CN110129357A - A kind of no label is used for the reagent combination and its application of gene editing - Google Patents

Abstract

A kind of reagent combination the present invention provides no label for gene editing, specifically, the present invention provides a kind of reagent of no label for gene editing and combines, comprising: (i) first nucleic acid constructs, or the first vector containing first nucleic acid constructs；And (ii) second nucleic acid constructs, or the Second support containing second nucleic acid constructs.By using the nucleic acid constructs of specific structure, the base for being successfully realized RNA guidance in plant for the first time pinpoints knocks in and/or replaces the present invention.

Description

A kind of no label is used for the reagent combination and its application of gene editing

Technical field

The present invention relates to field of biotechnology, and in particular, to a kind of no label for gene editing reagent combination and It is applied.

Background technique

Gene editing technology is quickly grown in recent years, final purpose be can any position of genome generate stablize and Heritable gene order changes, and including the insertion of the fixed point of specified segment or base, deletes or replaces.

Currently, Zinc finger nuclease technology (zinc finger nuclease, ZFN), activating transcription factor sample effector core Sour zymotechnic (transcription activator-like effector nucleases, TALEN) and CRISPR/Cas9 Technology (clustered regularly interspaced short palindromic repeats/CRISPR- Associated protein 9) it has been applied successfully to a variety of biologies, including Escherichia coli, yeast, rice, arabidopsis, fruit In the gene editing of fly, mouse and human cell etc..These three technologies can specify site specifically in organism genome Cutting DNA generates double-strand break, to carry out fixed point editor using the DNA repair mechanism of biology itself.Cell DNA self is repaired There are two types of compound formulas, non-homologous end joining (non-homologous end-joining, NHEJ) and homologous recombination (homology-directed,HDR).NHEJ tends to random erasure, insertion or one Duan Xulie of replacement or single in genome Base, when repairing, probability of happening is higher；HDR can realize accurate reparation, but need homologous sequence as template, and probability of happening It is lower.Therefore the existing gene editing technology using HDR needs in the external source homologous sequence being introduced into improve positive rate In addition screening label.

Instantly, the fixed point insertion or replacement for realizing specified sequence or base in the plant genome are still a problem.ZFN The albumen guidance of specificity is needed with TALEN technology, but the building of protein component is relative complex, higher cost, and editorial efficiency It is lower.CRISPR/Cas9 technology is guided with RNA, and external structure is simple, and cost is relatively low, in combination with HDR, it can be achieved that accurate base Because of editor.But it needs plus screening label in the exogenous array being introduced into, otherwise editorial efficiency is very low, it is difficult to effectively apply In plant research and breeding.

In conclusion for the needs of plant science research and breeding production, it is a kind of efficient there is an urgent need in the art to develop Knocked in without the gene target that screens label or replacement technology.

Summary of the invention

It is efficiently knocked in or replacement technology without screening the gene target of label the purpose of the present invention is to provide a kind of.

A kind of reagent of no label for gene editing is provided in terms of present invention 1A to combine, comprising:

(i) the first nucleic acid constructs, or the first vector containing first nucleic acid constructs, first nucleic acid construct Object has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；With

(ii) the second nucleic acid constructs, or the Second support containing second nucleic acid constructs, the second nucleic acid structure Object is built with structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In another preferred example, the nucleotide catenation sequence is 1-60nt.

In another preferred example, the nucleotide catenation sequence does not influence the normal transcription and translation of each element.

In another preferred example, the tissue-specific promoter includes the specifically expressed promoter of reproduction cell.

In another preferred example, the specifically expressed promoter of the reproduction cell is selected from the group: ovule is specifically expressed to be opened Mover, the promoter of pollen-specific expression, embryonic development early stage specifically expressed promoter, or combinations thereof.

In another preferred example, the specifically expressed promoter of the ovule includes DD45 promoter.

In another preferred example, the promoter of the pollen-specific expression includes Lat52 promoter.

In another preferred example, the embryonic development early stage specifically expressed promoter includes DD45 promoter.

In another preferred example, the Cas9 albumen is selected from the group: Cas9, Cas12a (Cpf1), Cas12b or its group It closes.

In another preferred example, the source of the Cas9 albumen is selected from the group: streptococcus pyogenes (Streptococcus Pyogenes), staphylococcus (Staphylococcus aureus), or combinations thereof.

In another preferred example, the source of the Cas12a albumen is selected from the group: Acidaminococcus (Acidaminococcus), Mao Luo section bacterium (Lachnospiraceae bacterium), or combinations thereof.

In another preferred example, the source of the Cas12b albumen includes biting sour thermoduric bacteria (Alicyclobacillus acidoterrestris)。

In another preferred example, the terminator is selected from the group: NOS terminator, UBQ terminator, or combinations thereof.

In another preferred example, the length of the donor dna is 600-3000bp, preferably, 700-2800bp.

In another preferred example, the polyT sequence is selected from the group: TTTTTTT.

In another preferred example, first nucleic acid constructs, and/or the second nucleic acid constructs further include enhancer member Part.

In another preferred example, the enhancer element is selected from the group: the First Intron of AtUbi10 gene (intron) sequence, TMV Omega sequence, or combinations thereof.

In another preferred example, the first vector and the Second support are different carriers.

In another preferred example, first nucleic acid constructs and second nucleic acid constructs are located at different carriers On.

In another preferred example, the first vector and the Second support are identical carrier.

In another preferred example, first nucleic acid constructs and second nucleic acid constructs are located at identical carrier On.

In another preferred example, without screening label on the donor dna.

In another preferred example, the carrier is the binary expression vector that can transfect or convert plant cell.

In another preferred example, the carrier is plant expression vector.

In another preferred example, the carrier is pCambia carrier.

In another preferred example, the plant expression vector is selected from the group: pCambia1300, pCambia3301, PCambia2300, or combinations thereof.

In another preferred example, the carrier is Agrobacterium Ti carrier.

In another preferred example, the carrier is cricoid or linear.

In another preferred example, the plant is selected from the group: crucifer, gramineae plant, leguminous plant, eggplant Section, or combinations thereof.

In another preferred example, the plant is selected from the group: arabidopsis, rice, Chinese cabbage, soybean, tomato, corn, cigarette Grass, wheat, sorghum, barley, oat, grain, peanut, or combinations thereof.

A kind of reagent of no label for gene editing is provided in terms of present invention 1B to combine, comprising:

(i) the first nucleic acid constructs, or the first vector containing first nucleic acid constructs, first nucleic acid construct Object has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；With

(ii) the second nucleic acid constructs, or the Second support containing second nucleic acid constructs, the second nucleic acid structure Object is built with structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In another preferred example, it is described tissue be converted period High-expression promoter include tissue-specific promoter and/ Or constitutive promoter.

In another preferred example, it is described tissue be converted period High-expression promoter include Agrobacterium infect phase height expression open Mover.

In another preferred example, the tissue is converted period High-expression promoter and is selected from the group: Maize Ubiquitin1 (abbreviation Ubi1), Rubisco, Actin promoter, or combinations thereof.

In another preferred example, it includes the group for meeting the following conditions that the tissue, which is converted period High-expression promoter (PX), It knits and is converted period High-expression promoter:

When flower-dipping method converts, ratio >=80% of PX/P1, more preferably, >=90%；

Ratio >=80% of PX/P1, more preferably, >=90%；And/or

When Transformation of Callus, ratio >=80% of PX/P2, more preferably, >=90%；

Ratio >=80% of PX/P2, more preferably, >=90%.

Wherein, PX is the starting intensity that tissue is converted period High-expression promoter；P1 is arabidopsis DD45 promoter Start intensity；P2 is the starting intensity of Ubi1 promoter.

In another preferred example, the constitutive promoter is selected from the group: Ubi 1, Actin, Rubisco, Ribosomal Promoter, or combinations thereof.

In another preferred example, the tissue-specific promoter include the specifically expressed promoter of reproduction cell and/or The highly expressed promoter of callus.

In another preferred example, the specifically expressed promoter of the reproduction cell is selected from the group: ovule is specifically expressed to be opened Mover, the promoter of pollen-specific expression, embryonic development early stage specifically expressed promoter, or combinations thereof.

In another preferred example, the specifically expressed promoter of the ovule includes DD45 promoter.

In another preferred example, the promoter of the pollen-specific expression includes Lat52 promoter.

In another preferred example, the embryonic development early stage specifically expressed promoter includes DD45 promoter.

In another preferred example, the highly expressed promoter of the callus includes Thaumatin promoter, Ribulose Bisphosphate carboxylase promoter, SlAHRD promoter, SlRBCSC promoter, Elongation factor are opened Mover.

In another preferred example, the Thaumatin promoter includes one or more plant origins selected from the group below Promoter: rice, corn, arrowroot, or combinations thereof.

In another preferred example, the Ribulose bisphosphate carboxylase promoter includes being selected from down Group one or more plant origins promoter: tomato, sweet potato, tobacco, rice, or combinations thereof.

