WO2019154285A1

WO2019154285A1 - No-label reagent combination for gene editing, and application thereof

Info

Publication number: WO2019154285A1
Application number: PCT/CN2019/074243
Authority: WO
Inventors: 朱健康; 三木大介; 张文心; 彭方楠
Original assignee: 中国科学院上海生命科学研究院
Priority date: 2018-02-08
Filing date: 2019-01-31
Publication date: 2019-08-15
Also published as: CN110129357A

Abstract

A no-label reagent combination for gene editing, comprising: (i) a first nucleic acid construct, or a first vector containing the first nucleic acid construct; and (ii) a second nucleic acid construct, or a second vector containing the second nucleic acid construct. By using a nucleic acid construct of a specific structure, the site-directed knock-in and/or replacement of an RNA-guided base is successfully implemented in a plant.

Description

A reagent combination without label for gene editing and its application

Technical field

The present invention relates to the field of biotechnology, and in particular to a reagent combination without labeling for gene editing and its use.

Background technique

Gene editing technology has developed rapidly in recent years, with the ultimate goal of producing stable and heritable genetic sequence changes anywhere in the genome, including site-specific insertion, deletion or substitution of specified fragments or bases.

Currently, zinc finger nuclease (ZFN), transcription activator-like effector nucleases (TALEN) and CRISPR/Cas9 techniques (clustered regular interspaced short palindromic repeats/CRISPR-associated) Protein 9) has been successfully applied to gene editing in a variety of organisms including E. coli, yeast, rice, Arabidopsis, fruit flies, mice and human cells. All three techniques can specifically cleave DNA at a designated site in the genome of a living organism, producing a double-strand break, thereby performing fixed-point editing using the organism's own DNA repair mechanism. There are two ways of cell DNA self-healing, non-homologous end-joining (NHEJ) and homology-directed (HDR). NHEJ tends to randomly delete, insert or replace a sequence or a single base in the genome, and the probability of occurrence is higher when repairing; HDR can achieve accurate repair, but a homologous sequence is required as a template, and the probability of occurrence is low. Therefore, in the existing gene editing technology using HDR, in order to increase the positive rate, it is necessary to add a screening label to the introduced foreign homologous sequence.

At the moment, it is still a challenge to achieve fixed-point insertion or replacement of a given sequence or base in a plant genome. ZFN and TALEN technologies require specific protein guidance, but the construction of protein components is relatively complex, costly, and less efficient to edit. The CRISPR/Cas9 technology is RNA-guided, simple in vitro, low cost, and combined with HDR for accurate gene editing. However, it is necessary to add a screening label to the introduced foreign sequence, otherwise the editing efficiency is very low, and it is difficult to effectively apply to plant research and breeding.

In summary, for the needs of plant scientific research and breeding production, there is an urgent need in the art to develop an efficient gene targeting knock-in or replacement technique that does not require a screening tag.

Summary of the invention

It is an object of the present invention to provide an efficient gene-targeted knock-in or replacement technique that does not require a screening tag.

A 1A aspect of the invention provides a reagent combination without a tag for gene editing, comprising:

(i) a first nucleic acid construct, or a first vector comprising said first nucleic acid construct, said first nucleic acid construct having a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a tissue-specific promoter;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

(ii) a second nucleic acid construct, or a second vector comprising the second nucleic acid construct, the second nucleic acid construct having a structure of formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

In another preferred embodiment, the nucleotide linkage sequence is 1-60 nt.

In another preferred embodiment, the nucleotide linking sequence does not affect the normal transcription and translation of each element.

In another preferred embodiment, the tissue-specific promoter comprises a germ cell-specific promoter.

In another preferred embodiment, the germ cell-specific promoter is selected from the group consisting of a ovule-specific promoter, a pollen-specific promoter, a promoter specifically expressed early in embryonic development, or a combination thereof.

In another preferred embodiment, the ovule-specific promoter includes a DD45 promoter.

In another preferred embodiment, the pollen-specific promoter comprises a Lat52 promoter.

In another preferred embodiment, the promoter specifically expressed early in embryonic development includes the DD45 promoter.

In another preferred embodiment, the Cas9 protein is selected from the group consisting of Cas9, Cas12a (Cpf1), Cas12b, or a combination thereof.

In another preferred embodiment, the source of the Cas9 protein is selected from the group consisting of Streptococcus pyogenes, Staphylococcus aureus, or a combination thereof.

In another preferred embodiment, the source of the Cas12a protein is selected from the group consisting of Acidaminococcus, Lachnospiraceae bacterium, or a combination thereof.

In another preferred embodiment, the source of the Cas12b protein comprises Alicyclobacillus acidoterrestris.

In another preferred embodiment, the terminator is selected from the group consisting of a NOS terminator, a UBQ terminator, or a combination thereof.

In another preferred embodiment, the donor DNA has a length of from 600 to 3000 bp, preferably from 700 to 2800 bp.

In another preferred embodiment, the polyT sequence is selected from the group consisting of TTTTTTT.

In another preferred embodiment, the first nucleic acid construct, and/or the second nucleic acid construct further comprises an enhancer element.

In another preferred embodiment, the enhancer element is selected from the group consisting of the first intron sequence of the AtUbi10 gene, the TMV Omega sequence, or a combination thereof.

In another preferred embodiment, the first carrier and the second carrier are different carriers.

In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are on different vectors.

In another preferred embodiment, the first carrier and the second carrier are the same carrier.

In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are on the same vector.

In another preferred embodiment, the donor DNA does not carry a screening tag.

In another preferred embodiment, the vector is a binary expression vector that can be transfected or transformed into a plant cell.

In another preferred embodiment, the vector is a plant expression vector.

In another preferred embodiment, the vector is a pCambia vector.

In another preferred embodiment, the plant expression vector is selected from the group consisting of pCambia 1300, pCambia 3301, pCambia 2300, or a combination thereof.

In another preferred embodiment, the carrier is an Agrobacterium Ti carrier.

In another preferred embodiment, the carrier is cyclic or linear.

In another preferred embodiment, the plant is selected from the group consisting of cruciferous plants, gramineous plants, legumes, Solanaceae, or combinations thereof.

In another preferred embodiment, the plant is selected from the group consisting of Arabidopsis thaliana, rice, cabbage, soybean, tomato, corn, tobacco, wheat, sorghum, barley, oats, millet, peanut, or a combination thereof.

A first aspect of the invention provides a reagent combination without a tag for gene editing, comprising:

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a promoter that is highly expressed during tissue transformation;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

In another preferred embodiment, the tissue is highly expressed by a transformation period promoter comprising a tissue-specific promoter, and/or a constitutive promoter.

In another preferred embodiment, the high expression promoter of the tissue during the transformation period comprises a high expression promoter in the Agrobacterium infective phase.

In another preferred embodiment, the tissue is overexpressed during the transformation period and the promoter is selected from the group consisting of Maize Ubiquitin1 (Ubi1 for short), Rubisco, Actin promoter, or a combination thereof.

In another preferred embodiment, the tissue is transformed by a high expression promoter (PX) comprising a tissue that satisfies the following conditions: a promoter is highly expressed during the transformation period:

When the dip flower method is used, the ratio of PX/P1 is ≥80%, more preferably ≥90%;

PX/P1 ratio ≥ 80%, more preferably ≥ 90%; and / or

When the callus is transformed, the ratio of PX/P2 is ≥80%, more preferably ≥90%;

The ratio of PX/P2 is ≥80%, more preferably ≥90%.

Among them, PX is the initiation strength of the promoter with high expression during the transformation period; P1 is the initiation intensity of the Arabidopsis DD45 promoter; P2 is the initiation intensity of the Ubi1 promoter.

