CN104611368B - The carrier of frameshift mutation is not generated after restructuring, the gene site-directed method knocked in and application are carried out in pawl frog genome - Google Patents

Abstract

The present invention provides do not generate the carrier of frameshift mutation after a kind of restructuring, the gene site-directed method knocked in and application are carried out in pawl frog genome.The method includes the steps of:1) donor vehicle containing guide RNA, Cas9 nuclease and with pancreas ela fluorescent screenings label and Cas9 target fragments in pawl frog fertilized eggs is made, 2) under guide RNA and Cas9 nuclease collective effect, double-strand Cas9 target fragments in pawl frog genome in target gene and on donor vehicle are sheared, 3) by itself DNA repair function of pawl frog cell, that realizes in pawl frog genome gene site-directed knocks in；4) G0 is screened for embryo by pancreas ela fluorescence labels, and carries out southern blot identifications to F1.The present invention is to be model animal research science of heredity using the pawl frog and studied human diseases to lay the foundation.

Description

The carrier of frameshift mutation is not generated after restructuring, progress gene is determined in pawl frog genome The method and application that point is knocked in

Technical field

The present invention relates to genetic engineering fields, and in particular to does not generate the carrier of frameshift mutation after a kind of restructuring, in the pawl frog The gene site-directed method knocked in and application are carried out in genome.

Background technology

Xenopous laevis (Xenopus laevis) is a kind of classical mode animal of body early embryo research.There is embryo's individual Greatly, the advantages that egg laying amount is more.The tropical pawl frog (Xenopus tropicalis) possesses all advantages of xenopous laevis, in addition the object Kind individual is smaller, and the breeding cycle is short (4-5 months), and is liploid variety, is suitble to do genetics research.

Tropical pawl frog genome sequencing has been completed, and genome has about 1,700,000,000 base-pairs, includes 20,000 to 2.1 ten thousand Gene, wherein about 1700 gene genes corresponding with the mankind are closely similar, in all human genes nearly 80% and heredity The related gene of disease can all find corresponding position (Hellsten et al., 2010) in the gene of tropical Xenopus laevis.And these bases Because the morbidity with the diseases such as cancer, asthma, heart disease is related.So the tropical pawl frog is a research gene function well, seek Disease correlation factor is looked for, establishes genetic disease, establishes the ideal model of large-scale medicine screening.

In the past, the pawl frog achieved the purpose that gene overexpression by mRNA injections, reached clpp gene with morpholino injections The purpose of drop.But both approaches all have timeliness, it is impossible to do genetics research for a long time.

Phase at the end of the 20th century, science family expenses homologous recombination technology complete gene knockout and pointed decoration, this method Due to extremely inefficient (Thomas et al., 1987), embryonic stem cell and body have been limited only to the research help of life science The species of nuclear transfer technology maturation.As people further appreciate that biology, it is found that DNA double chain fracture can be effective The gene site-directed modification of raising efficiency (Jasin., 1996), based on this, in recent years, double-strand is pinpointed with genome can be caused The continuous rise of the instrument of fracture, such as ZFN, TALEN, CRISPR/Cas9 etc., at present successfully in embryo's water of a variety of species It is flat to carry out gene knockout and gene site-directed modification.

Using gene targeting (ZFN, TALEN, CRISPR/Cas9) in the tropical pawl frog and xenopous laevis, pass through base Because of the nonhomologous end reparation after double-strand break, frameshift mutation is caused, achievees the purpose that specific gene afunction, realizes base The fixed point of cause destroy (Young et al., 2011；Lei et al., 2012；Ishibashi et al., 2012；Nakayama Et al., 2013；Blitz et al., 2013；Guo et al., 2014) so that the pawl frog is cured with biology exploring biomechanism Effect in medicine greatly increases.But under study for action, only specific gene lacks functionality is there are significant limitation, most In number research, it would be desirable to which the spatial and temporal expression for carrying out gene is adjusted and marked, and rite-directed mutagenesis correlation factor establishes human diseases mould Type etc..At this moment, it would be desirable to which accurate pointed decoration and editor are carried out to some sites of endogenous gene.So in the pawl frog Realize that the gene site-directed modification based on restructuring is very important.

At present, knocked in gene site-directed in modification, the various technologies of appearance can be mainly divided into two classes.

1. the gene site-directed modification mediated by homologous recombination machinery.This technology is broadly divided into double-strand by the difference of template Plasmid template, linearized plasmid templates, the gene site-directed modification of the homologous recombination mediation of single-stranded template mediation.

The drawback is that：Height is required to homology arm, efficiency is low, and cumbersome.

2. by the gene site-directed modification of non-homologous end joining mechanisms mediate.This technology is risen recently, respectively in cell Level completes gene site-directed modification in model animal zebra fish.But there is the phenomenon that not in reading frame in zebra fish (Auer et al., 2014) so that efficiency reduces by 2/3.

Recently, in xenopous laevis base is realized using the gene site-directed modification technique of non-homologous end joining mechanisms mediate Because of pointed decoration (Nakade et al., 2014).But this article data are shown, this modification by gonad without carrying out The information of transmission, and it is confined to the high gene of expression intensity.It is that can not be inserted into for expressing weak gene or lncRNA Screening.

So realized in the tropical pawl frog efficiently, it is accurate, can screen, heritable gene site-directed technology of knocking in is very Important.

The content of the invention

To solve the above problems, the present invention provides it is a kind of carried out in pawl frog genome the gene site-directed method knocked in and Using a kind of, carrier for not generating frameshift mutation after recombinating and application and a kind of it is used to carry out in pawl frog genome The gene site-directed kit knocked in.

It is to utilize in a first aspect, carrying out the gene site-directed method knocked in pawl frog genome the present invention provides a kind of CRISPR/Cas systems are transformed target gene in the pawl frog, which includes guide RNA and Cas9 nuclease, the side Method comprises the steps of：1) make in the pawl frog fertilization fourth of the twelve Earthly Branches containing guide RNA, Cas9 nuclease and donor vehicle, 2) then to It leads under RNA and Cas9 nuclease collective effects, the double-strand Cas9 targets in pawl frog genome in target gene and on donor vehicle Standard film section is sheared, 3) again by itself DNA repair function of pawl frog cell, that realizes in pawl frog genome gene site-directed strikes Enter；

Wherein, the guide RNA includes and the complementary RNA segments combined of the Cas9 target fragments；The donor vehicle Including Cas9 target fragments and gene to be knocked in；Target gene in the pawl frog genome includes Cas9 target fragments.