In another preferred example, the SlAHRD promoter includes the starting of one or more plant origins selected from the group below Son: tomato, sweet potato, cassava, or combinations thereof.

In another preferred example, SlRBCSC promoter includes the promoter of one or more plant origins selected from the group below: Tomato, sweet potato, cassava, or combinations thereof.

In another preferred example, the constitutive promoter is selected from the group: Ubi1, Actin, Rubisco, Ribosome are opened Mover, or combinations thereof.

In another preferred example, first nucleic acid constructs, and/or the second nucleic acid constructs further include enhancer member Part.

In another preferred example, the enhancer element is selected from the group: the First Intron of AtUbi10 gene (intron) sequence, TMV Omega sequence, or combinations thereof.

In another preferred example, the first vector and the Second support are identical or different carrier.

In another preferred example, first nucleic acid constructs and second nucleic acid constructs are located at identical or different On carrier.

In another preferred example, first nucleic acid constructs and second nucleic acid constructs are located at identical carrier.

In another preferred example, without screening label on the donor dna.

Second aspect of the present invention provides a kind of kit, in terms of the kit contains present invention 1A or the present invention the Reagent combination described in terms of 2A.

In another preferred example, the kit also contains label or specification.

The method that a kind of pair of plant carries out gene editing is provided in terms of present invention 3A, comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) the first nucleic acid constructs or first vector containing first nucleic acid constructs are imported into the plant to be edited The plant cell of object, to obtain the plant cell for importing the plant to be edited；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant of the progeny plant from the plant cell for importing the plant to be edited is obtained；

(iv) the second nucleic acid constructs or Second support containing second nucleic acid constructs filial generation is imported to plant The plant cell of strain,

Wherein the plant cell is selected from the group:

(b1) isolated cells from the progeny plant；

(b2) cell for the callus that the isolated cells of the progeny plant are formed；

(b3) cell from organ of multiplication on the plant of the progeny plant；

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In another preferred example, the organ of multiplication includes flower.

In another preferred example, the cell includes: pollen cell.

In another preferred example, in step (ii), plant cell is (a3)；And/or in step (iv), plant cell is (b3)。

In another preferred example, which comprises

(1) plant to be edited is provided；

(2) the first nucleic acid constructs or first vector containing first nucleic acid constructs are imported into the plant to be edited Plant cell；With

(3) after the T1 time, the second nucleic acid constructs or the Second support containing second nucleic acid constructs are led Enter the plant cell of the plant to be edited；

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In another preferred example, the T1 is -500 days 10 days, preferably, -200 days 15 days.

In another preferred example, the plant cell from flower, callus, or combinations thereof.

In another preferred example, callus plant cell induced synthesis selected from the group below: root, stem, leaf, Colored, and/or seed cell.

In another preferred example, when in step (ii) plant cell be (a3) be located on the plant come from organ of multiplication Cell (as using arabidopsis flower cell) when, then the T1 be -70 days 42 days, preferably, -63 days 49 days.

In another preferred example, when the callus that plant cell is formed in step (ii) for the isolated cells of (a2) described plant When cell (cell as used Rice Callus) of tissue, then the T1 is -40 days 15 days, preferably, -30 days 25 days.

In another preferred example, the plant cell in the step (ii) and step (iv) comes from same position.

In another preferred example, the plant cell in the step (2) and step (3) comes from same position.

In another preferred example, described to import to be imported by Agrobacterium.

In another preferred example, described to import to be imported by particle gun.

In another preferred example, the gene editing is that fixed point is knocked in or replaced.

The method that a kind of pair of plant carries out gene editing is provided in terms of present invention 3B, comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) the first nucleic acid constructs or first vector containing first nucleic acid constructs are imported into the plant to be edited The plant cell of object, to obtain the plant cell for importing the plant to be edited；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant of the progeny plant from the plant cell for importing the plant to be edited is obtained；

(iv) the second nucleic acid constructs or Second support containing second nucleic acid constructs filial generation is imported to plant The plant cell of strain,

Wherein the plant cell is selected from the group:

(b1) isolated cells from the progeny plant；

(b2) cell for the callus that the isolated cells of the progeny plant are formed；

(b3) cell from organ of multiplication on the plant of the progeny plant；

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

The method that a kind of pair of plant carries out gene editing is provided in terms of present invention 3C, comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) by the first nucleic acid constructs or first vector and the second nucleic acid constructs containing first nucleic acid constructs Or the Second support containing second nucleic acid constructs imports the plant cell of the plant to be edited, to obtain described in importing The plant cell of plant to be edited；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant from the plant cell for importing the plant to be edited is obtained；Wherein,

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In another preferred example, the first vector, Second support are identical or different carrier.

In another preferred example, first nucleic acid constructs and the second nucleic acid constructs are located at identical or different carrier On.

The method that a kind of pair of plant carries out gene editing is provided in terms of present invention 3D, comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) by the first nucleic acid constructs or first vector and the second nucleic acid constructs containing first nucleic acid constructs Or the Second support containing second nucleic acid constructs imports the plant cell of the plant to be edited, to obtain described in importing The plant cell of plant to be edited；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant from the plant cell for importing the plant to be edited is obtained；Wherein,

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In another preferred example, the first vector, Second support are identical or different carrier.

In another preferred example, first nucleic acid constructs and the second nucleic acid constructs are located at identical or different carrier On.

Fourth aspect present invention provides a kind of method of prepare transgenosis plant cell, comprising steps of

(i) transfection of plant cells reagent described in present invention 1A aspect or present invention 1B aspect is combined, so that institute The construction stated in reagent combination is knocked in and/or is replaced with the chromosome generation fixed point in the plant cell, to make Obtain the transgenic plant cells.

In another preferred example, the transfection uses Agrobacterium-mediated Transformation method or particle bombardment.

Fifth aspect present invention provides a kind of method of prepare transgenosis plant cell, comprising steps of

(i) transfection of plant cells reagent described in present invention 1A aspect or present invention 1B aspect is combined, so that institute It states plant cell and contains the construction in reagent combination, so that the transgenic plant cells be made.

Sixth aspect present invention provides a kind of method of prepare transgenosis plant, comprising steps of

Transgenic plant cells regeneration prepared by fourth aspect present invention or fifth aspect present invention the method For plant, to obtain the genetically modified plants.

Seventh aspect present invention provides a kind of genetically modified plants, described in the plant sixth aspect present invention Method preparation.

It should be understood that above-mentioned each technical characteristic of the invention and having in below (eg embodiment) within the scope of the present invention It can be combined with each other between each technical characteristic of body description, to form a new or preferred technical solution.As space is limited, exist This no longer tires out one by one states.

Detailed description of the invention

Fig. 1 is that schematic diagram is knocked in or replaced in targeting.

(A) foreign donor DNA fragmentation prepares schematic diagram.

(B) plant targeting is carried out by HDR mechanism using the donor dna without screening label and knocks in schematic diagram.

Fig. 2 is to knock in GFP fragmentary views in the targeting of the end of arabidopsis ROS1 gene 3 '.

(A) DD45::Cas9 vector construction schematic diagram.35S::HPT is the original component of binary vector pCambia1300.

(B) the vector construction schematic diagram of GFP donor fragment and expression gRNA.35S::Bar is binary vector The original component of pCambia3301.

(C) GFP donor fragment, ROS1 21^stExon sequence, gRNA sequence, 5 ' arm, 3 ' arm and PCR detection primers are set Count schematic diagram.

Fig. 3 is to knock in GFP segment testing result in the targeting of the end of arabidopsis ROS1 gene 3 '.

(A) purpose plant T1 is for PCR the selection result.

(B) purpose plant T2 is for pcr gene type qualification result.

(C) DNA sequencing result is knocked in GFP targeting.

Fig. 4 is arabidopsis ROS1-GFP expression and Function detection result.

(A) fluorescence quantitative PCR detection GFP is homozygous, ROS1-GFP in heterozygosis and the arabidopsis transgenic plant do not knocked in The expression of mRNA.Wild type Col-0 is control.

(B) GFP signal in laser confocal fluorescence microscope detection GFP homozygous plants root-tip cells.Wild type Col-0 is Negative control.

(C) quantitative Chop-PCR detection GFP is homozygous, ROS1-GFP egg in heterozygosis and the arabidopsis transgenic plant do not knocked in White demethylation function.At1g26400 and At1g03890 be the known hypomethylation in Col-0, ros1-4 function lack Lose the hyper-methylation site in mutant.

Fig. 5 is to knock in GFP fragmentary views in the targeting of the end of arabidopsis DME gene 3 '.

(A) the building schematic diagram of the carrier of GFP donor fragment and expression gRNA.35S::Bar is binary vector The original component of pCambia3301.

(B) GFP donor fragment, DME 20^thExon sequence, gRNA sequence, 5 ' arm, 3 ' arm and PCR detection primers are set Count schematic diagram.

In above-mentioned each figure, " arm " refers to homology arm.

Fig. 6 is to knock in GFP gene schematic diagram in the targeting of the end of rice Os ROS1a gene 3 '.