In another preferred embodiment, the constitutive promoter is selected from the group consisting of Ubi 1, Actin, Rubisco, Ribosomal promoter, or a combination thereof.

In another preferred embodiment, the tissue-specific promoter comprises a promoter that is specifically expressed by germ cells and/or a promoter that is highly expressed by callus.

In another preferred embodiment, the callus high expression promoter includes a Thaumatin promoter, a Ribulose bisphosphate carboxylase promoter, a SlAHRD promoter, a SlRBCSC promoter, and an Elongation factor promoter.

In another preferred embodiment, the Thaumatin promoter comprises one or more promoters of plant origin selected from the group consisting of rice, corn, bamboo stalk, or a combination thereof.

In another preferred embodiment, the Ribulose bisphosphate carboxylase promoter comprises one or more plant derived promoters selected from the group consisting of tomato, sweet potato, tobacco, rice, or a combination thereof.

In another preferred embodiment, the SlAHRD promoter comprises one or more plant derived promoters selected from the group consisting of tomato, sweet potato, tapioca, or a combination thereof.

In another preferred embodiment, the SlRBCSC promoter comprises one or more plant derived promoters selected from the group consisting of tomato, sweet potato, tapioca, or a combination thereof.

In another preferred embodiment, the constitutive promoter is selected from the group consisting of Ubi1, Actin, Rubisco, Ribosome promoter, or a combination thereof.

In another preferred embodiment, the first carrier and the second carrier are the same or different carriers.

In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are on the same or different vectors.

In another preferred embodiment, the first nucleic acid construct and the second nucleic acid construct are located on the same vector.

In another preferred embodiment, the donor DNA does not carry a screening tag.

According to a second aspect of the invention, there is provided a kit comprising the reagent combination according to the first aspect of the invention or the second aspect of the invention.

In another preferred embodiment, the kit further contains a label or instructions.

A third aspect of the invention provides a method for genetically editing a plant, comprising the steps of:

(i) providing the plant to be edited as a parental plant;

(ii) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct into the plant cell of the plant to be edited, thereby obtaining a plant cell introduced into the plant to be edited;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

(iii) obtaining a plant derived from the progeny plant of the plant cell into which the plant to be edited is introduced;

(iv) introducing a second nucleic acid construct or a second vector comprising the second nucleic acid construct into the plant cell of the progeny plant,

Wherein the plant cell is selected from the group consisting of:

(b1) an ex vivo cell from the progeny plant;

(b2) a cell of the callus formed by the ex vivo cells of the progeny plant;

(b3) cells from a reproductive organ located on a plant of the progeny plant;

Wherein the first nucleic acid construct has a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

The second nucleic acid construct has the structure shown by formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

In another preferred embodiment, the reproductive organ comprises a flower.

In another preferred embodiment, the cells comprise: pollen cells.

In another preferred embodiment, in step (ii), the plant cell is (a3); and/or in step (iv), the plant cell is (b3).

In another preferred embodiment, the method comprises:

(1) providing plants to be edited;

(2) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct into the plant cell of the plant to be edited;

(3) after the T1 time, introducing a second nucleic acid construct or a second vector containing the second nucleic acid construct into the plant cell of the plant to be edited;

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

In another preferred embodiment, the T1 is from 10 days to 500 days, preferably from 15 days to 200 days.

In another preferred embodiment, the plant cell is from a flower, callus, or a combination thereof.

In another preferred embodiment, the callus is induced to form cells of roots, stems, leaves, flowers, and/or seeds with plant cells selected from the group consisting of the following groups.

In another preferred embodiment, when the plant cell in step (ii) is (a3) a cell from a reproductive organ located on the plant (such as a cell using a flower of Arabidopsis thaliana), then the T1 is 42 days. -70 days, preferably 49 days - 63 days.

In another preferred embodiment, when the plant cell in step (ii) is (a2) a cell of a callus formed by an ex vivo cell of the plant (such as a cell using rice callus), then the T1 is 15 days - 40 days, preferably 25 days - 30 days.

In another preferred embodiment, the plant cells in step (ii) and step (iv) are from the same site.

In another preferred embodiment, the plant cells in step (2) and step (3) are from the same site.

In another preferred embodiment, the introduction is introduced by Agrobacterium.

In another preferred embodiment, the introduction is by a gene gun.

In another preferred embodiment, the gene is edited as a point-in or a substitution.

(i) providing the plant to be edited as a parental plant;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

Wherein the plant cell is selected from the group consisting of:

(b1) an ex vivo cell from the progeny plant;

(b2) a cell of the callus formed by the ex vivo cells of the progeny plant;

(b3) cells from a reproductive organ located on a plant of the progeny plant;

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

(i) providing the plant to be edited as a parental plant;

(ii) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct, and a second nucleic acid construct or a second vector comprising the second nucleic acid construct into the plant of the plant to be edited Cells, thereby obtaining plant cells introduced into the plant to be edited;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

(iii) obtaining a plant derived from the plant cell into which the plant to be edited is introduced; wherein

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

A 3D aspect of the invention provides a method of genetically editing a plant, comprising the steps of:

(i) providing the plant to be edited as a parental plant;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

A fourth aspect of the invention provides a method of preparing a transgenic plant cell, comprising the steps of:

(i) transfecting a combination of the agent of the first aspect of the invention or the agent of the first aspect of the invention with a plant cell such that the construct in the reagent combination is knocked into the chromosome of the plant cell and/or Alternatively, the transgenic plant cells are produced.

In another preferred embodiment, the transfection is performed using an Agrobacterium transformation method or a gene gun bombardment method.

A fifth aspect of the invention provides a method of preparing a transgenic plant cell, comprising the steps of:

(i) transfecting a plant combination according to the first aspect of the invention or the agent of the first aspect of the invention, such that the plant cell contains the construct in the reagent combination, thereby producing the transgenic plant cell .

A sixth aspect of the invention provides a method of preparing a transgenic plant, comprising the steps of:

The transgenic plant cell prepared by the method of the fourth aspect of the invention or the method of the fifth aspect of the invention is regenerated into a plant body, thereby obtaining the transgenic plant.

A seventh aspect of the invention provides a transgenic plant prepared by the method of the sixth aspect of the invention.

It is to be understood that within the scope of the present invention, the various technical features of the present invention and the various technical features specifically described hereinafter (as in the embodiments) may be combined with each other to constitute a new or preferred technical solution. Due to space limitations, we will not repeat them here.

DRAWINGS

Figure 1 is a schematic representation of targeted knock-in or replacement.

(A) Schematic diagram of preparation of exogenous donor DNA fragments.

(B) Schematic representation of plant targeted knock-in by HDR mechanism using donor DNA without a screening tag.

Figure 2 is a schematic representation of targeted knockdown of GFP fragments at the 3' end of the Arabidopsis ROS1 gene.

(A) Schematic diagram of DD45::Cas9 vector construction. 35S::HPT is the original component of the binary carrier pCambia1300.

(B) Schematic diagram of construction of GFP donor fragment and vector expressing gRNA. 35S::Bar is the original component of the binary carrier pCambia3301.

(C) Schematic diagram of GFP donor fragment, ROS1 21 ^st exon sequence, gRNA sequence, 5'arm, 3'arm and PCR detection primer design.

Figure 3 shows the results of detection of knock-in GFP fragments at the 3' end of the ROS1 gene of Arabidopsis thaliana.

(A) PCR screening results of T1 generation plants of interest.

(B) Identification results of the T2 generation PCR genotype of the plant of interest.

