WO2009113603A1 - Transcriptional repressor peptides and genes for the same - Google Patents

Abstract

Provided are peptides comprising an amino acid sequence represented by general formula (I) which are capable of repressing transcription in plants and can be used in the CRES-T method, which is a simple and widely applicable means for repressing gene transcription, and also provided are genes coding such peptides. Formula (I) X1-X2-Leu-Phe-Gly-Va1-X3 (In the formula, X1 and X3 represent an amino acid sequence comprising any 1-10 amino acids, and X2 represents Lys or Arg.)

Description

Transcriptional repressing peptide and its gene

The present invention includes a peptide having a transcriptional repression function, a gene encoding the peptide, a chimeric protein having a transcriptional repression function in which the peptide and a transcription factor or a DNA binding domain thereof are linked, a chimeric gene encoding the chimeric protein, The present invention relates to a recombinant vector having a chimeric gene, and a transformant containing the recombinant vector.

Conventionally, antisense methods or ribozyme methods are known as means for suppressing the expression of biological genes, and these are used, for example, to suppress the expression of genes that cause diseases such as oncogenes or to improve plants. Research is underway. In the antisense method, a target gene intended to suppress transcription or an antisense DNA or RNA complementary to a specific site such as mRNA transcribed from this is used. The prepared antisense DNA or RNA is other than the target gene. It cannot be used to suppress the expression of these genes, and for other target genes, it is necessary to newly prepare antisense DNA or RNA in accordance with the sequence. On the other hand, in the ribozyme method, in order to cleave a target DNA or mRNA with a ribozyme, the ribozyme is designed so that it has a complementary sequence for binding to the target DNA or mRNA and can be cleaved at a predetermined position. There is a need. In addition, even a ribozyme designed to cleave a target gene is constructed by linking this to a promoter such as the cauliflower mosaic virus 35S promoter and a transcription termination sequence to construct an introduction vector. When introduced in, an extra sequence may be added to the transcribed ribozyme and the ribozyme activity may be lost. In these prior arts, it is of course necessary to specify the target gene and determine the base sequence, and this has been a big problem especially for the purpose of improving plant traits. Because most of the research on plants uses model plants as materials, and there is little knowledge about the gene sequences of plants that are practical as food, fuel, building materials, etc., designing appropriate antisense DNA or RNA or ribozyme Because it is very difficult to do. Furthermore, it is well known that there are large differences in gene sequences between varieties and in some cases in practical plants, and it is almost impossible to design an appropriate antisense DNA or ribozyme for each useful variety. Impossible. In addition, there is a method of suppressing the expression by destroying the gene itself by a gene knockout method in which an endogenous gene is destroyed by chemical treatment, irradiation, or introduction of a foreign gene. However, this method is difficult to apply because, for example, in a diploid plant having a large number of natural gene sets, it is difficult to destroy all genes. Polyploid plants include soybeans and wheat, which are important crops for food and feed. In addition, genes having important functions are often duplicated in plants, and it has been difficult to destroy all genes even in normal diploid plants.

Accordingly, the present inventors have developed a CRES-T method (Chimeric repressor silencing technology), which is an approach that is completely different from the above prior art. (Patent Documents 1 to 8, Non-Patent Documents 1 to 3). The CRES-T method uses a transcriptional repressor domain (dominant repressor) isolated from plants and binds to the carboxyl group terminal of the transcriptional activator to give the transcriptional activator a strong transcriptional repressing activity. This technology strongly suppresses transcription of the target gene by expressing in vivo the chimeric gene of the nucleic acid molecule that encodes each. A chimeric gene fused with a transcriptional repression domain was created using the CRES-T method because it suppresses not only the transcriptional activator, but also all other functions of the transcriptional activator acting on the same gene. The plant shows a form in which the expression of the target gene is completely suppressed. For this reason, the CRES-T method is very useful not only for the practical modification of plant traits but also for the elucidation of basic gene functions. In addition, in the CRES-T method, it is possible to suppress the function of closely related genes whose functions are similar to those of the sequences. Therefore, DNA or RNA each time in accordance with the base sequence of the target gene as in the conventional antisense method or ribozyme method. It is not necessary to design the above, and simple and wide range application is possible.
The transcription repression domain comprises a motif (L / F) DLN (L / F) (X) P (where X represents an arbitrary amino acid residue), and was originally isolated from Arabidopsis thaliana, However, in addition to tobacco, many of the same motifs were identified from transcriptional repressing factors of a wide range of plants including monocotyledonous plants such as rice. So far, we have shown that it is possible to actively control secondary metabolic biosynthesis by converting transcription factors working in the secondary metabolic biosynthesis system into chimeric transcriptional repressors, and control of flower organ formation. We have succeeded in inducing male sterility and complete sterility not only in Arabidopsis thaliana but also in rice by expressing a chimeric transcriptional repressor of the transcription factor. From these results, it was shown that the CRES-T method can be used even in rice, which is a monocotyledon, and has attracted attention as a breakthrough technology that can be widely applied to plants in general.
However, not only in plants but also in living organisms in general, the (L / F) DLN (L / F) (X) P motif is the only conserved motif that has been found so far as a transcriptional repression domain. The present inventors have found that a known SUP gene has “DLELLL” as a transcriptional repression functional domain, but a transcriptional gene having the same motif cannot be found and cannot be said to be a conserved motif. Therefore, a search for a conserved motif of a transcriptional repression domain that is applicable to plants in general, as well as a (L / F) DLN (L / F) (X) P motif, and that is conserved in a natural transcription repressor. Was demanded.
Patent No. 3829200 Patent No. 3995211 JP 2001-269177 A JP 2001-269178 A JP 2001-292776 A JP 2001-292777 A JP 2001-269176 A JP 2001-269179 A The Plant Cell, 2001 13, 1959-1968 Plant Biotechnology J 2006. 4. 325-332 Plant Journal 2003 34: 733-739.

An object of the present invention is to apply a CRES-T method by providing a conserved motif sequence serving as a completely new transcription repression domain that can be used in the CRES-T method, which is a simple and widely applicable means of gene transcription repression. To increase scope and applicability.

In order to solve the above problems, the present inventors focused on the At2g36080 gene of the Arabidopsis transcription gene, and as a result of a transient assay in Arabidopsis leaves using an effector construct fused with the GAL4 DNA binding domain and the gene, strong transcription suppression The function was confirmed, and further, it was found that the transcription repressing active region was 8 peptide “LRLFFGVNM”. Next, 29 transcription regulator genes having an amino acid sequence similar to the LRLFVVNM motif were discovered from all genes registered in the Arabidopsis database, and the same was performed for At3g11580, At2g46870, At1g13260, At1g68840, At4g36990, and At4g11660. As a result of the transient assay, it was proved that all acted as transcription repressors. Of these transcriptional repressors, 6 genes had RLFVV as a conserved sequence, but At4g36990 was KLFFGV. At4g36990 was further analyzed with an effector plasmid into which mutation was introduced, and was referred to as “K / RLFGV”. It was determined that 5 amino acids (first 1 amino acid is K or R) are conserved sequences. On the other hand, as a result of creating a construct in which a DNA fragment encoding a partial amino acid 15 amino acid fragment of At2g36080 gene containing RLFFGV was fused to the Arabidopsis thaliana transcriptional activator CUC2 gene and the AG gene, and introduced into an Arabidopsis plant body, It was confirmed that the cotyledon fusion and double bloom traits were induced, similar to the transcriptional repression domain SRDX (LDLELRLGFA), and the present invention was completed.

Specifically, the present inventors expressed a chimeric gene in which the accession number At2g36080 gene classified as a transcriptional gene in the Arabidopsis database was linked to a yeast-derived GAL4 DNA binding domain under the control of the CaMV 35S promoter. Effector construct (35S: GAL4DBAt2g36080, attached FIG. 1A) was created. It was introduced into Arabidopsis leaves simultaneously with a reporter gene having a CaMV 35S enhancer region and a GAL4 binding region (35S-GAL4-TATA-LUC, attached FIG. 1A) and transiently expressed (transient assay). Then, the activity of the reporter gene was remarkably suppressed compared to the control (pUC18 or 35S: GAL4DB, attached FIG. 1A), suggesting that the At2g36080 gene functions as a transcriptional repressor. (Attached Figure 1B).
Therefore, in order to identify the transcriptional repression domain of At2g36080, an effector construct in which the coding region of At2g36080 was gradually deleted from the carboxyl terminus was created (Attached Figure 1A), and a transient assay was performed. As a result, amino acid region 178 to 192 ( 15 amino acid region) was found to have a region with strong transcriptional repression activity (Attached FIG. 1B). Further, since the effector construct (attached FIG. 1A) obtained by cutting out only this region and fused to the GAL4 DNA binding domain also showed strong transcription repressing activity (attached FIG. 1B), this region has transcription repressing activity against the DNA binding domain. It was found to be a transcriptional repression domain (repression domain) that imparts.
Further detailed analysis of the peptide consisting of 15 amino acids revealed that only 8 amino acids of LRLFGVNM at positions 183 to 190 function as a repression domain (Attached FIGS. 1C and 1D).