(A) Ubi1::Cas9 vector construction schematic diagram.35S::HPT is the original component of binary vector pCambia1300.

(B) the vector construction schematic diagram of GFP donor fragment and expression gRNA.35S::Bar is binary vector The original component of pCambia3301.

(C) GFP donor fragment, OsROS1 18^thExon sequence, gRNA sequence, 5 ' arm, 3 ' arm and PCR detection primers Design diagram.

Fig. 7 is to knock in GFP segment testing result in the targeting of the end of rice Os ROS1a gene 3 '.

(A) T0 positive single plant PCR the selection result.

(B) T1 single plant pcr gene type qualification result.

(C) DNA sequencing result is knocked in GFP targeting.

Fig. 8 is to knock in GFP fragmentary views and testing result in the targeting of the end of arabidopsis ROS1 gene 3 ' using one-step method；

(A) one-step method vector construction schematic diagram.It thereon include DD45::Cas9 component, GFP donor fragment, and expression gRNA Component.35S::HPT is the original component of binary vector pCambia1300.

(B) T1 single plant pcr gene type qualification result.

Fig. 9 is to knock in GFP segment in the targeting of the end of arabidopsis ROS1 gene 3 ' using enhancer on the basis of one-step method to illustrate Figure and testing result；

(A) one-step method vector construction schematic diagram.Thereon including DD45:: enhancer-Cas9 component, GFP donor fragment, and Express the component of gRNA.35S::HPT is the original component of binary vector pCambia1300.

(B) T1 single plant pcr gene type qualification result.

Specific embodiment

The present inventor, by largely screening, filters out specific tissue and is converted period by depth studying extensively High-expression promoter and/or Agrobacterium infect phase High-expression promoter, and (including tissue-specific promoter, and/or composing type open Mover), by using the nucleic acid constructs of specific structure, the present invention is successfully realized the base of efficient RNA guidance in plant Because of editor (base fixed point knock in and/or replace), and in the present invention, knock in and/or replace efficiency may be up to 5~10% or Higher and of the invention donor dna without screening label, realize for the first time target gene without label without burden, accurate It is seamless, stablize heritable editor.In addition, present invention firstly discovers that, method of the invention is universal method, one-step method or two steps Method can reach very high knockout and/or replacement efficiency.On this basis, the present inventor completes the present invention.

Term

As used herein, term " plant promoter " refers to the nucleic acid sequence for starting transcribed nucleic acid in plant cell. The plant promoter can be from plant, microorganism (such as bacterium, virus) or animal or artificial synthesized or transformation The promoter crossed.

As used herein, term " Cas albumen " refers to a kind of nuclease.A kind of preferred Cas albumen is Cas9 albumen.It is typical Cas9 albumen include (but being not limited to): derive from streptococcus pyogenes (Streptococcus pyogenes), staphylococcus The Cas9 of (Staphylococcus aureus).As used herein, term " coded sequence of Cas albumen " refers to that coding has and cuts Cut the nucleotide sequence of active Cas albumen.It is transcribed and translated to generate functionality in the polynucleotide sequence of insertion In the case where Cas albumen, technical staff has a large amount of polynucleotide sequences can be with, it will be recognized that because of the degeneracy of codon Encode identical polypeptide.In addition, technical staff will also recognize that different plant species have certain Preference for codon, it may The codon of Cas albumen can be optimized, these variants are all by term according to the needs expressed in different plant species " coded sequence of Cas albumen " is specifically covered.In addition, term specifically include overall length, with the basic phase of Cas gene order Same sequence, and encode out the sequence for retaining the protein of Cas protein function.

As used herein, term " plant " includes whole plant, plant organ (such as leaf, stem, root), seed and plant cell And their filial generation.The type that can be used for the plant of the method for the present invention is not particularly limited, and generally comprises any turned The higher plant type of change technology, including unifacial leaf, dicotyledon and gymnosperm.

As used herein, term " base is knocked in " refers to the displacement of large fragment, especially when in displacement being complete with protogene Full when different sequences.

As used herein, term " base replacement " refers to the displacement of small fragment, several amino acid, several bases.

As used herein, term " expression cassette " refers to the module containing element needed for gene to be expressed and expression One section of polynucleotide sequence.Component needed for expression includes promoter and polyadenylation signal sequence.In addition, of the invention Expression cassette can also contain or not contain other sequences, including (but being not limited to): enhancer, secretion signal peptide sequence etc..

Reagent of the no label for gene editing combines

A kind of reagent combination the present invention provides no label for gene editing, the reagent combination includes the first nucleic acid Construction or first vector containing first construction；Second with the second construction or containing second construction carries Body, wherein first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is gRNA transcription sequence；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In the present invention, the reagent for additionally providing a kind of no label for gene editing combines, comprising:

(i) the first nucleic acid constructs, or the first vector containing first nucleic acid constructs, first nucleic acid construct Object has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；With

(ii) the second nucleic acid constructs, or the Second support containing second nucleic acid constructs, the second nucleic acid structure Object is built with structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

In the present invention, the tissue is converted period High-expression promoter and refers in plant tissue (such as bud, callus group Knit, cotyledon etc.) the highly expressed strong promoter of growth and development stage, specifically, the tissue is converted the expression starting of period height Attached bag, which includes, to be met the tissues of the following conditions and is converted period High-expression promoter:

Ratio >=80% of PX/P1, more preferably, >=90%；And/or

Ratio >=80% of PX/P2, more preferably, >=90%；

Wherein, PX is the starting intensity that tissue is converted period High-expression promoter；P1 is arabidopsis DD45 promoter Start intensity；P2 is the starting intensity of Maize Ubi1 promoter.

In the present invention, tissue is converted period including transfection and infects.When infecting suitable for Agrobacterium, agriculture bar is used Bacterium infects phase High-expression promoter.In the present invention, Agrobacterium infect that phase High-expression promoter refers to can in the Agrobacterium infection stage Highly expressed strong promoter.

Various elements used in construction of the invention can use conventional method, as PCR method, full artificial chemistry synthesize Method, enzymatic cleavage methods obtain, and are then linked together by well known DNA interconnection technique, are formed construction of the invention.

Carrier conversion plant cell of the invention is whole to mediate carrier of the invention to carry out plant cell chromosome It closes, transgenic plant cells is made.

Transgenic plant cells of the invention are regenerated as plant, to obtain genetically modified plants.

By the above-mentioned nucleic acid constructs that builds of the present invention, pass through conventional plant recombinant technique (such as Agrobacterium-mediated Transformation Technology), plant cell can be imported, carries the nucleic acid constructs (or carrier with the nucleic acid constructs) to obtain Plant cell, or obtain and be integrated with the plant cell of the nucleic acid constructs in genome.

Gene editing (gene editing)

As described herein, " gene editing ", which refers to, carries out the change for artificially having target to gene, is exactly in biological genome Specific site on generate DNA deletion, insertion or replacement.

" gene targeting (gene targeting) " or " gene target " refer to (a kind of intracellular based on homologous recombination principle Intrinsic DNA damage repair mechanism) to genome carry out transformation, mainly gene knock-in, replacement.

In the present invention, gene editing includes gene targeting.

Vector construction

The carrier is mainly characterized by being converted period High-expression promoter using plant tissue (in Agrobacterium flower-dipping method such as DD45, if the Cas albumen in Ubi1) driving CRISPR/Cas system is in the plant being converted in Agrobacterium Transformation of Callus method Great expression in tissue, and the target position into genome is guided by guide RNA, by Cas Protein cleavage target spot, and pass through HDR mechanism carries out plant targeting and knocks in or replace.

In general, generally being connected by some flexible small peptides between albumen, i.e. Linker is (even to increase the activity of albumen Connect peptide sequence).Preferably, which can select ATTB.

Efficiency is knocked in and/or replaces in order to increase, present invention selection is specifically suitable for the promoter of plant cell, such as DD45 promoter, U6 promoter, Lat52 promoter, Ubi1 promoter etc..Selection is suitable for the guide RNA's of plant cell Expression cassette, and it is constructed from the opening expression cassette (ORF) of above-mentioned albumen in different carriers.

In the present invention, the carrier is not particularly limited, and any binary vector is ok, and is not limited to pCambia carrier, Both resistances are also not necessarily limited to, as long as meeting the carrier required as follows can be used in the present invention: (1) can be situated between by Agrobacterium It leads, conversion enters in plant；(2) RNA normal transcription is allowed；(3) plant is allowed to obtain new resistance.

In a preferred embodiment, the carrier is selected from the group: pCambia1300, pCambia3301, PCambia2300, or combinations thereof.

Genetic transformation

Above-mentioned carrier is imported into Plant accepter by suitable method.Introduction method includes but is not limited to: agriculture bar Bacterium infection protocol, particle bombardment, microinjection, electric shocking method, supercritical ultrasonics technology and polyethylene glycol (PEG) mediated method etc..Recipient plant Including but not limited to arabidopsis, rice, soybean, tomato, corn, tobacco, wheat, sorghum etc..Above-mentioned DNA vector or segment import After plant cell, the DNA in the plant cell of conversion is made to express the albumen and guide RNA.Cas albumen is in its guide RNA Guidance under, to target position carry out gene editing (knock in and/or replace).