(C) GFP targeted knock-in DNA sequencing results.

Figure 4 shows the expression levels and function of ROS1-GFP in Arabidopsis thaliana.

(A) Quantitative PCR was used to detect the expression level of ROS1-GFP mRNA in GFP homozygous, heterozygous and unknocked Arabidopsis transgenic plants. Wild type Col-0 is a control.

(B) Laser confocal fluorescence microscopy was used to detect GFP signal in root tip cells of GFP homozygous plants. Wild type Col-0 was a negative control.

(C) Quantitative Chop-PCR was used to detect the demethylation of ROS1-GFP protein in GFP homozygous, heterozygous and unknocked Arabidopsis transgenic plants. At1g26400 and At1g03890 are known hypomethylation in Col-0, a hypermethylation site in ros1-4 functional deletion mutants.

Figure 5 is a schematic representation of targeted knockdown of GFP fragments at the 3' end of the DME gene of Arabidopsis thaliana.

(A) Schematic diagram of the construction of a GFP donor fragment and a vector expressing gRNA. 35S::Bar is the original component of the binary carrier pCambia3301.

(B) Schematic diagram of primer design for GFP donor fragment, DME 20 ^th exon sequence, gRNA sequence, 5'arm, 3'arm and PCR detection.

In each of the above figures, "arm" refers to a homology arm.

Figure 6 is a schematic diagram of targeted knockdown of the GFP gene at the 3' end of the rice OsROS1a gene.

(A) Schematic diagram of Ubi1::Cas9 vector construction. 35S::HPT is the original component of the binary carrier pCambia1300.

(C) Schematic diagram of primer design for GFP donor fragment, OsROS1 18 ^th exon sequence, gRNA sequence, 5'arm, 3'arm and PCR detection.

Figure 7 shows the results of detection of knock-in GFP fragments at the 3' end of the rice OsROS1a gene.

(A) PCR screening results of T0 positive individuals.

(B) Results of PCR genotype identification of T1 plants.

(C) GFP targeted knock-in DNA sequencing results.

Figure 8 is a schematic diagram showing the target knock-in GFP fragment at the 3' end of the ROS1 gene of Arabidopsis thaliana using a one-step method;

(A) Schematic diagram of one-step vector construction. It includes the DD45::Cas9 component, a GFP donor fragment, and a component that expresses gRNA. 35S::HPT is the original component of the binary carrier pCambia1300.

(B) Results of PCR genotype identification of T1 plants.

Figure 9 is a schematic diagram showing the target knock-in GFP fragment at the 3' end of the Arabidopsis ROS1 gene using an enhancer on a one-step basis;

(A) Schematic diagram of one-step vector construction. It includes the DD45:: enhancer-Cas9 component, a GFP donor fragment, and a component that expresses gRNA. 35S::HPT is the original component of the binary carrier pCambia1300.

(B) Results of PCR genotype identification of T1 plants.

Detailed ways

The present inventors have extensively and intensively studied to screen out specific tissues that are highly expressed by the promoter during the transformation period and/or the Agrobacterium infecting stage with high expression promoters (including tissue-specific promoters, and/or components). Type promoter), by employing a nucleic acid construct of a specific structure, the present invention successfully achieves efficient RNA-directed gene editing (base-point typing and/or substitution) in plants, and in the present invention, knock-in and The replacement efficiency can be as high as 5 to 10% or higher, and the donor DNA of the present invention does not have a screening tag, and for the first time, the label-free, accurate, seamless, stable and heritable editing of the target gene is achieved. Furthermore, the present invention has found for the first time that the method of the present invention is a general method, and that one-step or two-step methods can achieve very high knockout and/or replacement efficiency. On the basis of this, the inventors completed the present invention.

the term

The term "plant promoter" as used herein refers to a nucleic acid sequence capable of initiating transcription of a nucleic acid in a plant cell. The plant promoter may be derived from a plant, a microorganism (such as a bacterium, a virus) or an animal, or a synthetic or engineered promoter.

The term "Cas protein" as used herein refers to a nuclease. A preferred Cas protein is the Cas9 protein. Typical Cas9 proteins include, but are not limited to, Cas9 derived from Streptococcus pyogenes, Staphylococcus aureus. As used herein, the term "coding sequence of a Cas protein" refers to a nucleotide sequence that encodes a Cas protein having cleavage activity. In the case where the inserted polynucleotide sequence is transcribed and translated to produce a functional Cas protein, the skilled artisan will recognize that because of the degeneracy of the codon, a large number of polynucleotide sequences can encode the same polypeptide. . In addition, the skilled person will also recognize that different species have a certain preference for codons, and may optimize the codons of the Cas protein according to the needs of expression in different species. These variants are all referred to by the term "Cas protein. The coding sequence is specifically covered. Furthermore, the term specifically encompasses a full-length sequence substantially identical to the Cas gene sequence, as well as a sequence encoding a protein that retains the function of the Cas protein.

As used herein, the term "plant" includes whole plants, plant organs (such as leaves, stems, roots, etc.), seeds and plant cells, and progeny thereof. The kind of plant which can be used in the method of the present invention is not particularly limited, and generally includes any higher plant type which can be subjected to transformation techniques, including monocots, dicots, and gymnosperms.

As used herein, the term "base knock-in" refers to the substitution of a large fragment, especially when the sequence is completely different from the original gene.

As used herein, the term "base substitution" refers to the replacement of small fragments, several amino acids, and several bases.

As used herein, the term "expression cassette" refers to a stretch of polynucleotide sequences comprising a gene to be expressed and a sequence component that expresses the desired element. The components required for expression include a promoter and a polyadenylation signal sequence. Furthermore, the expression cassettes of the invention may or may not contain other sequences including, but not limited to, enhancers, secretion signal peptide sequences, and the like.

Unlabeled reagent combination for gene editing

The invention provides a combination of reagents for label-free use in gene editing, the reagent combination comprising a first nucleic acid construct or a first vector comprising the first construct; and a second construct or comprising the second A second vector of the construct, wherein the first nucleic acid construct has a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is a gRNA transcript sequence;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

In the present invention, there is also provided a reagent combination without labeling for gene editing, comprising:

P1-Z1-Z2 (I)

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

P2-Z3-Z4-Z5 (II)

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.

In the present invention, the high expression promoter of the tissue during the transformation period refers to a strong promoter which is highly expressed in the growth stage of plant tissues (such as flower buds, callus, cotyledon, etc.), specifically, the tissue is transformed. The high expression promoter during the period includes a tissue that meets the following conditions: the promoter is highly expressed during the transformation period:

PX/P1 ratio ≥ 80%, more preferably ≥ 90%; and / or

The ratio of PX/P2 is ≥80%, more preferably ≥90%;

Among them, PX is the initiation strength of the promoter with high expression during the transformation period; P1 is the initiation intensity of the Arabidopsis DD45 promoter; P2 is the initiation intensity of the Maize Ubi1 promoter.

In the present invention, the stage of tissue transformation includes transfection and infection. When applied to Agrobacterium infection, the promoter is highly expressed in the Agrobacterium infection stage. In the present invention, the Agrobacterium infective high expression promoter refers to a strong promoter which is highly expressed in the Agrobacterium transfection stage.

The various elements used in the constructs of the present invention can be obtained by conventional methods, such as PCR methods, full artificial chemical synthesis, enzymatic cleavage methods, and then joined together by well-known DNA ligation techniques to form the constructs of the present invention. .

The transgenic plant cells are prepared by transforming the vector of the present invention into plant cells to mediate the integration of the plant cell chromosomes by the vector of the present invention.

The transgenic plant cells of the present invention are regenerated into plant bodies to obtain transgenic plants.