Next, when genes having sequences similar to LRLFGVNM were searched from all genes registered in the Arabidopsis database, genes encoding 29 transcriptional regulatory factors were found (Table 1: List [RK]). LFGV). Among them, the same transient assay was performed for 7 genes of At2g36080, At3g11580, At2g46870, At1g13260, At1g68840, At4g36990 and At4g11660, and it was proved that all 7 genes are transcriptional repressors (Attached FIGS. 2A to G). A detailed comparison of the amino acid sequences of six genes newly identified as transcriptional repressors with At2g36080, which was used to identify the transcriptional repression domain from the beginning, revealed that five amino acids, K / RLFGV (the first one amino acid is K or R) was found to be a conserved sequence (list [RK] LFGV). Among these, 6 genes had RLFVV as a conserved sequence, but the conserved sequence was KLFFGV for At4g36990 (Attached FIG. 2F). Based on this, for At4g36990, a more detailed domain analysis was performed using an effector plasmid into which mutation was introduced, and an 11 amino acid region (GEGLKLFGVWL, amino acids from 233 to 243) including KLFFG has transcription repressing activity. This was clarified (Attached FIGS. 3A and 3B). From these facts, it is predicted that all transcription factor genes (Table 1) having K / RLFGV discovered in the previous database search function as transcription repressing factors in the plant body.

<Table 1> Arabidopsis derived transcription factor having list [RK] LFGV

Next, the transcriptional activator activity is converted into a transcriptional repressor by fusing the transcription repressor peptide [K / R] LFGV identified above to a transcriptional regulator that originally has a transcriptional activator. In addition, analysis was performed to confirm whether the chimeric gene could actually function as a transcriptional repressor in plants and induce changes in plant traits. In actual experiments, CUC2 gene and AG gene derived from Arabidopsis thaliana, which has already been demonstrated to be related to plant trait changes by experiments using conventionally known transcription repressor peptides as model genes for transcription activators (non-patented) Documents 2, 3) were used.
Regarding the transcription repression domain SRDX (LDLELLRLGFA) already reported by the present inventors, a chimeric gene fused to the C-terminal side of the CUC2 gene (35S: CUC2SRDX), or a chimeric gene fused to the C-terminal side of the AG gene ( When 35S: AGSRDX) (Non-Patent Document 2) is expressed in Arabidopsis thaliana, cotyledon fusion is induced in the 35S: CUC2SRDX plant (Attached FIG. 4D), and the double-flowered trait in the 35S: AGSRDX plant (Attached FIG. 4B). ) It is known to be induced. Accordingly, a chimeric gene (35S: CUC2-36RD, 35S) in which 15 amino acids (indicated as 36RD in FIG. 4) containing RLFFGV, a novel repression domain discovered in the present invention, are fused to the C-terminal side of each of the CUC2 gene and the AG gene. : AG-36RD) (Attached FIG. 4A) and analyzed whether the Arabidopsis plants into which this was introduced exhibited similar traits.
As a result, in the plants into which 35S: CUC2-36RD (Attached FIG. 4E) and 35S: AG-36RD (Attached FIG. 4C) were introduced, cotyledon fusion was performed as in 35S: CUC2-SRDX and 35S: AG-SRDX. Or, a trait of double bloom was induced. From these, it was shown that the discovered [RK] LFGV peptide functions in plants as well as SRDX. The trait of double bloom observed in 35S: AG-36RD is very similar to that observed in the plant (ag mutant) in which the AG gene is disrupted. Therefore, the functional conversion of the AG gene is induced by the fused 36RD. It is considered that the 35S: AG-36RD chimeric gene, which became a strong transcriptional repressor, functioned, and thus AG was repressed all the expression of the target gene that originally activates transcription, thus leading to an induced trait. From this trait it is clear that the 35S: AG-36RD chimeric gene functions predominantly over the endogenous AG gene. In addition, the cotyledon fusion observed in 35S: CUC2-36RD is a trait (cuc1 cuc2) observed only when two of the CUC2 and CUC1 (similar genes that work complementarily to CUC2) genes are disrupted. From these results, it was proved that the 35S: CUC2-36RD chimeric gene functions not only with the endogenous CUC2 gene but also with the CUC1 gene having the same function as that of the endogenous CUC2 gene and suppresses the expression of the target gene.

That is, the present invention includes the following inventions.
[1] A peptide having a plant transcription repressing function, comprising an amino acid sequence represented by the following formula (I).
Formula (I)
X1-X2-Leu-Phe-Gly-Val-X3
(In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)
[2] The peptide according to [1], wherein the peptide comprises the amino acid sequence represented by any of SEQ ID NOs: 3 to 33.
[3] A nucleic acid molecule encoding the peptide according to [1] or [2].
[4] A chimera having a transcriptional repression function, characterized in that a peptide having a transcriptional repression function of a plant comprising the amino acid sequence represented by the following formula (I) is bound to a transcription factor or a DNA binding domain thereof. protein;
Formula (I)
X1-X2-Leu-Phe-Gly-Val-X3
(In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)
[5] A nucleic acid molecule encoding a peptide having a transcriptional repression function of a plant consisting of an amino acid sequence represented by the following formula (I) and a nucleic acid molecule encoding a transcription factor or a DNA binding domain thereof are aligned in a reading frame. A nucleic acid molecule encoding a chimeric protein having a transcriptional repression function, which is linked;
Formula (I)
X1-X2-Leu-Phe-Gly-Val-X3
(In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)
[6] An expression vector comprising the nucleic acid molecule according to [5].
[7] A transformant into which the nucleic acid molecule according to [5] has been introduced in an expressible state.
[8] A transformed plant into which the nucleic acid molecule according to [5] has been introduced in an expressible state.
[9] A chimeric protein having a transcriptional repression function, characterized by culturing cells transformed with the expression vector containing the nucleic acid molecule according to [5], and collecting and purifying the obtained expression product. Manufacturing method.
[10] A chimeric protein having a transcriptional repression function, characterized by linking a plant transcriptional repression function peptide consisting of an amino acid sequence represented by the following formula (I) and a transcription factor or a DNA binding domain thereof: Production method;
Formula (I)
X1-X2-Leu-Phe-Gly-Val-X3
(In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)

The peptide of the present invention is a transcription factor that can effectively suppress gene transcription in a very short size and binds to a transcription control region of a specific target gene, similarly to a conventionally known peptide having a transcriptional repression function, Alternatively, the chimeric protein linked to the DNA binding domain has a function of converting the transcription factor into a transcription repressing factor.
Therefore, the gene of the present invention is similar to a gene encoding a known transcriptional repressor peptide, a transcription factor that binds to the transcriptional regulatory region of a specific target gene, or a gene encoding its DNA binding domain, or its transcription By using a chimeric gene fused with a regulatory factor and a gene that forms a transcriptional regulatory complex, transcriptional repression targeting only a specific gene can be performed. Therefore, the transcription and expression of the target gene can be reliably inhibited.
Moreover, since the peptide of the present invention has a conserved motif that is completely different from a peptide group having a conventionally known transcriptional repression function, it can be used for breeding various plants by substituting or combining with a conventionally known peptide. The scope of application in the field is likely to further expand.

FIG. 1A is a view showing a GAL4DB-RD effector plasmid and a reporter gene containing various DNA fragments to be tested. FIG. 2 is a view showing a reporter gene and an effector plasmid used for determination of a domain having transcription repressing activity of At2g36080 gene. 5XGAL4: GAL4 transcription factor DNA binding sequence, TATA: region containing CaMV35S promoter TATA box, LUC: luciferase gene, CaMV35S: cauliflower mosaic virus 35S protein gene promoter, Ω: omega sequence derived from tobacco mosaic virus, GAL4DB: yeast GAL4 Transcription factor DNA-binding domain coding region, RD: repression domain sequence (LDLELRLGFA) of SUPERMAN, Nos: nopaline synthase gene transcription termination region. FIG. 1B is a diagram showing the influence of various peptides bound to pGAL4DB on the activity (Relative-Activity) of the reporter gene. It is a figure which shows the influence which the various peptide couple | bonded with pGAL4DB exerts on the activity (relative activity) of a reporter gene. In the figure, the graph on the right side shows the activity of the reporter gene when an effector plasmid having various DNA fragments is introduced (the activity of the reporter gene when PUC18 is inserted as an effector is set to 1.00). FIG. 1C is a diagram showing a reporter gene and an effector plasmid used to determine a domain having transcription repressing activity of At2g36080 gene. FIG. 1D is a diagram showing the effect of various peptides bound to pGAL4DB on the activity of the reporter gene (Relative Activity). In the figure, the graph on the right side shows the activity of the reporter gene when an effector plasmid having various DNA fragments is introduced (the activity of the reporter gene when PUC18 is inserted as an effector is set to 1.00). FIG. 2 is a diagram showing the influence of each gene bound to pGAL4DB on the activity of the reporter gene (relative activity). In the figure, the graph on the right side shows the activity of the reporter gene when an effector plasmid having various DNA fragments was introduced (the activity of the reporter gene when pGAL4DB was used as an effector was set to 1.00). Fig. 2A shows the activity when the At3g11580 gene, Fig. 2B shows the At2g36080 gene, Fig. 2C shows the At2g46870 gene, Fig. 2D shows the At1g13260 gene, Fig. 2E shows the At1g68840 gene, Fig. 2F shows the activity when the At4g36990 gene and Fig. 2GAt4g11660 gene are introduced. FIG. 3A is a diagram showing a reporter gene and an effector plasmid used for determination of a domain having transcriptional repression activity of At4g36990 gene. FIG. 3B is a diagram showing the influence of various peptides bound to pGAL4DB on the activity of the reporter gene (relative Activity). In the figure, the graph on the right side shows the activity of the reporter gene when an effector plasmid having various DNA fragments is introduced (the activity of the reporter gene when PUC18 is used as an effector is set to 1.00). FIG. 4A is a schematic diagram of various gene-transcription repressor peptide fusion constructs introduced into a plant body. FIG. 4B shows the form of AG-SRDX flowers. FIG. 4C is a form of AG-36RD flower. Fig. 4D shows the seedling form of CUC2-SRDX. FIG. 4E is a seedling form of CUC2-36RD.

