JP3407036B2 - Peptides having the function of suppressing gene transcription - Google Patents

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a peptide having a function of suppressing transcription of a gene, a gene encoding the peptide, a recombinant vector containing the gene, and a transformant containing the recombinant vector.

[0002]

BACKGROUND OF THE INVENTION The protein factor ERF (Ethy, which binds to cis-regulatory elements in response to the plant hormone ethylene)
lene Responsive Element binding Factor) is the ERF
It is a plant-specific transcription factor that has a DNA-binding domain named domain. Recent studies have revealed that the genes encoding the ERF proteins make up the multigene family. To date, cDNAs encoding protein factors having an ERF domain have been clarified from tobacco and Arabidopsis plants, but the present inventors have further performed functional analysis on cDNAs of tobacco, rice, and Arabidopsis thaliana to show intracellular Reveal the domain that acts as a repressor in
The present invention has been completed.

[0003]

That is, the present invention is D
A higher plant-derived peptide having a function of binding to NA and suppressing gene transcription, a gene encoding the peptide,
It is an object to provide a recombinant vector containing the gene and a transformant containing the recombinant vector.

[0004]

The present inventors have found that tobacco,
As a result of functional analysis of cDNA of rice and Arabidopsis thaliana, it was discovered that a region having a motif of aspartic acid-leucine-asparagine (DLN) in the carboxy-terminal region of ERF factor has a function of suppressing gene transcription. The present invention has been completed. D like this
Examples of the peptide having an LN motif and having a function of suppressing gene transcription include, for example, peptides contained in ERF3 derived from tobacco; AtERF3 derived from Arabidopsis thaliana,
Peptides contained in AtERF4, AtERF7 and AtERF8 (SEQ ID NO: 1); and peptides contained in osERF3 derived from rice.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION
A protein coding region was excised from the cDNA encoding the RF factor, ligated to the region encoding the DNA binding domain of the yeast GAL4 transcription factor, and further downstream of the cauliflower mosaic virus 35S promoter that functions in plant cells. Construct an effector plasmid. This was examined at the same time as the reporter gene consisting of the luciferase gene in which the GAL4 protein binding site was bound to the promoter region, was introduced into tobacco cultured cells by the electroporation method, and the activity of the luciferase gene, which is the reporter gene, was measured.

[0006] Next, in order to identify a repressor domain, which is a region having a repressor function existing in the repressor factor, the ERF factor was determined by using the deletion analysis method, which is a method of deleting the coding region of each gene. We investigated in which region of the protein the repressor domain resides.

[0007]

[Example] Arabidopsis (Japanese name Arabidopsis) AtER
Isolation of F8 gene (preparation of probe) Plasmid cloned with cDNA of tobacco ERF3 gene whose nucleotide sequence has been determined.
pERF3 was digested with restriction enzymes EcoRI and NotI, and a 950 bp DNA fragment containing ERF3 cDNA was isolated by agarose gel electrophoresis. After denaturing about 50 ng of this DNA fragment at 100 ° C for 10 minutes, DN
A labeling kit (Amersham Pharmacia Ready
-To-GoDNA Labeling Beads) and 5uL of alpha 32P-dCTP
(Amersham Pharmacia AA0005) was used for labeling to prepare a probe.