The nucleic acid construct constructed by the present invention can be introduced into a plant cell by a conventional plant recombination technique (for example, Agrobacterium transformation technology) to obtain a nucleic acid construct (or a vector carrying the nucleic acid construct). Plant cells, or plant cells in the genome in which the nucleic acid construct is integrated.

Gene editing

As used herein, "gene editing" refers to an artificial, targeted change in a gene that results in the deletion, insertion, or substitution of DNA at a particular site in the biological genome.

"Gene targeting" or "gene targeting" refers to the transformation of the genome based on the principle of homologous recombination (a DNA damage repair mechanism inherent in cells), mainly gene knock-in and substitution.

In the present invention, gene editing includes gene targeting.

Vector construction

The main feature of the vector is to use the high expression promoter of the plant tissue during the transformation period (such as DD45 in Agrobacterium tumefaciens, such as Ubi1 in Agrobacterium callus transformation method) to drive the Cas protein in the CRISPR/Cas system to be transformed. It is abundantly expressed in plant tissues and guided by guide RNA to a target site in the genome, the target is cleaved by Cas protein, and plant targeted knock-in or substitution is performed by HDR mechanism.

In general, in order to increase the activity of a protein, proteins are usually linked by some flexible short peptides, namely Linker (linker peptide sequence). Preferably, the Linker can use ATTB.

To increase knock-in and/or substitution efficiency, the present invention selects specific promoters suitable for plant cells, such as the DD45 promoter, the U6 promoter, the Lat52 promoter, the Ubi1 promoter, and the like. The expression cassette of the guide RNA suitable for plant cells is selected and constructed in a different vector from the open expression cassette (ORF) of the above proteins.

In the present invention, the vector is not particularly limited, and any binary vector may be, not limited to, a pCambia vector, and is not limited to these two kinds of resistance, as long as a carrier satisfying the following requirements can be used in the present invention: (1) It can be transformed into plants by Agrobacterium-mediated transformation; (2) allowing normal transcription of RNA; (3) allowing plants to acquire new resistance.

In a preferred embodiment, the vector is selected from the group consisting of pCambia 1300, pCambia 3301, pCambia 2300, or a combination thereof.

Genetic transformation

The above vector is introduced into a plant recipient by a suitable method. The introduction methods include, but are not limited to, Agrobacterium transfection method, gene gun method, microinjection method, electroporation method, ultrasonic method, and polyethylene glycol (PEG)-mediated method. Receptor plants include, but are not limited to, Arabidopsis thaliana, rice, soybean, tomato, corn, tobacco, wheat, sorghum, and the like. After the above DNA vector or fragment is introduced into a plant cell, the DNA in the transformed plant cell expresses the protein and the guide RNA. The Cas protein is genetically edited (knock-in and/or replaced) at the target site under the guidance of its guide RNA.

For plant cells or tissues or organs after site-directed replacement of the plant genome by the method of the present invention, the corresponding transgenic plants can be regenerated by conventional methods. For example, a genetically edited plant is obtained by Agrobacterium immersion.

application

The invention can be used in the field of plant genetic engineering for plant research and breeding, especially for the genetic improvement of economically valuable crops, forestry crops or horticultural plants.

The main advantages of the invention include:

(1) The present invention provides for the first time a highly efficient designated fragment or base-based knock-in or substitution method for plants, which realizes label-free, cumbersome, accurate, seamless, stable and heritable editing of the target gene, and its efficiency. It can be as high as 5 to 10% or higher and can be widely used in plant scientific research and breeding production.

(2) The donor DNA of the present invention does not need to contain a screening tag.

(3) The present invention firstly uses a tissue-expressing high expression promoter (including a tissue-specific promoter (such as promoter-specific promoter DD45) and/or a callus-expressing promoter Ubi1) to drive Cas9 nuclease. The expression, so as to efficiently achieve the specified fragment or base point-in or substitution, the editing efficiency can reach 3% to 10% or higher.

(4) The present invention firstly uses the Agrobacterium "two-step transformation method" to obtain a transformant plant of interest, that is, the method of first introducing Cas nuclease, then introducing donor DNA and guide RNA for the first time, and achieving efficient editing.

(5) The present invention only performs gene editing (knock-in and/or replacement) on the gene locus desired to be edited, and other sequences of the gene, especially the 5'arm and 3'arm sequences as homology arms, do not have a base. A change in the base or fragment.

(6) The plant gene editing method of the present invention is simple and easy to popularize and apply.

(7) The present invention can also obtain a transformant plant of interest by a "one-step method", and thus the method of the present invention has universality.

(8) The "one-step method" in the present invention includes the addition of an enhancer and the like to the expression element of the Cas9 nuclease after the element optimization (such as the first intron sequence of the AtUbi10 gene, the TMV Omega sequence, etc.), editing Efficiency is up to 4% or higher.

The invention is further illustrated below in conjunction with specific embodiments. It is to be understood that the examples are not intended to limit the scope of the invention. The experimental methods in the following examples which do not specify the specific conditions are usually carried out according to the conditions described in conventional conditions such as Sambrook et al., Molecular Cloning: Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the manufacturer. The suggested conditions. Percentages and parts are by weight unless otherwise stated. The experimental materials and reagents referred to in the present invention can be obtained from commercially available channels unless otherwise specified.

experimental method

1 Arabidopsis "two-step transformation" method

Wild type Arabidopsis thaliana, normal culture to full bloom (generally about 4 weeks), with Agrobacterium carrying Cas9 plasmid, in accordance with traditional methods, inflorescence, this is the first step of infection.

The dip-dyeing operation can be completed in one hour, as long as the carrier is constructed well, it takes only 5 days from the preparation of Agrobacterium to the completion of dip dyeing.

After the end of the dip flower, wait another 3 weeks, the inflorescence is firm, the seeds are fully mature, and harvested.

The seeds are cultured, and the resistant seedlings are selected by hygromycin. For example, 36 strains are obtained, and the presence and activity of Cas9 are identified, and the highest activity of Cas9 (such as 2 strains) is selected (this is a mother strain), and normal culture is carried out. In the flowering period, the Agrobacterium carrying the donor plasmid is used to soak the inflorescence. This is the second step of transfection, and then wait for 3 weeks, the seeds are matured and harvested, and identified and screened.

The plant with the best activity of Cas9 retains the seed that has not been infected by the Agrobacterium in the inflorescence, that is, the parent strain containing Cas9, and the subsequent experiments can be used.

2 Arabidopsis "one-step transformation" method

Wild-type Arabidopsis thaliana, normal culture to full bloom (usually about 4 weeks), using Agrobacterium carrying both Cas9 and donor plasmids, infecting inflorescences according to traditional methods, and waiting for 3 weeks, seeds matured and harvested, can be identified filter.

3 crop transformation method

For example, rice, tomato, corn, cassava and other crops that are not suitable for transformation by the dip method are generally transformed by using Agrobacterium-infected callus. The difference is that only the transforming materials are different, the Agrobacterium species are different, and the other vector design, plant identification and screening methods are the same.

In the "two-step transformation" strategy, the callus can be continuously transformed twice in a few hours, and then the two resistances can be used for positive screening at the same time; the Cas9 vector can also be transformed first, and cultured for several days to several weeks after a resistance screening. After the positive transformants were selected, the donor vector was transformed and a second resistance screen was performed.

In the "one-step conversion" strategy, there is only one vector, so only one conversion is needed, and the resistance screening is once.