Hereinafter, the present invention will be described in more detail.
In the present invention, there is provided a peptide that is a transcriptional repressing factor consisting of an amino acid sequence represented by the following formula (I) and has a function of converting a transcription factor into a transcriptional repressing factor.

Formula (I)
X1-X2-Leu-Phe-Gly-Val-X3

In the above formula (I), X2 represents Lys or Arg. X1 and X3 may be any amino acid, and the number of amino acids constituting the amino acid sequences of X1 and X2 may be any number as long as each is within the range of 1 to 10. From the viewpoint of ease of synthesis of the peptide to be used, the shorter one is better, but in order to surely increase the suppression effect, the total number of X1 and X3 is preferably 3 or more. More preferably, X1 + X3 is 6 or more, more preferably 10 or more.
Examples of the optimal peptide in the present invention include the amino acid sequences shown in SEQ ID NOs: 3 to 33 consisting of 8 to 15 amino acids. Peptides having an amino acid sequence in which 1 to several amino acids are deleted, substituted, or added in the X1 or X3 portion of the amino acid sequences shown in SEQ ID NOs: 3 to 33 are also preferred as the peptides of the present invention. Here, “1 to several” means 1 to 10, preferably 1 to 7, more preferably 1 to 5, and further preferably about 1 to 3.
The conserved motif contained in the transcription repressing peptide of the present invention is “K / RLFGV”, and has an amino acid sequence different from the motif (L / F) DLN (L / F) (X) P shown in the above prior art. The motif is completely different from the motif “DLELLL” in the amino acid sequence encoded by the SUP gene, which has been found by the present inventors to have a transcriptional repression function.
Since these transcription repressing peptides are short, they can be easily chemically synthesized. However, nucleic acid molecules encoding these peptides can be linked to an appropriate expression vector and produced by transformed cells. When acting as a transcription repressing factor in a plant body, plant cell, or yeast cell, a nucleic acid molecule encoding the transcription repressing peptide is introduced into the cell with or without being connected to the expression vector, and the transcription repressing function in the cell May be exhibited.

In the present invention, there is also provided a chimeric protein having a transcriptional repression function in which any of the above transcriptional repression peptides is bound to a transcription factor or a DNA binding domain thereof.
In that case, each peptide can be chemically peptide-bonded, but generally a nucleic acid molecule encoding the transcription repressing peptide of the present invention and a nucleic acid molecule encoding a transcription factor or its DNA binding domain Then, the chimeric gene combined in the reading frame is placed under the control of an appropriate promoter, and is expressed in a cell containing the target gene to act on the target gene. That is, the chimeric gene is linked to a promoter sequence, a plant body or a plant cell is transformed with or without an expression vector, and the chimeric gene is expressed in the transformed cell to produce a chimeric protein as an expression product. . In this chimeric protein as well, the transcription factor-derived DNA binding region binds to the transcriptional control region of the target gene, but the transcription repression function derived from the transcription repressor peptide is exerted in preference to the transcription activation function originally possessed by the transcription factor. Therefore, transcription of the target gene is suppressed and expression does not occur.

The transcription repression function by the chimeric protein of the present invention acts regardless of the type of DNA binding domain of the transcriptional regulator. Since the transcription repressing function of the chimeric protein of the present invention requires binding to the transcription control region of the target gene, the gene encoding the chimeric protein is a DNA binding domain that binds to the transcription control region of the specific target gene. A chimera fused with a gene that forms a transcription control complex with a transcription factor that binds to the transcription control region of the transcriptional control gene of the target or a nucleic acid sequence that encodes the DNA binding domain of the transcription control gene and the transcription control region of a specific target gene Transcriptional repression can be performed targeting a specific gene as a gene.

That is, the chimeric gene of the present invention expresses a chimeric protein in which a transcription factor is linked to a peptide having a function of converting a transcription factor into a transcriptional repressor, and a transcription factor-derived DNA binding domain in the chimeric protein binds. It specifically suppresses the transcription of genes controlled by the control region. Therefore, when transcriptional repression of a specific gene is performed, a transcription factor that governs the transcription of the gene is selected, and the gene of the present invention is linked to the end of the gene encoding the transcription factor or a DNA binding domain. What is necessary is just to construct | assemble a gene, connect this gene to a suitable vector, introduce | transduce into the living body site which wants to suppress the transcription | transfer of the said specific gene, and to suppress the transcription | transfer of the said specific gene.
Furthermore, the chimeric protein, which is the above-described chimeric gene expression product of the present invention, specifically suppresses transcription of the gene to which the DNA binding domain of the transcription factor binds, and this transcriptional suppression appears as a dominant trait.

By expressing the transcriptional repressor peptide of the present invention by fusing it to a transcriptional activator, the function of the transcriptional activator is converted to a transcriptional repressor and the transcription of the target gene that the transcription factor should be activated is specified. In addition, in order to prove dominant suppression, a method similar to the method used by the present inventors in the above Patent Documents 1 to 8 and Non-Patent Documents 1 to 3, that is, the CRES-T method is used. Applied.
This will be described in more detail by taking the case of using an AGAMOUS (AG) transcription factor as an example.
AGAMOUS is a transcriptional activator that acts on the flower organ formation in Arabidopsis thaliana, and in the ag mutant lacking the function of this gene, the stamen and pistil petals, and the formation of flower organs does not end, and petals are formed one after another. It is known that it will eventually become a so-called double-flowered flower with many petals. When a gene encoding a peptide containing the “K / RLFGV” motif of the present invention is fused to this transcriptional activator AG and expressed in Arabidopsis thaliana, the known (L / F) DLN (L / F) ( X) As in the case of the P motif (Non-patent Document 2), double-flowered flowers were obtained. This indicates that the AG gene having transcription activation ability was functionally converted to a transcription repressing factor by fusing with the transcription repressing peptide of the present invention, and further, it acted dominantly to the endogenous AG gene. Show.

This will be described in more detail by taking as an example the case where a CUP-SHAPEDCOTYLEDON1 (CUC2) transcription factor is used (Non-patent Document 3).
CUC2 is a transcription factor that controls the formation of seedling apical buds together with CUC1 having the same NAC domain, and the cotyledon of the plant body has a cup-like form only when both CUC1 and CUC2 genes have mutations ( cup-sahped cotyledon), and it has been shown that no apical meristem formation occurs. On the other hand, since one having a mutation in only one of CUC1 or CUC2 is normal, CUC1 and CUC2 are known to be functionally redundant factors (Development, 126, 1563). 1999; Development, 128, 1127, 2000). Of these CUC1 and CUC2 transcription factor genes having overlapping functions, when a chimeric gene in which a gene encoding the peptide of the present invention is bound to one CUC2 gene is expressed in a plant body, the expressed chimeric protein is In addition to the CUC2 transcription factor, the transcriptional activity of functionally overlapping CUC1 transcription factors can be suppressed, and the expression of genes controlled by the CUC2 transcription factor can be suppressed. In this case, the cotyledon of the plant body has a cup-shaped cotyledon shape which is a trait of a double mutant of CUC1 / CUC2, and no apical meristem is formed. In Example 6 described later, as a result of constructing a chimeric gene in which a gene encoding a peptide containing the “K / RLFGV” motif of the present invention and the CUC2 gene were fused, and transforming an Arabidopsis thaliana plant with the chimeric gene, CUC1 / CUC2 As well as a STM gene-deficient strain that controls the formation of a cup-shaped cotyledon that is characteristic of being a double-deficient strain of and controls the formation of apical mitotic cells that are controlled by the CUC2 transcription factor It was confirmed that no apical meristem formation was observed. This indicates that the CUC2 transcription factor having a transcriptional activation function was functionally converted to a transcriptional repressor by fusion with the peptide of the present invention, and not only the CUC2 transcription factor but also functionally overlapping CUC1 It also indicates that the activity of transcription factors is also preferentially suppressed and the expression of downstream genes is suppressed. This result is the same as the result (Non-patent Document 3) using a conventionally known transcription inhibitory peptide containing the “(L / F) DLN (L / F) (X) P” motif.

As can be understood from the above, the peptide of the present invention and the gene encoding the peptide have the ability to convert an arbitrary transcription factor into a transcription repressor, and other functionally redundant transcripts. It also has the ability to suppress factor activity.
On the other hand, in many cases, plant transcription factors often have a plurality of functionally overlapping transcription factors as shown by CUC, and the transcriptional repressors functionally converted according to the present invention are dominant traits (dominant traits). Therefore, according to the present invention, it is possible to analyze the function of a transcription factor that has not been clarified so far by knockout of one gene, and it is also effective for plants having a double diploid genome such as wheat. This is an extremely useful means in that it can act on the surface.

