JP3409079B2 - Peptides having the function of suppressing gene transcription - Google Patents

Description

Detailed Description of the Invention

[0001]

TECHNICAL FIELD The present invention relates to a peptide having a function of suppressing transcription of a gene, a gene encoding the peptide, a recombinant vector containing the gene, and a transformant containing the recombinant vector.

[0002]

BACKGROUND OF THE INVENTION The protein factor ERF (Ethy, which binds to cis-regulatory elements in response to the plant hormone ethylene)
lene Responsive Element binding Factor) is the ERF
It is a plant-specific transcription factor that has a DNA-binding domain named domain. Recent studies have revealed that the genes encoding the ERF proteins make up the multigene family. To date, cDNAs encoding protein factors having an ERF domain have been clarified from tobacco and Arabidopsis plants, but the present inventors have further performed functional analysis on cDNAs of tobacco, rice, and Arabidopsis thaliana to show intracellular Reveal the domain that acts as a repressor in
The present invention has been completed.

[0003]

That is, the present invention is D
A higher plant-derived peptide having a function of binding to NA and suppressing gene transcription, a gene encoding the peptide,
It is an object to provide a recombinant vector containing the gene and a transformant containing the recombinant vector.

[0004]

The present inventors have found that tobacco,
As a result of functional analysis of cDNA of rice and Arabidopsis thaliana, it was discovered that a region having a motif of aspartic acid-leucine-asparagine (DLN) in the carboxy-terminal region of ERF factor has a function of suppressing gene transcription. The present invention has been completed. D like this
Examples of the peptide having an LN motif and having a function of suppressing gene transcription include, for example, peptides contained in ERF3 derived from tobacco; AtERF3 derived from Arabidopsis thaliana,
Peptides contained in AtERF4, AtERF7 and AtERF8; peptides contained in rice-derived osERF3 (SEQ ID NO: 1) can be mentioned.

[0005]

BEST MODE FOR CARRYING OUT THE INVENTION
A protein coding region was excised from the cDNA encoding the RF factor, ligated to the region encoding the DNA binding domain of the yeast GAL4 transcription factor, and further downstream of the cauliflower mosaic virus 35S promoter that functions in plant cells. Construct an effector plasmid. This was investigated by measuring the activity of the luciferase gene, which is a reporter gene, by introducing it into a cultured tobacco cell or Arabidopsis thaliana leaf at the same time as the reporter gene consisting of the luciferase gene in which the GAL4 protein binding site was bound to the promoter region. It was

[0006] Next, in order to identify a repressor domain, which is a region having a repressor function existing in the repressor factor, the ERF factor was determined by using the deletion analysis method, which is a method of deleting the coding region of each gene. We investigated in which region of the protein the repressor domain resides.

[0007]

[Example] The isolated nucleotide sequence of rice osERF3 gene has been determined. The database was searched by the BLAST program based on the amino acid sequence of tobacco ERF3 gene, and the cDNA sequence of rice having homology with ERF3 was searched. did. Rice cDNA clone C1255, which shows homology with ERF3, was transferred from the National Institute for Agrobiological Sciences and the whole nucleotide sequence was determined. The plasmid having the full-length cDNA sequence of osERF3 shown in SEQ ID NO: 1 was named posERF3.

Identification of osERF3 repression domain Construction of effector plasmid (effector plasmid pGAL4DB-os containing full-length osERF3
Construction of ERF3: Figure 1) Clontech (Clontech, U
(SA) plasmid pBI221 is cleaved with restriction enzymes XhoI and SacI, blunt-ended with T4 polymerase, the GUS gene is removed by agarose gel electrophoresis, and transcription of cauliflower mosaic virus 35S promoter (CaMV35S) and nopaline synthase gene is performed. End area (Nos terminator,
35S-Nos plasmid fragment DNA containing the following Nos-ter) was obtained.
Restriction enzyme HindII for pAS2-1 vector manufactured by Clontech
Digested with I, DNA binding region of yeast GAL4 protein (1-1
A 748 bp DNA fragment (hereinafter referred to as GAL4DBD) encoding 47 amino acid residues) was isolated by agarose gel electrophoresis and blunt-ended with T4 DNA polymerase.
The DNA fragment containing this GAL4DBD was used to convert the 35S-Nos DNA
The p35S-GAL4DBD vector was constructed by inserting into the blunt end site between the 35S promoter and the Nos terminator and selecting the one in which the ORF of the DNA binding region of the yeast GAL4 protein was aligned in the forward direction with respect to the 35S promoter.

