1 to 10 mg of IMPA2 inhibitor is administered by injection per day. Is convenient. In the case of other animals, an amount converted per 60 kg body weight can be administered.
  • the prophylactic / therapeutic agent for IMPA2-related peripheral diseases can be produced by a method known per se as a pharmaceutical composition containing an IMPA2 inhibitor as an active ingredient together with a pharmaceutically acceptable carrier and the like.
  • compositions for oral administration include solid or liquid dosage forms, specifically tablets (including sugar-coated tablets and film-coated tablets), pills, granules, powders, capsules (including soft capsules). Syrup, emulsion, suspension and the like.
  • Such a composition is produced by a method known per se, and contains a carrier, diluent or excipient usually used in the pharmaceutical field. For example, lactose, starch, sucrose, magnesium stearate and the like are used as carriers and excipients for tablets.
  • injections for example, injections, suppositories and the like are used, and injections are intravenous injections, subcutaneous injections, intradermal injections, intramuscular injections, intravenous injections, intraarticular injections. Includes dosage forms such as agents.
  • Such an injection is prepared according to a method known per se, for example, by dissolving, suspending or emulsifying the IMPA2 inhibitor in a sterile aqueous or oily liquid usually used for injections.
  • aqueous solution for injection for example, isotonic solutions containing physiological saline, glucose and other adjuvants are used, and suitable solubilizers such as alcohol (eg, ethanol), polyalcohol (eg, Propylene glycol, polyethylene glycol), nonionic surfactants (eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)) and the like may be used in combination.
  • alcohol eg, ethanol
  • polyalcohol eg, Propylene glycol, polyethylene glycol
  • nonionic surfactants eg, polysorbate 80, HCO-50 (polyoxyethylene (50 mol) adduct of hydrogenated castor oil)
  • oily liquid for example, sesame oil, soybean oil and the like are used, and benzyl benzoate, benzyl alcohol and the like may be used in combination as a solubilizing agent.
  • the prepared injection solution is usually filled in a suitable amp
  • the IMPA2 inhibitor is an antisense polynucleotide, siRNA or shRNA
  • a suitable vector such as a retroviral vector, adenoviral vector, adenoviral associated viral vector, etc.
  • a mammal eg, , Human, rat, rabbit, sheep, pig, cow, cat, dog, monkey, etc .; human is preferred
  • the antisense polynucleotide or the like can be formulated as it is or with a physiologically recognized carrier such as an auxiliary agent for promoting intake, and can be administered by a gene gun or a catheter such as a hydrogel catheter.
  • the above-mentioned antisense polynucleotides or the like are formulated (injection) alone or together with a carrier such as liposomes, and are administered intravenously, subcutaneously, etc. It may be administered.
  • the present invention also provides a kit used in the screening of the present invention (sometimes abbreviated as the screening kit of the present invention).
  • the screening kit of the present invention contains a polypeptide used in the present invention, a cell having the ability to produce the polypeptide of the present invention, or a buffer as necessary.
  • the screening kit of the present invention may also contain a phosphatase substrate compound of the polypeptide of the present invention.
  • Examples of such compounds include 6-phosphogluconic acid and its related compounds such as myo-inositol-1-phosphate, myo-inositol-4-phosphate, myo-inositol-1,3-diphosphate, glucose-1- Phosphate, ⁇ -glycerophosphate, myo-inositol-1,4-diphosphate, myo-inositol-3-phosphate, 6-phosphoglucono-d-lactone, ribulose 5-phosphate, xylose 5-phosphate, erythrose 4- Examples thereof include, but are not limited to, phosphoric acid, 2,3-diphospho-D-glyceric acid, and glycerol-3-phosphate.
  • the screening kit of the present invention contains 6-phosphogluconic acid.
  • the screening kit of the present invention can contain a reagent used in the above screening method and a test compound as a control.