As described above, the chimeric gene of the present invention suppresses transcription of the target gene by generating a chimeric protein corresponding to the gene and binding the chimeric protein to the transcriptional regulatory region of the target gene. Thus, this chimeric protein may be synthesized separately and directly introduced into a living body site where the target gene exists.
The synthesis of the chimeric protein may be carried out using a normal genetic engineering technique. For example, the chimeric protein is incorporated into an appropriate vector, and the transformed microorganism is cultured using the chimeric gene. A large amount of protein can be synthesized.
The binding position of the gene of the present invention to the transcription factor is the downstream end of the region encoding the transcription factor or its DNA binding domain. When a gene encoding the peptide of the present invention is to be inserted into a gene encoding a transcription factor, it involves troublesome operations such as cleavage of the gene encoding the transcription factor, ligation of the gene of the present invention, and recombination. It is convenient to simply bind the gene of the present invention to the downstream end of the protein coding region of the transcription factor. This is one of the advantages of the present invention.
In addition, as long as the gene of this invention codes the peptide which has an amino acid sequence represented by the said Formula (I), what kind of base sequence may be sufficient as it. In addition, the gene of the present invention may be provided with a linking site for linking to a gene encoding a transcription factor, and when the amino acid reading frame of the gene of the present invention and the gene reading frame encoding the transcription factor do not match. Design genes to match. Therefore, you may have the additional base sequence for that. For example, as a base sequence encoding the amino acid sequence represented by the formula (I), there is 5′-GGGAGGCAACTCGAAGACATTAAGACTGTTCGGAGTGAACATGGAGTGCTAA-3 ′ (SEQ ID NO: 65).

In the present invention, in order to suppress the transcription of the target gene, the chimeric protein may be directly introduced into the living body. For example, when performing plant variety improvement, the transcription of a specific gene is constantly suppressed, It is necessary to suppress the expression of the gene, and it is more effective to link the gene encoding the chimeric protein to an appropriate vector and transform a plant or the like using this recombinant vector. Thereby, the gene encoding the chimeric protein is constantly expressed in the plant body, and the generated chimeric protein continues to suppress the transcription of the gene. In addition, as long as the introduced chimeric protein is produced in the subsequent generations of plants derived from the transformed plant into which the gene has been introduced (including plants produced by crossing using transformed pollen, etc.) Gene expression is suppressed.

Examples of the present invention will be described below, but the present invention is not particularly limited to these examples.

In Example 1, (i) various At2g36080 fragments combined with a region encoding the DNA binding domain of the yeast GAL4 transcription factor were linked downstream of the cauliflower mosaic virus 35S promoter that functions in plant cells. While constructing the plasmid, (ii) a reporter gene comprising a luciferase gene in which the enhancer region of the cauliflower mosaic virus 35S promoter, the GAL4 protein binding DNA sequence, and the TATA region of the 35S promoter of cauliflower mosaic virus were linked to the promoter region. These effector plasmid and reporter gene are simultaneously introduced into Arabidopsis thaliana leaves using a particle gun, and the activity of the luciferase gene, which is a reporter gene, is measured, thereby a gene encoding a protein having the entire amino acid sequence of At2g36080, and The transcriptional repression ability of a gene encoding the At2g36080 partial protein having a 178-192 amino acid sequence was examined.
In Example 2, the ability to suppress transcription of a gene encoding the At2g36080 partial protein having the 183-192 amino acid sequence of At2g36080 was examined by measuring the activity of luciferase, which is a reporter gene.
In Example 3, the transcriptional repression ability of a gene encoding a protein of At3g11580, At2g46870, At1g13260, At1g68840, At4g36990, At4g11660 genes having R / KLFGV amino acid sequence was examined by measuring luciferase activity which is a reporter gene.
In Example 4, the ability to suppress the transcription of a gene encoding the At4g36990 partial protein having the 233-243 amino acid sequence of At4g36990 was examined by measuring the activity of luciferase, which is a reporter gene.
In Example 5, a gene fragment encoding GNSKLTLRLFGVNMEC (36RD; Repression domain 178-192 of At2g36080) was ligated to the AG gene which is a transcription factor in an actual plant, and this was linked downstream of the cauliflower mosaic virus 35S promoter. By constructing a transformed plasmid, introducing the plasmid into an Arabidopsis plant, and observing the morphology of the flower of the transformed plant, the effect of suppressing the transcription function of the gene fragment on the target gene of the AG gene was examined. .
In Example 6, a gene fragment encoding GNSKLTLRLFGVNMEC (36RD; repression domain 178-192 of At2g36080) was ligated to the CUC2 gene which is a transcription factor in an actual plant, and this was linked downstream of the cauliflower mosaic virus 35S promoter. The CUC2 gene and the CUC1 gene functionally overlapping with the gene are observed by constructing a transformed plasmid and observing the morphology of the cotyledons after germination of the transformed plant prepared by introducing the plasmid into an Arabidopsis plant. It was investigated the effect of suppressing the transcription function of the above gene fragment on the target gene.

(Example 1) Transcriptional repression by an effector plasmid containing At2g36080 gene (1-1) Construction of effector plasmid vector p35S- GAL4DBD Plasmid pBI221 of Clontech (Clontech, USA) was transformed into restriction enzymes XhoI and SacI. After digestion with T4 polymerase and blunt end treatment, the GUS gene was removed by agarose gel electrophoresis, and the transcription termination region of the cauliflower mosaic virus 35S promoter (hereinafter referred to as CaMV 35S) and the nopaline synthase gene (Nos terminator, hereinafter referred to as Nos-). 35S-Nos plasmid fragment DNA containing ter) was obtained.
Clonetech pAS2-1 vector was digested with restriction enzyme HindIII, and a 748 bp DNA fragment (hereinafter referred to as GAL4DBD) encoding the DNA binding region (1-147 amino acid residues) of yeast GAL4 protein was subjected to agarose gel electrophoresis. And then blunt-ended with T4 DNA polymerase. The DNA fragment containing the GAL4DBD coding region was inserted into the 35S-Nos DNA at the site of the blunt end between the 35S promoter and Nos terminator, and the ORF of the DNA binding region of the yeast GAL4 protein was compared to the 35S promonitor. A vector arranged in the forward direction was selected to construct a p35S-GAL4DBD vector.

(1-2) Construction of effector plasmid (FIG. 1A)
(1-2-1) Construction of effector plasmid pGAL4-At2g36080 containing the entire protein coding region (1-244aa.) Of At2g36080 gene At2g36080 gene 5-terminal upper primer primer1 designed to match the reading frame (frame) of GAL4DBD on the 'side and 3' side (binding to At2g36080 gene / base sequence 1-29):
gATGTCAATAAACCAATACTCAAGCGATTT (SEQ ID NO: 34),
3-terminal lower primer primer1 having a restriction enzyme SalI site (binding to At2g36080 gene base sequence 710-735):
gtcgacgtcgacTTAGCTCGTCCGGTTCATATCTCCT (SEQ ID NO: 35)
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and cDNA derived from Arabidopsis seedlings as a template, and a DNA fragment containing the protein coding region of the At2g36080 gene was isolated. This DNA fragment is digested with the restriction enzyme SalI, the target DNA fragment is isolated by agarose electrophoresis, incorporated into the 35S-GAL4DBD plasmid previously digested with the restriction enzymes SmaI and SalI, and the nucleotide sequence is determined. The protein coding region of the At2g36080 gene that has already been reported was confirmed.
The PCR reaction was performed for 30 cycles, with a denaturation reaction at 94 ° C. for 1 minute, an annealing reaction at 50 ° C. for 1 minute, and an extension reaction at 72 ° C. for 3 minutes.

(1-2-2) Construction of effector plasmid pGAL4-At2g36080-1stEX containing amino acid sequence 1-169 of At2g36080 gene 5-terminal upper primer primer1 of At2g36080 gene designed to match the reading frame (frame) with GAL4DBD
gATGTCAATAAACCAATACTCAAGCGATTT (SEQ ID NO: 34),
Lower primer primer 2 (binding to At2g36080 gene base sequence 491-506):
AATAAAAAGGGTACCTGCATGAGGATAATA (SEQ ID NO: 36)
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and pGAL4-At2g36080 as a template, and a DNA fragment containing the amino acid sequence 1-169 of the At2g36080 gene was isolated. This DNA fragment is inserted into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the nucleotide sequence is determined, and the sequence encoding the region containing the amino acid sequence 1-169 of the At2g36080 gene that has already been reported I confirmed that there was.
The conditions for the PCR reaction are the same as in (1-2-1) above.

(1-2-3) Construction of effector plasmid pGAL4-de178 to 192 of the At2g36080 gene lacking the amino acid sequence 178-192 Primer1 of the 5-terminal upper primer of the At2g36080 gene designed to match the reading frame (frame) with GAL4DBD :
gATGTCAATAAACCAATACTCAAGCGATTT (SEQ ID NO: 34),
Lower primer primer3 having a restriction enzyme BglII site (binding to At2g36080 gene base sequence 511-531):
AGATCTAGATCTTTGGCTCTCCACCGCTTG (SEQ ID NO: 37)
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using pGAL4-At2g36080 as a template using these as primers, and a DNA fragment containing the amino acid sequence 1-178 of the At2g36080 gene was isolated. This DNA fragment was inserted into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the nucleotide sequence was determined, and the sequence coding for the previously reported region containing the amino acid sequence 1-178 of the At2g36080 gene It was confirmed that it was pGAL4-1-178.
Upper primer primer2 having a restriction enzyme BglII site (binding to nucleotide sequence 577-598 of At2g36080 gene):
agatctagatctCAGCTAGATTCGGACTGGTC (SEQ ID NO: 38);
3-terminal lower primer primer1 having a restriction enzyme SalI site (binding to At2g36080 gene base sequence 710-735):
gtcgacgtcgacTTAGCTCGTCCGGTTCATATCTCCT (SEQ ID NO: 35)
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and pGAL4-At2g36080 as a template, and a DNA fragment containing the amino acid sequence 193-244 of the At2g36080 gene was isolated. This DNA fragment is digested with the restriction enzymes BglII and SalI, and the desired DNA fragment is isolated by agarose electrophoresis and incorporated into the pGAL4-1-178 plasmid previously digested with the restriction enzymes BglII and SalI. The sequence was determined, and it was confirmed that it was a sequence encoding a protein lacking the amino acid number 178 to 192 region from the previously reported amino acid sequence of the At2g36080 gene.
The conditions for the PCR reaction are the same as in (1-2-1) above.