Replaced plant cell or tissue or organ, Ke Yiyong are pinpointed for carrying out Plant Genome with the method for the present invention Conventional method regeneration obtains corresponding transgenic plant.For example, obtaining the plant after gene editing by Agrobacterium flower-dipping method.

Using

The present invention can be used for plant genetic engineering field, be used for plant research and breeding, especially have economic value Crops, forestry crop or gardening plant genetic improvement.

Main advantages of the present invention include:

(1) present invention provides a kind of efficient specified segment or base fixed point suitable for plant for the first time and knocks in or replace Method, realize target gene without label without it is burdensome, accurate it is seamless, stablize heritable editor, efficiency may be up to 5~ 10% or higher, it can be widely applied to plant science research and breeding production.

(2) donor dna of the invention is not required to containing screening label.

(3) present invention is converted period High-expression promoter using tissue for the first time (including tissue-specific promoter is (as raw The specifically expressed promoter DD45 of cell colonization) and/or the highly expressed promoter Ubi1 of callus) driving Cas9 nuclease table It reaches, to efficiently realize that specified segment or base fixed point are knocked in or replaced, editorial efficiency is up to 3%~10% or higher.

(4) present invention obtains purpose transformant plant using Agrobacterium " two- step conversion method " for the first time, i.e., uses guide for the first time The method for entering Cas nuclease, importing donor dna and guide RNA again, realizes efficient editor.

(5) present invention only to expectation editor gene loci carry out gene editing (knock in and/or replace), the gene its His sequence, there is no the changes that base or segment occurs by 5 ' arm and 3 ' arm sequences especially as homology arm.

(6) plant gene edit methods of the invention are easy, are easy to promote and apply.

(7) present invention also can be used " one-step method " to obtain purpose transformant plant, therefore method of the invention has universality.

(8) " one-step method " in the present invention is after carrying out first piece optimization, including adding in the Expression element of Cas9 nuclease Add the components such as enhancer (first intron sequence, the TMV Omega sequence of such as AtUbi10 gene), editorial efficiency is reachable 4% or higher.

Present invention will be further explained below with reference to specific examples.It should be understood that these embodiments are merely to illustrate the present invention Rather than it limits the scope of the invention.In the following examples, the experimental methods for specific conditions are not specified, usually according to conventional strip Part such as Sambrook et al., molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or according to the normal condition proposed by manufacturer.Unless otherwise stated, otherwise percentage and Number is calculated by weight.Experimental material and reagent involved in the present invention can obtain unless otherwise specified from commercially available channel.

Experimental method

Arabidopsis 1. " conversion of two steps " method

Wildtype Arabidopsis thaliana, normal culture to full-bloom stage (general 4 weeks or so) are pressed with the Agrobacterium for carrying Cas9 plasmid According to conventional method, inflorescence is disseminated, this is infected for the first step.

It can complete in operation one hour of dip dyeing, as long as vector construction is good, be completed from Agrobacterium is prepared to dip dyeing, it is only necessary to 5 days.

After dip-flower, then etc. 3 weeks or so, inflorescence is solid, seed full maturity, harvest.

Cultivate seed, go out resistant seedling with hygromycin selection, for example obtain 36 plants, then identify Cas9 presence and Activity, it is highest (this is maternal plant) to choose more plants of (such as 2 plants) Cas9 activity, normal culture to full-bloom stage, then with carrying donor matter Grain Agrobacterium, disseminate inflorescence, this for second step transfect, then etc. 3 weeks, seed maturation harvest, evaluation and screening.

The best plant of Cas9 activity, retains and does not cross the seed that inflorescence is tied by During Agrobacterium, as contain The maternal plant of Cas9, subsequent experimental can be spare.

Arabidopsis 2. " step conversion " method

Wildtype Arabidopsis thaliana, normal culture to full-bloom stage (general 4 weeks or so), with the matter for carrying Cas9 and donor simultaneously The Agrobacterium of grain conventionally infects inflorescence, then 3 weeks equal, and seed maturation harvests, so that it may evaluation and screening.

3. the method for transformation of crop

The uncomfortable crop for sharing flower-dipping method conversion of such as rice, tomato, corn, cassava, usually utilizes During Agrobacterium Callus converts.Difference only has converting material different, and Agrobacterium strain is different, other carrier designs, plant identification sieve Choosing method etc. is all.

In " conversion of two steps " strategy, callus can be continuously to convert twice in a few houres, then with 2 kinds of resistances while doing sun Property screening；Cas9 carrier can also first be converted, by resistance screening culture a couple of days a to several weeks, select positive transformant it Afterwards, then donor carrier is converted, then does second of resistance screening.

In " step conversion " strategy, only one carrier, therefore only need to convert once, resistance screening is primary.

" conversion of the two steps " method of embodiment 1 knocks in GFP gene at the end of arabidopsis ROS1 gene 3 '

Using Agrobacterium flower-dipping method, by the carrier for expressing DD45::Cas9 and contain donor DNA segment GFP green fluorescence egg The white gene and carrier for expressing guide RNA successively converts plant, is finally inserted into arabidopsis for the GFP gene synthesized in vitro 3 ' end regions of ROS1 gene.PCR, DNA sequencing, quantitative PCR, quantitative Chop-PCR and laser confocal fluorescence microscope detection Show that the segment can efficiently be integrated into target position, normally play a role, and does not influence protogene normal function.Specifically Operating process is as follows:

The acquisition of 1.1Cas9 carrier preparation and transgenosis maternal plant (the first transgenic plant)

The Cas9 sequence that arabidopsis DD45 promoter mediates is integrated into binary vector pCambia1300 (hygromycin in vitro Resistance) on (Fig. 2A).It can refer to the method (Mao et al., 2013) of Mao Yanfei et al..

This Cas9 plasmid is transformed into competence Agrobacterium GV3101 with thermal shock method, then quasi- with the conversion of Agrobacterium flower-dipping method Southern mustard Col-0 inflorescence harvests mature seed.Using hygromycin as selective agent, resistance is provided through the culture screening of conventional seedling Plant expresses the arabidopsis maternal plant of Cas9 albumen, referred to as the first transgenic plant.

The acquisition of the preparation of 1.2 donor fragment carriers and purpose plant (the second transgenic plant) screening library

For the last one exon of arabidopsis ROS1 gene, i.e., 21^st3 ' the end design gRNA of exon, promoter are Arabidopsis AtU6.It can refer to the method (Mao et al., 2013) of Mao Yanfei et al..

With ROS1 21^stThe terminator codon TAA of exon is boundary, upstream takes 801bp as 5 ' homology arms (5 ' Arm), using TAATCCGTT as the segment for needing to replace on endogenous gene, downstream take 325bp as 3 ' homology arms (3 ' arm).5 ' arm, target fragment 720bp GFP gene are connected in turn with 3 ' arm in vitro, as donor fragment (donor) (Fig. 2 C).

Finally by AtU6::gRNA component and donor component co-integration to binary vector pCambia3301 (herbicide Basta resistance) on (Fig. 2 B).

This carrier is transformed into Agrobacterium GV3101 with thermal shock method, then the arabidopsis to be taken before flower-dipping method conversion Cas9 maternal plant (i.e. the first transgenic plant) inflorescence harvests mature seed.

Using herbicide basta as selective agent, the plant (i.e. T1 generation) of resistance is provided through the culture screening of conventional seedling, is made For the screening library of purpose plant.

Arabidopsis ROS1 gene 21^stExon and its upstream and downstream sequence are as follows:

Wherein, single underscore is shown gRNA target sequence (forward direction), is Cas9 cleavage site between overstriking black base CC, Black surround show the sequence that will be replaced, and italicized item sequence is 5 ' arm, and overstriking italicized item sequence is 3 ' arm.

GFP sequence is as follows:

Wherein, double underline show the catenation sequence for preventing gene silencing.

Efficiency testing is knocked in the acquisition and targeting of the plant single plant of 1.3 mesh

To all T1 plant number consecutivelies in screening library, single plant takes mature inflorescence to extract genomic DNA.

PCR amplification detection (Fig. 2 C) is carried out using following 3 pairs of specific designs primers:

ROS1-GFP 5’-F:GCAGTTGGAAAAGAGAGAACCTGATGATCC(SEQ ID NO.:3)

ROS1-GFP 5’-R:CTGAACTTGTGGCCGTTCACGTC(SEQ ID NO.:4)

ROS1-GFP full-F:ACCTGATGATCCATGTTCTTATTTG(SEQ ID NO.:5)

ROS1-GFP full-R:CCTTGTACAACTCTAGGACTGTT(SEQ ID NO.:6)

ROS1-GFP 3’-F:ACAACCACTACCTGAGCACC(SEQ ID NO.:7)

ROS1-GFP 3’-R:TGAAGATCGGAGCTGGTTCC(SEQ ID NO.:8)

Arabidopsis is diplont, and GFP donor dna successfully targets in the plant of insertion, homozygous and heterozygous plant ROS1- The amplicon of 5 '-F/R of GFP is 1011bp, and the amplicon of 3 '-F/R of ROS1-GFP is 559bp；For ROS1-GFP full- F/R, the amplicon of only one 1758bp of homozygous plants, there are one the amplicons of 1018bp for heterozygosis.The inspection of PCR amplification rear electrophoresis Survey result is as shown in Figure 3A, and the #1 from DD45-#58 maternal plant is heterozygote, and #2, #5 are homozygotes, and #3, #4, #6 are wild types； #9 from DD45-#70 maternal plant is heterozygote, and #11 is homozygote, and #7, #8, #10, #12 are wild types.