As described in the present invention, " guide RNA " is mutually used with " gRNA ".

As described in the present invention, " donor vehicle " is mutually used with " donor carriers ".

As described in the present invention, as existing literature is recorded, the guide RNA is successively by can be mutual with the target fragments It mends the RNA segments combined and skeleton RNA segments is formed by connecting；The skeleton RNA segments are fitted together to successively by tracrRNA, crRNA The RNA of similar hairpin structure is formed, the skeleton RNA segments can be combined with Cas9 nucleases, and the Cas9 nucleases carry core Localization signal peptide, in of the invention, the skeleton RNA segments, Cas9 nucleases are capable sequence commonly used in the trade.

In an embodiment of the present invention, the skeleton RNA segments are the DNA shown in nucleotide as shown in SEQUENCE NO.1 What transcription came out.

It in an embodiment of the present invention, can be with the complementary RNA segments combined of the target fragments in the guide RNA For such as SEQUENCE NO.2 (ets1：GGTTCAGAGAATTCAGAGGG)；SEQUENCE NO.3(ets2： GGTCTGGACTCTTACTCTCA)；Or SEQUENCE NO.4 (tyr：GGGGTCCCTAACTTCCTCTA DNA is transcribed out shown in) Come.

In an embodiment of the present invention, the encoding gene nucleotides sequence of the Cas9 nucleases with nuclear localization signal peptide Row are as shown in SEQUENCE NO.5.

As described in the present invention, as existing literature is recorded, a chain in the double-strand Cas9 target fragments has such as Lower structure：5’-N_xAny one of-NGG-3 ', N expression A, G, C and T, 18≤X≤22, but not limited to this.

In a preferred embodiment, the 5 '-GG-N_xIn-NGG-3 ', X=18.

In an embodiment of the present invention, it is described to make to contain guide RNA, Cas9 core in the pawl frog fertilization fourth of the twelve Earthly Branches in the step 1) The method of sour enzyme and donor vehicle is：To the pawl frog be fertilized guide RNA described in direct injection in the fourth of the twelve Earthly Branches, with nuclear localization signal peptide Cas9 nucleases and donor vehicle.

In an alternative embodiment of the invention, it is described to make to contain guide RNA, Cas9 in the pawl frog fertilization fourth of the twelve Earthly Branches in the step 1) The method of nuclease and donor vehicle is：It is fertilized to the pawl frog and the restructuring gram of the expression cassette containing the guide RNA is imported in the fourth of the twelve Earthly Branches The recombinant expression carrier and donor of grand carrier and encoding gene containing the Cas9 nucleases with nuclear localization signal peptide Carrier, the expression cassette of the guide RNA be fertilized in the fourth of the twelve Earthly Branches in the pawl frog and give expression to guide RNA, described with nuclear localization signal peptide The table encoding gene of Cas9 nucleases is fertilized in the fourth of the twelve Earthly Branches in the pawl frog and gives expression to the Cas9 nucleases with nuclear localization signal peptide.

In an embodiment of the present invention, in the step (1), when being injected into the pawl frog fertilization fourth of the twelve Earthly Branches, using micro- note It penetrates, and before the fertilization non-fourth of the twelve Earthly Branches in the fourth of the twelve Earthly Branches is split, is injected in fertilization fourth of the twelve Earthly Branches animal pole region.

In an embodiment of the present invention, in the step (1), the donor vehicle further includes fluorescent reporter gene expression Box, the fluorescent reporter gene expression cassette use pancreas promoter.

In this embodiment, the gene site-directed side knocked in is carried out in pawl frog genome described in first aspect present invention Method is that target gene is transformed in the pawl frog using CRISPR/Cas systems, which includes guide RNA and Cas9 nucleic acid Enzyme, the method are preferably to comprise the steps of：1) make to contain guide RNA, Cas9 nuclease in the pawl frog fertilization fourth of the twelve Earthly Branches and have The donor vehicle of pancreas promoter ela- fluorescent screening labels, 2) and then under guide RNA and Cas9 nuclease collective effect, pawl Double-strand Cas9 target fragments in frog genome in target gene and on donor vehicle are sheared, and 3) pass through pawl frog cell again Itself DNA repair function, realize in pawl frog genome it is gene site-directed knock in, 4) G0 passes through pancreas promoter ela- for embryo Fluorescent screening label is screened and (preferably, carries out southern blot identifications after screening again to F1)；

Wherein, the guide RNA includes and the complementary RNA segments combined of the Cas9 target fragments；The donor vehicle Including Cas9 target fragments and gene to be knocked in；Target gene in the pawl frog genome includes Cas9 target fragments.

In this embodiment, the fluorescent reporter gene in the fluorescent reporter gene expression cassette, which is preferably independent of, waits to strike Gene and Cas9 the target fragments expression entered.

In this embodiment, the fluorescent reporter gene in the fluorescent reporter gene expression cassette is preferably GFP report bases Cause.In an embodiment of the present invention, in the step (1), the donor vehicle further includes the intron sequences of pawl frog genome And exon sequence, in the donor vehicle, the Cas9 target fragments are located in the intron sequences, the introne sequence Row, exon sequence and gene to be knocked in are sequentially connected.

As described in the present invention, the intron sequences, exon sequence and gene to be knocked in " being sequentially connected " are to cause Cas9 target fragments can cause gene to be knocked in recombinate by CRISPR/Cas system identifications, be integrated into pawl frog genome In the order of connection gone.

In this embodiment, after recombinating, endogenous introne shearing mechanism is relied on, reaches not frameshift mutation Effect.The intron sequences (containing Cas9 target fragments) and exon sequence preferably derive from pawl frog genome, are these Invention is designed specifically to obtained by being screened in pawl frog genome：In some longer introne of the gene operated Select Cas9 target sites.When the target site of selection, destroy efficiency it is higher when, using PCR by the introne containing the target spot and under It swims the exon amplification closed on to go out, be cloned into carrier (such as pBS-ela-GFP), it would be desirable to the element (base to be knocked in of expression Cause) it is cloned into after the sequence, and confirm in the encoder block of the gene.After recombinating, endogenous introne is relied on Shearing mechanism, achievees the effect that not frameshift mutation.

In this embodiment, it is necessary to the mesh that the element (gene to be knocked in) of expression may include any desired research, knock in Gene is marked, such as foreign gene, sequence label, the target gene are preferably disposed on above-mentioned exon sequence downstream or centre.