(1-2-4) Construction of effector plasmid pGAL4-178 / 192 having partial amino acid sequence 178-192 of At2g36080 gene Partial sequence 1 of At2g36080 gene designed to match GAL4DBD and reading frame (frame) 39: equivalent to At2g36080 gene base sequence 532-576):
aGGCAACTCGAAGACATTAAGACTGTTCGGAGTGAACATGGAGTGCTAA and its complementary sequence, partial sequence 2 (SEQ ID NO: 40, corresponding to the complementary sequence of At2g36080 gene base sequence 532-576):
TTAGCACTCCATGTTCACTCCGAACAGTCTTAATGTCTTCGAGTTGCCT
Double-stranded DNA fragments synthesized, respectively, mixed and heated at 90 ° C. for 2 minutes, then heated at 60 ° C. for 1 hour, and then allowed to stand at room temperature (25 ° C.) for 2 hours for annealing. Got. This DNA fragment was inserted into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the nucleotide sequence was determined, and the sequence encoding the previously reported region containing the amino acid sequence 178-192 of the At2g36080 gene I confirmed that there was.

(1-3) Construction of reporter gene (FIG. 1A)
(1-3-1) Construction of p35S-GAL4-LUC reporter gene (FIG. 1A)
Plasmid pUC18 was digested with restriction enzymes EcoRI and SstI. The pBI221 plasmid (Clontech) was digested with restriction enzymes EcoRI and SstI, and a 270 bp DNA fragment containing a Nos-ter (nopaline synthase terminator) region was isolated by agarose gel electrophoresis. The obtained fragment was inserted into the EcoRI-SstI site of plasmid pUC18 which had been digested with restriction enzymes EcQRI and SstI. Complementary DNA containing the cauliflower mosaic virus 35S promoter TATA box DNA1: AGCTTAGATCTGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGGACACGCTG (SEQ ID NO: 41) and DNA2: GATCCAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTCTTGCAGATCTA (SEQ ID NO: 42)
The synthesized DNA was heated at 90 ° C. for 2 minutes, then heated at 60 ° C. for 1 hour, and then allowed to stand at room temperature (25 ° C.) for 2 hours for annealing to form a double strand. The pUC18 plasmid with Nos-ter was digested with restriction enzymes HindIII and BamHI. The synthesized double-stranded DNA was inserted into the HindIII-BamHI site of pUC18 to construct a plasmid containing TATA-box and Nos-ter.
This plasmid was digested with the restriction enzyme SstI and blunt-ended with T4 DNA polymerase.
A plasmid vector PGV-CS2 (manufactured by Toyo Ink Co.) having a firefly luciferase gene (LUC) was digested with restriction enzymes XbaI and NcoI, blunt-ended with T4 DNA polymerase, and then luciferase by agarose gel electrophoresis. A 1.65 kb DNA fragment containing the gene was isolated and purified. This DNA fragment was inserted into a plasmid containing the above TATA box and Nos terminator to construct a pTATA-LUC reporter gene.
Plasmid pG5CAT (manufactured by Clontech) having 5 copies of the yeast GAL4 protein DNA binding sequence was digested with restriction enzymes SmaI and XbaI, blunt-ended with T4 DNA polymerase, and then 5 copies of GAL4 protein DNA binding. The DNA fragment containing the sequence was purified by agarose gel electrophoresis. The TATA-LUC vector was digested with the restriction enzyme BglII and blunt-ended with T4 DNA polymerase. A DNA fragment containing 5 copies of the GAL4 protein DNA-binding sequence blunt-ended is inserted into this site, and a plasmid with the GAL4 protein DNA-binding sequence oriented in the forward direction is selected from the obtained plasmids, and the reporter gene pGAL4 is selected. -Constructed LUC.
Furthermore, using the plasmid pBI121 as a template, a 5-terminal upper primer: CGCCAGGGTTTTCCCAGTCACGAC (SEQ ID NO: 43) and a 3-terminal lower primer:
AAGGGTAAGCTTAAGGATAGTGGGATTGTGCGTCATC (SEQ ID NO: 44)
A DNA fragment containing the −800 to −46 region of the CaMV 35S promoter was obtained. After digestion with the restriction enzyme HindIII, a 760 bp DNA fragment containing the CaMV 35S promoter -800 to -46 region was isolated by agarose gel electrophoresis. This HindIII fragment was inserted into the reporter gene pGAL4-LUC previously digested with the restriction enzyme HindIII, and the one with the CaMV 35S promoter DAN facing in the forward direction was selected to construct the p35S-GAL4-LUC reporter gene. (See FIG. 1A).

(1-4) Construction of Reference Gene Promega's cassette vector pRL-null having a Renilla luciferase gene was cleaved with restriction enzymes NheI and XbaI and subjected to blunt end treatment with T4 DNA polymerase, and then agarose. A 948 bp DNA fragment containing the Renilla luciferase gene was purified by gel electrophoresis. This DNA fragment was inserted into the region where the GUS gene of the pBI221 vector was removed except for the GUS gene used in the construction of the effector plasmid. Among the obtained plasmids, those having the Renilla luciferase gene in the forward direction were selected (construction of pPTRL).

(1-5) Method for Measuring Reporter Gene Activity A reporter gene and an effector plasmid were introduced into an Arabidopsis thaliana plant using the particle gun method, and the effector effect was examined by measuring the activity of the reporter gene.

(1-6) Gene transfer by particle gun 1.6 mg of the p35S-GAL4-LUC reporter gene prepared above, 1.2 mg of each of the effector plasmid pGAL4DB-RD, and 0.4 mg of the reference gene plasmid are gold having a diameter of 1 mm. Coated to 510 mg of granules (manufactured by BioRad). Seven Arabidopsis leaves on the 21st day of growth were placed in a 9 cm petri dish with filter paper moistened with water, and DNA was implanted using a PDS-1000 / He bombardment machine manufactured by Bio-Rad. After standing at 22 ° C. for 6 hours in a light place, the activity of the reporter gene was measured.

(1-7) Measurement of luciferase activity Arabidopsis leaves that were allowed to stand for 6 hours were pulverized in liquid nitrogen and suspended in 200 μl of Passive Lysis Buffer attached to Dual-Luciferase ™ Reporter System (Promega). The supernatant was collected by centrifugation. 20 μl of this cell extract was mixed with 100 μl of measurement buffer attached to Dual-Luciferase ™ Reporter Assay System (Promega), and luciferase activity was measured using a luminometer (TD20 / 20, Turner Design). . Measurement of firefly luciferase and Renilla luciferase activity was carried out by counting the luminescence for 10 seconds in the integration mode according to the instruction of the measurement kit. The activity value of the reference gene was divided by the activity value of the reporter gene, and the relative value of the relative luciferase activity was determined as a measurement value. In the experiment, transient assay experiments were individually performed three times for each type of effector plasmid, and an average value and a standard deviation were obtained. When the relative value of the activity of the p35S-GAL4-LUC reporter gene when PUC18 is inserted as an effector is 1, variation in the activity value of the reporter gene when an effector plasmid in which each DNA fragment is fused to GAL4DBD is simultaneously introduced into the cell The effector effect was investigated. That is, when an effector plasmid incorporating a DNA encoding the p35S-GAL4-LUC reporter gene and each peptide sequence is introduced, if the activity value of the reporter decreases, the peptide suppresses the activity of the reporter gene (religion). This indicates that there is a presser function. Hereinafter, the activity value of the reporter was measured, and when the relative activity value of the p35S-GAL4-LUC reporter was 1 or less, it was determined that the introduced effector had a repressor function.

(1-8) Identification of Repressor Domain FIG. 1A shows the structure of a reporter gene and an effector plasmid. FIG. 1B shows the measurement results of the reporter gene activity.
As shown in FIG. 1B, the effector containing the full length of AT2G36080 or the amino acid number 178-192 of At2g36080 gene decreased the activity of the reporter gene by 75 to 90% or more compared to the case where the reporter gene activity was introduced as a PUC18 effector (control). From these results, it was proved that these peptides have transcription repressive ability. On the other hand, the peptide consisting of amino acids 1-169 of AT2G36080 or the effector plasmid of At2g36080 gene lacking amino acid sequence 178-192 did not decrease the activity of the reporter gene. This indicates that the region containing amino acid numbers 178 to 192 of the At2g36080 gene bound to the GAL4 DNA binding domain functions as a repressor that suppresses transcription.