Example 1 "Two-step transformation" method for knocking in the GFP gene at the 3' end of the ROS1 gene of Arabidopsis thaliana

The vector expressing DD45::Cas9 and the vector containing the donor DNA fragment GFP green fluorescent protein gene and expressing guide RNA were sequentially transformed into plants by Agrobacterium immersion method, and the GFP gene synthesized in vitro was finally inserted into Arabidopsis thaliana ROS1 gene. The 3' end area. PCR, DNA sequencing, quantitative PCR, quantitative Chop-PCR and laser confocal fluorescence microscopy showed that the fragment can be efficiently integrated into the target site, functioning normally, and does not affect the normal function of the original gene. The specific operation process is as follows:

1.1Cas9 vector preparation and acquisition of transgenic mother plants (first transgenic plants)

The Arabidopsis DD45 promoter-mediated Cas9 sequence was integrated in vitro into the binary vector pCambia1300 (hygromycin resistance) (Fig. 2A). Refer to the method of Mao Yifei et al. (Mao et al., 2013).

The Cas9 plasmid was transformed into competent Agrobacterium tumefaciens GV3101 by heat bombardment, and the Arabidopsis Col-0 inflorescence was transformed by Agrobacterium immersion method to harvest mature seeds. Using hygromycin as a screening agent, resistant plants were screened by conventional seedling culture, that is, an Arabidopsis parent strain expressing Cas9 protein, which is called a first transgenic plant.

1.2 Preparation of donor fragment vector and acquisition of target plant (second transgenic plant) screening library

The gRNA was designed for the last exon of the Arabidopsis ROS1 gene, the 3' end of 21 ^st exon, and the promoter is Arabidopsis AtU6. Refer to the method of Mao Yifei et al. (Mao et al., 2013).

Taking the stop codon TAA of ROS1 21 ^st exon as the limit, take 801 bp upstream as the 5' homology arm (5'arm), TAATCCGTT as the fragment to be replaced on the endogenous gene, and take 325 bp downstream as 3' Source arm (3'arm). The 5'arm, the target fragment 720 bp GFP gene and the 3'arm were sequentially ligated in vitro as a donor fragment (Fig. 2C).

Finally, the AtU6::gRNA component and the donor component were co-integrated into the binary vector pCambia3301 (herbicide Basta resistance) (Fig. 2B).

The vector was transformed into Agrobacterium GV3101 by heat bombardment, and the previously obtained Arabidopsis Cas9 mother strain (i.e., the first transgenic plant) inflorescence was transformed by the dip method to harvest the mature seeds.

Using the herbicide Basta as a screening agent, resistant plants (ie, T1 generation) were screened by conventional seedling culture as a screening library of the target plants.

The Arabidopsis ROS1 gene 21 ^st exon and its upstream and downstream sequences are as follows:

Among them, the single underline shows the gRNA target sequence (forward), the bold black base CC is the Cas9 cleavage site, the black box shows the sequence that will be replaced, and the italic partial sequence is 5'arm. The bold italic partial sequence is 3'arm.

The GFP sequence is as follows:

Among them, the double underline shows a linked sequence that prevents gene silencing.

1.3 Acquisition of target plants and detection of targeted knock-in efficiency

All T1 plants in the screening library were numbered sequentially, and genomic DNA was extracted from mature inflorescences per plant.

PCR amplification assays were performed using the following 3 pairs of specific design primers (Figure 2C):

ROS1-GFP 5'-F: GCAGTTGGAAAAGAGAGAACCTGATGATCC (SEQ ID NO.: 3)

ROS1-GFP 5'-R: CTGAACTTGTGGCCGTTCACGTC (SEQ ID NO.: 4)

ROS1-GFP full-F: ACCTGATGATCCATGTTCTTATTTG (SEQ ID NO.: 5)

ROS1-GFP full-R: CCTTGTACAACTCTAGGACTGTT (SEQ ID NO.: 6)

ROS1-GFP 3'-F: ACAACCACTACCTGAGCACC (SEQ ID NO.: 7)

ROS1-GFP 3'-R: TGAAGATCGGAGCTGGTTCC (SEQ ID NO.: 8)

Arabidopsis thaliana is a diploid plant, and GFP donor DNA is successfully targeted into the inserted plants. The amplicon of homozygous and hybrid plants ROS1-GFP 5'-F/R is 1011 bp, ROS1-GFP 3'-F The amplicon of /R is 559 bp; for ROS1-GFP full-F/R, the homozygous plant has only one 1758 bp amplicon, and the hybrid has a 1018 bp amplicon. The results of electrophoresis detection after PCR amplification are shown in Fig. 3A, #1 from DD45-#58 mother strain is heterozygous, #2, #5 are homozygous, #3, #4, #6 are wild type; from DD45 ##母母的#9 is heterozygous, #11 is homozygous, and #7, #8, #10, #12 are wild type.

The seeds of heterozygous single plant #1 were continuously cultured. The results of PCR detection by single plant are shown in Fig. 3B, that is, the T2 progeny of heterozygous T1 has gene separation, which is consistent with Mendelian inheritance law, indicating that the replacement insertion of GFP is heritable. ,stable.

Further sequencing results showed that the GFP donor DNA correctly replaced the endogenous gene TAATCCGTT sequence, seamlessly inserted into the 3' end of ROS1, and the remaining sequences of ROS1 21 ^st exon did not produce mutations (Fig. 3C).

The screening results from the background of two different Cas9 mother strains were counted. As shown in Table 1, the targeted knock-in efficiencies of exogenous GFP without the screening tag were 7.7% and 8.3%, respectively.

Table 1. GFP targeted knock-in efficiency of Arabidopsis ROS1 gene

1.4 knock-in fragment function and target gene function detection

Total RNA from Arabidopsis thaliana leaves was obtained from 21 days old and reverse transcribed into cDNA. Fluorescence quantitative PCR showed that GFP was stably inherited T3 homozygous and heterozygous plants, and the expression level of ROS1 gene was comparable to wild type Col-0. (Fig. 4A). Laser root confocal fluorescence microscopy showed that ROS1-GFP protein was successfully expressed in Arabidopsis root tip cells (Fig. 4B). BstUI-cleaved DNA was used as a template, and quantitative Chop-PCR assay showed that ROS1-GFP protein could still perform the normal function of endogenous ROS1 original demethylase (Fig. 4C).

The fluorescent quantitative PCR primers are as follows:

ROS1-qRT PCR-F: ACCAAACGAAGGGAACAGAGA (SEQ ID NO.: 9)

ROS1-qRT PCR-R: ACAGTCCTAGAGTTGTACAAGGT (SEQ ID NO.: 10)

Fluorescent quantitative Chop-PCR primers are as follows:

At1g26400-BstUI-qChop-F: TGACCTGCATAGGCTATAACACA (SEQ ID NO.: 11)

At1g26400-BstUI-qChop-R: ATTGGAATCAATCCGAGTGG (SEQ ID NO.: 12)

At1g03890-BstUI-qChop-F: CGTGCATTATTTTGGCAGTAACA (SEQ ID NO.: 13)

At1g03890-BstUI-qChop-R: ATGCGTCCGGATTTCAGTAT (SEQ ID NO.: 14)

Example 2

"Two-step transformation" method knocks LUC gene at the 3' end of Arabidopsis ROS1 gene

The vector expressing DD45::Cas9 and the vector containing the donor DNA fragment LUC luciferase gene and expressing guide RNA were transformed into plants by Agrobacterium immersion method, and finally the foreign fragment LUC was inserted into Arabidopsis thaliana ROS1 gene. The 3' end area.

2.1Cas9 vector preparation and acquisition of the first transgenic plants

The vector preparation and plant obtaining method were the same as in Example 1.