  • the compound obtained by using the screening method of the present invention or the screening kit of the present invention or a salt thereof is a test compound as described above, for example, a peptide, a polypeptide, a non-peptidic compound, a synthetic compound, a fermentation product, a cell extract, A compound selected from plant extracts, animal tissue extracts, plasma and the like, or a salt thereof, which inhibits the activity of the polypeptide of the present invention (eg, phosphatase activity, intracellular triglyceride accumulation promoting activity, etc.), A compound or a salt thereof that inhibits gene expression or inhibits expression of the polypeptide of the present invention.
  • a compound or salt thereof that inhibits the activity of the polypeptide of the present invention, a compound or salt thereof that inhibits the expression of the gene encoding the polypeptide of the present invention, a compound or salt thereof that inhibits the expression of the polypeptide of the present invention It has low toxicity and is useful as a prophylactic / therapeutic agent for IMPA2-related peripheral diseases (for example, diseases involving intracellular triglyceride accumulation or diseases involving intracellular mitochondrial activity: especially obesity).
  • IMPA2-related peripheral diseases for example, diseases involving intracellular triglyceride accumulation or diseases involving intracellular mitochondrial activity: especially obesity.
  • the polypeptide of the present invention is involved in intracellular triglyceride accumulation action or intracellular ⁇ -oxidation activity through phosphatase activity, early diagnosis of IMPA2-related peripheral diseases, determination of symptom severity, disease progression Useful as a marker for prediction. Accordingly, a compound or a salt thereof that inhibits the activity of the polypeptide of the present invention, an antibody against the polypeptide of the present invention, an antisense polynucleotide of a gene encoding the polypeptide of the present invention, etc. Can be used to diagnose and predict these diseases.
  • the polypeptide of the present invention is also involved in intracellular mitochondrial activity or mitochondrial mass, it is useful as a marker for early diagnosis of IMPA2-related peripheral diseases, determination of the severity of symptoms, and prediction of disease progression. Therefore, the compounds or salts thereof that inhibit the activity of the polypeptide of the present invention, the antibody of the present invention, the antisense polynucleotide of the present invention, etc. are used as diagnostic agents for the above diseases, for example, to diagnose and predict these diseases. can do.
  • the present invention also relates to a method for measuring obesity or an IMPA2-related peripheral disease characterized by measuring the expression of the polypeptide of the present invention or a gene encoding the same in a cell-containing sample collected from a mammal.
  • a diagnostic method is also provided. For example, when the gene encoding the polypeptide of the present invention is overexpressed, it is expected that the amount of intracellular triglyceride accumulation is high, so that the degree of obesity is high or the patient is suffering from an IMPA2-related peripheral disease Or it can be predicted that there is a high possibility of being affected. Therefore, it can be said that measuring the expression of the polypeptide of the present invention or a gene encoding the same in the cell-containing sample is useful for predicting obesity or diagnosing / predicting IMPA2-related peripheral diseases.
  • the present invention also provides a method for diagnosing an IMPA2-related peripheral disease, which comprises measuring the expression of the polypeptide of the present invention or a gene encoding the same in a cell-containing sample collected from a mammal.
  • a method for diagnosing an IMPA2-related peripheral disease comprises measuring the expression of the polypeptide of the present invention or a gene encoding the same in a cell-containing sample collected from a mammal.
  • intracellular mitochondrial activity is expected to be high, so that the patient is or is likely to suffer from an IMPA2-related peripheral disease. Can be predicted. Therefore, it can be said that measuring the expression of the polypeptide of the present invention or a gene encoding the same in the cell-containing sample is useful for the diagnosis / prediction of IMPA2-related peripheral diseases.