(Preparation and screening of cDNA) Leaves are collected from Arabidopsis plants and ground into powder using a mixer in liquid nitrogen. 20 g of RNA extraction buffer (8 M guanidine hydrochloride, 20 mM disodium ethylenediamine tetraacetate (E
DTA), 20 mM 2- (N-morpholino) ethanesulfonic acid (MES), 50 mM mercaptoethanol) and 8 mL of
Add phenol saturated with TE solution (10 mM Tris-Cl pH8.0, 1 mM EDTA) and 2 mL of chloroform, stir well, and centrifuge (10000 g) to collect the supernatant. 0.2 volumes of 1M acetic acid and 0.7 volumes of ethanol are added to the supernatant, and the mixture is left standing at -20 ° C and then centrifuged (10000g). Dissolve the precipitate in 2 mL of TE solution, add 500 mL of 10 M lithium chloride solution,
Let stand for 2 hours at ℃ and centrifuge. The precipitate was washed with 70% alcohol and then air-dried to obtain a total RNA preparation. This whole RAN
With the Pro A Poly A Tract System 1000
Only mRNA was purified from NA. Double-stranded cDNA is synthesized using this mRNA as a template and the Pharmacia cDNA Direction Cloning Kit. These are EcoRI-No of lambda gt11 expression vector according to the Pharmacia protocol.
After incorporating into the tI restriction enzyme site, the library was completed using the lambda packaging kit (Pharmacia).

Lambda phage incorporating the prepared Arabidopsis cDNA library was plated (10 cm x 14 cm)
In advance, the capacity to obtain about 40,000 plaques
Suspend and infect Escherichia coli strain 1090 that had been suspended with 0.5 ccmL of 10 mM magnesium sulfate solution, and select 50 mg / L sodium ampicillate LB agar medium (10 g tryptone per 1 L, 10 g Develop in sodium chloride, 5g yeast extract, 15g agar) and incubate at 37 ℃. When the plaque is about 2 mm, it is transferred to a nitrocellulose membrane (S & S) and the denaturing solution (0.2 M NaOH,
5 minutes on filter paper (Whatman 3MM) dipped in 1.5M NaCl), neutralization solution [0.4M Tris-HCl, pH7.5, 2xSSC (150mM NaCl, 15m
M sodium citrate)] on the filter paper for 5 minutes, then soak in 2xSSC solution for 5 minutes, and air dry on the filter paper for 20 minutes. The plaque DNA is fixed on a nitrocellulose membrane by drying at 80 ° C for 120 minutes.

2 mL of hybridization buffer (6xSS) per nitrocellulose membrane (10 cm x 14 cm)
C, 0.05% skim milk) and kept at 60 ℃ for 2 hours, then heated at 100 ℃ for 10 minutes and denatured by rapid cooling
Replace with new buffer containing ERF3 probe, 60
The temperature was kept at 12 ° C for 12 hours. After that, 5 per filter
2xS containing 0.1% SDS (sodium dodecyl sulfate)
SC solution for 15 minutes, 0.5x SSC with 0.1% SDS for 15 minutes, 0.
The plate was washed with 0.2xSSC containing 1% SDS for 15 minutes and exposed to an X-ray film. The ERF3 probe-bound plaques were isolated from the agar plate and 1 mL of phage buffer (10 mM
After suspending in Tris-HCl pH7.5, 10 mM MgSO4) and collecting the phage, the above screening was repeated 3 times to obtain a single plaque. This plaque was again infected with E. coli, amplified, DNA was extracted from the phage, and the cDNA region was excised using restriction enzymes EcoRI and NotI. This DNA fragment was used as restriction enzyme EcoRI-Not of plasmid pT7D3 (Pharmacia).
It was incorporated into the I site and the plasmid nucleotide sequence was analyzed. The plasmid having the full-length cDNA sequence of AtERF8 shown in SEQ ID NO: 1 was named pAtERF8.