OsERF3 cDNA plasmid posERF3 and GAL4D
5-terminal upper primer primer1 designed to match the reading frame with BD (SEQ ID NO: 3: bound to osERF3 nucleotide sequence 1-20) GATGGCGCCCAGAGCAGCTAC and restriction enzyme Sal
Lower terminal primer primer2 having I site (SEQ ID NO: 4: bound to osERF3 nucleotide sequence 685-708) GTCGACCTAGTTCTCTA
Using CCGGCGGCGGCC, osERF3 whole protein coding region (SEQ ID NO: 1: osERF3 nucleotide sequence 1-708; amino acid sequence 1-2
35) was amplified by the PCR method to obtain a DNA fragment. The conditions of PCR reaction are denaturation reaction 94 ° C for 1 minute, annealing reaction ° C 47 ° C 2
The extension reaction was carried out for 25 cycles by setting the extension reaction at 74 ° C. for 1 minute as one cycle. Hereinafter, all PCR reactions were performed under the same conditions. The obtained DNA fragment was digested with the restriction enzyme SalI, and then the target DNA fragment was isolated by agarose gel electrophoresis.
The DNA fragment encoding this osERF3 was digested with the restriction enzymes SmaI and Sal.
The effector plasmid pGAL-osERF3 was constructed by incorporating it into the 35S-GAL4DBD plasmid previously digested with I.

(Construction of Effector Plasmid pGAL-193 / 235osERF3 Containing osERF3 Amino Acid 193/235) posERF3 Plasmid and GAL4DBD Encoding 5th Upper Primer Primer3 Designed to Match the Frame and Reading Frame
(SEQ ID NO: 5: binding site osERF3 nucleotide sequence 575-600) GCGGC
GGTTGCACAAGTGACTCC and restriction enzyme SalI site 3 terminal lower primer primer2 (sequence number 4: binding site osERF3
The nucleotide sequence 685-708) GTCGACCTAGTTCTCTACCGGCGGCGGCC was used to obtain a DNA fragment containing the region of nucleotide sequence 575-708 corresponding to the amino acid sequence 193/235 coding region of osERF3 by PCR. This DNA fragment was digested with the restriction enzyme SalI, and the target DNA fragment was isolated by agarose electrophoresis.
The DNA fragment encoding the amino acid sequence 193/235 of osERF3 (DNA region 575-708) was incorporated into the 35S-GAL4DBD plasmid that had been pre-digested with the restriction enzymes SmaI and SalI, and the effector plasmid pGAL-141 / 185osERF3 was constructed. It was constructed.

(Construction of Reporter Gene: FIG. 2 and FIG. 3) The plasmid pUC18 is digested with restriction enzymes EcoRI and SstI.
pBI221 (Clontech) with restriction enzymes EcoRI and Sst
Digested with I, Nos-ter (nopaline synthase terminator)
It is isolated by agarose gel electrophoresis which inserts a 270 bp DNA fragment containing the region. The resulting fragment is the restriction enzyme EcoR
EcoRI-Ss of plasmid pUC18 digested with I and SstI
Insert at tI site. Cauliflower mosaic virus 35S
Complementary strand DNA1 containing the promoter TATA box (SEQ ID NO: 6) AGCTTAGATCTGCAAGACCCTTCCTCTATATAAGGAAGTTCA
TTTCATTTGGAGAGGACACGCTG and DNA2 (SEQ ID NO: 7) GATC
CAGCGTGTCCTCTCCAAATGAAATGAACTTCCTTATATAGAGGAAGGGTC
Synthesize TTGCAGATCTA. The synthesized DNA is heated at 90 ° C. for 2 minutes, then at 60 ° C. for 1 hour, and then left standing at room temperature (25 ° C.) for 2 hours to anneal to form a double strand.
The pUC18 plasmid containing Nos-ter was digested with restriction enzymes HindIII and B
Digest with amHI. Synthesized double-stranded DNA was used for HindIII of pUC18
-Insert at the BamHI site to construct a plasmid containing TATA-box and Nos-ter. The above procedure is shown in FIG.