The seed of heterozygosis single plant #1 is taken to continue to cultivate, single plant PCR testing result is as shown in Figure 3B, i.e. the T2 offspring of heterozygosis T1 Gene Isolation has occurred, meets mendel's law, illustrates that the replacement insertion of GFP is heritable, stable.

Further sequencing result shows that GFP donor dna has correctly replaced endogenous gene TAATCCGTT sequence, seamless Insert the end ROS1 3 ', ROS1 21^stRemaining sequence of exon does not generate mutation (Fig. 3 C).

The selection result from 2 difference Cas9 maternal plant backgrounds is counted, as shown in table 1, the external source GFP without screening label Targeting knock in efficiency and respectively reach 7.7% and 8.3%.

Efficiency is knocked in 1. arabidopsis ROS1 gene GFP of table targeting

1.4 knock in segment function and target gene Function detection

21 -day-old of arabidopsis true leaf is taken to mention total serum IgE, at cDNA, fluorescence quantitative PCR detection shows that GFP stablizes for reverse transcription The T3 of heredity is homozygous and heterozygous plant, the expression and wild type Col-0 of ROS1 gene are suitable (Fig. 4 A).Take 7 -day-old of GFP Homozygous Arabidopsis thaliana Seedlings root-tip cells, laser confocal fluorescence microscope detection show ROS1-GFP albumen in the arabidopsis tip of a root Successful expression (Fig. 4 B) in cell.For DNA after taking BstUI digestion as template, quantitative Chop-PCR detection shows ROS1-GFP Albumen remains to execute the normal function (Fig. 4 C) of the original demethylase of endogenous ROS1.

Fluorescence quantification PCR primer is as follows:

ROS1-qRT PCR-F:ACCAAACGAAGGGAACAGAGA(SEQ ID NO.:9)

ROS1-qRT PCR-R:ACAGTCCTAGAGTTGTACAAGGT(SEQ ID NO.:10)

Fluorescent quantitation Chop-PCR primer is as follows:

At1g26400-BstUI-qChop-F:TGACCTGCATAGGCTATAACACA(SEQ ID NO.:11)

At1g26400-BstUI-qChop-R:ATTGGAATCAATCCGAGTGG(SEQ ID NO.:12)

At1g03890-BstUI-qChop-F:CGTGCATTATTTTGGCAGTAACA(SEQ ID NO.:13)

At1g03890-BstUI-qChop-R:ATGCGTCCGGATTTCAGTAT(SEQ ID NO.:14)

Embodiment 2

" conversion of two steps " method knocks in LUC gene at the end of arabidopsis ROS1 gene 3 '

Using Agrobacterium flower-dipping method, by the carrier for expressing DD45::Cas9 and contain donor DNA segment LUC luciferase base Cause and the carrier for expressing guide RNA, successively convert plant, exogenous sequences LUC are finally inserted into arabidopsis ROS1 gene 3 ' end regions.

The acquisition of 2.1Cas9 carrier preparation and the first transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.

The acquisition of 2.2 donor fragment carriers preparation and the second transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.Difference is that the donor DNA segment synthesized in vitro becomes The LUC gene of 1653bp.

The selection result from a Cas9 maternal plant background is counted, as shown in table 2, the external source LUC's without screening label Efficiency is knocked in up to 6.3% in the targeting of ROS1 gene.

Efficiency is knocked in 2. arabidopsis ROS1 gene LUC of table targeting

Embodiment 3

" conversion of two steps " method knocks in GFP gene at the end of arabidopsis DME gene 3 '

Using Agrobacterium flower-dipping method, and by the carrier for expressing DD45::Cas9 and containing donor DNA segment GFP gene express The carrier of guide RNA successively converts plant, and exogenous sequences GFP is finally inserted into 3 ' end regions of arabidopsis DME gene.

The acquisition of 3.1Cas9 carrier preparation and the first transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.

The acquisition of 3.2 donor fragment carriers preparation and the second transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.Difference is: being 1. for the last of arabidopsis DME gene One exon, i.e., 20^th3 ' the end design gRNA of exon.2. homology arm sequence is derived from DME gene 20^thThe termination of exon is close The upstream and downstream (Fig. 5 A, 5B) of numeral.

The selection result from a Cas9 maternal plant background is counted, as shown in table 3, the external source GFP's without screening label Efficiency is knocked in up to 9.1% in the targeting that DME gene 3 ' is held.

Efficiency is knocked in the GFP targeting of 3. arabidopsis DME gene 3 ' of table end

Embodiment 4

" conversion of two steps " method knocks in GFP gene at arabidopsis DME gene 5 ' end

Using Agrobacterium flower-dipping method, and by the carrier for expressing DD45::Cas9 and containing donor DNA segment GFP gene express The carrier of guide RNA successively converts plant, and exogenous sequences GFP is finally inserted into 5 ' end regions of arabidopsis DME gene.

The acquisition of 4.1Cas9 carrier preparation and the first transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.

The acquisition of 4.2 donor fragment carriers preparation and the second transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.Difference is: being 1. second for arabidopsis DME gene A exon, i.e. 5 ' the end design gRNA of 2rd exon.2. homology arm sequence is derived from DME gene 2rd exon initiation codon Upstream and downstream.

The selection result from 2 difference Cas9 maternal plant backgrounds is counted, as shown in table 4, the external source GFP without screening label The targeting at DME gene 5 ' end knock in efficiency up to 8.3%.

Efficiency is knocked in 4. arabidopsis DME gene 5 ' end GFP of table targeting

Embodiment 5

The proline P in 33 site of arabidopsis DME protein 16 is substituted for alanine A by " conversion of two steps " method

Using Agrobacterium flower-dipping method, and by the carrier for expressing DD45::Cas9 and containing donor DNA segment GFP gene express The carrier of guide RNA successively converts plant, and the proline P sequence in 1633 site of arabidopsis DME gene is finally substituted for third Propylhomoserin A sequence.

The acquisition of 5.1Cas9 carrier preparation and the first transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.

The acquisition of 5.2 donor fragment carriers preparation and the second transgenic plant

Carrier preparation and plant preparation method are the same as embodiment 1.Difference is: being 1. 1633 for arabidopsis DME albumen Design gRNA in site.2. homology arm sequence is derived from the upstream and downstream gene in 33 site of DME protein 16.

The selection result from a Cas9 maternal plant background is counted, as shown in table 5, the gene site-directed replacement effect of arabidopsis DME Rate is 5.3%.

The gene site-directed replacement efficiency of 5. arabidopsis DME of table

In conclusion " conversion of the two steps " method of utilization, by the carrier for expressing DD45::Cas9 and contains donor dna and expresses The carrier of guide RNA successively converts plant, may be implemented length to 1653bp size target fragment without label, without mutation, It targets heritablely and knocks in or replace and work orderly, editorial efficiency can be up to 9.1%.

Embodiment 6

" conversion of two steps " method knocks in GFP gene at the end of rice Os ROS1a gene 3 '

Using Agrobacterium callus infestation method, by the carrier for expressing Ubi1::Cas9 and contain donor DNA segment GFP base Because and express the carrier of guide RNA and successively convert plant, the exogenous sequences GFP synthesized in vitro replacement is finally inserted into rice 3 ' end regions of OsROS1a gene.PCR and DNA sequencing show that the segment can be integrated into target position.Concrete operations process It is as follows:

The acquisition of 6.1 Cas9 carriers preparation and transgenosis maternal plant (the first transgenic plant)

The Cas9 sequence that corn Ubi1 promoter mediates is integrated into binary vector pCambia1300 in vitro, and (hygromycin is anti- Property) on (Fig. 6 A).It can refer to the method (Zhang et al., 2014) of Zhang Hui et al..

This Cas9 plasmid is transformed into competence Agrobacterium EH105 with thermal shock method, then water is converted with Agrobacterium infestation method Rice OryzasativaLcv.Nipponbare callus.Using hygromycin as selective agent, the positive is obtained after cultivating on differential medium after screening Plant expresses the rice maternal plant of Cas9 albumen, referred to as the first transgenic plant.Collect the seed of the maternal plant, inducing expression The Rice Callus of Cas9 albumen is spare.