Identification of AtERF8 repression domain Construction of effector plasmid (effector plasmid containing the full length AtERF8 pGAL4DB-At
Construction of ERF8: Fig. 1) Clontech (Clontech, U
(SA) plasmid pBI221 is cleaved with restriction enzymes XhoI and SacI, blunt-ended with T4 polymerase, the GUS gene is removed by agarose gel electrophoresis, and transcription of cauliflower mosaic virus 35S promoter (CaMV35S) and nopaline synthase gene is performed. End area (Nos terminator,
35S-Nos plasmid fragment DNA containing the following Nos-ter) was obtained.
Restriction enzyme HindII for pAS2-1 vector manufactured by Clontech
Digested with I, DNA binding region of yeast GAL4 protein (1-1
A 748 bp DNA fragment (hereinafter referred to as GAL4DBD) encoding 47 amino acid residues) was isolated by agarose gel electrophoresis and blunt-ended with T4 DNA polymerase.
The DNA fragment containing this GAL4DBD was used to convert the 35S-Nos DNA
The p35S-GAL4DBD vector was constructed by inserting into the blunt end site between the 35S promoter and the Nos terminator and selecting the one in which the ORF of the DNA binding region of the yeast GAL4 protein was aligned in the forward direction with respect to the 35S promoter.

AtERF8 cDNA plasmids pAtERF8 and GAL4DBD
5 terminal upper primer primer1 (SEQ ID NO: 3: bound to AtERF8 base sequence 1-20) GATGCCCAACATCACCATGGG and restriction enzyme SalI designed to match the reading frame
3 terminal lower primer primer2 (SEQ ID NO: 4 bound to AtERF8 nucleotide sequence 532-558) GTCGACCTATTCCGCCG
Using GAGGAGCTAAGTTAAG, AtERF8 whole protein coding region (SEQ ID NO: 1: AtERF8 nucleotide sequence 1-558; amino acid sequence 1
-185) was amplified by the PCR method to obtain a DNA fragment. The conditions of PCR reaction are denaturation reaction 94 ° C for 1 minute, annealing reaction 47 ° C 2
The extension reaction was carried out for 25 cycles by setting the extension reaction at 74 ° C. for 1 minute as one cycle. Hereinafter, all PCR reactions were performed under the same conditions. The obtained DNA fragment was digested with the restriction enzyme SalI, and then the target DNA fragment was isolated by agarose gel electrophoresis.
The DNA fragment encoding this AtERF8 was digested with the restriction enzymes SmaI and Sal.
The effector plasmid pGAL-AtERF8 was constructed by incorporating it into the 35S-GAL4DBD plasmid previously digested with I.
The procedure for constructing this effector plasmid pGAL-AtERF8 is shown in FIG.

(Construction of effector plasmid pGAL-141 / 185AtERF8 containing AtERF8 amino acids 141/185) pAtERF8
5 terminal upper primer primer designed to match the reading frame with the frame encoding the plasmid and GAL4DBD
3 (SEQ ID NO: 5: binding site AtERF8 nucleotide sequence 420-440) GCGA
Amino acid sequence 141/185 of AtERF8 using CGTATCCAAAGATGAC and a lower primer primer2 (SEQ ID NO: 4 binding site AtERF8 nucleotide sequence 532-558) having SalI site of restriction enzyme
DNA containing the region of nucleotide sequence 420-558 corresponding to the coding region
The fragment was obtained by the PCR method. This DNA fragment is the restriction enzyme SalI
DNA of interest after digestion with agarose gel
The fragment was isolated. The DNA fragment (DNA region 420-558) encoding the amino acid sequence 166/225 of AtERF8 was digested with the restriction enzyme Sma.
The effector plasmid pGAL-141 / 185AtERF8 was integrated into the 35S-GAL4DBD plasmid that had been previously digested with I and SalI.
Was built.