2.2 Preparation of donor fragment vector and acquisition of second transgenic plants

The vector preparation and plant obtaining method were the same as in Example 1. The difference is that the in vitro synthesized donor DNA fragment becomes a 1653 bp LUC gene.

The screening results from the background of a Cas9 mother strain were counted. As shown in Table 2, the exogenous LUC without the screening tag had a targeted knock-in efficiency of 6.3% in the ROS1 gene.

Table 2. LUC targeted knock-in efficiency of Arabidopsis ROS1 gene

Example 3

The "two-step transformation" method knocks the GFP gene at the 3' end of the DME gene of Arabidopsis thaliana

The vector expressing DD45::Cas9 and the vector containing the GFP gene of the donor DNA fragment and expressing guide RNA were transformed into plants by Agrobacterium immersion method, and the exogenous fragment GFP was finally inserted into the 3' of the Arabidopsis DME gene. End area.

3.1Cas9 vector preparation and acquisition of the first transgenic plants

3.2 Preparation of donor fragment vector and acquisition of second transgenic plants

The vector preparation and plant obtaining method were the same as in Example 1. The difference is: 1 is to design the gRNA for the 3' end of the last exon of the Arabidopsis DME gene, 20 ^th exon. 2 The homology arm sequence was taken upstream and downstream from the stop codon of the DME gene 20 ^th exon (Fig. 5A, 5B).

The screening results from the background of a Cas9 parent strain were counted. As shown in Table 3, the knock-in efficiency of exogenous GFP without the screening tag at the 3' end of the DME gene was 9.1%.

Table 3. GFP targeted knock-in efficiency of the Arabidopsis DME gene at the 3' end

Example 4

The "two-step transformation" method knocks the GFP gene at the 5' end of the DME gene of Arabidopsis thaliana

The vector expressing DD45::Cas9 and the vector containing the donor DNA fragment GFP gene and expressing guide RNA were transformed into plants by Agrobacterium immersion method, and the exogenous fragment GFP was finally inserted into the 5' of the Arabidopsis DME gene. End area.

4.1Cas9 vector preparation and acquisition of the first transgenic plants

4.2 Preparation of donor fragment vector and acquisition of second transgenic plants

The vector preparation and plant obtaining method were the same as in Example 1. The difference is: 1 is to design a gRNA against the 5' end of the second exon of the Arabidopsis DME gene, 2rd exon. 2 The homology arm sequence was taken from the upstream and downstream of the 2rd exon start codon of the DME gene.

The screening results from the background of 2 different Cas9 mother strains were counted. As shown in Table 4, the knock-in efficiency of exogenous GFP without the screening tag at the 5' end of the DME gene was 8.3%.

Table 4. GFP targeted knock-in efficiency of the 5' end of Arabidopsis DME gene

Example 5

"Two-step transformation" method replaces proline P at position 1633 of Arabidopsis DME protein with alanine A

The vector expressing DD45::Cas9 and the vector containing the GFP gene of the donor DNA fragment and expressing guide RNA were transformed into plants by Agrobacterium immersion method, and the proline P sequence of the 1633 locus of Arabidopsis DME gene was finally obtained. Replace with the alanine A sequence.

Preparation of 5.1Cas9 vector and acquisition of first transgenic plants

5.2 Preparation of donor fragment vector and acquisition of second transgenic plants

The vector preparation and plant obtaining method were the same as in Example 1. The difference is: 1 is to design gRNA for the 1633 locus of Arabidopsis DME protein. 2 The homology arm sequence was taken from the upstream and downstream genes of the 1633 site of the DME protein.

The screening results from the background of a Cas9 parent strain were counted. As shown in Table 5, the Arabidopsis DME gene site-replacement efficiency was 5.3%.

Table 5. Site-directed replacement efficiency of Arabidopsis DME genes

In summary, the "two-step transformation" method, the vector expressing DD45::Cas9 and the vector containing the donor DNA and expressing the guide RNA are sequentially transformed into plants, and the target fragment of the length of 1653 bp can be achieved without labeling or mutation. It can be genetically targeted to knock in or replace and function normally, and the editing efficiency can be as high as 9.1%.

Example 6

The "two-step transformation" method knocks the GFP gene into the 3' end of the rice OsROS1a gene.

Using Agrobacterium callus infection method, the vector expressing Ubi1::Cas9 and the vector containing the donor DNA fragment GFP gene and expressing guide RNA were sequentially transformed into plants, and the exogenous fragment GFP synthesized in vitro was finally inserted into rice OsROS1a. The 3' end region of the gene. PCR and DNA sequencing indicated that the fragment was able to integrate to the target location. The specific operation process is as follows:

6.1Cas9 vector preparation and acquisition of transgenic mother plants (first transgenic plants)

The maize Ubi1 promoter-mediated Cas9 sequence was integrated in vitro into the binary vector pCambia1300 (hygromycin resistance) (Fig. 6A). See Zhang Hui et al. (Zhang et al., 2014).

The Cas9 plasmid was transformed into competent Agrobacterium tumefaciens EH105 by heat bombardment, and then transformed into Japanese Nipponbare callus by Agrobacterium infection method. Hygromycin was used as a screening agent, and after screening, a positive plant, that is, a rice mother plant expressing Cas9 protein, was obtained after being cultured on a differentiation medium, and was referred to as a first transgenic plant. The seed of the mother strain was collected, and the rice callus expressing the Cas9 protein was induced to stand by.

6.2 Preparation of donor fragment vector and acquisition of the target plant (second transgenic plant)

The gRNA was designed against the last exon of the rice OsROS1a gene, the 3' end of the 18 ^th exon, and the promoter was OsU6. See Zhang Hui et al. (Zhang et al., 2014).

Take the stop codon TAG of OsROS1a 18 ^th exon as the limit, take 1000bp upstream as the 5' homology arm (5'arm), take TAG as the fragment to be replaced on the endogenous gene, and take 1000bp as the 3' Source arm (3'arm). The 5'arm, the target fragment 720 bp GFP gene and the 3'arm were sequentially ligated in vitro to serve as a donor fragment (Fig. 6C).

Finally, the OsU6::gRNA component and the donor component were co-integrated into the binary vector pCambia3301 (herbicide Basta resistance) (Fig. 6B).

The vector was transformed into Agrobacterium EH105 by heat bombardment, and the rice callus expressing Cas9 protein (ie, callus induced by the seed of the first transgenic plant) obtained by Agrobacterium infection was transformed. The second transgenic callus library. Using the herbicide Basta as a screening agent, the T0-positive callus was obtained after screening by conventional callus culture, and then induced to differentiate into rice T0 plants, and the target plants (second transgenic plants) were obtained after PCR and sequencing. .

The 18 ^th exon of rice OsROS1a gene and its upstream and downstream sequences are as follows:

Among them, the single underline shows the gRNA target sequence (forward), the bold double underlined black base CA is the Cas9 cleavage site, the black box shows the sequence that will be replaced, and the italic partial sequence is 5'. Arm, the bold part of the sequence is 3'arm.

The GFP sequence is as described above:

6.3 Targeting knock-in efficiency detection

1 screening and obtaining of positive plants

Different T0 plants were numbered sequentially, and genomic DNA was extracted from leaves per plant. PCR amplification assays were performed using 2 pairs of specificities.