In this embodiment, the intron sequences containing Cas9 target fragments that the present invention uses are preferably from pawl The introne of frog genome, further preferably torrid zone pawl frog tyrosinase genes, ndrg1 genes or tubb2b genes, In, the target sequence of tyrosinase genes is that sequence is shown in SEQUENCE NO.6；The target sequence of ndrg1 genes is Shown in SEQUENCE NO.7；The target sequence of tubb2b genes is shown in SEQUENCE NO.8.

In this embodiment, the present invention screen, from pawl frog genome intron sequences (containing Cas9 targets Segment) and exon sequence total length be preferably such as SEQUENCE NO.9, SEQUENCE NO.10 or SEQUENCE NO.11 institutes The nucleotide sequence shown.

In this embodiment, the donor vehicle is preferably plasmid vector.

In an alternative embodiment of the invention, in the step (1), in the donor vehicle, the Cas9 target fragments and Gene to be knocked in is sequentially connected.As described in the present invention, the Cas9 target fragments and gene " being sequentially connected " to be knocked in To cause Cas9 target fragments by CRISPR/Cas system identifications, and gene to be knocked in can be recombinated, be integrated into the pawl frog The order of connection gone in genome.

In this embodiment, in the donor vehicle, the Cas9 target fragments are preferably located at described to be knocked in The upstream or centre of gene.

In this embodiment, the sequence of the Cas9 target fragments is preferably such as SEQUENCE NO.12, SEQUENCE Nucleotide sequence shown in NO.13 or SEQUENCE NO.14.

In this embodiment, the Cas9 target fragments are preferably to be included in extron, the extron and described Gene to be knocked in is sequentially connected, and the extron is the extron in pawl frog genome.

In this embodiment, the donor vehicle is preferably plasmid vector.

What first aspect present invention provided carries out the gene site-directed method knocked in pawl frog genome, can obtain stable something lost The tropical pawl frog of the mutation of insertion pass, gene site-directed.

Second aspect, the present invention provides a kind of carrier for not generating frameshift mutation after recombinating, the carrier bag Cas9 target fragments and gene to be knocked in are included, the carrier further includes the intron sequences of pawl frog genome and extron sequence Row, wherein, the Cas9 target fragments are located in the intron sequences, the intron sequences, exon sequence and wait to strike Enter gene to be sequentially connected.

In this embodiment, after recombinating, endogenous introne shearing mechanism is relied on, reaches not frameshift mutation Effect.The intron sequences (containing Cas9 target fragments) and exon sequence preferably derive from pawl frog genome, are these Invention is designed specifically to obtained by being screened in pawl frog genome：In some longer introne of the gene operated Select Cas9 target sites.When the target site of selection, destroy efficiency it is higher when, using PCR by the introne containing the target spot and under It swims the exon amplification closed on to go out, be cloned into carrier (such as pBS-ela-GFP), it would be desirable to the element (base to be knocked in of expression Cause) it is cloned into after the sequence, and confirm in the encoder block of the gene.After recombinating, endogenous introne is relied on Shearing mechanism, achievees the effect that not frameshift mutation.

In this embodiment, it is necessary to the mesh that the element (gene to be knocked in) of expression may include any desired research, knock in Gene is marked, such as foreign gene, sequence label, the target gene are preferably disposed on above-mentioned exon sequence downstream or centre.

In this embodiment, the intron sequences containing Cas9 target fragments that the present invention uses are preferably from pawl The introne of frog genome, further preferably torrid zone pawl frog tyrosinase genes, ndrg1 genes or tubb2b genes, In, the target sequence of tyrosinase genes is that sequence is shown in SEQUENCE NO.6；The target sequence of ndrg1 genes is Shown in SEQUENCE NO.7；The target sequence of tubb2b genes is shown in SEQUENCE NO.8.

In this embodiment, the present invention screen, from pawl frog genome intron sequences (containing Cas9 targets Segment) and exon sequence total length be preferably such as SEQUENCE NO.9, SEQUENCE NO.10 or SEQUENCE NO.11 institutes The nucleotide sequence shown.

In this embodiment, the donor vehicle is preferably plasmid vector.

In an embodiment of the present invention, the carrier for not generating frameshift mutation after recombinating further includes fluorescence report Expression casette, the fluorescent reporter gene expression cassette use pancreas promoter.

In this embodiment, the fluorescent reporter gene in the fluorescent reporter gene expression cassette, which is preferably independent of, waits to strike Gene and Cas9 the target fragments expression entered.

In this embodiment, the fluorescent reporter gene in the fluorescent reporter gene expression cassette is preferably GFP report bases Cause.

The third aspect, one kind for carried out in pawl frog genome it is gene site-directed knock in kit, including following (1) or (2)：

(1) guide RNA, Cas9 nucleases and donor vehicle with nuclear localization signal peptide；

(2) it is fertilized to the pawl frog in the fourth of the twelve Earthly Branches and imports the recombinant cloning vector of the expression cassette containing the guide RNA and containing described The recombinant expression carrier and donor vehicle of the encoding gene of Cas9 nucleases with nuclear localization signal peptide, the guide RNA Expression cassette be fertilized in the pawl frog in the fourth of the twelve Earthly Branches and give expression to guide RNA, the table of the Cas9 nucleases with nuclear localization signal peptide encodes Gene is fertilized in the fourth of the twelve Earthly Branches in the pawl frog and gives expression to the Cas9 nucleases with nuclear localization signal peptide,

In (1) or (2), the guide RNA includes and the complementary RNA segments combined of the Cas9 target fragments；Institute Stating donor vehicle includes Cas9 target fragments and gene to be knocked in；Target gene in the pawl frog genome includes Cas9 targets Standard film section.

Preferably, the guide RNA, the Cas9 nucleases with nuclear localization signal peptide and donor vehicle are such as first party Described in face.

Preferably, it is used to carrying out in pawl frog genome the gene site-directed method for knocking in kit using described and includes such as the The gene site-directed method and step knocked in is carried out in pawl frog genome described in one side.

Fourth aspect is knocked in the present invention provides being carried out in pawl frog genome as described in relation to the first aspect is gene site-directed Method or the carrier for not generating frameshift mutation after recombinating as described in second aspect, in pawl frog genome is prepared The gene site-directed application knocked in reagent.

The present invention provides technical solution have the advantages that：

1) present invention realizes gene site-directed insertion in the tropical pawl frog for the first time, and stablizes heredity to the next generation.

