CN107881200A - A kind of rapid screening method applied to model animal zebra fish transgenosis - Google Patents

Abstract

The present invention provides a kind of rapid screening method applied to model animal zebra fish transgenosis, comprises the following steps：1) expression vector containing strong promoter, target gene and label gene is built；2) the specific target spot for target gene is designed, obtains targeting SgRNA sequences；3) homologous recombination vector is built on the basis of specific target spot；4) mRNA for synthesizing homologous recombination vector fragment, SgRNA sequences in-vitro transcription, and the nCas9 mRNA of in-vitro transcription synthesis, three's co-injection zebra fish fertilized egg；5) zebra fish of target gene function missing is first filtered out；Programmed screening is carried out by label gene again, obtains label gene expression individual, so as to obtain expression destination gene expression individual.This method can screen to early stage zebra juvenile fish, reach and quickly establish transgenic models purpose.

Description

A kind of rapid screening method applied to model animal zebra fish transgenosis

Technical field

The present invention relates to genetic engineering field, and in particular to a kind of rapid screening method applied to zebra fish transgenosis.

Background technology

In gene functional research, the missing of target gene and overexpression research are main Research approach.At present, zebra The method of fish gene expression mainly has three kinds：A kind of is the mRNA of external synthesis target gene, by the approach of microinjection, is led Enter to reach into zebrafish embryo expression purpose, but because the swift nature of zebra fish development causes mRNA inequalities in cell Even distribution, so as to cause the inaccuracy of expression pattern, while mRNA is easily degraded in zebra fish body, can only achieve and instantaneously crosses table The effect reached, it is impossible to obtain the spatial and temporal expression profile for being overexpressed gene.It is for second by building expression vector, utilization is non- Vector integration is entered genome by the mode of homologous end connection, and this method efficiency is low, and time-consuming, while needs a large amount of zebra fish Screening, this method are the conventional strategies of cell, are fallen flat for zebra fish.The third is, by transposon-mediated Transgenosis, i.e., by building transposon vector, target gene is transferred in host, it is such a to reach the purpose of transgenosis Method, efficiency is higher, but due to the radom insertion of transposons, often causes unexpected mutation, while need substantial amounts of screening Work.

DNA double-strand missing (Double Strand Break, DSB) is produced with toolenzyme, there is provided new clpp gene Remove, gene knock-in and various genome rearrangements, such as the approach of chromosome deficiency, reversion, repetition and transposition.Two of double-strand missing It is main to repair approach：Non-homologous end joining (Non-homologous End Joining, NHEJ) and homologous recombination (Homologous Recombination, HR) is widely used.Non-homologous end joining, the activity with other reparation approach Being limited to moment difference can occur in the whole cell cycle, be a kind of inaccurate repair mechanism independent of masterplate.Its By lacking, inverting, repeating, transposition or radom insertion cause frameshift mutation in open reading frame, gene knockout and dye Colour solid is reset usually using this mechanism.Homologous recombination, it is that one kind is deposited in double-strand indentation, there during late S phases and G2 occurs In the accurate reparation approach of the recovery template of the long homologous sequence of genomic DNA.HR recovery template is sister's dyeing in vivo Monomer, when external source targeting vector use indentation, there large fragment homologous sequence, gene knock-in can be made by homologous recombination.Although The gene knock-in of homologous recombination mediation is reported in several cells and organism, such as human pluripotent stem cells and mouse, But there are still progressive space in gene knock-in, particularly improve genetic recombination efficiency and in various animal models and In the applicability of cell.

At present, develop rapidly micro- homologous end engagement (Microhomology-mediated end joining, MMEJ) mechanism, it has been found that substitute traditional double-strand missing reparation approach, the clpp gene for being used for toolenzyme mediation that can stablize Except experiment, such as CRISPR/CAS systematic researches.Homologous recombination sluggish M early stages and S phases occur for micro- homologous end engagement, An opportunity independently repaired is provided for the mechanism, is found in the equipotential of the base deletion of simple express nucleic acid enzyme induction earliest In gene, often there is the generation of MMEJ reparations, show that the approach can be used for the breach reparation for repairing double-strand missing.Further It is different that research, which shows that NHEJ, HR and MMEJ lack remediation efficiency in different nucleus animal model double center chains, and MMEJ exists What is showed in mammalian cell and model animal is more efficient.In zebra fish is studied, CRISPR/CAS9 systems are in recent years A kind of conventional means for gene editing.MMEJ development simultaneously so that CRISPR/Cas9 fixed point editors are more efficient. The present invention combines CRISPR/Cas9 fixed points editor and MMEJ is efficiently repaired, and target gene and fluorogene fixed point are knocked in into pigment Gene loci, realize the quick screening to transgenic zebrafish.

The content of the invention

The purpose of the present invention is to establish a kind of method quickly screened applied to zebra fish transgenosis, and this method is a kind of CRISPR/Cas9 mediations, integrated in zebra fish pigment gene and be overexpressed target gene and high frequency zone can be carried out obtain Obtain target gene and be overexpressed method.Its cardinal principle is：CRISPR/Cas9 technologies are applied first, in zebra fish pigment gene Targeting shearing forms double-strand break, induces the generation of the recombination event of upper frequency, the efficiency of micro- homologous recombination is greatly improved, together When for pigment gene knockout can influence tyrosinase synthesis cause zebra fish B16 cell obstacle as selection markers One of；Secondly, structure is directed to the homologous recombination vector of pigment gene target sequence, using point of contact both sides each 40bp of upstream and downstream as same Source sequence, while add eGFP reporter genes and the target gene CDs fragments being overexpressed；Finally, under CRISPR/Cas9 mediations The double-strand indentation, there of formation, MMEJ repairs are carried out, can efficiently be inserted on pigment gene and contain the same of reporter gene Source recombinant fragment sequence, and then use pigment gene and GFP reporter gene Double Selections.By three above advantage, realize While target gene efficiently pinpoints insertion, while the quick screening of transgenic animals can be carried out.