The acquisition of 6.2 donor fragment carriers preparation and purpose plant (the second transgenic plant)

For the last one exon of rice Os ROS1a gene, i.e., 18^th3 ' the end design gRNA of exon, promoter are OsU6.It can refer to the method (Zhang et al., 2014) of Zhang Hui et al..

With OsROS1a 18^thThe terminator codon TAG of exon is boundary, upstream takes 1000bp as 5 ' homology arms (5 ' Arm), using TAG as the segment for needing to replace on endogenous gene, downstream take 1000bp as 3 ' homology arms (3 ' arm).In vitro 5 ' arm, target fragment 720bp GFP gene are connected in turn with 3 ' arm, as donor fragment (donor) (Fig. 6 C).

Finally by OsU6::gRNA component and donor component co-integration to binary vector pCambia3301 (herbicide Basta resistance) on (Fig. 6 B).

This carrier is transformed into Agrobacterium EH105 with thermal shock method, then the table to be taken before the conversion of Agrobacterium infestation method Up to the Rice Callus (i.e. by the callus of the first transgenic plant Seed inducement) of Cas9 albumen, the second transgenosis is obtained Callus library.Using herbicide basta as selective agent, the callus of the T0 positive is obtained after the screening of conventional callus tissue culture Tissue can obtain (the second transgenosis plant of purpose plant by rice T0 is induced to differentiate into for plant after PCR and sequencing detection Strain).

Rice Os ROS1a gene 18^thExon and its upstream and downstream sequence are as follows:

Wherein, single underscore is shown gRNA target sequence (forward direction), is Cas9 between overstriking double underline black base CA Cleavage site, black surround show the sequence that will be replaced, and italicized item sequence is 5 ' arm, and thickened portion sequence is 3 ' arm。

GFP sequence is as previously described:

Wherein, double underline show the catenation sequence for preventing gene silencing.

Efficiency testing is knocked in 6.3 targetings

1. the screening and acquisition of positive plant

To different T0 plant number consecutivelies, single plant takes blade to extract genomic DNA.PCR amplification is carried out using 2 pairs of specificity Detection.

OsROS1a-GFP 5’-F:TCGCAGGTTTGACAACTGAAG(SEQ ID NO.:17)

OsROS1a-GFP 5’-R:CCGGTGGTGCAGATGAACTT(SEQ ID NO.:18)

OsROS1a-GFP full-F:GCAGAGGAGCATGTCTCTATTCT(SEQ ID NO.:19)

OsROS1a-GFP full-R:TGGTCAGCGATCCATTTCAGG(SEQ ID NO.:20)

Rice is diplont, in the purpose plant (i.e. the second transgenic plant) that GFP gene is successfully knocked in, it is homozygous and The amplicon of 5 '-F/R of heterozygote plant OsROS1a-GFP is 1383bp；For OsROS1a-GFP full-F/R, heterozygous plant Amplicon be 1857bp and 1137bp.PCR product agarose gel electrophoresis testing result is as shown in Figure 7 A, wherein #95 plant (T0-95) amplified band is bright and size is correct, is heterozygote.

Further sequencing result shows that GFP gene has correctly replaced endogenous gene TAG sequence, seamless to insert OsROS1a 3 ' is held, OsROS1a 18^thRemaining sequence of exon does not generate mutation (Fig. 7 C).

The seed (T1-95) of heterozygous plant #95 is taken to continue to cultivate, PCR testing result is as shown in Figure 7 B, i.e. the T1 of heterozygosis T0 Gene Isolation has occurred in offspring, meets mendel's law, illustrates that knocking in for GFP is heritable, stable.

Statistics display, after donor fragment vector the first callus of rice transformation, induction differentiation obtains 33 parts of rice the Two callus continue to cultivate up to 33 plants of T0 single plants, wherein gene targeting 1 plant of plant of success.Therefore paddy gene is calculated to beat Target efficiency is 3.0% (table 6).

Efficiency is knocked in the GFP targeting of 6. rice Os ROS1a gene 3 ' of table end

Therefore, using Agrobacterium twice comversion, by the carrier for expressing Ubi1::Cas9 and contain donor dna and express The long target fragment to 720bp size may be implemented without label, nothing in the successive rice transformation callus of the carrier of guide RNA Mutation, heritable target are knocked in/are replaced, and editorial efficiency can achieve 3.0%.

In addition, difference is using the method for embodiment 6, High-expression promoter is surpassed (such as using Rice Callus Thaumatin promoter) mediate Cas9 sequence, the results showed that, editorial efficiency can achieve 10% to 20%.

In conclusion on dicotyledonous and monocotyledonous model plant, all with method (" conversion of two steps " method) of the invention Efficient gene targeting may be implemented.And the transform mode of arabidopsis is Agrobacterium flower-dipping method, the transform mode of rice is Agrobacterium Transformation of Callus, then gene targeting can be carried out with the method by being suitble to the plant of these two types transform mode, The scope of application greatly expands.

Embodiment 7

" step conversion " method knocks in GFP gene at the end of arabidopsis ROS1 gene 3 '

Using the method for embodiment 1, exogenous sequences GFP gene target is knocked in 3 ' ends of arabidopsis ROS1 gene, difference It is, as shown in Figure 8 A, Cas9 enzyme nucleic acid expression element, gRNA Expression element, donor dna is attached on a plasmid (pCambia1300), only primary using Agrobacterium-mediated Transformation using Colombia's Col-0 Arabidopsis thaliana ecotype as background, obtain 293 A T1 resistant plant (hygromycin resistance), as screening library.PCR testing result is as shown in Figure 8 B.The result shows that energy in T1 plant Purpose single plant is screened, efficiency is 0.68% (table 7).

Editorial efficiency is knocked in the mono- carrier targeting of 7. arabidopsis ROS1 gene GFP of table

Embodiment 8

Agrobacterium infects the evaluation method of phase High-expression promoter starting intensity

1. what the transgenosis of arabidopsis generallyd use is Agrobacterium flower-dipping method, therefore transforming tissue is the inflorescence of full-bloom stage. When promoter to be checked is the promoter of arabidopsis endogenous gene, then directly extraction arabidopsis full-bloom stage inflorescence RNA uses qRT- PCR method detects the gene expression amount (using Actin7 as reference gene), compared with the expression quantity of DD45 promoter.

If gene expression amount to be checked >=80%DD45 expression quantity, so that it may which being considered as Agrobacterium to infect the phase (is more broadly group Knit the period of being converted) High-expression promoter.

When promoter to be checked is the promoter of plant foreign gene, carrier construction (driving Cas9 with the promoter) conversion Into plant, the RNA of transforming tissue is then equally extracted, qRT-PCR method detects Cas9 gene expression amount, with DD45 driving Cas9 gene expression amount compares.

Such as the evaluation of cauliflower mosaic virus CaMV 35S promoter.35S::Cas9 and DD45::Cas9 are turned respectively Change and enter in arabidopsis, after taking homozygote, detects the expression quantity of Cas9 gene in arabidopsis floral, the results showed that, DD45's It is 10 times of 35S.Therefore 35S is not that Agrobacterium infects phase High-expression promoter.

2. what the transgenosis of the crops such as rice generallyd use is Agrobacterium Transformation of Callus method, therefore will test material and change It is other similar at callus, and be changed to compared with the Cas9 expression quantity that Maize Ubi1 drives.

If the Cas9 expression quantity of gene expression amount >=80%Ubi1 to be checked, so that it may be considered as Agrobacterium and infect the phase (broadly Saying is, tissue is converted period) High-expression promoter.

Embodiment 9

" step conversion " method for adding enhancer element knocks in GFP gene at the end of arabidopsis ROS1 gene 3 '

Using the method for embodiment 7, exogenous sequences GFP gene target is knocked in 3 ' ends of arabidopsis ROS1 gene, difference It is, as shown in Figure 9 A, the translational enhancer element (albumen such as from tobacco mosaic virus (TMV) TMV is added before Cas9 gene Translational enhancer Omega sequence), the Cas9 Expression element that this is optimized, then be attached to gRNA Expression element, donor dna On one plasmid (pCambia1300), using Colombia's Col-0 Arabidopsis thaliana ecotype as background, Agrobacterium-mediated Transformation one is only utilized It is secondary, 125 T1 resistant plants (hygromycin resistance) are obtained, as screening library.PCR testing result is as shown in Figure 9 B.The result shows that Purpose single plant can be screened in T1 plant, efficiency is 2.4% (table 8).

Same method, difference are, transcription enhancer element is added before Cas9 gene (as come from arabidopsis The 1 of AtUbiquitin10 gene^stIntron sequence), efficiency 1.7%.

Same method, difference are, add transcription and translation enhancer element simultaneously before Cas9 gene (AtUbi10 and Omega), efficiency 3.8%.