(Example 2) Identification of peptide functioning as a repression domain (2-1) Construction of effector plasmid pGAL4-183 / 192 having partial amino acid sequence 183-192 of At2g36080 gene Matching reading frame (frame) with GAL4DBD Partial sequence 3 of At2g36080 gene designed in (SEQ ID NO: 45: equivalent to At2g36080 gene / base sequence 547-576): TTAAGACTGTTCGGAGTGAACATGTAA and its complementary sequence partial sequence 4 (SEQ ID NO: 46: complement of At2g36080 gene base sequence 547-576) (Corresponding to the sequence) oligonucleotides having TTACATGTTCACTCCGAACAGTCTTAA: were synthesized, mixed, heated at 90 ° C. for 2 minutes, then heated at 60 ° C. for 1 hour, and then allowed to stand at room temperature (25 ° C.) for 2 hours for annealing. To obtain a double-stranded DNA fragment. This DNA fragment was inserted into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the nucleotide sequence was determined, and the sequence encoding the previously reported region containing the amino acid sequence 178-192 of the At2g36080 gene I confirmed that there was.

(2-2) Gene transfer and measurement of luciferase activity A p35S-GAL4-LUC reporter gene was constructed by the same method as in Example (1-3-1), and a reference gene ( pPTRL) was constructed.
Similarly to the method for measuring the activity of the reporter gene described in Example (1-5), a reporter gene and an effector plasmid are used in an Arabidopsis plant using the same particle gun method as in (1-6). The effector effect was examined by measuring the activity of the reporter gene.
The luciferase activity of the cell extract of Arabidopsis leaves that was allowed to stand for 6 hours was measured in the same manner as the luciferase activity measurement in (1-6) above, and the relative luciferase activity was determined as the measurement value. In the experiment, transient assay experiments were individually performed three times for each type of effector plasmid, and an average value and a standard deviation were obtained. When the relative value of the activity of the p35S-GAL4-LUC reporter gene when PUC18 is inserted as an effector is 1, variation in the activity value of the reporter gene when an effector plasmid in which each DNA fragment is fused to GAL4DBD is simultaneously introduced into the cell The effector effect was investigated. That is, when an effector plasmid pGAL4DB-RD incorporating a p35S-GAL4-LUC reporter gene and DNA encoding each peptide sequence is introduced, if the activity value of the reporter decreases, the peptide suppresses the activity of the reporter gene. It shows that there is an effect (repressor function). Hereinafter, the activity value of the reporter was measured, and when the relative activity value of the p35S-GAL4-LUC reporter was 1 or less, it was determined that the introduced effector had a repressor function.

(2-3) Identification of Repressor Domain FIG. 1C shows the structure of the reporter gene and effector plasmid. FIG. 1D shows the measurement results of the reporter gene activity.
As shown in FIG. 1D, an effector containing the region of amino acid numbers 178 to 192 of the At2g36080 gene or the region of amino acid numbers 183 to 192 of the At2g36080 gene shows the activity of the reporter gene when PUC18 is added as an effector (control). ), It was proved that these peptides have transcriptional repression ability.
This indicates that the At2g36080 gene fragment (183-190aa.) Bound to the GAL4 DNA binding domain functions as a repressor that suppresses transcription.

(Example 3) Transcriptional repression by an effector plasmid containing a gene having an R / KLFGV amino acid sequence (3-1) Construction of an effector plasmid (3-1-1) Effector plasmid pGAL4-containing the entire protein coding region of the At3g11580 gene Construction of At3g11580 The nucleotide sequence of the At3g11580 gene is 5 of the At3g11580 gene designed so that the GAL4DBD reading frame (frame) matches the 5 'side and 3' side of the protein coding region of the Arabidopsis At3g11580 gene already reported. End upper primer primer (SEQ ID NO: 47: equivalent to At3g11580 gene / base sequence 1-29):
gATGTCAGTCAACCATTACCACAACACTCT
And a 3-terminal lower primer primer having a restriction enzyme SalI site (SEQ ID NO: 48, corresponding to the nucleotide sequence 782-804 of At3g11580 gene):
GTCGACGTCGACtcaACCTCGTCCATCTCCTACCTG
Each of the oligonucleotides having a sequence corresponding to was synthesized, and PCR was performed using these as primers and a cDNA derived from Arabidopsis seedlings as a template to isolate a DNA fragment containing the protein coding region of the At3g11580 gene. This DNA fragment is digested with the restriction enzyme SalI, the target DNA fragment is isolated by agarose electrophoresis, incorporated into the 35S-GAL4DBD plasmid previously digested with the restriction enzymes SmaI and SalI, and the nucleotide sequence is determined. The protein coding region of the At3g11580 gene that has already been reported was confirmed. The PCR reaction was performed for 30 cycles, with a denaturation reaction at 94 ° C. for 1 minute, an annealing reaction at 50 ° C. for 1 minute, and an extension reaction at 72 ° C. for 3 minutes.

(3-1-2) Construction of effector plasmid pGAL4-At2g46870 containing the entire protein coding region of At2g46870 gene The nucleotide sequence of At2g46870 gene is the 5 ′ side and 3 ′ side of the protein coding region of Arabidopsis At2g46870 gene already reported. Furthermore, the At2g46870 gene 5-terminal upper primer designed to match the reading frame (frame) of GAL4DBD (SEQ ID NO: 49, equivalent to At2g46870 gene / base sequence 1-29): gATGATGACAGATTTATCTCTCACGAGAGA
And 3 lower end primer primer (SEQ ID NO: 50: equivalent to At2g46870 gene base sequence 910-933): TTATTGATCCAAATCAAAAGACAA
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and a cDNA derived from Arabidopsis sheath as a template, and a DNA fragment containing the protein coding region of the At2g46870 gene was isolated. After inserting this DNA fragment into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the orientation and base sequence of the insert were determined, and it was confirmed that it was the protein coding region of the At2g46870 gene already reported. did. The PCR reaction conditions are the same as in (3-1-1) above.

(3-1-3) Construction of effector plasmid pGAL4-At1g13260 containing the entire protein coding region of At1g13260 gene The nucleotide sequence of At1g13260 gene is the 5 ′ side and 3 ′ side of the protein coding region of Arabidopsis At1g13260 gene already reported. In addition, the At1g13260 gene 5-terminal upper primer designed to match the reading frame (frame) of GAL4DBD (SEQ ID NO: 51, equivalent to At1g13260 gene / base sequence 1-22): GATGGAATCGAGTAGCGTTGATG
And the 3rd lower primer primer (SEQ ID NO: 52: equivalent to At1g13260 gene base sequence 1012-1035): TTACGAGGCGTGAAAGATGCGTTG
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and cDNA derived from Arabidopsis seedlings as a template, and a DNA fragment containing the protein coding region of the At1g13260 gene was isolated. After inserting this DNA fragment into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the orientation and base sequence of the insert were determined, and it was confirmed that it was the protein coding region of the At1g13260 gene already reported. did. The PCR reaction conditions are the same as in (3-1-1) above.

(3-1-4) Construction of effector plasmid pGAL4-At1g68840 containing the entire protein coding region of At1g68840 gene The nucleotide sequence of At1g68840 gene is 5 ′ and 3 ′ of the protein coding region of Arabidopsis thaliana At3g11580 At1g68840 gene already reported. On the side, the At1g68840 gene 5-terminal upper primer designed to match the reading frame (frame) of GAL4DBD (SEQ ID NO: 53, equivalent to At1g68840 gene / base sequence 1-22): GATGGATTCTAGTTGCATAGACG
And the 3rd lower primer primer (SEQ ID NO: 54: equivalent to At1g68840 gene base sequence 1035-1059): TTACAAAGCATTGATTATCGCCTGC
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and a cDNA derived from Arabidopsis seedlings as a template, and a DNA fragment containing the protein coding region of the At1g68840 gene was isolated. After inserting this DNA fragment into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the orientation and base sequence of the insert region were determined, and it was confirmed that the protein coding region of the At1g68840 gene had already been reported. confirmed. The PCR reaction conditions are the same as in (3-1-1) above.

(3-1-5) Construction of effector plasmid pGAL4-At4g36990 containing the entire protein coding region of At4g36990 gene The nucleotide sequence of At4g36990 gene is the 5 ′ side and 3 ′ side of the protein coding region of Arabidopsis At4g36990 gene already reported. In addition, the At4g36990 gene 5-terminal upper primer primer1 designed to match the reading frame (frame) of GAL4DBD (SEQ ID NO: 55: equivalent to At4g36990 gene / base sequence 1-29): gATGACGGCTGTGACGGCGGCGCAAAGATC
And a three-end lower primer primer1 having a restriction enzyme SalI site (SEQ ID NO: 56: equivalent to At4g36990 gene base sequence 823-855): gtcgacgtcgacTTAGTTGCAGACTTTGCTGCTTTTCCACAACGG
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and cDNA derived from Arabidopsis roots as a template, and a DNA fragment containing the protein coding region of the At4g36990 gene was isolated. This DNA fragment is digested with the restriction enzyme SalI, the target DNA fragment is isolated by agarose electrophoresis, incorporated into the 35S-GAL4DBD plasmid previously digested with the restriction enzymes SmaI and SalI, and the nucleotide sequence is determined. The protein coding region of the At4g36990 gene already reported was confirmed. The PCR reaction conditions are the same as in (3-1-1) above.