2) technical solution provided by the invention without considering genome polymorphism, need to only consider that CRISPR/Cas9 systems are known Polymorphism is not present in other sequence.

3) efficiently.Compared to other reporter genes, the present invention uses independent ela-GFP reporter genes, need to only filter out few Measure G0 generation individuals, you can it is the working strength that research staff is greatly reduced effectively to be built by system genitale passage.

4) it is simple.Method using the present invention, it is only necessary to build gRNA carriers and donor carriers.Donor carriers are without structure Build complicated homology arm.

5) it is widely used.Method using the present invention can be widely applied to the cell lineage tracking of the animals such as the pawl frog, item Part knocks out, and lncRNA is knocked out, and human disease model establishes, and large-scale medicine screening model is established etc..

Description of the drawings

The Technology Roadmap that Fig. 1 is used for the present invention；

By Cas9, gRNA, donor co-injections are in 1 cell stage embryo's animal pole；Gene is destroyed by Cas9/gRNA jointly Group and donor carriers, are recombinated by nonhomologous end repair mechanism, and donor DNA are inserted into genome destroys site Place, achievees the effect that restructuring.

Fig. 2 is intermediate carrier (a) and donor carriers (b, c) structure diagram used in the present invention.

Fig. 3 is the structure diagram of Cas9 expression vectors (a) and gRNA expression vectors (b) used in the present invention；

Cas9 expression vectors include 5 ' and 3 ' two nuclear localization signals (NLS) so that Cas9 can be focused in nucleus, production Raw execution is stronger, and passes through EcoRI and XhoI and be subcloned into pCS2 carriers, passes through the SP6 promoters of upstream Carry out mRNA transcriptions；After prepared by gRNA plasmids, transcribed by the T7 promoters of upstream.

Fig. 4 schemes for microinjection rear solid end frog G0 of the present invention for pancreas GFP+；It is fitted together in various degree for pancreas shown in figure The G0 of ela-GFP is for 42-44 phase tadpoles.

Fig. 5 schemes (a) and PCR primer position (b) and Southern for G0 of the present invention generations with F1 generation GFP+ after wild type crosses Blot probe locations (b) schematic diagram；

A. shown in figure for G0 for pancreas GFP+ into the uniform GFP of F1 generation after the frog and wild type crosses；B. schematic diagram is recombinated, As shown in the figure, carry out PCR amplification to 5 ' connectors after restructuring with primer P1/P2, with primer P3/P4 to 3 ' connectors after restructuring into Row PCR amplification, Southem blot probes difference is as shown in the figure.

Fig. 6 is that ets1 recombinates schematic diagram (a) and F1 generation Southem blot results in present example one；

A. recombinated in the site of ets1 extrons 5 (e5), with endonuclease BamHI (B), SacI (S), and XbaI (X) does Southem blot analyses；B. test to obtain by conventional Southem blot according to theoretical schematic diagram as a result, aobvious Show that except wild type control group is hybridized due to genome polymorphism in 3 ' probe be to cause the DNA of a 4.1kb in addition to, Yu Jun is consistent with notional result, achievees the effect that restructuring.(wt：Wild type, M：DNA marker.)

Fig. 7 is that ets2 recombinates schematic diagram (a) and F1 generation Southem blot results in present example two；

A. recombinated in the site of ets2 exon 3s (e3), with endonuclease ApaI (A), BamHI (B), EcoRI (E), PstI (P) do Southern blot analyses；B. tested according to theoretical schematic diagram by conventional Southern blot It obtains as a result, show that result is consistent with notional result, achieving the effect that restructuring (wt：Wild type, M：DNAmarker.).

Fig. 8 is that tyr recombinates schematic diagram in present example three；

It is recombinated in the site of tyr introne 1s, with endonuclease ApaI (A), BamHI (B), EcoRV (EV), XbaI (X), EcoRI (EI), PstI (P) are Southern blot analyses (e1：Exons 1, e2：Exon 2)；After restructuring Theoretical mRNA is T mRNA.

Fig. 9 is F1 generation RT-PCR and sequencing result after tyr restructuring in present example three；

A. GFP+/PCR+F1 individuals are extracted into RNA is crossed after recombinating, and after RT-PCR, agarose gel electrophoresis structure is shown greatly Small suitable with theoretical value, wherein ODC compares for internal reference, and wt is wild type control.B. after RT-PCR is identified, by PCR product It is cloned into conventional carrier T, carries out sequence verification；As a result as shown in the figure, in exons 1 and exon 2 junction, reached complete Beautiful endogenous shearing.

Figure 10 is F1 generation Southem blot results after tyr restructuring in present example three；

It tests to obtain as a result, showing result and notional result one by conventional Southern blot according to theoretical schematic diagram It causes, achievees the effect that restructuring (wt：Wild type, M：DNAmarker.).

Figure 11 is the destruction efficiency in igsf3-3 ' sites in present example 4；

Single underlined sequences are target sequence, and "-" represents missing base, and small character auxiliary sequence represents insertion base.

Specific embodiment

As described below is the preferred embodiment of the present invention, it is noted that for those skilled in the art For, various improvements and modifications may be made without departing from the principle of the present invention, these improvements and modifications are also considered as Protection scope of the present invention.

Outer without illustrating in the embodiment of the present invention, agents useful for same and consumptive material are commercial goods.

If without specified otherwise, in the embodiment of the present invention：

What the skeleton RNA segments transcribed out for the DNA shown in nucleotide as shown in SEQUENCE NO.1.

Can be such as SEQUENCE NO.2 with the complementary RNA segments combined of the target fragments in the guide RNA (ets1：GGTTCAGAGAATTCAGAGGG)；SEQUENCE NO.3(ets2：GGTCTGGACTCTTACTCTCA)；Or SEQUENCE NO.4(tyr：GGGGTCCCTAACTTCCTCTA DNA transcribes out shown in).Note：Cas9 identifies that genome is By PAM (3 NGG bases), without the base of this 3 NGG on gRNA, but the donor plasmid carrier and genome built On DNA double chain, be respectively provided with the base of this 3 NGG.

The encoding gene nucleotide sequence of the Cas9 nucleases with nuclear localization signal peptide such as SEQUENCE NO.5 institutes Show.

With reference to Fig. 1, the present invention provides following examples, in Fig. 1, there is positive restructuring and reversely restructuring, positive to recombinate Maximum probability, for knocking out lncRNA or doing fixed point transgenosis etc., forward direction restructuring and reversely restructuring are applicable in.