(Construction of reporter gene: FIGS. 2 and 3) The plasmid pUC18 is digested with restriction enzymes EcoRI and SstI. pBI221 (Clontech) with restriction enzyme EcoRI
Digested with SstI, Nos-ter (nopaline synthase terminat
(or) region is isolated by agarose gel electrophoresis in which a 270 bp DNA fragment is inserted. The obtained fragment is a restriction enzyme
EcoR of plasmid pUC18 digested with EcoRI and SstI
Insert at the I-SstI site. Cauliflower mosaic virus
DNA of complementary strand including 35S promoter TATA box 1
(SEQ ID NO: 6) AGCTTAGATCTGCAAGACCCTTCCTCTATATAAGGA
AGTTCATTTCATTTGGAGAGGACACGCTG and DNA2 (SEQ ID NO: 7) GATCCAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATATAG
AGGAAGGGTCTTGCAGATCTA is synthesized. Synthesized DNA at 90 ℃
After heating for 2 minutes, it is heated at 60 ° C. for 1 hour, and then left standing at room temperature (25 ° C.) for 2 hours to anneal to form a double strand. Restriction enzyme for pUC18 plasmid containing Nos-ter
Digest with HindIII and BamHI. Synthesized double-stranded DNA is pU
Inserted in HindIII-BamHI site of C18, TATA-box and Nos-ter
Construct a plasmid containing The above procedure is shown in FIG.

This plasmid was digested with the restriction enzyme SstI,
Blunt end with T4 DNA polymerase. Plasmid vector PGV-CS2 (manufactured by Toyo Ink Co.) containing the firefly luciferase gene (LUC) was used as restriction enzyme XbaI.
After digestion with NcoI and blunt end treatment with T4 DNA polymerase, a 1.65 kb DNA fragment containing the luciferase gene was isolated and purified by agarose gel electrophoresis. This DNA fragment was inserted into the above plasmid containing the TATA box and Nos terminator to construct a TATA-LUC reporter gene. DN of yeast GAL4 protein
Plasmid pG5CAT (Clontech, which has 5 copies of A-binding sequence)
Digested with restriction enzymes SmaI and XbaI and blunt-ended with T4 DNA polymerase.
The DNA fragment containing the DNA binding sequence of GAL4 protein was purified by agarose gel electrophoresis. Digest the TATA-LUC vector with the restriction enzyme BglII and blunt end it with T4 DNA polymerase. A blunt-ended 5 copies DNA fragment containing the DNA-binding sequence of GAL4 protein was inserted into this site, and those having the DNA-binding sequence of GAL4 protein in the forward direction were selected from the obtained plasmids. -Builded LUC.

(Construction of Reference Gene) A cassette vector pRL-null manufactured by Promega, which has a luciferase gene derived from Renilla is cut with restriction enzymes NheI and XbaI, and blunt-ended with T4 DNA polymerase, and then agarose. By gel electrophoresis, Renilla
Purify a 948 bp DNA fragment containing the luciferase gene. This DNA fragment was used in the construction of the effector plasmid.
Insert in the region where the gene was. From the obtained plasmids, those in which the Renilla luciferase gene is oriented in the forward direction are selected (construction of pPTRL).

Method for measuring activity of reporter gene The reporter gene and effector plasmid were introduced into protoplasts of cultured tobacco cells by electroporation, and the effect of the effector was examined by measuring the activity of the reporter gene. (Protoplast preparation method) 100 mL of MS medium (mixed salts for Murashige-Skoog medium, Nippon Pharmaceutical Co., Ltd., 3% sucrose, 0.2 g / L KH2PO4, 0.2 g / L m-inositol, 2 mg / L g
lycine, 1 mg / L thiamine hydrochloride, 0.2 mg / L 2, 4-D, pH
To 5.8) cultured tobacco cells for 7 days
By adding 3 ml of BY-2 preculture medium and culturing the cells in the dark at 26 ° C for 3 days, the cells were made of a metal mesh (openness of 125 mm,
(Tokyo Screen) Collect by filtration and wash the cells with MS medium containing 0.4M mannitol. Washed cells 25
Suspend in 1 mL of MS medium containing 0.4 M mannitol.
Leave at room temperature for 0 minutes Centrifuge at 3,000 rpm for 1 minute to collect cells. The cells were resuspended in 20 mL of MS medium containing 1% cellulase (Onozuka RS,) and 0.1% pectolyase Y-23 (manufactured by Seishin) and spun at 60 rpm in the dark for 90 minutes at 26 ° C. Digest the cell wall with shaking. Then, centrifuge at 1,000 rpm for 5 minutes to collect protoplasts.