  • a sample for example, blood, cells, tissue, etc. collected from a patient
  • the expression level of the polypeptide of the present invention is measured (quantified).
  • the antibody of the present invention can be used for detecting the polypeptide of the present invention present in a subject such as a body fluid or tissue.
  • the antibody of the present invention can be prepared by preparing an antibody column used for purifying the polypeptide of the present invention, detecting the polypeptide of the present invention in each fraction during purification, and detecting the polypeptide of the present invention in a test cell. It can be used for analysis of peptide behavior.
  • the DNA of the present invention can be used as, for example, a mammal, such as a mammal (eg, human, rat, mouse, guinea pig, rabbit, bird, sheep, pig, cow, horse, cat, dog, monkey, Since abnormality (gene abnormality) of DNA or mRNA encoding the polypeptide of the present invention or a partial peptide thereof (genetic abnormality) in chimpanzees and the like (preferably human) can be detected, for example, damage, mutation or expression of the DNA or mRNA It is useful as a genetic diagnostic agent for reduction, increase or overexpression of the DNA or mRNA. Such a gene diagnostic agent is included in the present invention.
  • a mammal eg, human, rat, mouse, guinea pig, rabbit, bird, sheep, pig, cow, horse, cat, dog, monkey
  • the above gene diagnosis using the DNA of the present invention includes, for example, known Northern hybridization and PCR-SSCP method (Genomics, Vol. 5, pp. 874-879, 1989, Proceedings of the National Academy of Sciences of the United States). States of America, 86, 2766-2770, 1989). For example, if an overexpression is detected by Northern hybridization, or if a DNA mutation is detected by the PCR-SSCP method, the subject is affected by the IMPA2-related peripherality or affected by these diseases. Can be diagnosed as being at high risk.
  • bases, amino acids and the like are indicated by abbreviations based on abbreviations by IUPAC-IUB Commission on Biochemical Nomenclature or conventional abbreviations in the field, examples of which are described below.
  • optical isomers with respect to amino acids L form is shown unless otherwise specified.
  • DNA deoxyribonucleic acid
  • cDNA complementary deoxyribonucleic acid
  • A adenine T: thymine
  • G guanine
  • C cytosine RNA: ribonucleic acid
  • mRNA messenger ribonucleic acid
  • dATP deoxyadenosine triphosphate
  • dTTP deoxythymidine triphosphate
  • dGTP deoxyguanosine tri
  • Phosphate dCTP deoxycytidine triphosphate ATP: adenosine triphosphate
  • EDTA ethylenediaminetetraacetic acid
  • SDS sodium dodecyl sulfate
  • Gly glycine Ala: alanine Val: valine Leu: leucine
  • Ile isoleucine
  • Ser threonine
  • CyrM threonine
  • Methionine Glu Glutamic acid
  • Asp Aspa Gin acid
  • sequence numbers in the sequence listing in the present specification indicate the following sequences.
  • Example 1 Increase in IMPA2 expression accompanying differentiation in C3H10T1 / 2 differentiated adipocytes
  • Mouse C3H10T1 / 2 cells were cultured in D-MEM medium containing 10% CS. Differentiation into adipocytes was induced by the following method.
  • C3H10T1 / 2 cells were seeded in a 96-well Collagen type 1 coated plate (IWAKI) at 10,000 cells / well and cultured at 37 ° C. in a 0.5% CO 2 atmosphere. After overnight culture, the cells were replaced with 10% FBS-containing D-MEM medium containing 10 ⁇ M pioglitazone to induce differentiation into adipocytes.
  • IWAKI Collagen type 1 coated plate
  • RNA amount of IMPA2 was quantified from the prepared cDNA sample by TaqMan PCR according to the attached protocol.
  • Example 2 Inhibition of adipocyte triglyceride (TG) accumulation by suppression of IMPA2 expression using siRNA siRNA against IMPA2 was applied to C3H10T1 / 2 differentiated adipocytes induced by the same method as in Example 1 by the following method. Introduced. Using the transfection reagent HiperFect (Qiagen), siRNAs of SEQ ID NOs: 16 and 17, or SEQ ID NOs: 18 and 19 were introduced into differentiated adipocytes on the second day after induction of fat differentiation according to the attached protocol. On the fourth day after siRNA introduction, intracellular triglyceride accumulation was quantified using the following method.