OsROS1a-GFP 5'-F: TCGCAGGTTTGACAACTGAAG (SEQ ID NO.: 17)

OsROS1a-GFP 5'-R: CCGGTGGTGCAGATGAACTT (SEQ ID NO.: 18)

OsROS1a-GFP full-F: GCAGAGGAGCATGTCTCTATTCT (SEQ ID NO.: 19)

OsROS1a-GFP full-R: TGGTCAGCGATCCATTTCAGG (SEQ ID NO.: 20)

Rice is a diploid plant, and the amplicon of the homozygous and heterozygous plant OsROS1a-GFP 5'-F/R is 1383 bp in the target plant (ie, the second transgenic plant) in which the GFP gene is successfully knocked in; for OsROS1a-GFP The full-F/R, amplicon of the hybrid plants was 1857 bp and 1137 bp. The results of PCR product agarose gel electrophoresis are shown in Figure 7A, in which the amplified bands of #95 plants (T0-95) are bright and of correct size and are heterozygous.

Further sequencing results showed that the GFP gene correctly replaced the endogenous gene TAG sequence, seamlessly inserted into the 3' end of OsROS1a, and the remaining sequences of OsROS1a 18 ^th exon did not produce mutations (Fig. 7C).

The seeds of hybrid plant #95 (T1-95) were further cultured, and the results of PCR detection were as shown in Fig. 7B, that is, the T1 progeny of heterozygous T0 had gene separation, which was consistent with Mendelian inheritance law, indicating that GFP knock-in was Genetic and stable.

The results showed that after the first fragment of rice was transformed with the donor fragment vector, 33 rice second calli were induced and differentiated, and 33 strains of T0 were obtained. Among them, one gene was successfully targeted. Therefore, the rice gene targeting efficiency was calculated to be 3.0% (Table 6).

Table 6. GFP targeted knock-in efficiency of the 3' end of rice OsROS1a gene

Therefore, by using the Agrobacterium secondary transformation method, the vector expressing Ubi1::Cas9 and the vector containing the donor DNA and expressing the guide RNA are sequentially transformed into rice calli, and the target fragment of 720 bp in size can be realized without labeling or mutation. Genetically targeted knock-in/replace, editing efficiency can reach 3.0%.

Furthermore, the method of Example 6 was employed, except that the Cas9 sequence mediated by the rice callus super-high expression promoter (such as the Thaumatin promoter) was used, and the results showed that the editing efficiency could reach 10% to 20%.

In summary, on the model plants of dicotyledonous and monocotyledonous, high efficiency gene targeting can be achieved by the method of the present invention ("two-step transformation" method). Moreover, the transformation method of Arabidopsis thaliana is Agrobacterium immersion flower method, and the transformation mode of rice is Agrobacterium callus transformation, so plants suitable for these two types of transformation methods can use this method for gene targeting, and the scope of application is greatly expanded.

Example 7

The "one-step transformation" method knocks the GFP gene at the 3' end of the Arabidopsis ROS1 gene

The exogenous fragment GFP gene was targeted to the 3' end of the Arabidopsis ROS1 gene by the method of Example 1, except that, as shown in FIG. 8A, the Cas9 nuclease expression element, the gRNA expression element, and the donor DNA were used. The plasmid was loaded onto a plasmid (pCambia1300) in the background of Colombian Col-0 ecotype Arabidopsis thaliana, and only transformed with Agrobacterium, and 293 T1 resistant plants (hygromycin resistance) were obtained as a screening library. The PCR test results are shown in Figure 8B. The results showed that the target plants were screened in T1 plants with an efficiency of 0.68% (Table 7).

Table 7. Arabidopsis ROS1 gene GFP single vector targeting knock-in editing efficiency

Example 8

Evaluation method for high-expression promoter initiation intensity in Agrobacterium infection stage

1 The genetic modification of Arabidopsis thaliana is usually carried out by agrobacteria soaking, so the transformed tissue is the inflorescence of the flowering stage. When the promoter to be tested is the promoter of the Arabidopsis endogenous gene, the inflorescence RNA of the Arabidopsis thaliana flower is directly extracted, and then the expression of the gene (using Actin7 as the internal reference gene) and the DD45 promoter are detected by qRT-PCR. The amount of expression is compared.

If the expression level of the gene to be detected is ≥80% DD45 expression level, it can be regarded as a high expression promoter in the Agrobacterium infection period (more broadly, the tissue is transformed).

When the promoter to be tested is a promoter of a plant exogenous gene, the construct vector (using the promoter to drive Cas9) is transformed into a plant, and then the RNA of the transformed tissue is also extracted, and the expression of Cas9 gene is detected by qRT-PCR, and driven by DD45. Comparison of Cas9 gene expression levels.

For example, the evaluation of the cauliflower mosaic virus CaMV 35S promoter. 35S::Cas9 and DD45::Cas9 were transformed into Arabidopsis thaliana, respectively. After obtaining homozygous, the expression level of Cas9 gene in Arabidopsis inflorescence was detected. The results showed that DD45 was 10 times that of 35S. Therefore, 35S is not a high expression promoter in the Agrobacterium infective phase.

2 The transgenic rice and other crops usually use the Agrobacterium callus transformation method, so the test material is replaced with callus, and the others are similar, and compared with the Maize Ubi1-driven Cas9 expression.

If the amount of Cas9 expression of the gene to be detected is ≥80% Ubi1, it can be regarded as a high expression promoter in the Agrobacterium infection stage (more broadly, the stage of tissue transformation).

Example 9

The "one-step transformation" method of adding an enhancer element knocks the GFP gene at the 3' end of the Arabidopsis ROS1 gene.

Using the method of Example 7, the exogenous fragment GFP gene was targeted to the 3' end of the Arabidopsis ROS1 gene, with the difference that, as shown in Figure 9A, a translational enhancer element (such as from tobacco flower) was added before the Cas9 gene. Leaf protein TMV protein translation enhancer Omega sequence), this optimized Cas9 expression element, and gRNA expression element, donor DNA was loaded onto a plasmid (pCambia1300), with Colombian Col-0 ecotype Arabidopsis thaliana Background, only one transformation with Agrobacterium was performed, and 125 T1 resistant plants (hygromycin resistance) were obtained as a screening library. The PCR test results are shown in Figure 9B. The results showed that the target plants were screened in T1 plants with an efficiency of 2.4% (Table 8).

The same method, except that a transcription enhancer element (such as a 1 ^st intron sequence from the Arabidopsis AtUbiquitin10 gene) was added before the Cas9 gene, the efficiency was 1.7%.

The same method, except that the transcription and translation enhancer elements (AtUbi10 and Omega) were added simultaneously before the Cas9 gene, the efficiency was 3.8%.

Table 8. Arabidopsis ROS1 gene addition enhancer GFP single vector targeting knock-in editing efficiency

Comparative example 1

The method of Example 1 was used, except that the promoter of Cas9 nuclease was 35S (strong promoter, also a constitutive promoter, but expressed in Agrobacterium-infected Arabidopsis inflorescence tissue), CDC45 or Yao (the stem-tip meristem-specific promoter, but not the high-expression promoter of the inflorescence site of the infested site), the statistics were from 7 T2 seed banks, and the results are shown in Table 9. The results showed that whether the GFP fragment was knocked into the 3' end of the Arabidopsis ROS1 gene by using 35S::Cas9, or the GFP fragment was knocked into the 5' end of the DME gene by using CDC45::Cas9 or Yao::Cas9. Positive plants were not screened in T2 plants, so the editing efficiency of these three promoters was very low, and plants that were successfully edited were not screened.

Table 9. Arabidopsis gene editing efficiency when Cas9 is regulated by other promoters

references

1.Mao,Y.,Zhang,H.,Xu,N.,Zhang,B.,Gou,F.,and Zhu,JK(2013).Application of the CRISPR-Cas System for Efficient Genome Engineering in Plants.Molecular plant.2.Zhang, H., Zhang, J., Wei, P., Zhang, B., Gou, F., Feng, Z., Mao, Y., Yang, L., Zhang, H., Xu ,N.,and Zhu,JK(2014).The CRISPR/Cas9system produces specific and homozygous targeted gene editing in rice in one generation.Plant Biotechnol.