(Gene Transfer by Electroporation) The protoplasts obtained above were electroporated to a concentration of 2.5 × 10 ⁶ cells / mL.
Resuspend in (5 mM MES pH5.8, 70 mM KCl, 0.3 M mannitol). PGALDB-AtERF8 or its deletion series (pGALDB-1 / 25AtERF8 ~ pGALDB) as a pGAL4-LUC reporter gene and effector plasmid constructed in a cuvette for electroporation (Gene Pulser cuvette 0.4 cm elecrode, manufactured by Bio-Rad)
-204-225AtERF8) each 10 ug and reference gene plasmid 1 ug 100 μL 2X electroporation buffer (10 mM MES pH5.8, 140 mM KCl, 0.6 M mannitol) and add sterile water to the total volume. Set to 200 uL.
Add 600 uL of protoplast suspension to the cuvette and place it in an electroporator (Genepulser II Electropor
ation System Bio-Rad) 600 V, 25 m
Introduce DNA under F condition. After the introduction, collect the protoplasts from the cuvette by centrifugation at 1,000 rpm for 5 minutes,
The protoplasts were resuspended in 5 mL of MS medium containing 0.4 M mannitol and allowed to stand at 26 ° C for 6 hours in the dark, and then the activity of the reporter gene was measured.

(Measurement of luciferase activity) 1 mL of the protoplast suspension left still for 6 hours was sampled, and 2,000 rpm
After collecting the protoplasts by centrifugation for 3 minutes at
LuciferaseTM Reporter Assay System (Promega)
Suspend in 50 uL of Passive Lysis Buffer attached to. After crushing the protoplasts, centrifuge and collect the supernatant. Use 5 uL of this cell extract for Dual-Lucifer
Luciferase activity was measured using aseTMReporter Assay System (Promega) and luminescence reader (BLR-201, Aloka). For the measurement of firefly luciferase and Renilla luciferase activities, luminescence for 10 seconds was counted in integration mode according to the instruction of the measurement kit. The activity value of the reference gene is divided by the activity value of the reporter gene, and the relative value Rela
The tive luchifarase activity was obtained as a measurement value. When the effector plasmid was not introduced, the relative value was set to 100, and the effect of the effector was investigated by the fluctuation of the activity value of the reporter gene when the effector plasmid was simultaneously introduced into the cells. That is, when the pGAL4-LUC reporter gene and the pGALDB-AtERF8 effector plasmid were introduced, the activity value of the reporter was decreased.
-AtERF8 has the effect of suppressing the activity of the reporter gene (repressor function). Less than,
The activity of the reporter is measured, and when the relative activity of the reporter is 100 or less, the effector that has been introduced has a repressor function. Investigated by doing.

(Identification of repressor domain) In order to analyze the function involved in the transcriptional regulation of the Arabidopsis AtERF8 gene, the reporter genes pGAL4-LUC and pGALDB-AtERF8 were introduced into protoplasts prepared from cultured tobacco cells by electroporation. , The activity of the reporter gene was investigated. As a result, the pGAL-AtERF8 effector reduced the activity of the reporter gene to 70% as compared with the case of using the reporter gene alone without introducing the effector (control). AtERF8 as a control experiment
P35S-GALDBD, which does not contain the coding region of Escherichia coli, did not affect the activity of the reporter gene. This is AtER
It shows that F8 functions as a repressor that suppresses transcription.

Next, it was examined whether pGAL-141 / 185AtERF8, an effector plasmid having a DAN fragment in which the protein coding region of the AtERF8 gene was deleted, has a function of suppressing the activity of the reporter gene. pGAL-141 / 185AtER
The F8 effector plasmid was introduced into tobacco cultured cells together with the reporter gene, and the activity of the reporter gene was measured.As a result, pGAL-141 / 185AtERF8 effector was identified as pGALDB.
Similar to the case of introducing -AtERF8, it was shown that there is a repressor function that suppresses the activity of the reporter gene to about 45% as compared with the control. (FIG. 4B). From this result, the region having the repressor function of AtERF8 (repression domain) is the amino acid sequence of AtERF8, 141/185.
It was revealed that it exists in (Fig. 4B). This amino acid sequence is shown in SEQ ID NO: 2.