To achieve these goals, technical scheme is as follows：

A kind of method of zebra fish gene overexpression, comprises the following steps：

1) expression vector containing strong promoter, target gene and label gene is built；

2) the specific target spot for target gene is designed, screening obtains the optimal SgRNA of targeting knock out；

3) on the basis of the specific target spot that 2) target gene obtains, homology arm is designed, and gene expression carries in 1) Body both wings add homology arm, are built into homologous recombination vector；

4) zebra fish microinjection：Target gene, label gene and target gene homology will be contained obtained in step 3) SgRNA obtained in the homologous recombination vector fragment and step 2) of arm, and the nCas9-mRNA that in-vitro transcription obtains, common note Penetrate zebra fish fertilized egg；

5) zebra fish of target gene function missing is filtered out in 2dpf (days post fertilization) first, this It is due to the result of step 2) target gene targeting mutation；Programmed screening is carried out by label gene again on this basis, obtained Label gene expression individual is obtained, so as to obtain expression destination gene expression individual.

Specifically, when label gene selects GFP, and target gene selects pigment Tyrosinase genes, screening technique is as follows：

1) expression vector containing strong promoter, the gene C Ds sequences that need to be overexpressed and label gene GFP is built；

2) the specific target spot for pigment Tyrosinase genes is designed, screening obtains efficiency highest SgRNA sequences Row, and expression vector both wings homology arm is designed, it is built into overexpression homologous recombination vector；

3) zebra fish microinjection：Homologous recombination vector piece segment DNA obtained in step 2), in-vitro transcription are synthesized SgRNA and nCas9-mRNA, three's co-injection zebra fish fertilized egg；

4) zebra fish of melanin degeneration is filtered out in 2dpf first, is carried out second by GFP genes on this basis Screening, GFP expression zebra fish individuals are obtained, so as to obtain the individual for being transferred to target gene, pass through the strong promoter of carrier carrying It is overexpressed the gene being transferred to.

The present invention also provides a kind of homologous recombination vector applied to zebra fish transgenosis, and the homologous recombination vector includes Insert Fragment, described Insert Fragment include strong promoter (Promoter), multiple cloning sites (Multiple cloning Site, MCS), internal ribosome entry site (Internal ribosome entry site, IRES), reporter gene The homology arm designed at (Report gene), transcription stop signals (Termination signal) fragment, target gene target spot, Wherein, the promoter is located at multiple cloning sites and reporter gene upstream, and the termination signal is located at reporter gene downstream.

Alternatively, the described preferred fluorescent reporter gene of label gene；Such as eGFP genes (Enhanced Green Fluorescent Protein), alternatively, described transcription is whole for any fluorescence protein gene such as GFP, RFP, YFP, mCherry Stop signal is SV40polyA (Simian vacuolating virus 40polyA), its nucleotides sequence is classified as SEQ ID NO.3, other termination signals can also be such as β-globin Teminator or BGH polyA (Bovine growth Hormone polyA), its nucleotide sequence is respectively SEQ ID NO.4 and SEQ ID NO.5.

Preferably, described target gene can pay the utmost attention to pigment gene, including but not limited to using Tyrosinase genes It is as follows as target gene, its advantage：1) it is the gene of tyrosinase encoding known to current zebra fish；2) its effect master Being embodied in influences melanin generation, and phenotype does not interfere with the development of embryo's individual；3) a reporter gene is used as, in zebra fish Embryonic development early stage 24hpf-120hpf, has and its obvious albefaction phenotype, is easy to screen.

Preferably, the Insert Fragment of described homologous recombination vector group includes 40bp homology arm, uses MMEJ Mode carries out micro- homologous recombination, more efficient.The homology arm be located at zebra fish Tyrosinase genes (Danio rerio, Gene ID:30207)。

The beneficial effect that technical scheme reaches is：

1) this method uses CRISPR/Cas9 System-mediateds, and objective gene sequence is targetted and imported in pigment gene, is passed through The expression of zebra fish phenotype pigment degeneration and eGFP genes carries out Double Selection.With the existing transgenosis side applied on zebra fish Method is compared, and the method provided by the present invention targeting is accurate, screening efficiency is high, speed is fast, gene expression positive effect, and will not introduce Influence the factor of embryonic development, it is ensured that it is more accurate that gene function is overexpressed.Meanwhile body early embryo detection is more easily by micro- Mirror carries out live body tracking and monitoring.MicroRNA, lncRNA etc. research are applicable to by building new expression vector.

2) nCas9 used in this method is that the Cas9 expression that codon optimization was carried out for species zebra fish carries Body, so as to improve targeting cutting efficiency, then by efficient in-vitro transcription kit (Life, AM1348), in-vitro transcription conjunction Into nCas9-mRNA, and SgRNA in-vitro transcriptions product and homologous recombination DNA fragmentation, three's co-injection zebra fish fertilized egg, with MRNA form injection substitutes vector injection, has met the fast characteristic of Zebrafish Embryo, has met zebra fish microinjection Requirement.

3) can be high by the specificity of CRISPR/Cas9 system target gene group DNA sequence dnas, method of the present invention Effect ground, which targets homologous recombination fragment, imports target gene；Opened because reporter gene and overexpression target gene share an identical Mover, it can ensure that two genes co-express in genome；Meanwhile MMEJ homologous recombination mode also further increase it is whole Close the specificity and directionality of fragment.

4) method of the present invention, suitable for the gene overexpression using zebra fish as the vertebrate animal model of representative, enter And study gene function.The present invention provides the homologous recombination vector comprising expression target gene and eGFP genes, and professional can With the knockout site with reference to this method and homology arm, can also at Tyrosinase genes other target spots the new 40bp of design it is same Source arm；Or in other pigment genes such as Kit, Gol etc., design new target spot；Either set again from other screening-genes Target spot is counted, is applied to different plant species transgenosis purpose to reach, effective ways is provided for gene functional research.

Brief description of the drawings

Fig. 1 is transgene carrier structure schematic diagram.It is building process rough schematic in figure, expands PCR primer respectively, even PGEM-T Vector are inserted after connecing and obtain transgene carrier framework pZF-OP-Vector.

Fig. 2 is Carp beta actin promoter promoters and IRES-eGFP-PA amplification electrophoretograms.Scheme A: 40bp homology arm and restriction enzyme site is added in promoter upstream, and final size is 1215bp, and M represents DL5000marker；Scheme B, In polyA downstreams addition 40bp homology arm and restriction enzyme site, final size is 1639bp, and M represents DL2000marker.

Fig. 3 is Nsun2-CDs areas amplification electrophoretogram.The final sizes of Nsun2-CDs are 2133bp, and M is represented DL5000marker。

Fig. 4 is the schematic diagram of Nsun2 expression vectors.Amplification Nsun2-CDs is inserted into the formation of over-express vector framework Nsun2 expression vectors.

Fig. 5 is the micro- homologous recombination mechanism of action for targetting Tyrosinase genes.The target spot of design is directed to Tyrosinase- CDs1 areas, the micro- homology arms of MMEJ of 40bp length are separately designed in the upstream and downstream of target spot.

Fig. 6 is nCas9 transcription result figures.Wherein 1 represents nCas9-mRNA purified products, and 2 represent the template of in-vitro transcription, M represents RNA HR marker.

Fig. 7 is albefaction phenotype after zebra fish Tyrosinase is knocked out.Left side A is after zebra fish knocks out Tyrosinase genes Phenotype, B is the fragment that 332bp at site is expanded after knocking out, and 208bp and 124bp fragment is obtained by T7E1 digestions, card Bright knockout is successful, and M represents DL500marker.

Fig. 8 is GFP expression figures after transgene carrier insertion zebra fish.Light field figure A1 and B1 are contrasted, can clearly be seen Disappear to pigment, contrast fluorescence picture A2 and B2, it can be seen that the GFP expression being transferred to.

Fig. 9 is Nsun2 expression insertion proof diagrams.Scheme A and represent design of primers ideograph；Scheme B and represent electrophoretogram：1 table in figure It is shown as negative control group, 2 represent do not have the control group of fluorescence after injection in figure, and 3 are expressed as Nsun2 expression and have the sample of fluorescence in figure This, 732bp and 1554bp purpose band is obtained with Nsun2-test1/Nsun2-test2 detections respectively, and internal reference Actin shows CDNA is effective, and M represents DL5000marker.

Figure 10 is that Nsun2 is overexpressed design sketch.As figure relative to control group, Nsun2 transgenosis groups has been overexpressed 12.25 Times.

Figure 11 is the sg-RNA designs for targetting Tyrosinase genes.Designed as shown in the figure for Tyrosinase-CDs1 4 SgRNA.

Figure 12 is the efficiency comparative for targetting Tyrosinase genes.Figure A is part representative after Tyrosinase gene knockouts Picture；Figure B is zebra fish T7E1 testing result comparison diagrams after injection, and the efficiency in figure is calculated by gray value.

Embodiment

Before the specific embodiment of the invention is further described, it should be appreciated that protection scope of the present invention is not limited to down State specific specific embodiment；It is also understood that the term used in the embodiment of the present invention is specific specific in order to describe Embodiment, the protection domain being not intended to be limiting of the invention；In description of the invention and claims, in order to illustrate Technical scheme and technical purpose.Below in conjunction with the accompanying drawings and embodiment is described further to the present invention. Method in following embodiments, it is conventional method unless otherwise instructed.

Embodiment 1：

The present embodiment 1 provides the method that targeting is transferred to zebra fish Nsun2 genes that how to apply the inventive method to, together When pass through strong promoter be overexpressed zebra fish Nsun2 genes.Build the transgenosis homologous recombination vector containing eGFP reporter genes PZF-Nsun2-OP-Vector, the double-strand breach mediated using CRISPR/Cas9, it is inserted by MMEJ methods First exon region of Tyrosinase genes, express the Nsun2 being transferred to simultaneously in the expression for terminating Tyrosinase genes Gene, finally carry out high frequency zone acquisition using double labelling and be transferred to Nsun2 genes, while be overexpressed the zebra fish of the gene Body.

It is different according to transgene, the CDs areas of the gene can be cloned by expanding, is building up to reach in the carrier and turns base Because of purpose, if what is be transferred to is the endogenous gene of host, the purpose of overexpression is reached while transgenosis, design is directed to The pigment gene targeting sgRNA and corresponding micro- homology arm of different plant species, so as to which this method to be applied to the gene of different plant species It is overexpressed.

The present embodiment 1 specifically includes following steps：

1. structure contains the transgene carrier pZF-Nsun2-OP-Vector for including screening label：

1.1 amplification Carp beta actin promoter promoters：

With pGBT-RP2.1 (addgene, Plasmid#31828) for template, high-fidelity enzyme (Phanta HS are used Super-Fidelity DNA Polymerase, Vazyme) amplification 1136bp Carp beta actin promoter bases Cause.Designing amplimer is：Bactin-F and Bactin-R, wherein Bactin-F upstream plus 40bp homology arm LHR and Restriction enzyme site NcoI.More restriction enzyme site XhoI-BglII-AfeI-BmtI-NheI, amplified production are added on anti-sense primer 1215bp。

50 μ L reaction systems include：10ng pGBT-RP2.1 plasmids are as template, 1 μ L (10 μM) Bactin-F primers, and 1 μ L (10 μM) Bactin-R primers, 1 μ L DNA Polymerase, 10 μ L 5x SF Buffer, 1 μ L (10 μM) dNTP Mix and 32μL ddH₂O.Its reaction condition is：95℃5min；95 DEG C of 10s, 56 DEG C of 30s, 72 DEG C of 1min30s, 35x circulation；72℃ 10min, 4 DEG C of maintenances, shown in amplification (such as accompanying drawing 2A).

The primer Bactin-F and Bactin-R nucleotides and restriction enzyme site sequence (capitalization) are as follows, wherein The homology arm small letter of Bactin-F upstream addition, more restriction enzyme sites have underscore mark：

Bactin-F:5’-CCATGG agctcgtctctccagcagttcccccgagtctgcacctccc GCTTTTAGACCTTCTTACTT-3’(SEQ ID NO.6)

Bactin-R:5’-CTCGAGATCTAGCGCTAGCGTCTAGA GCTGAGACGCTGGGCGCGCTC-3’(SEQ ID NO.7)。

1.2 expression vector framework pZF-OP-Vector structure：

IRES-eGFP-PA is expanded from pIRES2-EGFP (Clontech, PT3267-5) carrier with specific primer, 1639bp, then it is attached with above-mentioned Carp beta actin promoter fragments, 16 DEG C of connection 16h.With NcoI and SpeI digestion pGEM-Teasy vector, above-mentioned connection product is inserted, and forms over-express vector framework pBactin-IRES- EGFP-PA, name pZF-OP-Vector.Carrier includes multiple cloning sites, and insertion needs the CDs areas for the target gene expressed, i.e., Transgene carrier can be formed.

Designing amplimer is：GFP-F/R, wherein GFP-F addition XhoI sites, GFP-R add 40bp homology arm RHR With restriction enzyme site SpeI, anti-sense primer adds more digestion positions, and amplified production size is 1639bp.50 μ L reaction systems include： 10ng pIRES2-EGFP plasmids are as template, 1 μ L (10 μM) GFP-F primers, 1 μ L GFP-R primers, 1 μ L DNA Polymerase, 10 μ L 5x SF Buffer, 1 μ L (10 μM) dNTP Mix and 32 μ L ddH₂O.Its reaction condition is：95℃ 5min；95 DEG C of 10s, 62 DEG C of 30s, 72 DEG C of 2min, 35x circulation；72 DEG C of 10min, 4 DEG C of maintenances, amplification such as accompanying drawing 2B It is shown.

The primer GFP-F/R nucleotide sequence (capitalization) is as follows, wherein GFP-F upstreams addition XhoI sites (lowercase), GFP-R downstreams addition 40bp homology arms (lowercase), addition restriction enzyme site SpeI (capitalization).

GFP-F：5’-ctcgag AATTCTGCAGTCGACGGTAC-3’(SEQ ID NO.8)；

GFP-R：5’-ACTAGT ggccagactggacagcagcgtttggactggaggacttctgTAAGATACATTGA TGAGTTT-3’(SEQ ID NO.9)；

1.3 over-express vector framework pZF-Nsun2-OP-Vector structure：

Zebra fish Nsun2 gene C DS area (Gene ID are obtained in NCBI:325292), using high-fidelity enzyme (Phanta HS Super-Fidelity DNA Polymerase, Vazyme) using zebra fish cDNA as masterplate, expand Nsun2-CDs, such as Fig. 3. Wherein the primer Nsun2-F upstream adds EcoRI, pcr amplification product plus restriction enzyme site EcoRI, Nsun2-R upstreams 2133bp.PCR primer is purified (TAKARA) with kit, and purified product is standby.With BglII and EcoRI digestions pZF-OP- Vector, it is connected with PCR purified products after product gel extraction, 16 DEG C of connection 16h.Nsun2-CDs is inserted into over-express vector Framework pZF-OP-Vector multiple cloning sites, form pZF-Nsun2-OP-Vector, such as Fig. 4.

50 μ L reaction systems include：10ng pIRES2-EGFP plasmids are as template, 1 μ L (10 μM) GFP-F primers, 1 μ L GFP-R primers, 1 μ L DNA Polymerase, 10 μ L 5x SF Buffer, 1 μ L (10 μM) dNTP Mix and 32 μ L ddH₂O。 Its reaction condition is：95℃5min；95 DEG C of 10s, 62 DEG C of 30s, 72 DEG C of 2min, 35x circulation；72 DEG C of 10min, 4 DEG C of maintenances.

The primer Nsun2-F and Nsun2-R nucleotide sequence are as follows, and restriction enzyme site BglII, downstream are added in upstream Plus restriction enzyme site EcoRI, restriction enzyme site small letter：

Nsun2-F：5’-agatct ATGGAGGCCATGAGGGAGCC-3’(SEQ ID NO.10)；

Nsun2-R：5’-gaattc CTAACTCGTAGACCCATCAC-3’(SEQ ID NO.11)；

1.4 are used for the acquisition of the transgene carrier vector linearization fragment of injection

The pZF-Nsun2-OP-Vector carriers ultimately formed need to expand into performing PCR, obtain the LHR- for injection Nsun2-OP-RHR, design primer Nsun2-OP-F and Nsun2-OP-R are used to expand, and nucleotide sequence is as follows：

Nsun2-OP-F:5’-AGCTCGTCTCTCCAGCAGTTC-3’(SEQ ID NO.12)；

Nsun2-OP-R:5’-GGCCAGACTGGACAGCAGCGT-3’(SEQ ID NO.13)；

100 μ L reaction systems include：200ng pZF-Nsun2-OP-Vector linearizes product as template, 2 μ L (10 μM) Nsun2-OP-F primers, 2 μ L (10 μM) Nsun2-OP-R primers, 2 μ L DNA Polymerase, 20 μ L 5x SF Buffer, 2 μ L (10 μM) dNTP Mix and ddH₂O polishings are to 100 μ L.Its reaction condition is：95℃ 5min；95 DEG C of 10s, 60 DEG C 30s, 72 DEG C of 5min, 30x circulation；72 DEG C of 10min, 4 DEG C of maintenances.Fragment after amplification is coagulated by 1% agarose Glue, in 1xTAE, electrophoresis detection target fragment, with the Purification Kit fragment, dissolved with without enzyme water, Nanodrop measure After concentration, for injecting, principle such as Fig. 5 for being incorporated into genome.

2. it is overexpressed genetic fragment, Tyrosinase-sgRNA1 and Cas9-mRNA co-injections and screening.

Cas9-mRNA synthesis and preparation used in 2.1 injections.

Plasmid nCas9 (Addgene, Plasmid#46757) is cut with enzyme XbaI, obtains 7300bp or so linearisation production Thing, transcription templates are used as after purification by the use of phenol chloroform.Transcribed by in-vitro transcription kit, transcription product uses phenol chlorine Imitative extracting and purifying.As a result such as Fig. 6, the 4200bp injected for zebra fish or so nCas9-mRNA is obtained.

The μ L reaction systems of in-vitro transcription 20：10 μ L T3 2X NTP/CAP, 2 μ L T3Enzyme Mix, 2 μ L 10X T3 Reaction Buffer, 0.1-1 μ g linear template DNA, (1 μ L) (optional) [α-32P] UTP as a Tracer, Nuclease-free Water polishings are to 20 μ L.Reaction condition：It is placed in PCR instrument, 37 DEG C, isothermal reaction 4h；Add 1 μ L DNase handle 15min, remove transcription masterplate.

2.2 zebra fish microinjections

Zebra fish provides AB systems kind fish by Inst. of Hydrobiology, Chinese Academy of Sciences (China, Wuhan).By zebra fish with public affairs： Female=1：2 ratio is matched, perform the photoperiod (14 hours daylight and 10 hours dark), after second day changes water, unplug every Plate, treats post-coitum, and timing 15min receives ovum, removes dead ovum, microinjection is carried out under injection instrument.After injection, ovum is shifted To zebrafish embryo nutrient solution, 28.5 DEG C of cultures are placed in.

The double label filtrations of zebra fish after 2.3 injections

Zebra fish is cultivated to 48hpf after injection, by body colour whether albefaction, as long as the fish of transgenosis just has albefaction Occur.Fig. 7 is the effect of albefaction under microscope.On the basis of the screening of zebra fish pigment, then fluorescent screening is carried out, as shown in Figure 8.

The detection that 2.4 injection Post genomes are integrated

In order to further verify integration, design expands interface purpose fragment, expands pattern for the primer of insertion point Such as Fig. 9 A, as shown in Figure 9 B, there is the insertion of external source recombination in the site to PCR results.

Checking primer is respectively Nusn2-test-F and Nusn2-test2-F/R internal control primer Actin-F/R, nucleotides sequence Row are as follows:

Nusn2-test-F：5’-GCGTCTCACTCTCCTCGACT-3’(SEQ ID NO.14)；

Nusn2-test1-R:5’-TTGTATACTTAAGGAGCAACTAGCTGGTC-3’(SEQ ID NO.15)；

Nusn2-test2-R:5’-GCGTCTCACTCTCCTCGACTCTTCC-3’(SEQ ID NO.16)；

Actin-F：5’-CGAGCAGGAGATGGGAACC-3’(SEQ ID NO.17)；

Actin-R：5’-CAACGGAAACGCTCATTGC-3’(SEQ ID NO.18).

2.5 are overexpressed the detection of efficiency

The juvenile fish and wild type juvenile fish of luciferase expression, extraction RNA (RNAiso, TAKARA) are taken, and reverse transcription is cDNA (TAKARA) effect being overexpressed, is detected by RT-qPCR.As a result show, compared with compareing fish, genetically engineered fish there are 12.25 times Overexpression effect, as shown in Figure 10.

Nsun2 fluorescent quantitation primer is QNsun2-F/R, and internal control primer 18S1-F/R, primer is capitalized as follows：

QNsun2-F：5’-CCAGCTACAATACGGATAACAGG-3’(SEQ ID NO.19)；

QNsun2-R：5’-CTCAATTTTCTGCCCGTCCAC-3’(SEQ ID NO.20)；

18S1-F：5’-TCGCTAGTTGGCATCGTTTATG-3’(SEQ ID NO.21)；

18S1-R：5’-CGGAGGTTCGAAGACGATCA-3’(SEQ ID NO.22).

Embodiment 2：

This example 2 is provided to being directed to preferably being obtained with homology arm for Tyrosinase gene targets in the present invention.

Specifically include following steps：

The design of 1.1 target spots

Zebra fish Tyrosinase (Danio rerio strain Tuebingen chromosome are searched for from NCBI 15.NC_007126.7), on-line prediction target position, website http://chopchop.cbu.uib.no/.Selection scoring is most Alternately target position, shot design pattern are as shown in figure 11 by high four.

The checking of 1.2 target spots

T7promoter is added in target spot upstream, downstream addition overloop, then synthetic primer, is annealed, and is obtained PCR primer.Using PCR primer as masterplate, in-vitro transcription forms SgRNA, with Cas9-mRNA co-injection zebra fish, collects 60hpf's Juvenile fish, part knock out juvenile fish as illustrated in fig. 12, extract different groups of juvenile fish DNA.Purpose piece is expanded with Tyrosinase detection primers Duan Jinhang T7E1 digestions, with 2% agarose electrophoresis.Result is obtained, carries out gray value analysis, Tyrosinase-sgRNA1-4's Knocking out efficiency is respectively：64.68%th, 42.83%, 53.26%, 0%, the results showed that Tyrosinase-sgRNA1 knockout effect Rate highest, as optimal target spot, as a result such as Figure 12 B.T7E1 detection primers Tyrosinase-test1-F/R is used to detect Tyrosinase-sgRNA1/2, Tyrosinase-test2-F/R are used to detect Tyrosinase-sgRNA1/2.Four target spots Sequence capitalization it is as follows, target spot for capitalization, before be small letter T7promoter sequences, behind for small letter overloop sequences, two To the big write sequence of detection primer：

Tyrosinase-sgRNA1:5’- gtaatacgactcactatagGGACTGGAGGACTTCTGGGGgttttagagctagaaatagc-3’(SEQ ID NO.23)；

Tyrosinase-sgRNA2:5’- gtaatacgactcactatagTGCGGCGTCCAGTCAGGTCGgttttagagctagaaatagc-3’(SEQ ID NO.24)；

Tyrosinase-sgRNA3:5’- gtaatacgactcactatagACTCCTGAGTGAGGATACTGgttttagagctagaaatagc-3’(SEQ ID NO.25)；

Tyrosinase-sgRNA4:5’- gtaatacgactcactatagGCAGTATCCTCACTCAGGAGgttttagagctagaaatagc-3’(SEQ ID NO.26)；

Tyrosinase-test1-F:5’-GTGTGTGTGAAGCGTCTCACTCTC-3’(SEQ ID NO.27)；

Tyrosinase-test1-R:5’-CCCCATGTAGTTTCCGGCGC-3’(SEQ ID NO.28)；

Tyrosinase-test2-F:5’-CCTCCTCTTCTTCCTCCAGCTC-3’(SEQ ID NO.29)；

Tyrosinase-test2-R:5’-CATTCGCCGCAATCAAACCCC-3’(SEQ ID NO.30)；

The acquisition of 1.3 target spots and micro- homology arm

By screening test, this research obtains the target spot for being efficiently directed to Tyrosinase genes, the garbled target spot For Tyrosinase-sgRNA1.Based on this target spot, the micro- homology arm Tyrosinase-sg1-LHR of upstream and downstream is designed And represented under Tyrosinase-sg1-RHR, target spot Tyrosinase-sgRNA1 with underscore, its nucleotide sequence is as follows:

Tyrosinase-sgRNA1:5’-GGACTGGAGGACTTCTGGGG AGG-3’(SEQ ID NO.31)；

Tyrosinase-sg1-LHR:5’-AGCTCGTCTCTCCAGCAGTTCCCCCGAGTCTGCACCTCCC-3’(SEQ ID NO.32)；

Tyrosinase-sg1-RHR:5’-GGCCAGACTGGACAGCAGCGTTTGGACTGGAGGACTTCTG-3’(SEQ ID NO.33)；

General principle, principal character and the advantages of the present invention of the present invention has been shown and described above.The technology of the industry Personnel should be recognized that.The present invention is not limited to the above embodiments, and the simply explanation described in above-described embodiment and specification is originally The principle of invention, without departing from the spirit and scope of the present invention, various changes and modifications of the present invention are possible, the present invention Claimed scope is by appended claims, specification and its equivalent thereof.

SEQUENCE LISTING

<110>Yangzhou University

<120>A kind of rapid screening method applied to model animal zebra fish transgenosis

<130>

<160> 33

<170> PatentIn version 3.3

<210> 1

<211> 1136

<212> DNA

<213>Artificial sequence

<400> 1

gcttttagac cttcttactt ttggggatta tataagtatt ttctcaataa atatctcata 60

tcttactgtg gtttaactgc tgaatctaaa attttaatac aaaagtagtt atatttgttg 120

tacattgtaa actataactt aacttcagtt tcagagaaac tcatgtgctc aaaatgtaaa 180

aaaagtttcc tgttaaatat tttgtaaatg tattgaagac aaaataagaa aaaaaaaaat 240

ataagccact aaatcacact gtccttggta tcagcaagag attctgacat aatcagctgt 300

ttttgtttat tactgccatt gaaggccatg tgcattagtc ccaagttaca cattaaaaag 360

tcacatgtag cttaccaaca tcagtgctgt tcaagcacag cctcatctac tattcaaact 420

gtggcaccat ctaaaatatg ccagaatttt tttatttaat gaatttgacc ctgaaatatg 480

tattaatatc actcctgtga tttttttgta atcagcttac aattacagga atgcaagcct 540

gattcattac aagtttcact acactttctc tgacaacatc acctactgaa ctcagaccag 600

ctagttgctc cttaagtata caatcatgtc agtaatcctc atttcaatga aaaatacccg 660

tattgtactt ggtacttggt agataaccac agagcagtat tatgccatta ttgtgaatac 720

aataagaggt aaatgaccta cagagctgct gctgctgttg tgttagattg taaacacagc 780

acaggatcaa ggaggtgtcc atcactatga ccaatactag cactttgcac aggctctttg 840

aaaggctgaa aagagcctta ttggcgttat cacaacaaaa tacgcaaata cggaaaacaa 900

cgtattgaac ttcgcaaaca aaaaacagcg attttgatga aaatcgctta ggccttgctc 960

ttcaaacaat ccagcttctc cttctttcac tctcaagttg caagaagcaa gtgtagcaat 1020

gtgcacgcga cagccgggtg tgtgacgctg gaccaatcag agcgcagagc tccgaaagtt 1080

taccttttat ggctagagcc ggcatctgcc gtcatataaa agagcgcgcc cagcgt 1136

<210> 2

<211> 587

<212> DNA

<213>Artificial sequence

<400> 2

cccctctccc tccccccccc ctaacgttac tggccgaagc cgcttggaat aaggccggtg 60

tgcgtttgtc tatatgttat tttccaccat attgccgtct tttggcaatg tgagggcccg 120

gaaacctggc cctgtcttct tgacgagcat tcctaggggt ctttcccctc tcgccaaagg 180

aatgcaaggt ctgttgaatg tcgtgaagga agcagttcct ctggaagctt cttgaagaca 240

aacaacgtct gtagcgaccc tttgcaggca gcggaacccc ccacctggcg acaggtgcct 300

ctgcggccaa aagccacgtg tataagatac acctgcaaag gcggcacaac cccagtgcca 360

cgttgtgagt tggatagttg tggaaagagt caaatggctc tcctcaagcg tattcaacaa 420

ggggctgaag gatgcccaga aggtacccca ttgtatggga tctgatctgg ggcctcggtg 480

cacatgcttt acatgtgttt agtcgaggtt aaaaaaacgt ctaggccccc cgaaccacgg 540

ggacgtggtt ttcctttgaa aaacacgatg ataatatggc cacaacc 587

<210> 3

<211> 122

<212> DNA

<213> SV40

<400> 3

aacttgttta ttgcagctta taatggttac aaataaagca atagcatcac aaatttcaca 60

aataaagcat ttttttcact gcattctagt tgtggtttgt ccaaactcat caatgtatct 120

ta 122

<210> 4

<211> 1753

<212> DNA

<213>Artificial sequence

<400> 4

gctcgctttc ttgctgtcca atttctatta aaggttcctt tgttccctaa gtccaactac 60

taaactgggg gatattatga agggccttga gcatctggat tctgcctaat aaaaaacatt 120

tattttcatt gcaatgatgt atttaaatta tttctgaata ttttactaaa aagggaatgt 180

gggaggtcag tgcatttaaa acataaagaa atgaagagct agttcaaacc ttgggaaaat 240

acactatatc ttaaactcca tgaaagaagg tgaggctgca aacagctaat gcacattggc 300

aacagccctg atgcctatgc cttattcatc cctcagaaaa ggattcaagt agaggcttga 360

tttggaggtt aaagttttgc tatgctgtat tttacattac ttattgtttt agctgtcctc 420

atgaatgtct tttcactacc catttgctta tcctgcatct ctcagccttg actccactca 480

gttctcttgc ttagagatac cacctttccc ctgaagtgtt ccttccatgt tttacggcga 540

gatggtttct cctcgcctgg ccactcagcc ttagttgtct ctgttgtctt atagaggtct 600

acttgaagaa ggaaaaacag ggggcatggt ttgactgtcc tgtgagccct tcttccctgc 660

ctcccccact cacagtgacc cggaatctgc agtgctagtc tcccggaact atcactcttt 720

cacagtctgc tttggaagga ctgggcttag tatgaaaagt taggactgag aagaatttga 780

aagggggctt tttgtagctt gatattcact actgtcttat taccctatca taggcccacc 840

ccaaatggaa gtcccattct tcctcaggat gtttaagatt agcattcagg aagagatcag 900

aggtctgctg gctcccttat catgtccctt atggtgcttc tggctctgca gttattagca 960

tagtgttacc atcaaccacc ttaacttcat ttttcttatt caatacctag gtaggtagat 1020

gctagattct ggaaataaaa tatgagtctc aagtggtcct tgtcctctct cccagtcaaa 1080

ttctgaatct agttggcaag attctgaaat caaggcatat aatcagtaat aagtgatgat 1140

agaagggtat atagaagaat tttattatat gagagggtga aacctaaaat gaaatgaaat 1200

cagacccttg tcttacacca taaacaaaaa taaatttgaa tgggttaaag aattaaacta 1260

agacctaaaa ccataaaaat ttttaaagaa atcaaaagaa gaaaattcta atattcatgt 1320

tgcagccgtt ttttgaattt gatatgagaa gcaaaggcaa caaaaggaaa aataaagaag 1380

tgaggctaca tcaaactaaa aaatttccac acaaaaaaga aaacaatgaa caaatgaaag 1440

gtgaaccatg aaatggcata tttgcaaacc aaatatttct taaatatttt ggttaatatc 1500

caaaatatat aagaaacaca gatgattcaa taacaaacaa aaaattaaaa ataggaaaat 1560

aaaaaaatta aaaagaagaa aatcctgcca tttatgcgag aattgatgaa cctggaggat 1620

gtaaaactaa gaaaaataag cctgacacaa aaagacaaat actacacaac cttgctcata 1680

tgtgaaacat aaaaaagtca ctctcatgga aacagacagt agaggtatgg tttccagggg 1740

ttgggggtgg gag 1753

<210> 5

<211> 225

<212> DNA

<213>Artificial sequence

<400> 5

ctgtgccttc tagttgccag ccatctgttg tttgcccctc ccccgtgcct tccttgaccc 60

tggaaggtgc cactcccact gtcctttcct aataaaatga ggaaattgca tcgcattgtc 120

tgagtaggtg tcattctatt ctggggggtg gggtggggca ggacagcaag ggggaggatt 180

gggaagacaa tagcaggcat gctggggatg cggtgggctc tatgg 225

<210> 6

<211> 66

<212> DNA

<213>Artificial sequence

<400> 6

ccatggagct cgtctctcca gcagttcccc cgagtctgca cctcccgctt ttagaccttc 60

ttactt 66

<210> 7

<211> 47

<212> DNA

<213>Artificial sequence

<400> 7

ctcgagatct agcgctagcg tctagagctg agacgctggg cgcgctc 47

<210> 8

<211> 26

<212> DNA

<213>Artificial sequence

<400> 8

ctcgagaatt ctgcagtcga cggtac 26

<210> 9

<211> 66

<212> DNA

<213>Artificial sequence

<400> 9

actagtggcc agactggaca gcagcgtttg gactggagga cttctgtaag atacattgat 60

gagttt 66

<210> 10

<211> 26

<212> DNA

<213>Artificial sequence

<400> 10

agatctatgg aggccatgag ggagcc 26

<210> 11

<211> 26

<212> DNA

<213>Artificial sequence

<400> 11

gaattcctaa ctcgtagacc catcac 26

<210> 12

<211> 21

<212> DNA

<213>Artificial sequence

<400> 12

agctcgtctc tccagcagtt c 21

<210> 13

<211> 21

<212> DNA

<213>Artificial sequence

<400> 13

ggccagactg gacagcagcg t 21

<210> 14

<211> 20

<212> DNA

<213>Artificial sequence

<400> 14

gcgtctcact ctcctcgact 20

<210> 15

<211> 29

<212> DNA

<213>Artificial sequence

<400> 15

ttgtatactt aaggagcaac tagctggtc 29

<210> 16

<211> 25

<212> DNA

<213>Artificial sequence

<400> 16

gcgtctcact ctcctcgact cttcc 25

<210> 17

<211> 19

<212> DNA

<213>Artificial sequence

<400> 17

cgagcaggag atgggaacc 19

<210> 18

<211> 19

<212> DNA

<213>Artificial sequence

<400> 18

caacggaaac gctcattgc 19

<210> 19

<211> 23

<212> DNA

<213>Artificial sequence

<400> 19

ccagctacaa tacggataac agg 23

<210> 20

<211> 21

<212> DNA

<213>Artificial sequence

<400> 20

ctcaattttc tgcccgtcca c 21

<210> 21

<211> 22

<212> DNA

<213>Artificial sequence

<400> 21

tcgctagttg gcatcgttta tg 22

<210> 22

<211> 20

<212> DNA

<213>Artificial sequence

<400> 22

cggaggttcg aagacgatca 20

<210> 23

<211> 59

<212> DNA

<213>Artificial sequence

<400> 23

gtaatacgac tcactatagg gactggagga cttctggggg ttttagagct agaaatagc 59

<210> 24

<211> 59

<212> DNA

<213>Artificial sequence

<400> 24

gtaatacgac tcactatagt gcggcgtcca gtcaggtcgg ttttagagct agaaatagc 59

<210> 25

<211> 59

<212> DNA

<213>Artificial sequence

<400> 25

gtaatacgac tcactataga ctcctgagtg aggatactgg ttttagagct agaaatagc 59

<210> 26

<211> 59

<212> DNA

<213>Artificial sequence

<400> 26

gtaatacgac tcactatagg cagtatcctc actcaggagg ttttagagct agaaatagc 59

<210> 27

<211> 24

<212> DNA

<213>Artificial sequence

<400> 27

gtgtgtgtga agcgtctcac tctc 24

<210> 28

<211> 20

<212> DNA

<213>Artificial sequence

<400> 28

ccccatgtag tttccggcgc 20

<210> 29

<211> 22

<212> DNA

<213>Artificial sequence

<400> 29

cctcctcttc ttcctccagc tc 22

<210> 30

<211> 21

<212> DNA

<213>Artificial sequence

<400> 30

cattcgccgc aatcaaaccc c 21

<210> 31

<211> 23

<212> DNA

<213>Artificial sequence

<400> 31

ggactggagg acttctgggg agg 23

<210> 32

<211> 40

<212> DNA

<213>Artificial sequence

<400> 32

agctcgtctc tccagcagtt cccccgagtc tgcacctccc 40

<210> 33

<211> 40

<212> DNA

<213>Artificial sequence

<400> 33

ggccagactg gacagcagcg tttggactgg aggacttctg 40

Claims (9)

1. a kind of rapid screening method applied to model animal zebra fish transgenosis, it is characterised in that comprise the following steps：

1) expression vector containing strong promoter, target gene and label gene is built；

2) the specific target spot for target gene is designed, screening obtains the optimal SgRNA of targeting knock out；

3) on the basis of the specific target spot that 2) target gene obtains, homology arm, and expression vector two in 1) are designed The wing adds homology arm, is built into homologous recombination vector；

4) zebra fish microinjection：By obtained in step 3) containing target gene, label gene and target gene homology arm SgRNA obtained in homologous recombination vector fragment and step 2), and the nCas9-mRNA that in-vitro transcription obtains, co-injection spot Horse fish fertilized egg；

5) zebra fish of target gene function missing is filtered out first, and carrying out second by label gene again on this basis sieves Choosing, label gene expression individual is obtained, so as to obtain expression destination gene expression individual.

2. according to the method for claim 1, it is characterised in that the label gene is fluorescent reporter gene.

3. according to the method for claim 1, it is characterised in that the target gene is pigment gene.

4. a kind of homologous recombination vector quickly screened applied to zebra fish transgenosis, it is characterised in that the homologous recombination carries Body includes Insert Fragment, including strong promoter, multiple cloning sites, internal ribosome entry site, label gene, tanscription termination letter The homology arm designed at number fragment, target gene target spot；Wherein, the promoter is located at label upstream region of gene, the termination signal Positioned at label downstream of gene, left side homology arm is located at promoter upstream, and right side homology arm is located at termination signal downstream.

5. a kind of homologous recombination vector quickly screened applied to zebra fish transgenosis as claimed in claim 4, its feature exist In described promoter is Carp beta actin promoter, and its nucleotides sequence is classified as SEQ ID NO.1.

6. a kind of homologous recombination vector quickly screened applied to zebra fish transgenosis as claimed in claim 4, its feature exist In described label gene is eGFP.

7. a kind of homologous recombination vector quickly screened applied to zebra fish transgenosis as claimed in claim 4, its feature exist In described internal ribosome entry site is IRES2, and its nucleotides sequence is classified as SEQ ID NO.2.

8. a kind of homologous recombination vector quickly screened applied to zebra fish transgenosis as claimed in claim 7, its feature exist In described transcription stop signals fragment is SV40polyA, and its nucleotides sequence is classified as SEQ ID NO.3.

9. a kind of homologous recombination vector quickly screened applied to zebra fish transgenosis as claimed in claim 4, its feature exist In the homology arm is located at zebra fish Tyrosinase genes.