Editorial efficiency is knocked in the mono- carrier targeting of arabidopsis ROS1 gene GFP that table 8. adds enhancer

Comparative example 1

Using the method for embodiment 1, difference is, promoter 35S (strong promoter, and composition of Cas9 nuclease Type promoter, but expression quantity is lower in the arabidopsis floral tissue that Agrobacterium is infected), CDC45 or (mitogenetic group of stem apex of Yao Knit specific promoter, but be not inflorescence tissue this infected the High-expression promoter at position), statistics come from 7 T2 seed banks, The results are shown in Table 9.The result shows that arabidopsis ROS1 gene 3 ' either is knocked in the targeting of GFP segment using 35S::Cas9 End, or DME gene 5 ' end is knocked in into the targeting of GFP segment using CDC45::Cas9 or Yao::Cas9, it is screened not in T2 single plant To positive plant, so the editorial efficiency of this 3 kinds of promoters is very low, the plant edited less than success is screened.

Table 9. by when other promoter regulations Cas9 to arabidopsis gene editorial efficiency

Bibliography

1.Mao,Y.,Zhang,H.,Xu,N.,Zhang,B.,Gou,F.,and Zhu,J.K.(2013) .Application of the CRISPR-Cas System for Efficient Genome Engineering in Plants.Molecular plant.2.Zhang,H.,Zhang,J.,Wei,P.,Zhang,B.,Gou,F.,Feng,Z., Mao,Y.,Yang,L.,Zhang,H.,Xu,N.,and Zhu,J.K.(2014).The CRISPR/Cas9system produces specific and homozygous targeted gene editing in rice in one generation.Plant Biotechnol.

All references mentioned in the present invention is incorporated herein by reference, independent just as each document It is incorporated as with reference to such.In addition, it should also be understood that, after reading the above teachings of the present invention, those skilled in the art can To make various changes or modifications to the present invention, such equivalent forms equally fall within model defined by the application the appended claims It encloses.

Sequence table

<110>Shanghai Inst. of Life Science, CAS

<120>reagent combination and its application of a kind of no label for gene editing

<130> P2018-2526

<150> CN 201810130658.2

<151> 2018-02-08

<160> 20

<170> SIPOSequenceListing 1.0

<210> 1

<211> 1242

<212> DNA

<213>arabidopsis (Arabidopsis thaliana)

<400> 1

gtaatttaat gatttgcata tcttttaatc atgaaatcaa atcggtatct ttaatcgatg 60

tgttattcaa caggtgagac ggctgattct attcaaccgt ctgttagtac gtgcatattc 120

caagcaaatg gtatgctttg tgacgaggag acttgtttct cctgcaacag catcaaggag 180

actagatctc aaattgtgag agggacaatt ttggtaagta gttgcatcaa tctccttatg 240

cggcttacta cacttatgtt ttctacagat taatatgttg taaattgtac agattccttg 300

tagaacagcg atgaggggta gttttcctct aaatggaacg tactttcaag taaatgaggt 360

aagacttgaa ctccaataac tccaactctt tcattttaat tatttgcatt gaaacttgtg 420

atgtattcta ttgatacagg tgtttgcgga tcatgcatcc agcctaaacc caatcaatgt 480

cccaagggaa ttgatatggg aattacctcg aagaacggtc tattttggta cctctgttcc 540

tacgatattc aaaggtataa gattttcttt attggattgt gatgcgattg tttatataaa 600

agaaagttgt tctaaccact tgagctctat ttttctcagg tttatcaact gagaagatac 660

aggcttgctt ttggaaaggt acattttgta ttaagcagtt tcttcttgtt ctgaaacata 720

acttatcttt tgatattatg tagggtacgt atgtgtacgt ggatttgatc gaaagacgag 780

gggaccgaag cctttgattg caagattgca cttcccggcg agcaaactga agggacaaca 840

agctaacctc gcctaatccg ttggcaagca aacaaataca agcttatggt taagagtgag 900

agagcacact gttccaatct agttaatgta agaaagtgaa aacgtaaagt taacagtcct 960

agagttgtac aaggtttcta aatcccattt tagtttcgtc ttaaatttgt atcaaacact 1020

tgtcacaaaa aacagacccg tagctgtgta aactctctgt tcccttcgtt tggtttatat 1080

ctgaatttac ggttagcttt tggttacctg aatcaagatc tggttcgata tgtggaggat 1140

ctcacttaac ttggtttaaa tcagatagtt caaccggacc aaagaattct attgttgtca 1200

aatattagat gatgggccta ttatacatgg aatgtgggtc at 1242

<210> 2

<211> 740

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 2

acaagtttgt atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt 60

cgagctggac ggcgacgtga acggccacaa gttcagcgtg tccggcgagg gcgagggcga 120

tgccacctac ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc 180

ctggcccacc ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga 240

ccacatgaag cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg 300

caccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 360

cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 420

cctggggcac aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa 480

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 540

gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 600

cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga 660

tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct 720

gtacaagtaa tacaaagtgg 740

<210> 3

<211> 30

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 3

gcagttggaa aagagagaac ctgatgatcc 30

<210> 4

<211> 23

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 4

ctgaacttgt ggccgttcac gtc 23

<210> 5

<211> 25

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 5

acctgatgat ccatgttctt atttg 25

<210> 6

<211> 23

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 6

ccttgtacaa ctctaggact gtt 23

<210> 7

<211> 20

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 7

acaaccacta cctgagcacc 20

<210> 8

<211> 20

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 8

tgaagatcgg agctggttcc 20

<210> 9

<211> 21

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 9

accaaacgaa gggaacagag a 21

<210> 10

<211> 23

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 10

acagtcctag agttgtacaa ggt 23

<210> 11

<211> 23

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 11

tgacctgcat aggctataac aca 23

<210> 12

<211> 20

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 12

attggaatca atccgagtgg 20

<210> 13

<211> 23

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 13

cgtgcattat tttggcagta aca 23

<210> 14

<211> 20

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 14

atgcgtccgg atttcagtat 20

<210> 15

<211> 2003

<212> DNA

<213>rice (Oryza sativa)