The peptide having the function of suppressing the transcription of the gene of the present invention is fused with a DNA-binding protein that specifically binds to the transcriptional regulatory region of the oncogene, and expressed in the cell to express the oncogene. The expression can be efficiently suppressed. In addition, the repressor function was nonspecific to the gene when examined, but it is necessary to bind to DNA. Therefore, by fusion with a DNA binding domain that binds to specific DNA, the repressor function may be gene-specific or non-specific. It is possible to suppress the transfer. This makes it possible, for example, to control the expression of a gene encoding an enzyme of the pigment metabolism system, and to create a flower having petals of different colors, which has never been obtained before. In addition, by suppressing the expression of the protein that becomes an allergen, it becomes possible to produce foods that are low in allergen.

[0023]

[Sequence list] SEQUENCE LISTING    <110> Secretary of Agency of Industrial Science and Technology    <120> Novel repression domain of plant specific transcription factor    <130>    <160> 7   <210> 1 <211> 558 <212> DNA <213> Arabidopsis thaliana    <400> 1 atg ccc aac atc acc atg ggt ttg aaa ccc gac ccg gtt gct cca acg 48 Met Pro Asn Ile Thr Met Gly Leu Lys Pro Asp Pro Val Ala Pro Thr             5 10 15    aac ccg act cat cat gag agt aat gct gcc aaa gag att cgt tac aga 96 Asn Pro Thr His His Glu Ser Asn Ala Ala Lys Glu Ile Arg Tyr Arg          20 25 30                        ggc gtt agg aaa cgt cca tgg gga aga tac gcc gct gag atc cga gat 144 Gly Val Arg Lys Arg Pro Trp Gly Arg Tyr Ala Ala Glu Ile Arg Asp       35 40 45       ccg gtt aag aaa act cga gtc tgg ctc ggt acg ttc gac acc gct cag 192 Pro Val Lys Lys Thr Arg Val Trp Leu Gly Thr Phe Asp Thr Ala Gln    50 55 60         cag gcg gcg cgt gct tac gac gca gcc gcg cgt gac ttt cgt ggt gtt 240 Gln Ala Ala Arg Ala Tyr Asp Ala Ala Ala Arg Asp Phe Arg Gly Val 65 70 75 80                          aag gct aag acc aat ttc ggt gtt atc gtt ggt agt agt cct act cag 288 Lys Ala Lys Thr Asn Phe Gly Val Ile Val Gly Ser Ser Pro Thr Gln              85 90 95                                         agt agc acc gtc gtc gac tct ccc acg gcg gca cgg ttt ata aca cct 336 Ser Ser Thr Val Val Asp Ser Pro Thr Ala Ala Arg Phe Ile Thr Pro         100 105 110    ccg cac ctc gag ctc agc tta ggc ggc ggc ggc gcg tgt cgt cgt aag 384 Pro His Leu Glu Leu Ser Leu Gly Gly Gly Gly Ala Cys Arg Arg Lys      115 120 125         atc ccg ctt gtg cat ccg gtt tac tac tat aac atg gcg acg tat cca 432 Ile Pro Leu Val His Pro Val Tyr Tyr Tyr Asn Met Ala Thr Tyr Pro   130 135 140    aag atg acg acg tgt ggt gtc cag agc gag tct gaa acg tcg tcg gtc 480 Lys Met Thr Thr Cys Gly Val Gln Ser Glu Ser Glu Thr Ser Ser Val 145 150 155 160                                 gtt gat ttc gaa ggt gga gct ggg aag ata tct ccg ccg tta gat ctg 528 Val Asp Phe Glu Gly Gly Ala Gly Lys Ile Ser Pro Pro Leu Asp Leu             165 170 175                gat ctt aac tta gct cct ccg gcg gaa tag 558 Asp Leu Asn Leu Ala Pro Pro Ala Glu          180 185    <210> 2 <211> 45 <212> RPT <213> Arabidopsis thaliana    <400> 2 Ala Thr Tyr Pro Lys Met Thr Thr Cys Gly Val Gln Ser Glu Ser Glu              5 10 15 Thr Ser Ser Val Val Asp Phe Glu Gly Gly Ala Gly Lys Ile Ser Pro          20 25 30 Pro Leu Asp Leu Asp Leu Asn Leu Ala Pro Pro Ala Glu       35 40 45 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 3 gatgcccaac atcaccatgg g    <210> 4 <211> 33 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 4 gtcgacctat tccgccggag gagctaagtt aag    <210> 5 <211> 20 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 5 gcgacgtatc caaagatgac    <210> 6 <211> 65 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 6 agcttagatc tgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca       10 20 30 40 50 60 cgctg    65    <210> 7 <211> <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 7 gatccagcgt gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcag       10 20 30 40 50 60 atcta   65