Example 1 carries out gene site-directed insertion in tropical pawl frog ets1 gene extrons 5

One .Cas9 target sites

(sequence is such as the corresponding target sites of ets1-T2 of table 1 in document (Guo et al., 2014) for ets1 target spots Shown in SEQUENCE NO.15, i.e. 5-GGTTCAGAGAATTCAGAGGGCGG-3)

It is prepared by two .Cas9mRNA and gRNA

Cas9mRNA and gRNA is synthesized according to following scheme：

1) prepared by Cas9mRNA

Restriction endonuclease NotI is by 10ug pCS2-3 × FLAG-NLS-SpCas9-NLS (addgene ID：51307；Carrier knot Structure is as shown in Figure 3a) plasmid linearization, prepare Cas9mRNA using SP6 in-vitro transcriptions.

2) prepared by gRNA

A. prepared by carrier

The method of reference literature (Guo et al., 2014) is acted on using the digestion of BbsI, will be such as SEQUENCE NO.15 Shown Cas9 target sites are cloned on skeleton carrier, and skeleton carrier is pUC57-T7-gRNA plasmids (addgene ID： 51306；Carrier structure is as shown in Figure 3b), so as to obtain the gRNA special to ets1.

B.gRNA transcription synthesis

Transcription templates are directly amplified using PCR method, T7RNA transcriptases transcription synthesis gRNA is simultaneously purified.

PCR primer is：S：5-GAAATTAATACGACTCACTATA-3(SEQUENCE NO.16)；

A：5-AAAAAAAGCACCGACTCGGTGCCAC-3(SEQUENCE NO.17).

It is prepared by three .donor

1) PCR amplification

Round pcr is used to expand (template is tropical pawl frog genome) and goes out the genome sequence containing ets1-T2 (819bp), sequence is as shown in SEQUENCE NO.18.

Primer is：ets1-S(XhoI)：gcaCTCGAGGAATCTGCTTGTTCTTCAGGAAC(SEQUENCE NO.19)

ets 1-A(ClaI)：gcaATCGATGCAGTAATGAGATGGTCACGG(SEQUENCE NO.20)

2) prepared by donor plasmids

2-1) with the intermediate carrier pBS-ela-GFP that can screen label in structure-a pawl frog

Intermediate carrier pBS-ela-GFP (carrier structure is as shown in Figure 2 a) contains：Pancreas-specific promoter Elastase promoter, and with GFP reporter genes, which is named as ela-GFP (sequence such as SEQUENCE (including ela promoters, GFP and SV40pA) shown in NO.21, (GenBank in pBS carriers is put by NotI single endonuclease digestions： DQ836146.1)。

The est1 segments obtained by XhoI and ClaI double digestion pBS-ela-GFP and 819bp PCR, and connect.Conversion, extraction Plasmid, after sequence verification, positive plasmid is named as pBS-ets1-ela-GFP.

Four, torrid zones pawl frog microinjections

1) injected sample configures

Total volume is the parenteral solution of 6ul, wherein including 300pg Cas9mRNA, 100pg gRNA, 20pg donor per 2nl Plasmid.

2) embryo prepares

After in vitro fertilization to tropical pawl frog's embryo tire progress conventional manual, in the 3% cysteine hydrochloride aqueous solution of pH7.9 In at the uniform velocity stir 2.5-3min and go to take serous coat.

3) microinjection

Embryo's injection is carried out with conventional picoliters pump PV820.In fertilization fourth of the twelve Earthly Branches animal pole injection before the fertilization fourth of the twelve Earthly Branches is split for the fourth of the twelve Earthly Branches The sample for 2nl is measured, 200 fertilization fourths of the twelve Earthly Branches of per injection, it is that the embryo injected immediately rejects that the fourth of the twelve Earthly Branches, which is split for 2 cell stages,.It repeats Aforesaid operations, injection quantity reach 600.

Five .GFP fluorescent screenings

The embryonic development of the pawl frog carries out embryo's screening by varying strength GFP to the 42-44 phases using pancreas GFP fluorescence⁺Individual is chosen Go out raising (as shown in Figure 4).Probably filter out 60 tadpoles for carrying GFP.

Six, passage identifications

1) fluorescent screening and PCR identifications

After G0 is for GFP+ body maturation, hybridize with wild type individual, obtain F1 generation individual.This example utilizes 7 male raw G0 Hybridize for GFP+ into the frog and wild type into the frog, treat that the 42-44 phases, embryo's sieve is carried out using pancreas GFP fluorescence for F1 generation embryonic development Choosing is (as shown in Figure 5 a).It is right (in primer sequence table 1 as shown in table 1, est1 corresponding P1, P2, P3, P4) with specific primer again GFP+ individuals carry out PCR identifications (as shown in Figure 5 b).The results show that after G0 generations pass on into the frog, there are 3 G0 generation individuals that there is GFP+ Filial generation, wherein having GFP+/PCR+ filial generations with 1 G0 generation individual, which is named as individualIts GFP+/PCR+ In generation, accounts for 46.4% (the results are shown in Table 2) of total GFP+ filial generations.

2) Southern blot are identified

Before the abnormal completion of filial generation tadpole, for GFP+/PCR+ individuals, set according to both ends joint sequencing result Digestion mode and probe sequence (5 ' and 3 ' connector sequencing results are as shown in table 3) are counted, including 1 internal probe and 2 external spies (probe synthetic primer is as shown in table 4, internal probe sequences such as SEQUENCE NO.22, ets1-5 ' probe sequences for pin Such as SEQUENCE NO.23, ets1-3 ' probe sequences are as shown in SEQUENCE NO.24).Then, to different F1 generation individuals into Row Southern blot detections (schematic diagram as shown in Figure 6 a, as a result as shown in Figure 6 b).

The results show thatGFP+/PCR+ filial generations be correct gene knock-in.

Example 2 carries out gene site-directed insertion in tropical pawl frog ets2 gene extrons 3

One .Cas9 target sites

Ets2 target spots for table 1 in document (Guo et a1., 2014) the corresponding target sites of ets2 (sequence such as SEQUENCE Shown in NO.25), i.e. ggtctggact cttactctca tgg.