  • TG adipocyte triglyceride
  • the cells were treated with 2.5% glutaraldehyde for 15 minutes and then treated with AdipoRed solution (CAMBREX) diluted 100-fold with PBS for 20 minutes to stain intracellular triglycerides. Stained triglycerides were detected with EnVision (485 nm / 535 nm, PerkinElmer). Furthermore, using the cells into which siRNA was introduced under the same conditions, the amount of mRNA of IMPA2 was quantified in the same manner as in Example 1, and the gene expression suppression effect by siRNA was evaluated. As a result, it was clarified that the suppression of IMPA2 gene expression using siRNA suppresses triglyceride accumulation in adipocytes (FIG. 2).
  • Example 3 Large-scale preparation of human IMPA2 and human IMPA1 protein (polypeptide)
  • the human IMPA2 gene expression vector pcDNA3.1F-hIMPA2 was prepared as follows. First, a pcDNA3.1FF vector in which a FLAG sequence was introduced into pcDNA3.1 (+) (Invitrogen) was constructed using a synthetic DNA having a FLAG sequence.
  • FLAGNHENOT-F 5'-CTAGCGCCACCATGGACTACAAGGACGACGATGACAAGGGATCCGACTACAAGGACGACGATGACAAGTGAGC-3 '(SEQ ID NO: 26) and FLAGNHENOT-R 5'-GGCCGCTCACTTGTCATCGTCGTCCTTGTAGTCTCGATCTGTTTGCATCGTCTC Slow cooling and annealing.
  • a vector pcDNA3.1F-hIMPA2 for expressing a protein (polypeptide) in which FLAG was fused to the N-terminal side of human IMPA2 was constructed by the following method. That is, the IMPA2 fragment was amplified by PCR using a primer with the BAMHI at the 5 'end of IMPA2 and the XhoI recognition sequence added at the 3' end from the entry vector pENTR TM -IMPA2 (Invitrogen) purchased from Invitrogen. Using the / XhoI restriction site, it was inserted into pcDNA3.1FF, and the resulting plasmid was transformed into DH5 ⁇ strain (Invitrogen).
  • Plasmid DNA was extracted from the obtained clone with QIAprep spin Miniprep kit (50) (QIAGEN), and sequence confirmation (ABI PRISM 3130xl Genetic Analyzer, ABI) was performed.
  • a vector pcDNA3.1F-hIMPA1 for expressing a protein (polypeptide) in which FLAG was fused to the N-terminal side of human IMPA1 was constructed by the following method.
  • Total RNA was extracted from HEK293 cells using RNeasy mini kit (QIAGEN), and the extracted total RNA was reverse transcribed using High Capacity cDNA Reverse Transcription Kit (ABI PRISM) to obtain cDNA.
  • the IMPA1 fragment was amplified by PCR using primers with BglII at the 5 'end and XhoI recognition sequence added at the 3' end, and the amplified fragment was converted into pcDNA3.1FF using BamHI / XhoI restriction sites.
  • the DH5 ⁇ strain (Invitrogen) was transformed with the resulting plasmid. Positive clones were selected by colony PCR using T7 forward primer, BGH reverse primer, Insert check Ready (TOYOBO), and plasmid DNA was extracted with QIAprep spin Miniprep kit (50) (QIAGEN) for sequence confirmation.
  • QIAprep spin Miniprep kit 50
  • QIAGEN QIAGEN
  • pcDNA3.1F-hIMPA2 and pcDNA3.1F-hIMPA1 were introduced into FreeStyle293 cells, respectively, and human IMPA2 protein (polypeptide) and human IMPA1 protein (polypeptide) were prepared in large quantities by affinity purification using anti-FLAG antibody. That is, FreeStyle293 was seeded in 90 mL of FreeStyle293 expression medium (Invitrogen) at a cell concentration of 0.6 ⁇ 10 6 cells / mL and cultured overnight. On the next day, the number of cells was counted, and the cells were diluted with a medium so as to be 1.1 ⁇ 10 6 cells / mL.
  • FreeStyle293 FreeStyle293 expression medium (Invitrogen) at a cell concentration of 0.6 ⁇ 10 6 cells / mL and cultured overnight.
  • the number of cells was counted, and the cells were diluted with a medium so as to be 1.1 ⁇ 10 6 cells / mL.
  • pcDNA3.1F-hIMPA2 or pcDNA3.1F-hIMPA190 ⁇ g was added to a 50 mL tube (Falcon), and 3 ml of Opti-MEM (Invitrogen) was added thereto and mixed.
  • Opti-MEM Invitrogen
  • 120 ⁇ l of 293fectin and 3 mL of Opti-MEM were added and mixed.
  • the DNA diluted solution and the 293fectin diluted solution were mixed and reacted at room temperature for 20 minutes. After 20 minutes, the DNA-293fectin reaction solution was added to the culture solution, and then the cells were cultured for 72 hours. After 72 hours, cells were collected and stored at -80 ° C.