(3-1-6) Construction of effector plasmid pGAL4-At4g11660 containing the entire protein coding region of At4g11660 gene The nucleotide sequence of At4g11660 gene is the 5 ′ side and 3 ′ side of the protein coding region of Arabidopsis At4g11660 gene already reported. In addition, the At4g11660 gene 5-terminal upper primer designed to match the reading frame (frame) of GAL4DBD (SEQ ID NO: 57: equivalent to At4g11660 gene / base sequence 1-29): gATGCCGGGGGAACAAACCGGAGAAACTCC
And a three-end lower primer primer having a restriction enzyme SalI site (SEQ ID NO: 58, corresponding to the nucleotide sequence 1108-1134 of At4g11660 gene): gtcgacgtcgacTCATTTTCCGAGTTCAAGCCACGACCC
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and a cDNA derived from Arabidopsis roots as a template, and a DNA fragment containing the protein coding region of the At4g11660 gene was isolated. This DNA fragment is digested with the restriction enzyme SalI, the target DNA fragment is isolated by agarose electrophoresis, incorporated into the 35S-GAL4DBD plasmid previously digested with the restriction enzymes SmaI and SalI, and the nucleotide sequence is determined. The protein coding region of the At4g11660 gene that has already been reported was confirmed. The PCR reaction conditions are the same as in (3-1-1) above.

(3-2) Gene transfer and luciferase activity measurement A p35S-GAL4-LUC reporter gene was constructed by the same method as in Example (1-3-1), and a reference gene ( pPTRL) was constructed.
Similarly to the method for measuring the activity of the reporter gene described in Example (1-5), a reporter gene and an effector plasmid are used in an Arabidopsis plant using the same particle gun method as in (1-6). The effector effect was examined by measuring the activity of the reporter gene.
The luciferase activity of the cell extract of Arabidopsis leaves that was allowed to stand for 6 hours was measured in the same manner as the luciferase activity measurement in (1-6) above, and the relative luciferase activity was determined as the measurement value. In the experiment, transient assay experiments were individually performed three times for each type of effector plasmid, and an average value and a standard deviation were obtained. When the relative value of the activity of the p35S-GAL4-LUC reporter gene when p35S-GAL4DBD is inserted as an effector is 1, the activity value of the reporter gene when the effector plasmid fused with each DNA fragment to GAL4DBD is simultaneously introduced into the cell The effect of the effector was investigated. That is, when an effector plasmid pGAL4DB-RD incorporating a p35S-GAL4-LUC reporter gene and DNA encoding each peptide sequence is introduced, if the activity value of the reporter decreases, the peptide suppresses the activity of the reporter gene. It shows that there is an effect (repressor function). Hereinafter, the activity value of the reporter was measured, and when the relative activity value of the p35S-GAL4-LUC reporter was 1 or less, it was determined that the introduced effector had a repressor function.

(3-3) Identification of Repressor FIGS. 2A to 2G show measurement results of reporter gene activity.
As shown in FIGS. 2A to 2G, an effector comprising a peptide in which a gene region encoding the protein of At3g11580, At2g46870, At1g13260, At1g68840, At4g36990, At4g11660 genes having the amino acid sequence of “R / KLFGV” is fused to GAL4DBD. Since the activity of the reporter gene was reduced by 82 to 96% compared to the case where p35S-GAL4DBD was added as an effector (control), it was proved that these peptides have transcription repressive ability. This indicates that the At3g11580, At2g46870, At1g13260, At1g68840, At4g36990, and At4g11660 genes bound to the GAL4 DNA binding domain function as repressors that suppress transcription.

Example 4 Identification of Repression Domain of At4g36990 (4-1) Construction of Effector Plasmid (4-1-1) Effector Plasmid pGAL4-At4g36990-233 / 243 Containing Partial Amino Acid Sequence (233-243) of At4g36990 Gene Construction of partial sequence 1 of the At4g36990 gene designed to match the reading frame (frame) with GAL4DBD (SEQ ID NO: 59, corresponding to At4g36990 gene / base sequence 697-729, having a SalI restriction enzyme site on the 3 ′ side): gGGTGAAGGATTGAAATTGTTTGGGGTGTGGTTGgtcgacgtcgac
And partial sequence 2 which is a complementary sequence thereof (SEQ ID NO: 60, corresponding to the complementary sequence of At4g36990 gene base sequence 697-729, having a SalI restriction enzyme site on the 5 ′ side): GTCGACGTCGACCAACCACACCCCAAACAATTTCAATCCTTCACCC
Double-stranded DNA fragments synthesized, respectively, mixed and heated at 90 ° C. for 2 minutes, then heated at 60 ° C. for 1 hour, and then allowed to stand at room temperature (25 ° C.) for 2 hours for annealing. Got. After inserting this DNA fragment into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the orientation and base sequence of the insert were determined, and the region containing the previously reported amino acid sequence 233-243 of the At4g36990 gene It was confirmed that the sequence encodes.

(4-1-2) Construction of effector plasmid pGAL4-mut236-243 of the At4g36990 gene in which a mutation was introduced into the amino acid sequence 236-243 5-prime upper primer of the At4g36990 gene designed to match the reading frame (frame) with GAL4DBD primer1 (SEQ ID NO: 55: equivalent to At4g36990 gene / base sequence 1-29): gATGACGGCTGTGACGGCGGCGCAAAGATC
And lower primer primer 2 (SEQ ID NO: 61: equivalent to At4g36990 gene base sequence 680-705): CCCCCCGCGGCTCCAGCTCCTTCACCTACCCCCTCCTCTGC
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and pGAL4-At4g36990 as a template, and a DNA fragment containing the amino acid sequence 1-236 of the At4g36990 gene was isolated. This DNA fragment was inserted into the 35S-GAL4DBD plasmid previously digested with the restriction enzyme SmaI, the nucleotide sequence was determined, and the sequence encoding the previously reported region containing the amino acid sequence 1-236 of the At4g36990 gene It was confirmed that there was pGAL4-1-236. Upper primer primer 2 (SEQ ID NO: 62: bound to At4g36990 gene / base sequence 732-752): gggccgcgggggcttgggctAAAGGAGAGAGAAAAAAGAGGG
And a three-end lower primer primer1 having a restriction enzyme SalI site (SEQ ID NO: 56: bound to At4g36990 gene base sequence 823-855): gtcgacgtcgacTTAGTTGCAGACTTTGCTGCTTTTCCACAACGG
Each of the oligonucleotides having a sequence corresponding to was synthesized, PCR was performed using these as primers and pGAL4-At4g36990 as a template, and a DNA fragment containing the amino acid sequence 244-283 of the At4g36990 gene was isolated. This DNA fragment is digested with the restriction enzyme SalI, the target DNA fragment is isolated by agarose electrophoresis, and incorporated into the pGAL4-1-236 plasmid previously digested with the restriction enzymes SmaI and SalI. It was determined and confirmed to be a sequence having an amino acid mutation in the region of amino acid numbers 236 to 243 from the previously reported amino acid sequence of the At4g36990 gene.
The PCR reaction was performed for 30 cycles, with a denaturation reaction at 94 ° C. for 1 minute, an annealing reaction at 50 ° C. for 1 minute, and an extension reaction at 72 ° C. for 3 minutes.

(4-2) Gene transfer and luciferase activity measurement The p35S-GAL4-LUC reporter gene was constructed in the same manner as in Example (1-3-1), and a reference gene ( pPTRL) was constructed.
Similarly to the method for measuring the activity of the reporter gene described in Example (1-5), a reporter gene and an effector plasmid are used in an Arabidopsis plant using the same particle gun method as in (1-6). The effector effect was examined by measuring the activity of the reporter gene.
The luciferase activity of the cell extract of Arabidopsis leaves that was allowed to stand for 6 hours was measured in the same manner as the luciferase activity measurement in (1-6) above, and the relative luciferase activity was determined as the measurement value. In the experiment, transient assay experiments were individually performed three times for each type of effector plasmid, and an average value and a standard deviation were obtained. When the relative value of the activity of the p35S-GAL4-LUC reporter gene when PUC18 is inserted as an effector is 1, variation in the activity value of the reporter gene when the effector plasmids in which each DNA fragment is fused to GAL4DBD are simultaneously introduced into the cell The effector effect was investigated. That is, when an effector plasmid pGAL4DB-RD incorporating a p35S-GAL4-LUC reporter gene and DNA encoding each peptide sequence is introduced, if the activity value of the reporter decreases, the peptide suppresses the activity of the reporter gene. It shows that there is an effect (repressor function). Hereinafter, the activity value of the reporter was measured, and when the relative activity value of the p35S-GAL4-LUC reporter was 1 or less, it was determined that the introduced effector had a repressor function.

(4-3) Identification of Repressor FIG. 3B shows the measurement results of the activity of the reporter gene.
As shown in FIG. 3B, the effector containing the full length of AT4g36990 or the amino acid number 233-243 of the AT4g36990 gene reduces the activity of the reporter gene by 60 to 80% compared to the case where PUC18 is introduced as an effector (control). From these results, it was proved that these peptides have transcription repressive ability. On the other hand, the effector plasmid of AT4g36990 gene in which a mutation was introduced into amino acids 236 to 243 of AT4g36990 did not reduce the activity of the reporter gene. This indicates that the 233-243rd amino acid of the AT4g36990 gene functions as a repressor domain that represses transcription.