<400> 15

tatccttttt tttgccattt cagctgatag ctactctcca gtcaaaatat ttgccatctc 60

tattgaactt ttcattgtct tctgaatgta tcttactctt ggatcattaa tatttcattt 120

tgtcacgata tagtggtata ggacaataaa atcatgggaa gtatttattt tcatcaccaa 180

tctactcata taattttcaa atgacaatta taaatatctt aaaaatatat tgttagttgt 240

cctgtataaa ataattgtca caccctagtc cacagcgaca agaatttgtg tctacaggct 300

agagtgagta ctctagaagt atcttcatag gaatcggaat aaaatgccaa tgtgaatgaa 360

caaggatatc aagtataccc tcaaaatctc tagagaggat tgcgtaaata tgtaggtgta 420

attaaacaat tgtttcatat ggagggtttt cttaaaggag gtacaagact tatcaatatg 480

ggtaaagtag tttttatcca taggcattgt tggcagaaag ctgcttaggg tagaatgcta 540

ctccctccgt cccacaatat aagagatttt gagtttttgc ttgcaacgtt tgaccactcg 600

gcttattcaa aaatttttga aattattatt tattttattt gtgacttact ttattattca 660

cagtacttta agtacaactt ttcgtttttt atatttgcaa aaaaaattgt ataagacgag 720

tggtcaaacg ttgtacgcaa aaactcaaaa tcccttatat tgtgggacgg agggagtact 780

tatggatgcc ttttttgtcc aagatgtcag taacattttc tttcagggat gtggattttt 840

acttcttttt tccctaactt tttcaggatt tgtgtgcgtg agaggctttg ataggacatc 900

aagagcaccc agaccactgt atgcaagact ccactttcca gcaagcaaaa ttaccaggaa 960

taaaaaatct gcaggttctg ctccaggaag agatgatgaa taggccatct ggaaaaccag 1020

aaaggaaata aagaggaggt acatatgatc tgccagaaga tcactgacct gaaatggatc 1080

gctgaccaat aagttgccgt aggcaattca attatttctg gccatataca tctgctgaaa 1140

gttatgaact ccagccactg acgaattcgt ggtgctggta ttcttcggca acatgatcca 1200

tcatacagat tctatgcttg gttgttgcaa gcaattctta tgcggtgaca gttgctgctg 1260

atagggagaa aaggcatgtc cggcggctca gcggctctaa ctgtactttc atatgagtgg 1320

aaccgattgt tgtacatgtg aaaagtttgc cattcaaaat ggtcattcat gttgttaggt 1380

cattcatgta gtcgatgtca aattaatcat caattatttg atttgattca ttcacaagtt 1440

taattggctc tagatacttg tgagctgcag gccagcaatg tcataatgta tgtcgggaaa 1500

aggtagatat aaatcgtcag catttacctg aaataccctt cctctgtcca taaatacaag 1560

ggattttggg ttgttaagcg tattttaagt tcgatatgaa aattactttg atgttccgaa 1620

gggcttattt tgtcttgggt tgtttagcat gtcataaggt tgatattaaa ttactttcat 1680

gcccttagga gttttggaaa gttgacgctt aacagatgcg actagcagta agcaataaat 1740

gtctagatgg attgagaaag tagtatttct tccgtctcaa aatattgcta taagctctgt 1800

ttgttagggt tctaacttct aaattacttt agaagttagg tatatagtga agttgtggaa 1860

ctatttaaat atagttatat ctctctagtt tattttttat tttatgagag cacttcaatt 1920

cattccactc tttttttttt tggaattgaa atcatttggt tgtgcttcag ttctagaaaa 1980

tgtggagcta gagttgaaga cgt 2003

<210> 16

<211> 740

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 16

acaagtttgt atggtgagca agggcgagga gctgttcacc ggggtggtgc ccatcctggt 60

cgagctggac ggcgacgtga acggccacaa gttcagcgtg tccggcgagg gcgagggcga 120

tgccacctac ggcaagctga ccctgaagtt catctgcacc accggcaagc tgcccgtgcc 180

ctggcccacc ctcgtgacca ccttcaccta cggcgtgcag tgcttcagcc gctaccccga 240

ccacatgaag cagcacgact tcttcaagtc cgccatgccc gaaggctacg tccaggagcg 300

caccatcttc ttcaaggacg acggcaacta caagacccgc gccgaggtga agttcgaggg 360

cgacaccctg gtgaaccgca tcgagctgaa gggcatcgac ttcaaggagg acggcaacat 420

cctggggcac aagctggagt acaactacaa cagccacaac gtctatatca tggccgacaa 480

gcagaagaac ggcatcaagg tgaacttcaa gatccgccac aacatcgagg acggcagcgt 540

gcagctcgcc gaccactacc agcagaacac ccccatcggc gacggccccg tgctgctgcc 600

cgacaaccac tacctgagca cccagtccgc cctgagcaaa gaccccaacg agaagcgcga 660

tcacatggtc ctgctggagt tcgtgaccgc cgccgggatc actcacggca tggacgagct 720

gtacaagtaa tacaaagtgg 740

<210> 17

<211> 21

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 17

tcgcaggttt gacaactgaa g 21

<210> 18

<211> 20

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 18

ccggtggtgc agatgaactt 20

<210> 19

<211> 23

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 19

gcagaggagc atgtctctat tct 23

<210> 20

<211> 21

<212> DNA

<213>artificial sequence (artificial sequence)

<400> 20

tggtcagcga tccatttcag g 21

Claims (21)

1. a kind of reagent of no label for gene editing combines characterized by comprising

(i) the first nucleic acid constructs, or the first vector containing first nucleic acid constructs, the first nucleic acid constructs tool There is the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；With

(ii) the second nucleic acid constructs, or the Second support containing second nucleic acid constructs, second nucleic acid constructs With structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

2. a kind of reagent of no label for gene editing combines characterized by comprising

(i) the first nucleic acid constructs, or the first vector containing first nucleic acid constructs, the first nucleic acid constructs tool There is the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；With

(ii) the second nucleic acid constructs, or the Second support containing second nucleic acid constructs, second nucleic acid constructs With structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

3. reagent combination as claimed in claim 2, which is characterized in that the tissue is converted period High-expression promoter and includes Tissue-specific promoter, and/or constitutive promoter.

4. reagent combination as claimed in claim 2, which is characterized in that the tissue is converted period High-expression promoter and includes Agrobacterium infects phase High-expression promoter.

5. reagent combination as claimed in claim 2, which is characterized in that the tissue is converted period High-expression promoter and is selected from The following group: Maize Ubiquitin1, Rubisco, Actin promoter, or combinations thereof.

6. reagent combination as described in claim 1, which is characterized in that the tissue-specific promoter includes reproduction cell spy The promoter of different expression.

7. reagent combination as claimed in claim 6, which is characterized in that the specifically expressed promoter of reproduction cell is selected from down Group: the specifically expressed promoter of ovule, the promoter of pollen-specific expression, embryonic development early stage specifically expressed promoter or A combination thereof.

8. reagent composition as claimed in claim 7, which is characterized in that the specifically expressed promoter of ovule includes DD45 Promoter.

9. reagent combination as claimed in claim 2, which is characterized in that the tissue is converted period High-expression promoter (PX) Tissue including meeting the following conditions is converted period High-expression promoter:

When flower-dipping method converts, ratio >=80% of PX/P1, more preferably, >=90%；

Ratio >=80% of PX/P1, more preferably, >=90%；And/or

When Transformation of Callus, ratio >=80% of PX/P2, more preferably, >=90%；

Ratio >=80% of PX/P2, more preferably, >=90%；

Wherein, PX is the starting intensity that tissue is converted period High-expression promoter；P1 is the starting of arabidopsis DD45 promoter Intensity；P2 is the starting intensity of Ubi1 promoter.

10. reagent combination as claimed in claim 1 or 2, which is characterized in that without screening label on the donor dna.

11. a kind of kit, which is characterized in that the kit contains reagent combination of any of claims 1 or 2.

12. the method that a kind of pair of plant carries out gene editing, which is characterized in that comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) the first nucleic acid constructs or first vector containing first nucleic acid constructs are imported into the plant to be edited Plant cell, to obtain the plant cell for importing the plant to be edited；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant of the progeny plant from the plant cell for importing the plant to be edited is obtained；

(iv) the second nucleic acid constructs or Second support containing second nucleic acid constructs are imported into the progeny plant Plant cell,

Wherein the plant cell is selected from the group:

(b1) isolated cells from the progeny plant；

(b2) cell for the callus that the isolated cells of the progeny plant are formed；

(b3) cell from organ of multiplication on the plant of the progeny plant；

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

13. method as claimed in claim 12, which is characterized in that in step (ii), plant cell is (a3)；And/or step (iv) in, plant cell is (b3).

14. the method that a kind of pair of plant carries out gene editing, which is characterized in that comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) the first nucleic acid constructs or first vector containing first nucleic acid constructs are imported into the plant to be edited Plant cell, to obtain the plant cell for importing the plant to be edited；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant of the progeny plant from the plant cell for importing the plant to be edited is obtained；

(iv) the second nucleic acid constructs or Second support containing second nucleic acid constructs are imported into the progeny plant Plant cell,

Wherein the plant cell is selected from the group:

(b1) isolated cells from the progeny plant；

(b2) cell for the callus that the isolated cells of the progeny plant are formed；

(b3) cell from organ of multiplication on the plant of the progeny plant；

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

15. the method that a kind of pair of plant carries out gene editing, which is characterized in that comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) by the first nucleic acid constructs or first vector and the second nucleic acid constructs containing first nucleic acid constructs or contain The Second support of second nucleic acid constructs imports the plant cell of the plant to be edited, so that it is described wait compile to obtain importing Collect the plant cell of plant；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant from the plant cell for importing the plant to be edited is obtained；Wherein,

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is tissue-specific promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

16. method as claimed in claim 15, which is characterized in that first nucleic acid constructs and second nucleic acid construct Level is on identical or different carrier.

17. the method that a kind of pair of plant carries out gene editing, which is characterized in that comprising steps of

(i) plant to be edited is provided, as parent plant；

(ii) by the first nucleic acid constructs or first vector and the second nucleic acid constructs containing first nucleic acid constructs or contain The Second support of second nucleic acid constructs imports the plant cell of the plant to be edited, so that it is described wait compile to obtain importing Collect the plant cell of plant；

Wherein the plant cell is selected from the group:

(a1) isolated cells from the plant；

(a2) cell for the callus that the isolated cells of the plant are formed；

(a3) cell from organ of multiplication being located on the plant；

(iii) plant from the plant cell for importing the plant to be edited is obtained；Wherein,

Wherein, first nucleic acid constructs has the Formulas I structure from 5 ' -3 ':

P1-Z1-Z2 (I)

Wherein, P1 is the first promoter, and first promoter is that tissue is converted period High-expression promoter；

Z1 is coding Cas9 albumen coded sequence；

Z2 is terminator；

Also, "-" is key or nucleotide catenation sequence；

Second nucleic acid constructs has structure shown in the Formula II from 5 ' -3 ':

P2-Z3-Z4-Z5 (II)

Wherein, P2 is the second promoter, and second promoter is selected from the group: U6, U3,7SL, or combinations thereof；

Z3 is the coded sequence of gRNA；

Z4 is polyT sequence；

Z5 is donor DNA sequences；

Also, "-" is key or nucleotide catenation sequence.

18. method as claimed in claim 17, which is characterized in that first nucleic acid constructs and second nucleic acid construct Level is on identical or different carrier.

19. a kind of method of prepare transgenosis plant cell, which is characterized in that comprising steps of

(i) transfection of plant cells reagent of any of claims 1 or 2 is combined, so that the building in reagent combination Object occurs fixed point with the chromosome in the plant cell and knocks in and/or replace, so that the transgenic plant cells be made.

20. a kind of method of prepare transgenosis plant cell, which is characterized in that comprising steps of

(i) transfection of plant cells reagent of any of claims 1 or 2 is combined, so that the plant cell contains the reagent The construction in combination, so that the transgenic plant cells be made.

21. a kind of method of prepare transgenosis plant, which is characterized in that comprising steps of

The transgenic plant cells prepared by claim 19 or claim 20 the method are regenerated as plant, thus Obtain the genetically modified plants.