  • Lysis buffer (20 mM TrisHCl (pH 7.5), 0.25 M sucrose, 1.2 mM EGTA, 1 mM sodium orthovanadate, 1 mM sodium pyrophosphate, 1 mM NaF, 1% Triton X-100 , 0.5% Nonidet P-40, 150 mM NaCl).
  • Example 4 Phosphatase activity of human IMPA2
  • the standard measurement system was 50 mM Tris-HCl (pH 8.0), 0.1 mM EGTA, 1 mM substrate (compound described in Table 1 below), IMPA1 obtained in the above Example 3 or IMPA2 70 ng (40 ⁇ l) was used at 37 ° C. for 24 hours.
  • To 20 ⁇ l of each reaction solution add 30 ⁇ L of 50 mM Tris-HCl (pH 8.0) 0.1 mM EGTA buffer and 100 ⁇ L of Biomol Green reagent (BIOMOL Research Lab., Plymouth Meeting, PA), and measure the absorbance at 600 nm
  • the relative activity of IMPA2 to IMPA1 is shown in Table 1.
  • 6-phosphogluconic acid was identified as a substrate compound having a different reactivity from IMPA1 and having a high relative activity to IMPA2.
  • This 6-phosphogluconic acid is a novel substrate for IMPA2 and can be a substrate although it is weak against IMPA1, but it clearly has a high substrate specificity for IMPA2. Therefore, this 6-phosphogluconic acid related compound is very likely to be an IMPA2-specific substrate.
  • Example 5 IMPA2 mRNA expression in mouse muscle tissue From normal (m + / m +) mice (BKS.Cg-m + / m + / Jcl, 9 weeks old, male, 5 mice), the soleus and gastrocnemius red The dark part and the thin part were collected separately. For each tissue, total RNA was prepared with Isogen (Nippon Gene) and RNeasy mini (Qiagen) according to the manual. From 1.35 ⁇ g of this total RNA, cDNA was synthesized according to the manual using High Capacity cDNA Reverse Transcription Kit (ABI). Sequence Detection System Prism 7900 (ABI) was used to measure the expression level of mouse IMPA2 mRNA.
  • Isogen Nippon Gene
  • RNeasy mini Qiagen
  • RNA expression level of IMPA2 in the obtained various mouse tissues was calculated as the copy number per 10 ng of total RNA (FIG. 3). Since the red part of the soleus or gastrocnemius muscle is known to have a large amount of mitochondria and high mitochondrial activity, the results shown in Fig. 3 indicate that IMPA2 is strongly involved in mitochondrial function or activity. Strongly suggest.
  • Example 6 IMPA2 mRNA expression in rat adipose tissue Brown adipose tissue, subcutaneous fat, mesenteric fat and epididymal fat were separately collected from Wistar rats (9 weeks old, male). For each tissue, total RNA was prepared by ISOGEN (Nippon Gene) according to the manual. CDNA was synthesized from 750 ng of this total RNA using the High Capacity cDNA Reverse Transcription kit according to the manual. For the expression level of rat IMPA2 mRNA, Sequence Detection System Prism 7900 (ABI) was used.
  • 5'-GTGGCATTGTGATTGACACCTC-3 '(SEQ ID NO: 23), 5'-GAGCTATGAGCACTGCCATCTC-3' (SEQ ID NO: 24) as primers for amplification and detection of rat IMPA2, and 5 '-(FAM)-as TaqMan probe AGCCACCACTCTGCACGACATGAGGT- (TAMRA) -3 ′ (SEQ ID NO: 25) was used.
  • Express qPCR Supermix Universal (Invitrogen) 5.0 ⁇ l, 0.1 ⁇ l of 100 ⁇ M primer solution, 1 ⁇ l of 5 ⁇ M TaqMan probe, and 2 ⁇ l of the cDNA solution prepared above were added, and the total reaction volume was adjusted to 10 ⁇ l with distilled water.
  • RNA expression level of IMPA2 in the obtained rat tissues was calculated as the copy number per 10 ng of total RNA (FIG. 4). Since brown fat is known to have a large amount of mitochondria and high mitochondrial activity, the results shown in FIG. 4 strongly suggest that IMPA2 is strongly involved in mitochondrial function or activity.
  • Example 7 Increase in fatty acid ⁇ oxidation activity by suppression of IMPA2 expression using siRNA siRNA against IMPA2 was introduced into C3H10T1 / 2 cells cultured in D-MEM medium containing 10% CS in the same manner as in Example 2. The same siRNA as in Example 2 was used. 5 days after introduction, reaction medium (5 nCi / ml [ 3 H] -oleic acid (GE Healthcare, TRK140), 0.1 mM oleic acid (Wako), 1.1% ethanol, 0.12% BSA (Sigma) -containing DMEM (Invitrogen) ) And cultured for 6 hours.
  • reaction medium 5 nCi / ml [ 3 H] -oleic acid (GE Healthcare, TRK140), 0.1 mM oleic acid (Wako), 1.1% ethanol, 0.12% BSA (Sigma) -containing DMEM (Invitrogen)
  • reaction medium 5 nCi / ml [ 3 H] -ole