(Example 5) Inhibition of transcriptional activation function of AG in plant body by gene fragment encoding At2g36080 repression domain 178-192 (5-1) Construction of transformation vector pBIG2 Clontech (Clontech, USA) plasmid p35S-GFP was cleaved with restriction enzymes HindIII and BamHI, and a DNA fragment containing the cauliflower mosaic virus 35S promoter (CaMV 35S) was separated and collected by agarose gel electrophoresis. A plant transformation vector pBIG-HYG (Becker, D. 1990 Nucleic Acid Research, 18: 203) assigned by Michigan State University, USA was cleaved with restriction enzymes HindIII and SstI, and the GUS gene was removed by agarose gel electrophoresis. A DNA fragment was obtained.
DNA having the following sequence was synthesized, heated at 70 ° C. for 10 minutes, and then annealed by natural cooling to obtain double-stranded DNA. This DNA fragment has a BamHI restriction enzyme site at the 5 ′ end, an omega sequence derived from tobacco mosaic virus that enhances translation efficiency, and restriction enzyme sites SmaI and SalI.
5'-GATCCACAATTACCAACAACAACAAACAACAAACAACATTACAATTACAGATCCCGGGGGTACCGTCGACGAGCTC-3 '(SEQ ID NO: 63)
5'- CGTCGACGGTACCCCCGGGATCTGTAATTGTAATGTTGTTTGTTGTTTGTTGTTGTTGGTAATTGT-3 '(SEQ ID NO: 64)
A double-stranded DNA synthesized with a DNA fragment containing the CaMV 35S promoter region was inserted into the HindIII and SstI sites of pBIG-HYG excluding the GUS gene to obtain a plant transformation vector pBIG2.

(5-2) Construction of Transformation Vector pAG36RD Two complementary DNA sequences in which GGG is 3 ′ and a stop codon is added 3 ′ to the partial base sequence (corresponding to 532-576) of At2g36080
5'-GGGAGGCAACTCGAAGACATTAAGACTGTTCGGAGTGAACATGGAGTGCTAA-3 '(SEQ ID NO: 65)
5'-TTAGCACTCCATGTTCACTCCGAACAGTCTTAATGTCTTCGAGTTGCCTCCC-3 '(SEQ ID NO: 66)
Was annealed, inserted into the pBIG2 vector cut with SmaI, the sequence was confirmed, and the one introduced in the forward direction was selected and designated as p36RD.
Five-terminal upper primer gATGACCGCGTACCAATCGGAGCTAGGAGG (SEQ ID NO: 67) using as a template cDNA prepared by reverse transcription of RNA extracted from Arabidopsis cocoons
3rd lower primer CACTAACTGGAGAGCGGTTTGGTCTTGGCG (SEQ ID NO: 68)
The full-length sequence of AGAMOUS (base sequence 1-759, amino acids 1-252) was amplified by PCR reaction (reaction conditions are the same as those in the above examples). Next, it was inserted into the above-mentioned p36RD that was cut with SmaI and collected by agarol gel electrophoresis. The sequence was confirmed, and the AG gene and 36RD reading frames coincided from those in which the AG gene was introduced in the forward direction. One was selected and designated pAG36RD.

(5-3) Preparation of Plants Transformed with pAG36RD Transformation of Arabidopsis plants with pAG36RD is performed according to Transformation of Arabidopsis thaliana byvacuum inflation (http: //www.bch.msu.pent. It was. However, I did not use vacuum to infect it, but just dipped it. The plasmid pAG36RD was introduced into a soil bacterium [(Agrobacterium tumefaciens strain GV3101 (C58C1Rifr) pMP90 (Gmr) (koncz and Schel 1986)) strain by electroporation. The introduced bacteria were cultured in 250 ml of LB medium for 2 days.
Subsequently, the bacterial cells were collected from the culture solution and suspended in 500 ml of an infection medium. In this solution, Arabidopsis thaliana grown for 14 days was soaked for 1 minute, infected, and then grown and seeded again. The collected seeds are sterilized with 50% bleach and 0.02% Triton X-100 solution for 7 minutes, rinsed three times with sterilized water, and the sterilized seeds are added to 1/2 MS selective medium containing 30 mg / l hygromycin. I was slaughtered.
A transformed plant growing on the hygromycin plate was selected, replanted in soil, and grown.

(5-4) Traits of plants transformed with pAG36RD Traits of plants transformed with pAG36RD are shown in FIG. In the flower of the plant transformed with pAG36RD, an increase in the number of petals (so-called double bloom) was confirmed, which is the flower of the plant transformed with pAGSRDX and the ag mutant shown in FIG. It was similar to a flower. From this, it was shown that the 36RD (GNSKTLRLFGVNMEC: SEQ ID NO: 3) peptide fragment confers transcription repressing ability to the fused transcriptional activator.

(Example 6) Suppression of transcriptional activation function of CUC2 and its duplicated gene CUC1 in a plant by gene fragment encoding At2g36080 repression domain 178-192 (6-1) Construction of transformation vector pCUC2-36RD In the same manner as in Examples (5-1) and (5-2), p36RD was obtained in which a partial base sequence of AT2G36080 (corresponding to 532-576) was inserted in the transformation vector pBIG2 in the forward direction.
Using a cDNA prepared by reverse transcription of RNA extracted from the shoot apex of Arabidopsis thaliana as a template, a 5-terminal upper primer GGGATGGACATTCCGTATTACCACTAC (SEQ ID NO: 69) and a 3-terminal lower primer GTAGTTCCAAATACAGTCAAGTC (sequence) from which the stop codon was removed from the 3 ′ end of the CUC2 gene Number 70)
Was used to amplify the full-length sequence of CUC2 (base sequence 1-1128, amino acids 1-375) by PCR reaction (reaction conditions are the same as those in the above examples). Next, it was inserted into the above-mentioned p36RD that was cut with SmaI and collected by agarol gel electrophoresis, and the sequence was confirmed and the reading frame of 36RD coincided with that of CUC2 gene that was introduced in the forward direction. One was selected and designated as pCUC2-36RD.

(6-2) Preparation of plant transformed with pCUC2-36RD In the same manner as in Example (5-3), Arabidopsis plants were transformed with pCUC2-36RD, selected on a hygromycin plate, and replanted in soil. Grow.

(6-3) Trait of plant transformed with pCUC2-36RD Seedling traits transformed with pCUC2-36RD are shown in E of FIG. Usually, Arabidopsis seedlings have the form of “shellfish greens” having two independent cotyledons, but in the seedlings of plants transformed with pCUC2-36RD, a trait in which some or all of the cotyledons are fused (so-called cups). ), And there were individuals lacking the shoot apical meristem. This was very similar to the shape of the plant seedlings transformed with pCUC2-SRDX shown in FIG. 4D and the cuc1 / cuc2 double-deficient strain.
From the above results, the peptide having the amino acid sequence of 36RD (GNSKTLRLFGVNMEC: SEQ ID NO: 3) and the gene encoding it have the ability to convert any transcription factor into a transcriptional repressor, It was also revealed that it functions dominantly against live duplicate genes.

All publications, patents and patent applications cited in this specification shall be incorporated into this specification as they are.

Since the peptide encoded by the gene of the present invention can perform transcriptional repression targeting only a specific gene, as in the case of conventionally known transcriptional repression functional peptide groups, as in known transcriptional repression functional peptide genes, It is expected to be applied in the field of breeding and at the same time has a conserved motif that is completely different from the known peptide group, so it can be applied in a wider range of fields by using it alone or in combination with known peptides And potentially useful technical means.

Claims (10)

1. A peptide having an amino acid sequence represented by the following formula (I) and having a plant transcription repressing function.
   Formula (I)
   X1-X2-Leu-Phe-Gly-Val-X3
   (In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)
2. The peptide according to claim 1, wherein the peptide comprises an amino acid sequence represented by any of SEQ ID NOs: 3 to 33.
3. A nucleic acid molecule encoding the peptide according to claim 1 or 2.
4. A chimeric protein having a transcriptional repression function, wherein a peptide having a transcriptional repression function of a plant consisting of an amino acid sequence represented by the following formula (I) is bound to a transcription factor or a DNA binding domain thereof;
   Formula (I)
   X1-X2-Leu-Phe-Gly-Val-X3
   (In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)
5. A nucleic acid molecule encoding a peptide having a transcriptional repression function of a plant consisting of an amino acid sequence represented by the following formula (I) and a nucleic acid molecule encoding a transcription factor or a DNA binding domain thereof are linked in a reading frame. A nucleic acid molecule encoding a chimeric protein having a transcriptional repression function;
   Formula (I)
   X1-X2-Leu-Phe-Gly-Val-X3
   (In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)
6. An expression vector comprising the nucleic acid molecule according to claim 5.
7. A transformant into which the nucleic acid molecule according to claim 5 has been introduced in an expressible state.
8. A transformed plant into which the nucleic acid molecule according to claim 5 has been introduced in an expressible state.
9. A method for producing a chimeric protein having a transcriptional repression function, comprising culturing cells transformed with an expression vector containing the nucleic acid molecule according to claim 5, and collecting and purifying the obtained expression product.
10. A method for producing a chimeric protein having a transcriptional repression function, comprising linking a peptide having a transcriptional repression function of a plant comprising an amino acid sequence represented by the following formula (I) and a transcription factor or a DNA binding domain thereof;
    Formula (I)
    X1-X2-Leu-Phe-Gly-Val-X3
    (In the formula, X1 and X3 represent an amino acid sequence composed of 1 to 10 arbitrary amino acids, and X2 represents Lys or Arg.)

Images