[Brief description of drawings]

FIG. 1 is a diagram showing a procedure for constructing pGALDB-AtERF8 from plasmid pBI221.

FIG. 2 shows the first half of the procedure for constructing the reporter gene GAL4-LUC.

FIG. 3 is a diagram showing the latter half of the procedure for constructing the reporter gene GAL4-LUC following FIG. 2.

FIG. 4A is a diagram showing a reporter gene and an effector plasmid. In the figure, 5XGAL4: GAL4 transcription factor
DNA binding sequence, TATA: CaMV 35S promoter region containing TATA box, LUC: Luciferase gene, CaMV 35S:
Cauliflower mosaic virus 35S protein gene promoter, GAL4 DB: yeast GAL4 transcription factor DAN binding domain coding region, Nos: nopaline synthase gene transcription termination region. B is a figure which shows the influence which the deletion of AtERF8 and AtERF8 has on the activity (Relative Activity) of a reporter gene. In the figure, the number on the left (141/18
5) shows the amino acid region of AtERF8. The box in the middle indicates the amino acid sequence region corresponding to the number on the left. The graph on the right shows the activity of the reporter gene when an effector plasmid having the region on the left is introduced. The activity of the reporter gene when no effector was added was set to 100. It has been shown that the AtERF8 and AtERF8 deletion effectors having the amino acid sequence 141/185 reduce the activity of the reporter gene to 45% and have the effect of suppressing transcription.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI C12N 5/10 C12N 5/00 A (56) References The Plant Cell, 1995, Vol. 7, p. 173-182 Biochem. J. , 1999, Vol. 339, p. 111-117 The Journal of Biological Chemistry, 1999, Vol. 274, No. 41, p. 29500-29504 Mol Gen Genet, 1997, Vol. 253, No. 5, p. 553-561 (58) Fields investigated (Int.Cl. ⁷ , DB name) C12N 15/09 C12N 15/29 C07K 14/415 SwissProt / PIR / GeneS eq GenBank / EMBL / DDBJ / GeneSeq BIOSIOS / WPI (DIALOG) ) PubMed

Claims (5)

(57) [Claims] 1. A peptide comprising (a) the amino acid sequence represented by SEQ ID NO: 1, or (b) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence (a). A peptide having the function of suppressing gene transcription. 2. A peptide comprising (a) the amino acid sequence represented by SEQ ID NO: 2, or (b) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence (a). A peptide having the function of suppressing gene transcription. 3. A gene encoding the peptide according to claim 1 or 2. 4. A recombinant vector containing the gene according to claim 3. 5. A transformant containing the recombinant vector according to claim 4.