  • the culture supernatant was passed through a MultiScreen DV 0.65 mm plate (Millipore) filled with Norit (Wako), and the radioactivity of the water-soluble fraction containing tritium water produced by fatty acid oxidation was measured with TopCount (PerkinElmer) (FIG. 5). , P ⁇ 0.05).
  • suppression of intracellular IMPA2 expression using siRNA1 and siRNA2 of IMPA2 resulted in an increase in intracellular fatty acid ⁇ -oxidation activity. This reduces the amount of intracellular triglycerides, suggesting that IMPA2 inhibitors are useful as prophylactic / therapeutic agents for IMPA2-related peripheral diseases, particularly diseases related to triglyceride accumulation such as obesity.
  • Example 8 Large-scale preparation of human IMPA2 and human IMPA1 protein (polypeptide) pcDNA3.1F-hIMPA2 and pcDNA3.1F-hIMPA1 were introduced into FreeStyle293 cells, respectively, and human IMPA2 protein ( Polypeptide) and human IMPA1 protein (polypeptide) were prepared in large quantities. That is, FreeStyle293 was seeded in 90 mL of FreeStyle293 expression medium (Invitrogen) at a cell concentration of 0.6 ⁇ 10 6 cells / mL and cultured overnight. The next day, the number of cells was counted, and the cells were diluted with a medium so as to be 1.1 ⁇ 10 6 cells / mL.
  • FreeStyle293 FreeStyle293 expression medium (Invitrogen) at a cell concentration of 0.6 ⁇ 10 6 cells / mL and cultured overnight. The next day, the number of cells was counted, and the cells were diluted with a medium so as to be 1.1 ⁇
  • pcDNA3.1F-hIMPA2 90 ⁇ g of pcDNA3.1F-hIMPA2 (or pcDNA3.1F-hIMPA1) was added to a 50 mL tube (Falcon), and 3 ml of Opti-MEM (Invitrogen) was added thereto and mixed. Then, 120 ⁇ l of 293fectin and 3 mL of Opti-MEM were added to another 50 mL falcon tube and mixed. The obtained DNA diluted solution and 293fectin diluted solution were mixed and further reacted at room temperature for 20 minutes. The obtained DNA-293fectin reaction solution was added to the culture solution, the cells were cultured for 72 hours, and the cells were collected and stored at ⁇ 80 ° C.
  • the absorbance at a wavelength of 280 nm for the flow-through was measured, and washing was performed four times until the absorbance was 0.05 or less. Thereafter, the target FLAG fusion protein (polypeptide) bound to the resin was competitively eluted using an Elution buffer (TBS, 10% Glycerol, 1 mM DTT, 200 ng / ⁇ L 3 ⁇ FLAG peptide (Sigma)).
  • Elution buffer TBS, 10% Glycerol, 1 mM DTT, 200 ng / ⁇ L 3 ⁇ FLAG peptide (Sigma)
  • the obtained human IMPA2 protein (polypeptide) and human IMPA1 protein (polypeptide) were prepared with Elution buffer to a protein concentration of 2 mg / ml and stored at -80 ° C.
  • Example 9 Human IMPA2 phosphatase activity measurement system used for screening and selectivity test 50 mM Tris-HCl (pH 7.5), 0.1 mM EGTA, 2 mM MgCl 2 , 0.01% BSA, 1 mM DTT, 0.01% CHAPS, 1 Reaction was performed at room temperature for 50 minutes using mM 6-phosphogluconic acid, 27 ng (9 ⁇ l) of IMPA2 obtained in Example 8 above, and 3 ⁇ M (or each concentration of 0.3-100 ⁇ M selectivity test). went.
  • a prophylactic / therapeutic agent for IMPA2-related peripheral diseases (particularly obesity) can be efficiently searched.
  • the preventive / therapeutic agent for IMPA2-related peripheral diseases comprising an IMPA2 inhibitor is useful as a preventive / therapeutic agent for the above-mentioned IMPA2-related peripheral diseases (particularly obesity), and has low toxicity and safety. It is.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Medicinal Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Hematology (AREA)
  • Immunology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Biomedical Technology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • General Chemical & Material Sciences (AREA)
  • Urology & Nephrology (AREA)
  • Molecular Biology (AREA)
  • Diabetes (AREA)
  • Biochemistry (AREA)
  • Analytical Chemistry (AREA)
  • Microbiology (AREA)
  • Pathology (AREA)
  • Obesity (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Wood Science & Technology (AREA)
  • Genetics & Genomics (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Food Science & Technology (AREA)
  • General Physics & Mathematics (AREA)
  • Zoology (AREA)
  • Vascular Medicine (AREA)
  • Endocrinology (AREA)
  • General Engineering & Computer Science (AREA)