2nd, prepared by Cas9mRNA and gRNA

The preparation of 1.Cas9mRNA, referring to embodiment 1

The preparation of 2.gRNA, referring to embodiment 1

A. prepared by carrier

The method of reference literature (Guo et al., 2014) is acted on using the digestion of BbsI, will be such as SEQUENCE NO.25 Shown Cas9 target sites are cloned on skeleton carrier, and skeleton carrier is pUC57-T7-gRNA plasmids (carrier structure such as Fig. 3 b institutes Show), so as to obtain the gRNA special to ets2.

B.gRNA transcription synthesis, referring to embodiment 1

It is prepared by three .donor

1) PCR amplification

Go out the genome sequence (611bp) containing ets2 target sequences using PCR amplification (template is tropical pawl frog genome), Sequence is as shown in SEQUENCE NO.26.

Primer is：ets2-S(XhoI)：gcaCTCGAGCCAAATTAGAAGGCTTCCATGTAG(SEQUENCE NO.27)

ets2-A(ClaI)：gcaATCGATCAATATTAACAGAGTTGGCACCG(SEQUENCE NO.28)

2) prepared by donor plasmids

The est2 segments obtained by XhoI and ClaI double digestion pBS-ela-GFP and 611bp PCR, and connect.Conversion, extraction Plasmid, spare after sequence verification, positive plasmid is named as pBS-ets2-ela-GFP.

Four, torrid zones pawl frog microinjections

With example one, the gRNA amounts in every 2nl are adjusted to 50pg.

Five .GFP fluorescent screenings

With example one.

Six, passage identifications

1) fluorescent screening and PCR identifications

Method is with example one, and joint PCR primer sequence is as shown in table 1, and 5 ' and 3 ' connector sequencing results are as shown in table 3. The results show that after this example is passed on by 9 (7 heros 2 are female) G0 generations into the frog, there are 5 G0 generation individuals that there is GFP+ filial generations, wherein having 2 G0 generation individuals have GFP+/PCR+ filial generations, this two G0 are named as individualGFP+/ PCR+ filial generations account for the 10.3% of total GFP+ filial generations；GFP+/PCR+ filial generations account for 100% (result such as table 2 of total GFP+ filial generations It is shown).

2) Southern blot are identified

Before the abnormal completion of filial generation tadpole, for GFP+/PCR+ individuals, set according to both ends joint sequencing result Digestion mode and probe sequence are counted, including 1 internal probe (with example one) and 2 external probe (probe synthetic primer such as tables Shown in 4, ets2-5 ' probe sequences are as shown in SEQUENCE NO.29, ets2-3 ' probe sequences such as SEQUENCE NO.30 institutes Show).Then, Southern blot detections are carried out to different F1 generations individual (schematic diagram as shown in Figure 7a, as a result such as Fig. 7 b institutes Show).

The results show thatGFP+/PCR+ filial generations be correct gene knock-in.

Example 3 carries out the gene site-directed effect be inserted into and reach not frameshit at tropical pawl frog tyrosinase gene introns 1 Fruit

It is prepared by 1.Cas9mRNA and gRNA

1) Cas9mRNA synthetic methods are the same as embodiment 1

2) preparation of gRNA

Target site, from exon 2 about 600bp, is named as tyr-int1 in introne 1.

Target site identification sequence is 5-GGGGTCCCTAACTTCCTCTATGG-3 (SEQUENCE NO.31).

Two annealing single stranded sequences are as follows：

tyr-int1-S：5-TAGGGGTCCCTAACTTCCTCTA-3(SEQUENCE NO.32)

tyr-int1-A：5-AAACTAGAGGAAGTTAGGGACC-3(SEQUENCE NO.33)

GRNA synthetic methods are the same as example one.

It is prepared by 2.donor

1) PCR amplification

Go out the introne containing tyr-int1 target spots using PCR amplification (template is tropical pawl frog genome) and downstream is adjacent Extron partial sequence, common 906bp is named as tyr-int1-exon2 (sequence is as shown in SEQUENCE NO.34).

Primer is：tyr-S(SalI)：gcaGTCGACGTGGACTCAGGCATTCTAAG(SEQUENCE NO.35)

tyr-A(EcoRI)：gcaGAATTCAAAGTTGGCCGACCGATCCA(SEQUENCE NO.36)

2) prepared by donor plasmids

SalI and EcoRI double digestions are carried out to pBS and 906bp PCR fragments, be inserted into pBS carriers SalI and EcoRI Point.After sequence verification, correct carrier is named as pBS-tyr-int1-exon2.

It after with NotI, pBS-tyr-int1-exon2 is digested, is connected with NotI-ela-GFP-NotI, by 5-NotI- After ela-GFP-NotI-3 sequences are cloned into tyr-int1-exon2 sequences.After sequence verification, correct carrier is named as pBS-tyr-int1-exon2-ela-GFP。

3. tropical pawl frog microinjection

With example one, the gRNA amounts in every 2nl are adjusted to 50pg.

4.GFP fluorescent screenings

With example one.

5. passage identification

1) fluorescent screening and PCR identifications

Method is with example one, and joint PCR primer sequence is as shown in table 1, and 5 ' and 3 ' connector sequencing results are as shown in table 3. The results show that after this example is passed on by 2 male G0 generations into the frog, there is 1 G0 there are GFP+ filial generations for individual, and have GFP+/PCR + filial generation, this G0 are named as individualGFP+/PCR+ filial generations account for total GFP+ filial generations 30% (the result is shown in Shown in table 2).

2)RT-PCR

RT-PCR sense primers are on First Exon, the ela- after exon 2 of the anti-sense primer after genetic manipulation In GFP sequences, upstream and downstream primer crosses over introne 1 (1981bp).Whether primer identification in this way reaches perfect endogenous Shearing generates the effect of not frameshit (schematic diagram is as shown in Figure 8).

Primer amplification theory size is 557bp, is named as tyr-T, for sequence as shown in sequence table 20, primer sequence is as follows：

S：5-ACTATGCCTCCCGTGATGTCTTC-3(SEQUENCE NO.37)；

A：5-CACTCAGTTAACCCAAGTCGACC-3(SEQUENCE NO.38).

PCR is the results show that in this exampleGFP+/PCR+ filial generations RT-PCR results be the positive (result such as Fig. 9 a It is shown)；Sequencing result shows that the gene site-directed modification of the reorganization operation relies on endogenous shearing mechanism, has reached and has perfectly repaiied It adorns (result is as shown in figure 9b).Wherein, it is primer at underscore, to being exon1 between grey arrow, grey arrow arrives underscore For exon2 between hollow arrow, it is ela-GFP that hollow arrow, which is arrived between small black arrow,.