All documents mentioned in the present application are hereby incorporated by reference in their entirety in their entireties in the the the the the the the the In addition, it should be understood that various modifications and changes may be made by those skilled in the art in the form of the appended claims.

Claims

A combination of reagents for label-free gene editing, comprising:

(i) a first nucleic acid construct, or a first vector comprising said first nucleic acid construct, said first nucleic acid construct having a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a tissue-specific promoter;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

(ii) a second nucleic acid construct, or a second vector comprising the second nucleic acid construct, the second nucleic acid construct having a structure of formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.
A combination of reagents for label-free gene editing, comprising:

(i) a first nucleic acid construct, or a first vector comprising said first nucleic acid construct, said first nucleic acid construct having a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a promoter that is highly expressed during tissue transformation;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

(ii) a second nucleic acid construct, or a second vector comprising the second nucleic acid construct, the second nucleic acid construct having a structure of formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.
The reagent combination according to claim 2, wherein the tissue is highly expressed by a transformation period promoter comprising a tissue-specific promoter, and/or a constitutive promoter.
The reagent combination according to claim 2, wherein the tissue is highly expressed by a transformation period promoter comprising a high expression promoter in the Agrobacterium infection stage.
The reagent combination according to claim 2, wherein the tissue is highly expressed during the transformation period and the promoter is selected from the group consisting of Maize Ubiquitin1, Rubisco, Actin promoter, or a combination thereof.
The reagent combination according to claim 1, wherein the tissue-specific promoter comprises a germ cell-specific promoter.
The reagent combination according to claim 6, wherein the germ cell-specific promoter is selected from the group consisting of an ovule-specific promoter, a pollen-specific promoter, and a promoter specifically expressed in early embryonic development. Or a combination thereof.
The reagent composition according to claim 7, wherein the ovule-specific promoter comprises a DD45 promoter.
The reagent combination according to claim 2, wherein the tissue is expressed by a high expression promoter (PX) during the transformation period, and the tissue that satisfies the following conditions is highly expressed in the transformation period:

When the dip flower method is used, the ratio of PX/P1 is ≥80%, more preferably ≥90%;

PX/P1 ratio ≥ 80%, more preferably ≥ 90%; and / or

When the callus is transformed, the ratio of PX/P2 is ≥80%, more preferably ≥90%;

The ratio of PX/P2 is ≥80%, more preferably ≥90%;

Among them, PX is the initiation strength of the promoter with high expression during the transformation period; P1 is the initiation intensity of the Arabidopsis DD45 promoter; P2 is the initiation intensity of the Ubi1 promoter.
The reagent combination according to claim 1 or 2, wherein the donor DNA does not carry a screening label.
A kit comprising the reagent combination of claim 1 or 2.
A method for genetically editing a plant, comprising the steps of:

(i) providing the plant to be edited as a parental plant;

(ii) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct into the plant cell of the plant to be edited, thereby obtaining a plant cell introduced into the plant to be edited;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

(iii) obtaining a plant derived from the progeny plant of the plant cell into which the plant to be edited is introduced;

(iv) introducing a second nucleic acid construct or a second vector comprising the second nucleic acid construct into the plant cell of the progeny plant,

Wherein the plant cell is selected from the group consisting of:

(b1) an ex vivo cell from the progeny plant;

(b2) a cell of the callus formed by the ex vivo cells of the progeny plant;

(b3) cells from a reproductive organ located on a plant of the progeny plant;

Wherein the first nucleic acid construct has a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a tissue-specific promoter;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

The second nucleic acid construct has the structure shown by formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.
The method according to claim 12, wherein in step (ii), the plant cell is (a3); and/or in step (iv), the plant cell is (b3).
A method for genetically editing a plant, comprising the steps of:

(i) providing the plant to be edited as a parental plant;

(ii) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct into the plant cell of the plant to be edited, thereby obtaining a plant cell introduced into the plant to be edited;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

(iii) obtaining a plant derived from the progeny plant of the plant cell into which the plant to be edited is introduced;

(iv) introducing a second nucleic acid construct or a second vector comprising the second nucleic acid construct into the plant cell of the progeny plant,

Wherein the plant cell is selected from the group consisting of:

(b1) an ex vivo cell from the progeny plant;

(b2) a cell of the callus formed by the ex vivo cells of the progeny plant;

(b3) cells from a reproductive organ located on a plant of the progeny plant;

Wherein the first nucleic acid construct has a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a promoter that is highly expressed during tissue transformation;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

The second nucleic acid construct has the structure shown by formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.
A method for genetically editing a plant, comprising the steps of:

(i) providing the plant to be edited as a parental plant;

(ii) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct, and a second nucleic acid construct or a second vector comprising the second nucleic acid construct into the plant of the plant to be edited Cells, thereby obtaining plant cells introduced into the plant to be edited;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

(iii) obtaining a plant derived from the plant cell into which the plant to be edited is introduced; wherein

Wherein the first nucleic acid construct has a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a tissue-specific promoter;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

The second nucleic acid construct has the structure shown by formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.
The method of claim 15 wherein said first nucleic acid construct and said second nucleic acid construct are on the same or different vectors.
A method for genetically editing a plant, comprising the steps of:

(i) providing the plant to be edited as a parental plant;

(ii) introducing a first nucleic acid construct or a first vector comprising the first nucleic acid construct, and a second nucleic acid construct or a second vector comprising the second nucleic acid construct into the plant of the plant to be edited Cells, thereby obtaining plant cells introduced into the plant to be edited;

Wherein the plant cell is selected from the group consisting of:

(a1) an ex vivo cell from the plant;

(a2) a cell of a callus formed by an ex vivo cell of said plant;

(a3) cells from the reproductive organs located on the plant;

(iii) obtaining a plant derived from the plant cell into which the plant to be edited is introduced; wherein

Wherein the first nucleic acid construct has a structure of formula I from 5' to 3':

P1-Z1-Z2 (I)

Wherein P1 is a first promoter, and the first promoter is a promoter that is highly expressed during tissue transformation;

Z1 is a coding sequence encoding a Cas9 protein;

Z2 is a terminator;

Also, "-" is a bond or nucleotide linkage sequence;

The second nucleic acid construct has the structure shown by formula II from 5'-3':

P2-Z3-Z4-Z5 (II)

Wherein P2 is a second promoter, and the second promoter is selected from the group consisting of U6, U3, 7SL, or a combination thereof;

Z3 is the coding sequence of gRNA;

Z4 is a polyT sequence;

Z5 is a donor DNA sequence;

Also, "-" is a bond or nucleotide linkage sequence.
The method of claim 17 wherein said first nucleic acid construct and said second nucleic acid construct are on the same or different vectors.
A method for preparing a transgenic plant cell, comprising the steps of:

(i) transfecting a combination of the reagents according to claim 1 or 2 with a plant cell such that the construct in the reagent combination is knocked in and/or replaced with a chromosome in the plant cell, thereby producing The transgenic plant cell.
A method for preparing a transgenic plant cell, comprising the steps of:

(i) transfecting a combination of the agents of claim 1 or 2 into a plant cell such that the plant cell contains the construct in the combination of reagents, thereby producing the transgenic plant cell.
A method for preparing a transgenic plant, comprising the steps of:

The transgenic plant cell prepared by the method of claim 19 or claim 20 is regenerated into a plant body to obtain the transgenic plant.