Abstract

La présente invention concerne un nouvel agent thérapeutique pour des maladies périphériques associées à IMPA2, comprenant l'obésité et le diabète, et un procédé de criblage pour un tel agent thérapeutique. Un composé de la présente invention qui inhibe l'activité d'un polypeptide comprenant la même ou sensiblement la même séquence d'acides aminés que la séquence d'acides aminés représentée par SEQ ID NO : 1, 3, 5, 7, 9 ou 11, ou un sel et similaire du composé peut être utilisé en tant qu'agent prophylactique ou thérapeutique pour des maladies périphériques associées à IMPA2, telles que des maladies associées à l'accumulation intracellulaire de triglycérides (par exemple l'obésité, le diabète, l'hyperlipémie, l'artériosclérose, la néphropathie chronique, la néphropathie diabétique, la stéatose hépatique, l'hypertension, la cardiopathie ischémique et le cancer) et des maladies associées à l'activité mitochondriale intracellulaire (par exemple l'obésité, la maladie dégénérative de la rétine, la neuropathie diabétique, la rétinopathie diabétique, la sclérose glomérulaire rénale, la néphropathie, la néphropathie diabétique, la néphropathie chronique, l'insulinorésistance, l'hypertension, l'artériosclérose, le diabète, le stress oxydatif, la cardiopathie ischémique, le vieillissement, un trouble musculaire, un trouble nerveux, la perte d'audition, la cécité, la stéatose hépatique, la stéatohépatite, l'hépatite virale, la cirrhose biliaire du foie, la lésion d'ischémie-reperfusion, le rejet de greffe, l'anémie hémolytique et le cancer).
PCT/JP2011/069487 2010-08-30 2011-08-29 Procédé de criblage WO2012029722A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2010192467 2010-08-30
JP2010-192467 2010-08-30

Publications (1)

Publication Number Publication Date
WO2012029722A1 true WO2012029722A1 (fr) 2012-03-08

Family

ID=45772808

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2011/069487 WO2012029722A1 (fr) 2010-08-30 2011-08-29 Procédé de criblage

Country Status (1)