3) Southem blot are identified

Before the abnormal completion of filial generation tadpole, for GFP+/PCR+ individuals, set according to both ends joint sequencing result Digestion mode and probe sequence are counted, including 1 internal probe (with example one) and 2 external probe (probe synthetic primer such as tables Shown in 4, tyr-5 ' probe sequences are as shown in sequence table 21, and tyr-3 ' probe sequences are as shown in sequence table 22).Then, to not Southem blot detections are carried out with F1 generation individual (schematic diagram is as shown in figure 8, the results are shown in Figure 10).

The results show thatGFP+/PCR+ filial generations be perfect genetic modification.

Embodiment 4 carries out gene site-directed insertion at tropical pawl frog igsf3 gene extrons 5 and achievees the effect that not frameshit

It is prepared by 1.Cas9mRNA and gRNA

1) Cas9mRNA synthetic methods are the same as embodiment 1

2) preparation of gRNA

Target site is named as igsf3-3 ' in extron 5.

Target site identification sequence is 5-GGGCATGAAGTTTATCCTGAAGG-3 (SEQUENCE NO.39).

Two annealing single stranded sequences are as follows：

igsf3-S：5-TAGGGCATGAAGTTTATCCTGA-3(SEQUENCE NO.40)

igsf3-A：5-AAACTCAGGATAAACTTCATGC-3(SEQUENCE NO.41)

GRNA synthetic methods are the same as embodiment 1.

2. gene disruption Efficiency testing

Each embryo is in 1 cell stage in animal pole injection 2nl (300pg Cas9mRNA, 50pg gRNA).Inject 50 embryos Tire.After Embryo Culture is stayed overnight, genome is extracted after randomly choosing 5 embryo's mixing, with the primer at target practice site both ends By the fragment amplification (amplimer S：5-GCACCTGTGAAGCAAGTGAAAGA-3(SEQUENCE NO.42)；

A：5-AAGAAGTGAGTGTGTAAGGGGATATG-3 (SEQUENCE NO.43)), which is connected into carrier T Afterwards, the sequencing of 10 single bacterium colonies is selected at random, and the destruction efficiency in the results show site is 30% (see Figure 11).In figure, single underscore Sequence is target sequence, and "-" represents missing base, and small character auxiliary sequence represents insertion base.

It is prepared by 3.donor

1) PCR amplification

Gone out using PCR amplification and be named as igsf3-3 ' UTR containing the common 305bp of igsf3-3 ' target spot extron partial sequences (sequence such as SEQUENCE NO.44.

Primer is：

igsf3-3’(SalI)：5-gcaGTCGACCCCTGACGTATTATCTCATTGCAG-3(SEQUENCE NO.45)

igsf3-3’(SpeI)：5-gcaACTAGTGGGGAATGGGGAGGATATACAC-3(SEQUENCE NO.46)

2) prepared by donor plasmids

The progress digestion of pBS with 305bp igsf3-3 ' PCR fragments is connected by SalI/SpeI double digestions, is named as pBS-igsf3-3’；By SpeI/ClaI by IRES (internal ribosome entry site sequence (Internal ribosome Entry site, IRES (GenBank：KC710231.1)) digestion is carried out with pBS-igsf3-3 ' to connect, be named as pBS- igsf3-3’-IRES；By ClaI/EcoRI by cre (addgene ID：11918) and pBS-igsf3-3 '-IRES carry out enzyme Connection is cut, is named as pBS-igsf3-3 '-IRES-cre；By EcoRI/NotI by SV40pA (GenBank：DQ649431.1) Digestion is carried out with pBS-igsf3-3 ' IRES-cre to connect, and is named as pBS-igsf3-3 '-IRES-cre-pA.

After with NotI, pBS-igsf3-3 '-IRES-cre-pA are digested, connect with the NotI-ela-GFP-NotI of embodiment 1 It connects.After sequence verification, correct carrier is named as pBS-igsf3-3 '-IRES-cre-pA-ela-GFP.

The embodiment of the present invention use IRES sequences, be the target site due to igsf3 near terminator, use IRES sequences The expression efficiency of subsequent tag can be increased.

3. tropical pawl frog microinjection

With embodiment 1, the gRNA amounts in every 2nl are adjusted to 50pg.

4.GFP fluorescent screenings

With embodiment 1.

5.G0 is identified for embryo PCR

The results show that detect positive insertion result not over PCR.

It is attached：

15 ' and 3 ' joint PCR primer table of table

The gene site-directed insertion passage statistical forms of table 2ets1, ets2, tyr

The gene site-directed insertion F1 generation joint sequencing statistical forms of table 3ets1, ets2, tyr

Table 4ets1, ets2, tyr gene southem blot probe primer tables

Bibliography

Auer TO, et al.Highly efficient CRISPR/Cas9-mediated knock-in in Zebrafish by homology-independent DNA repair.GenomeRes, 2014,24 (1), 142-153 Page

Blitz IL, et al.Biallelic genome modification in F₀ Xenopus tropicalis Embryos using the CRISPR/Cas system.Genesis, 2013,51 (12), the 827-834 pages

Guo X, et al.Efficient RNA/Cas9-mediated genome editing in Xenopus Tropicalis.Development, 2014,141 (3), the 707-714 pages

Hellsten U, et al.The genome of the Western clawed frog Xenopus Tropicalis.Science, 2010,328 (5978), the 633-636 pages

Ishibashi S, Cliffe R , ＆Amaya E.Highly efficient bi-allelic mutation Rates using TALENs in Xenopus tropicalis.Biol Open, 2012,1 (12), the 1273-1276 pages

Jasin M.Genetic manipulation of genomes with rare-cutting Endonucleases.Trends Genet, 1996,12 (6), the 224-228 pages

Lei Y, et al.Efficient targeted gene disruption in Xenopus embryos using engineered transcription activator-like effector nucleases(TALENs) .ProcNatlAcadSci USA, 2012,109 (43), the 17484-17489 pages

Nakade S, et al.Microhomology-mediated end-joining-dependent integration of donor DNA in cells and animals using TALENs and CRISPR/ Cas9.Nat Commun, 2014,20 (5), the of page 5560

Nakayama T, et al.Simple and efficient CRISPR/Cas9-mediated targeted Mutagenesis in Xenopus tropicalis.Genesis, 2013,51 (12), the 835-843 pages

Thomas KR, Capecchi MR.Site-directed mutagenesis by gene targeting in Mouse embryo-derived stem cells.Cell, 1987,51 (3), the 503-512 pages

Young JJ, et al.Efficient targeted gene disruption in the soma and germ line of the frog Xenopus tropicalis using engineered zinc-finger Nucleases.Proc Natl Acad Sci USA, 2011,108 (17), 7052-7057 pages of

The foregoing is merely illustrative of the preferred embodiments of the present invention, is not intended to limit the invention, all essences in the present invention All any modification, equivalent and improvement made within refreshing and principle etc., should all be included in the protection scope of the present invention.

Claims (9)

1. It is right in the pawl frog using CRISPR/Cas systems 1. a kind of carry out the gene site-directed method knocked in pawl frog genome Target gene is transformed, which includes guide RNA and Cas9 nuclease, which is characterized in that the method includes following step Suddenly:1) make to contain guide RNA, Cas9 nuclease and donor vehicle in pawl frog fertilized eggs, 2) and then in guide RNA and Cas9 core Under sour enzyme collective effect, the double-strand Cas9 target fragments in pawl frog genome in target gene and on donor vehicle are sheared, 3) again by itself DNA repair function of pawl frog cell, that realizes in pawl frog genome gene site-directed knocks in；

   Wherein, the guide RNA includes and the complementary RNA segments combined of the Cas9 target fragments；The donor vehicle includes Cas9 target fragments and gene to be knocked in；Target gene in the pawl frog genome includes Cas9 target fragments；

   It is such as SEQUENCE NO.2, SEQUENCE with the complementary RNA segments combined of the target fragments in the guide RNA What DNA shown in NO.3 or SEQUENCE NO.4 transcribed out；

   In the step (1), the donor vehicle further includes the intron sequences and exon sequence of pawl frog genome, the confession In body carrier, the Cas9 target fragments are located in the intron sequences, the intron sequences, exon sequence and wait to strike Enter gene to be sequentially connected；

   The intron sequences and exon sequence total length be such as SEQUENCE NO.9, SEQUENCE NO.10 or Nucleotide sequence shown in SEQUENCE NO.11.
2. 2. the gene site-directed method knocked in is carried out in pawl frog genome as described in claim 1, which is characterized in that described double A chain in chain Cas9 target fragments has such as lower structure:Any one of 5 '-Nx-NGG-3 ', N expression A, G, C and T, 18 ≤X≤22。
3. 3. the gene site-directed method knocked in is carried out in pawl frog genome as described in claim 1, which is characterized in that the step Suddenly it is described to make the method containing guide RNA, Cas9 nuclease and donor vehicle in pawl frog fertilized eggs be in (1):To the pawl frog by Guide RNA, Cas9 nucleases and donor vehicle with nuclear localization signal peptide described in direct injection in smart ovum.
4. 4. the gene site-directed method knocked in is carried out in pawl frog genome as described in claim 1, which is characterized in that the step Suddenly it is described to make the method containing guide RNA, Cas9 nuclease and donor vehicle in pawl frog fertilized eggs be in (1):To the pawl frog by The recombinant cloning vector of the expression cassette containing the guide RNA is imported in smart ovum and containing described with nuclear localization signal peptide The recombinant expression carrier and donor vehicle of the encoding gene of Cas9 nucleases, the expression cassette of the guide RNA are fertilized in the pawl frog Guide RNA is given expression in ovum, the table encoding gene of the Cas9 nucleases with nuclear localization signal peptide is in pawl frog fertilized eggs Give expression to the Cas9 nucleases with nuclear localization signal peptide.
5. 5. the gene site-directed method knocked in is carried out in pawl frog genome as described in claim 1, which is characterized in that the step Suddenly

   (1) in, when being injected into pawl frog fertilized eggs, using microinjection, and before the non-spilting of an egg of fertilized eggs, it is injected in Fertilized eggs animal pole region.
6. 6. described in claim 1 carry out the gene site-directed method knocked in pawl frog genome, which is characterized in that the step (1) in, the donor vehicle further includes fluorescent reporter gene expression cassette, and the fluorescent reporter gene expression cassette is started using pancreas Son.
7. 7. a kind of carrier for not generating frameshift mutation after recombinating, which is characterized in that the carrier includes Cas9 target pieces Section and gene to be knocked in, the carrier further include the intron sequences and exon sequence of pawl frog genome, wherein, it is described Cas9 target fragments are located in the intron sequences, and the intron sequences, exon sequence and gene to be knocked in connect successively It connects；The intron sequences and exon sequence total length are such as SEQUENCE NO.9, SEQUENCE NO.10 or SEQUENCE Nucleotide sequence shown in NO.11.
8. It is 8. a kind of for carrying out the gene site-directed kit knocked in pawl frog genome, which is characterized in that including following (1) or (2)：

   (1) guide RNA, Cas9 nucleases and donor vehicle with nuclear localization signal peptide；

   (2) recombinant cloning vector of the expression cassette containing the guide RNA is imported into pawl frog fertilized eggs and is carried containing described The recombinant expression carrier and donor vehicle of the encoding gene of the Cas9 nucleases of nuclear localization signal peptide, the table of the guide RNA Guide RNA, the table encoding gene of the Cas9 nucleases with nuclear localization signal peptide are given expression in pawl frog fertilized eggs up to box The Cas9 nucleases with nuclear localization signal peptide are given expression in pawl frog fertilized eggs,

   In (1) or (2), the guide RNA includes and the complementary RNA segments combined of the Cas9 target fragments；The confession Body carrier includes Cas9 target fragments and gene to be knocked in；Target gene in the pawl frog genome includes Cas9 target pieces Section；

   It is such as SEQUENCE NO.2, SEQUENCE with the complementary RNA segments combined of the target fragments in the guide RNA What DNA shown in NO.3 or SEQUENCE NO.4 transcribed out；

   The donor vehicle further includes the intron sequences and exon sequence of pawl frog genome, described in the donor vehicle Cas9 target fragments are located in the intron sequences, and the intron sequences, exon sequence and gene to be knocked in connect successively It connects；

   The intron sequences and exon sequence total length be such as SEQUENCE NO.9, SEQUENCE NO.10 or Nucleotide sequence shown in SEQUENCE NO.11.
9. 9. the gene site-directed method knocked in is carried out in pawl frog genome as described in claim 1 or such as claim 7 institute That states does not generate the carrier of frameshift mutation after recombinating, and gene site-directed in pawl frog genome is prepared is knocked in reagent Using.