This plasmid was digested with the restriction enzyme SstI,
Blunt end with T4 DNA polymerase. Plasmid vector PGV-CS2 (manufactured by Toyo Ink Co.) containing the firefly luciferase gene (LUC) was used as restriction enzyme XbaI.
After digestion with NcoI and blunt end treatment with T4 DNA polymerase, a 1.65 kb DNA fragment containing the luciferase gene was isolated and purified by agarose gel electrophoresis. This DNA fragment was inserted into the above plasmid containing the TATA box and Nos terminator to construct a TATA-LUC reporter gene. DN of yeast GAL4 protein
Plasmid pG5CAT (Clontech, which has 5 copies of A-binding sequence)
Digested with restriction enzymes SmaI and XbaI and blunt-ended with T4 DNA polymerase.
The DNA fragment containing the DNA binding sequence of GAL4 protein was purified by agarose gel electrophoresis. Digest the TATA-LUC vector with the restriction enzyme BglII and blunt end it with T4 DNA polymerase. A blunt-ended 5 copies DNA fragment containing the DNA-binding sequence of GAL4 protein was inserted into this site, and those having the DNA-binding sequence of GAL4 protein in the forward direction were selected from the obtained plasmids. -Builded LUC. (See Figure 3)

(Construction of Reference Gene) A cassette vector pRL-null made by Promega, which has a luciferase gene derived from Renilla is cut with restriction enzymes NheI and XbaI and blunt-ended with T4 DNA polymerase, and then agarose. By gel electrophoresis, Renilla
Purify a 948 bp DNA fragment containing the luciferase gene. This DNA fragment was used in the construction of the effector plasmid.
Insert in the region where the gene was. From the obtained plasmids, those in which the Renilla luciferase gene is oriented in the forward direction are selected (construction of pPTRL).

(Method for measuring activity of reporter gene) A reporter gene and an effector plasmid were introduced into protoplasts of cultured tobacco cells by electroporation, and the effect of the effector was examined by measuring the activity of the reporter gene. (Protoplast preparation method) 100 mL of MS medium (mixed salts for Murashige-Skoog medium, Nippon Pharmaceutical Co., Ltd., 3% sucrose, 0.2 g / L KH2PO4, 0.2 g / L m-inositol, 2 mg / L g
lycine, 1 mg / L thiamine hydrochloride, 0.2 mg / L 2, 4-D, pH
To 5.8) cultured tobacco cells for 7 days
By adding 3 ml of BY-2 preculture medium and culturing the cells in the dark at 26 ° C for 3 days, the cells were made of a metal mesh (openness of 125 mm,
(Tokyo Screen) Collect by filtration and wash the cells with MS medium containing 0.4M mannitol. Washed cells 25
Suspend in 1 mL of MS medium containing 0.4 M mannitol.
Leave at room temperature for 0 minutes Centrifuge at 3,000 rpm for 1 minute to collect cells. The cells were resuspended in 20 mL of MS medium containing 1% cellulase (Onozuka RS,) and 0.1% pectolyase Y-23 (manufactured by Seishin) and spun at 60 rpm in the dark for 90 minutes at 26 ° C. Digest the cell wall with shaking. Then, centrifuge at 1,000 rpm for 5 minutes to collect protoplasts.

(Gene Transfer by Electroporation) The protoplasts obtained above were used at a concentration of 2.5 × 10 ⁶ cells /
Electroporation buffer (5 m
Resuspend in M MES pH5.8, 70 mM KCl, 0.3 M mannitol). PGAL4-LUC reporter gene constructed in a cuvette for electroporation (Gene Pulsar cuvette 0.4 cm elecrode, manufactured by Bio-Rad) and pGALDB-osERF3 as an effector plasmid or its deletion series (pGALDB-1 / 25osERF3 to pGALDB-204-225)
osERF3) DNA (10 ug each) and reference gene plasmid 1 ug (100 μL) of 2X electroporation buffer (10 mM MES pH5.8, 140 mM KCl, 0.6 M mannitol), and sterilized water to make the total volume 200 μL. To do. Add 600 uL of protoplast suspension to the cuvette and place it in an electroporator (Genepulser II Electroporation).
System Bio-Rad) is used to introduce DNA under the conditions of 600 V and 25 mF. After the introduction, collect the protoplasts from the cuvette by centrifugation at 1,000 rpm for 5 minutes, and collect 5 mL.
The protoplasts were resuspended in MS medium containing 0.4 M mannitol, and the reporter gene activity was measured after standing at 26 ° C. for 6 hours in the dark.

(Measurement of luciferase activity) 1 mL of the protoplast suspension left standing for 6 hours was sampled at 2,000 rpm.
After collecting the protoplasts by centrifugation for 3 minutes at
LuciferaseTM Reporter Assay System (Promega)
Suspend in 50 uL of Passive Lysis Buffer attached to. After crushing the protoplasts, centrifuge and collect the supernatant. Use 5 uL of this cell extract for Dual-Lucifer
Luciferase activity was measured using aseTMReporter Assay System (Promega) and luminescence reader (BLR-201, Aloka). For the measurement of firefly luciferase and Renilla luciferase activities, luminescence for 10 seconds was counted in integration mode according to the instruction of the measurement kit. The activity value of the reference gene is divided by the activity value of the reporter gene, and the relative value Rela
The tive luchifarase activity was obtained as a measurement value. When the effector plasmid was not introduced, the relative value was set to 100, and the effect of the effector was investigated by the fluctuation of the activity value of the reporter gene when the effector plasmid was simultaneously introduced into the cells. That is, since the activity value of the reporter when the pGAL4-LUC reporter gene and the pGALDB-osERF3 effector plasmid was introduced was reduced, pGALDB-o
It has been shown that sERF3 has the effect of suppressing the activity of the reporter gene (repressor function). Hereafter, the activity value of the reporter is measured, and when the relative activity value of the reporter is 100 or less, the introduced effector has a repressor function. Therefore, which effector functions as a repressor activity is reported. It was investigated by measuring.

(Identification of repressor domain) In order to analyze the function involved in the transcriptional regulation of the Arabidopsis osERF3 gene, reporter genes pGAL4-LUC and pGALDB-osERF3 were introduced into protoplasts prepared from cultured tobacco cells by electroporation. , The activity of the reporter gene was investigated. As a result, the pGAL-osERF3 effector reduced the activity of the reporter gene by 50% as compared with the case of using the reporter gene alone without introducing the effector (control). As a control experiment, p35S-GALDBD containing no coding region of osERF3 did not affect the activity of the reporter gene. This is osERF3
Shows that it functions as a repressor that suppresses transcription.

Next, it was examined whether pGAL-193 / 235osERF3, an effector plasmid having a DAN fragment in which the protein coding region of the osERF3 gene was deleted, had a function of suppressing the activity of the reporter gene. pGAL-141 / 185osER
The F3 effector plasmid was introduced into tobacco cultured cells together with the reporter gene, and the activity of the reporter gene was measured.As a result, pGAL-193 / 235osERF3 effector was identified as pGALDB.
As in the case of introducing -osERF3, it was shown that there is a repressor function of suppressing the activity of the reporter gene to about 40% as compared with the control. (Fig. 4B). From this result, the region having the repressor function of osERF3 (repression domain) was found to be the amino acid sequence of osERF3, 141/185.
It was revealed that it exists in (Fig. 4B). This amino acid sequence is shown in SEQ ID NO: 2.

The peptide having the function of suppressing the transcription of the gene of the present invention is fused with a DNA-binding protein that specifically binds to the transcriptional regulatory region of the oncogene and expressed in the cell to express the oncogene. The expression can be efficiently suppressed. In addition, the repressor function was nonspecific to the gene when examined, but it is necessary to bind to DNA. Therefore, by fusion with a DNA binding domain that binds to specific DNA, the repressor function may be gene-specific or non-specific. It is possible to suppress the transfer. This makes it possible, for example, to control the expression of a gene encoding an enzyme of the pigment metabolism system, and to create a flower having petals of different colors, which has never been obtained before. In addition, by suppressing the expression of the protein that becomes an allergen, it becomes possible to produce foods that are low in allergen.

[0020]

[Sequence list] SEQUENCE LISTING    <110> Secretary of Agency of Industrial Science and Technology    <120> Novel repression domain of plant specific transcription factor    <130>    <160> 7    <210> 1 <211> 741 <212> DNA <213> oriza stativa    <400> 1 atg gcg ccc aga gca gct acg gtg gag aag gtt gct gtg gcg cca ccc 48 Met Ala Pro Arg Ala Ala Thr Val Glu Lys Val Ala Val Ala Pro Pro               5 10 15    acc ggg ctt ggt ctt ggc gtc ggc gga ggt gtc gga gcc ggg ggt cct 96 Thr Gly Leu Gly Leu Gly Val Gly Gly Gly Val Gly Ala Gly Gly Pro           20 25 30    cac tac agg ggc gtc cgc aag cgc ccg tgg ggg cgt tac gca gcg gag 144 His Tyr Arg Gly Val Arg Lys Arg Pro Trp Gly Arg Tyr Ala Ala Glu       35 40 45    atc cgt gac cct gcc aag aag agc cgg gtg tgg ctc ggt acc tac gac 192 Ile Arg Asp Pro Ala Lys Lys Ser Arg Val Trp Leu Gly Thr Tyr Asp    50 55 60    acg gca gag gag gcc gcc cgc gcc tac gac gcc gcc gct cga gag ttc 240 Thr Ala Glu Glu Ala Ala Arg Ala Tyr Asp Ala Ala Ala Arg Glu Phe 65 70 75 80    cgg ggt gcc aag gca aaa aca aac ttt ccg ttt gca tca cag tcg atg 288 Arg Gly Ala Lys Ala Lys Thr Asn Phe Pro Phe Ala Ser Gln Ser Met              85 90 95    gtc ggc tgt ggc ggc agc ccc agc agc aat agc acg gta gac acc ggt 336 Val Gly Cys Gly Gly Ser Pro Ser Ser Asn Ser Thr Val Asp Thr Gly          100 105 110 ggc ggc ggg gtt cag acg cct atg cgg gcc atg cct ctg ccg ccg act 384 Gly Gly Gly Val Gln Thr Pro Met Arg Ala Met Pro Leu Pro Pro Thr       115 120 125    ctg gac ttg gat ttg ttc cac cgc gcg gct gct gtg act gca gtc gcc 432 Leu Asp Leu Asp Leu Phe His Arg Ala Ala Ala Val Thr Ala Val Ala     130 135 140    ggc acc ggc gtt cgc ttt cct ttc aga gga tat ccc gtt gca cgt cca 480 Gly Thr Gly Val Arg Phe Pro Phe Arg Gly Tyr Pro Val Ala Arg Pro 145 150 155 160    gca acg cat cct tac ttt ttc tat gag cag gct gca gcg gct gcc gca 528 Ala Thr His Pro Tyr Phe Phe Tyr Glu Gln Ala Ala Ala Ala Ala Ala             165 170 175    gct gag gct gga tac cgt atg atg aag ctt gca ccg ccg gtc acc gtg 576 Ala Glu Ala Gly Tyr Arg Met Met Lys Leu Ala Pro Pro Val Thr Val          180 185 190    gcg gcg gtt gca caa agt gac tcc gac tcc tcg tcg gtg gtt gat ctc 624 Ala Ala Val Ala Gln Ser Asp Ser Asp Ser Ser Ser Val Val Asp Leu       195 200 205    gcg ccg tca cct cca gcg gtt acg gcg aac aag gcg gca gct ttc gat 672 Ala Pro Ser Pro Pro Ala Val Thr Ala Asn Lys Ala Ala Ala Phe Asp   210 215 220      ctg gat ctg aac cgg ccg ccg ccg gta gag aac tag ctc agg atg ggt 720 Leu Asp Leu Asn Arg Pro Pro Pro Val Glu Asn *** Leu Arg Met Gly 225 230 235 240    tag ctg acg act ttg tag ttt 741 *** Leu Thr Thr Leu ***              245    <210> 2 <211> 43 <212> RPT <213> oriza stativa    <400> 2 Ala Ala Val Ala Gln Ser Asp Ser Asp Ser Ser Ser Val Val Asp Leu              5 10 15 Ala Pro Ser Pro Pro Ala Val Thr Ala Asn Lys Ala Ala Ala Phe Asp           20 25 30 Leu Asp Leu Asn Arg Pro Pro Pro Val Glu Asn        35 40    <210> 3 <211> 21 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA <400> 3 gatggcgccc agagcagcta c    <210> 4 <211> 29 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 4 gtcgacctag ttctctaccg gcggcggcc    <210> 5 <211> 23 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 5 gcggcggttg cacaagtgac tcc    <210> 6 <211> 65 <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 6 agcttagatc tgcaagaccc ttcctctata taaggaagtt catttcattt ggagaggaca       10 20 30 40 50 60 cgctg    65    <210> 7 <211> <212> DNA <213> Artificial Sequence    <223> Description of Artificial Sequence: Synthetic primer DNA    <400> 7 gatccagcgt gtcctctcca aatgaaatga acttccttat atagaggaag ggtcttgcag       10 20 30 40 50 60 atcta   65

[Brief description of drawings]

FIG. 1 shows the procedure for constructing pGALDB-osERF3 from plasmid pBI221.

FIG. 2 shows the first half of the procedure for constructing the reporter gene GAL4-LUC.

FIG. 3 is a diagram showing the latter half of the procedure for constructing the reporter gene GAL4-LUC subsequent to FIG.

FIG. 4A is a diagram showing a reporter gene and an effector plasmid. In the figure, 5XGAL4: GAL4 transcription factor
DNA binding sequence, TATA: CaMV 35S promoter region containing TATA box, LUC: Luciferase gene, CaMV 35S:
Cauliflower mosaic virus 35S protein gene promoter, GAL4 DB: yeast GAL4 transcription factor DAN binding domain coding region, Nos: nopaline synthase gene transcription termination region. B is a figure which shows the influence which the deletion of osERF3 and osERF3 gives to the activity (Relative Activity) of a reporter gene. In the figure, the number on the left (193/23
5) shows the amino acid region of osERF3. The box in the middle indicates the amino acid sequence region corresponding to the number on the left. The graph on the right shows the activity of the reporter gene when an effector plasmid having the region on the left is introduced. The activity of the reporter gene when no effector was added was set to 100. It has been shown that an effector having the amino acid sequence 193/235, which is an effector of osERF3 and osERF3 deletion, reduces the activity of the reporter gene to 40% and has an effect of suppressing transcription.

─────────────────────────────────────────────────── ─── Continuation of the front page (51) Int.Cl. ⁷ Identification code FI C12N 5/10 C12N 5/00 A (56) References The Plant Cell, 1995, Vol. 7, p. 173-182 Biochem. J. , 1999, Vol. 339, p. 111-117 The Journal of Biological Chemistry, 1999, Vol. 274, No. 41, p. 29500-29504 Mol Gen Genet, 1997, Vol. 253, No. 5, p. 553-561 (58) Fields investigated (Int.Cl. ⁷ , DB name) C12N 15/09 C12N 15/29 C07K 14/415 SwissProt / PIR / GeneS eq GenBank / EMBL / DDBJ / GeneSeq BIOSIOS / WPI (DIALOG) ) PubMed

Claims (5)

(57) [Claims] 1. A peptide comprising (a) the amino acid sequence represented by SEQ ID NO: 1, or (b) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence (a). A peptide having the function of suppressing gene transcription. 2. A peptide comprising (a) the amino acid sequence represented by SEQ ID NO: 2, or (b) an amino acid sequence in which one or several amino acids are deleted, substituted or added in the amino acid sequence (a). A peptide having the function of suppressing gene transcription. 3. A gene encoding the peptide according to claim 1 or 2. 4. A recombinant vector containing the gene according to claim 3. 5. A transformant containing the recombinant vector according to claim 4.