Country Link
WO (1) WO2012029722A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014162792A (ja) * 2013-02-28 2014-09-08 Kobe Gakuin ミトコンドリア機能回復促進剤
WO2024055810A1 (fr) * 2022-09-16 2024-03-21 复旦大学 Utilisation d'acide 6-phosphogluconique et d'un dérivé de celui-ci dans la préparation d'un médicament pour la prévention ou le traitement de maladies du trouble du glycométabolisme

Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004101779A2 (fr) * 2003-05-16 2004-11-25 Janssen Pharmaceutica N.V. Caracterisation fonctionnelle de myo-inositol monophosphatase
WO2006079792A1 (fr) * 2005-01-25 2006-08-03 Cambridge Enterprise Limited Procedes d'induction d'autophagie dans des cellules mammaliennes
WO2009122639A1 (fr) * 2008-03-31 2009-10-08 Sugimoto Yoshikazu Inhibiteur de l'expression de protéine de transporteur abc

Patent Citations (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004101779A2 (fr) * 2003-05-16 2004-11-25 Janssen Pharmaceutica N.V. Caracterisation fonctionnelle de myo-inositol monophosphatase
WO2006079792A1 (fr) * 2005-01-25 2006-08-03 Cambridge Enterprise Limited Procedes d'induction d'autophagie dans des cellules mammaliennes
WO2009122639A1 (fr) * 2008-03-31 2009-10-08 Sugimoto Yoshikazu Inhibiteur de l'expression de protéine de transporteur abc

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
OHNISHI, T. ET AL.: "Spatial expression patterns and biochemical properties distinguish a second myo-inositol monophosphatase IMPA2 from IMPA1.", THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 282, no. 1, 2007, pages 637 - 646 *
SHAMIR, A. ET AL.: "Characterization of two genes, Impa1 and Impa2 encoding mouse myo-inositol monophosphatases.", GENE, vol. 271, 2001, pages 285 - 291 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2014162792A (ja) * 2013-02-28 2014-09-08 Kobe Gakuin ミトコンドリア機能回復促進剤
WO2024055810A1 (fr) * 2022-09-16 2024-03-21 复旦大学 Utilisation d'acide 6-phosphogluconique et d'un dérivé de celui-ci dans la préparation d'un médicament pour la prévention ou le traitement de maladies du trouble du glycométabolisme

Similar Documents

Publication Publication Date Title
JP4659736B2 (ja) スクリーニング方法
US20090082303A1 (en) Drug for preventing and treating atherosclerosis
JPWO2006028241A1 (ja) 動脈硬化の予防・治療用医薬
WO2012029722A1 (fr) Procédé de criblage
WO2009125804A1 (fr) Procédé de criblage
US20110104705A1 (en) Musclin receptor and use thereof
US7833972B2 (en) Proteins and use thereof
EP2153847A1 (fr) Gène sensible à une maladie des os/articulations et son utilisation
JP3792655B2 (ja) 新規な癌遺伝子、該癌遺伝子由来の組換えタンパク質、およびそれらの用途
US7700361B2 (en) Secretory or membrane protein expressed in skeletal muscles
JP4761812B2 (ja) マスクリン受容体およびその用途
JP4169651B2 (ja) 新規蛋白質およびその用途
JP4559775B2 (ja) 新規蛋白質
JP4530631B2 (ja) 新規タンパク質および癌の予防・治療剤
US20070275888A1 (en) Preventive/Remedy for Cancer
JPWO2005118631A1 (ja) 新規タンパク質複合体およびその用途
US20090047282A1 (en) Prophylactic/Therapeutic Agent for Cancer
EP1428877A1 (fr) Nouvelle proteine et adn associe
EP1536011A1 (fr) Agents de prevention/remedes pour maladies neurodegeneratives
US20060035209A1 (en) Screening method
US20060148692A1 (en) Novel protein and its dna
EP1536010A1 (fr) Medicaments destines a la prevention et au traitement du cancer
JP2005151826A (ja) Ｃ１ｑｔｎｆ５の用途
JP2003289876A (ja) がんの予防および／または治療剤
JP2004121246A (ja) 神経変性疾患の予防・治療剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11821738

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11821738

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP