WO2009106795A1 - Enzyme - Google Patents
Enzyme Download PDFInfo
- Publication number
- WO2009106795A1 WO2009106795A1 PCT/GB2009/000411 GB2009000411W WO2009106795A1 WO 2009106795 A1 WO2009106795 A1 WO 2009106795A1 GB 2009000411 W GB2009000411 W GB 2009000411W WO 2009106795 A1 WO2009106795 A1 WO 2009106795A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- nucleic acid
- polypeptide
- seq
- dna polymerase
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
- C12N9/1252—DNA-directed DNA polymerase (2.7.7.7), i.e. DNA replicase
Definitions
- the present invention relates to novel polypeptides having DNA polymerase activity, and their uses.
- DNA polymerases are enzymes involved in vivo in DNA repair and replication, but have become an important in vitro diagnostic and analytical tool for the molecular biologist.
- E. coli DNA polymerase I encoded by the gene "DNA polA” was discovered in 1956, and cloned and characterised in the early 1970s.
- the enzyme has a variety of uses including DNA labelling by nick translation, second-strand cDNA synthesis in cDNA cloning, and DNA sequencing.
- the so-called "Klenow” or "Large” fragment of E. coli DNA polymerase l is a large protein fragment originally produced upon cleavage of the native enzyme by the protease enzyme subtilisin.
- This Large fragment exhibits 5'-»3' polymerase activity and 3'-»5' exonuclease proofreading activity, but loses 5'— >3' exonuclease activity which mediates nick translation during DNA repair in the native enzyme.
- DNA polymerase I-like enzymes Since being discovered in E. coli, DNA polymerase I-like enzymes have been characterised in many prokaryotes, although the non-is. coli counterparts do not always have a 3'— >5' exonuclease proofreading function.
- Certain DNA polymerase I -like enzymes obtained from various thermophilic eubacteria, for example Thermits flavus, Thermus aquaticus, Thermus brocki ⁇ ms, Thermus ruber, Thermus thermophilus, Thermus flliformis, Thermus lacteus, Thermus rubens, Bacillus stearothermophilus, Bacillus caldotenax and Thermotoga maritima, have been found to be thermostable, retaining polymerase activity at around 45°C to 100 0 C.
- thermostable DNA polymerases have found wide use in methods for amplifying nucleic acid sequences by thermocycling amplification reactions such as the polymerase chain reaction (PCR) or by isothermal amplification reactions such as strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR), and loop-mediated isothermal amplification (LAMP; see Notomi et al., 2000, Nucleic Acids Res. 28: e63).
- Thermostable DNA polymerases have different properties such as thermostability, strand displacement activity, fidelity (error rate) and binding affinity to template DNA and/or free nucleotides, and are therefore typically suited to different types of amplification reaction.
- DNA polymerase I enzymes such as Bst DNA polymerase I Large fragment and Bca DNA polymerase I Large fragment are preferred in reactions such as LAMP (see Notomi et al., 2000, supra).
- thermocycling amplification reactions such as PCR require a DNA polymerase with reasonable processivity and thermostability at the cycling temperatures used (typically up to 94°C).
- DNA polymerase II-like enzymes for example, Vent, Deep Vent, Pwo, Pfu, KOD, 9N7, Tfu DNA polymerases
- Vent, Deep Vent, Pwo, Pfu, KOD, 9N7, Tfu DNA polymerases which lack 5'->3' exonuclease activity but have proofreading 3'->5' exonuclease activity.
- DNA polymerase I enzymes typically those from Thermotoga and Thermus species, for example Taq DNA polymerase
- Taq DNA polymerase for example, has insufficient strand displacement activity to function adequately in isothermal amplification reactions.
- thermostable DNA polymerases from Thermotoga naphthophila and Thermotoga petrophellia.
- Moussard et al discloses the discovery of the genus Thermodesulfatator, with Thermodesulfatator indicus as the type species.
- the present invention provides a novel thermostable DNA polymerase I and Large fragment thereof for use in reactions requiring DNA polymerase activity such as nucleic acid amplification reactions.
- the polymerase particularly its Large fragment, has surprisingly and advantageously been found to be useful in both thermocycling and isothermal amplification reactions. Included within the scope of the present invention are various mutants (deletion and substitution) that retain thermostability and the ability to replicate DNA.
- a polypeptide having thermostable DNA polymerase activity comprising or consisting essentially of an amino acid sequence with at least 51% identity, for example at least 55%, 56%, 57%, 58%, 59%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 91%, 98% or even 99% identity, to Thermodesulfatator indicus DNA polymerase I Large (or "Klenow") fragment shown in SEQ ID NO:1.
- the polypeptide is isolated.
- T. indicus DNA polymerase I has the following amino acid sequence:
- SEQ ID NO:32 An alternative amino acid sequence, identified by further and improved sequencing analysis, for the Large fragment of T. indicus DNA polymerase I is SEQ ID NO:32 as follows:
- This sequence is 99% identical to SEQ ID NO: 1.
- the predicted molecular weight of the 613 amino acid residue T. indicus DNA polymerase I Large fragment shown in SEQ ID NO:32 is about 69,990 Daltons.
- the predicted molecular weight of the 612 amino acid residue sequence shown in SEQ ID NO: 1 is about 69,820 Daltons.
- the amino acid sequence for inclusion in the polypeptide according to the invention may be an amino acid sequence with at least 51% identity, for example at least 55%, 56%, 57%, 58%, 59%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity, to the sequence shown in SEQ ID NO:32.
- the percentage sequence identity may be determined using the BLASTP computer program with SEQ ID NO:1 or 32 as the base sequence. This means that SEQ ID NO:1 or 32, as appropriate, is the sequence against which the percentage identity is determined.
- the BLAST software is publicly available at http://blast.ncbi.nlm. nih.gov/Blast.cgi (accessible on 11 February 2009).
- T. indicus is a thermophilic chemolithoautotrophic sulphate-reducing bacterium isolated from a deep-sea hydrothermal vent site, and has a reported temperature range for growth of 55-80 0 C and an optimum growth temperature of 70 0 C (see Moussard et al., 2004, Int. J. Syst. Evol. Microbiol. 54: 227-233).
- the inventors have isolated genomic DNA (gDNA) from T. indicus and used a sophisticated gene walking technique to clone a DNA polymerase A (polA) gene encoding a DNA polymerase I and corresponding Large fragment thereof.
- the Large fragment having the amino acid sequence as shown in SEQ ID NO: 1 has been shown to be surprisingly efficient in both PCR and LAMP amplification reactions when compared with the different preferred DNA polymerases for these reactions.
- the polypeptide of the invention may exhibit strand displacement activity.
- the polypeptide may accordingly be suitable for carrying out isothermal amplification reactions such as LAMP.
- the polypeptide may additionally or alternatively be suitable for carrying out thermocycling amplification reactions such as PCR.
- the polypeptide as described herein may be about 613 amino acid residues in length, for example from about 610 to about 620, about 600 to about 630, about 550 to about 650, or about 500 to about 750 amino acids in length.
- the polypeptide may comprise or consist essentially of the amino acid sequence SEQ ID NO:1 or 32, or of the amino acid sequence of SEQ ID NO:1 or 32 with 1, 2, 3, 4,
- N-terminus region and/or the C-terminus region are N-terminus region and/or the C-terminus region.
- the full length may be 619 amino acid residues.
- an isolated polypeptide having thermostable DNA polymerase activity comprising or consisting essentially of an amino acid sequence with at least 55% identity, for example at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or even 99% identity, to T. indicus DNA polymerase I as shown in SEQ ID NO:2.
- the polypeptide according to this aspect of the invention is a polypeptide according to the first aspect of the invention and, therefore, has at least 51% identity to T. indicus DNA polymerase I Large fragment shown in SEQ ID NO:1
- T. indicus DNA polymerase I has a full length amino acid sequence as follows:
- the predicted molecular weight of this 900 amino acid residue 71 indicus DNA polymerase I shown in SEQ ID NO:34 is about 102,900 Daltons.
- the predicted molecular weight of the 900 amino acid residue sequence shown in SEQ ID NO.2 is about 102,850 Daltons.
- the amino acid sequence for inclusion in the polypeptide according to the invention may be an amino acid sequence with at least 51% identity, for example at least 52%, 53%, 54%, 55%, 56%, 57%, 58%, 59%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or even 99% identity, to the sequence shown in SEQ ID NO:34.
- the percentage sequence identity may be determined using the BLASTP computer program with SEQ ID NO:2 or 34 as the base sequence. This means that SEQ ID NO:2 or 34, as appropriate, is the sequence against which the percentage identity is determined.
- the polypeptide may comprise or consist essentially of the amino acid sequence SEQ ID NO:2 or 34, or of the amino acid sequence of SEQ ID NO:2 or 34 with 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, about 20, about 30, about 40, about 50, about 100, about 150, about 200, about 250, about 260, about 270, 280, 281, 282, 283, 284, 285, 286, 287 or 288 contiguous amino acids added to or removed from any part of the polypeptide and/or 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, about 20, about 30, about 40, about 50, about 100, about 150, about 200, about 250, about 260, about 270, 280, 281, 282, 283, 284, 285, 286, 287 or 288 amino acids added to or removed from the N-terminus region and/or the C-terminus region.
- the polypeptide according to this aspect of the invention may be an isolated thermostable DNA polymerase I obtainable from T. indicus and having a molecular weight of about 102,500 to 103,500 Daltons (preferably about 102,900 or about 103,000 Daltons), or an en2ymatically active fragment thereof.
- the term "enzymatically active fragment” means a fragment of such a polymerase obtainable from T. indicus and having enzyme activity which is at least 60%, preferably at least 70%, more preferably at least 80%, yet more preferably 90%, 95%, 96%, 97%, 98%, 99% or 100% that of the full length polymerase being compared to.
- the given activity may be determined by any standard measure, for example, the number of bases of nucleotides of the template sequence which can be replicated in a given time period. The skilled person is routinely able to determine such properties and activities.
- Residues 3-612 of the T. indicus DNA polymerase I Large fragment shown in SEQ ID NO: 1 correspond with residues 290-900 of the full length DNA polymerase I shown in SEQ ID NO:2. Residues 1-2 of SEQ ID NO:1 are artificially introduced compared to the sequence of SEQ ID NO:2 to allow in vitro expression of the Large fragment in a host cell (see Examples below). Similarly, residues 3-613 of the T. indicus DNA polymerase I Large fragment shown in SEQ ID NO: 32 correspond with residues 290-900 of the full length DNA polymerase I shown in SEQ ID NO:34.
- polypeptide according to the invention may be greater in size where, according to a further aspect of the invention, it comprises additional functional or structural domains, for example an affinity purification tag (such as an His purification tag), or
- DNA polymerase activity-enhancing domains such as the proliferating cell nuclear antigen homologue from Archaeoglobus fulgidus, T3 DNA polymerase thioredoxin binding domain, DNA binding protein Sso7d from Sulfolobus solfataricus, Sso7d-like proteins, or mutants thereof, or helix-hairpin-helix motifs derived from DNA topoisomerase V.
- the DNA polymerase activity-enhancing domain may also be a
- Cren7 enhancer domain or variant thereof as defined and exemplified in co-pending International patent application no. PCT/GB2009/000063, which discloses that this highly conserved protein domain from Crenarchaeal organisms is useful to enhance the properties of a DNA polymerase.
- International patent application no. PCT/GB2009/000063 is incorporated herein by reference in its entirety.
- the polypeptides of the invention may be suitable for use in one or more reactions requiring DNA polymerase activity, for example one or more of the group consisting of: nick translation, second-strand cDNA synthesis in cDNA cloning, DNA sequencing, thermocycling amplification reactions such as PCR, and isothermal amplification reactions for example strand displacement amplification (SDA), nucleic acid sequence-based amplification (NASBA), self-sustained sequence replication (3SR) and LAMP.
- SDA strand displacement amplification
- NASBA nucleic acid sequence-based amplification
- 3SR self-sustained sequence replication
- thermostable 5'— >3' exonuclease activity and having at least 55% identity, for example at least 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or even 99% identity, to residues 1-289 of T. indicus DNA polymerase I as shown in SEQ ID NO: 2 or 34.
- polypeptides of the invention have 3'-»5' exonuclease proofreading activity.
- the polypeptides exhibit high fidelity polymerase activity during a thermocycling amplification reaction (such as PCR).
- High fidelity may be defined as a PCR error rate of less than 1 nucleotide per 300 x 10 6 amplified nucleotides, for example less than 1 nucleotide per 250 x 10 6 , 200 x 10 6 , 150 x 10 6 , 100 x 10 6 or 50 x 10 6 amplified nucleotides.
- the error rate of the polypeptides may be in the range 1-300 nucleotides per 10 6 amplified nucleotides, for example 1-200, 1-100, 100-300, 200-300, 100-200 or 75-200 nucleotides per 10 6 amplified nucleotides. Error rate may be determined using the opal reversion assay as described by Kunkel et al. (1987, Proc. Natl Acad. Sci. USA 84: 4865-4869). In another aspect of the invention there is provided a composition comprising the polypeptide as described herein.
- the composition may for example include a buffer, most or all ingredients for performing a reaction (such as a DNA amplification reaction for example PCR or LAMP), a stabiliser (such as E. coli GroEL protein, to enhance thermostability), and/or other compounds.
- a buffer most or all ingredients for performing a reaction (such as a DNA amplification reaction for example PCR or LAMP), a stabiliser (such as E. coli GroEL protein, to enhance thermostability), and/or other compounds.
- the invention further provides an isolated nucleic acid encoding the polypeptide with identity to the T. indicus DNA polymerase I Large fragment.
- the nucleic acid may, for example, have a sequence as shown below (5 '-3'): atgggcctcttaaaggaacttccagctactaaaaccctttcgatgaccagatacgagctggttcttgacccggataaagtaaa agaaattgtagaaaggccaaaggggccgaagtggtggctattgaccttgaaagtgatacgaaagaccccatgcgtggg aaaatagtaggggtctcgctttgttttaacccgcccaaagcctattatttcccttttagacatgaaggccttgaggcccaaag cagcttccctggga
- the nucleotide of SEQ ID NO:3 encodes the T. indicus DNA polymerase I Large fragment of SEQ ID NO: 1 as follows:
- the nucleic acid has the sequence shown below (5 '-3'): atgggcctcttaaaggaacttccagctactaaaaccctttcgtatgaccagtacgagctggttcttgacccggataaagtaa agaaattgtagaaaggccaaaggggccgaagtggtggctattgaccttgaaagtgatacgaaagaccccatgcgtggg aaaatagtaggggtctcgctttgttttaacccgcccaaagcctattatttcccttttagacatgaaggccttgaggcccaaaag cagcttccctgggaggcctttactcatctggccagcctcattgaagacccctcagttaaaagatag
- the invention further provides an isolated nucleic acid encoding the polypeptide with identity to the T. indicus full length DNA polymerase I.
- the nucleic acid may, for example, have a sequence as shown below (5'-3'): atggcgcagaaaagcttgtttcctaaaaaattaccatttaaagatgataaagaccccatcttcgttattgacgggagttcttttgt ttaccgggcttactatgccataagagggcatctatcaaaccgcaaagggctcccaaccaaggcggtctttgggttacccag atgcitttaaagciffigcgtgagatgaaccctgagtatgtggtggtgtgctttgacgccaaagggcctacttttcgccacgag atgtacaaagaataca
- the nucleotide of SEQ ID NO:4 encodes the T. indicus full length DNA polymerase I of SEQ ID NO:2 as follows:
- nucleic acid has the sequence shown below (5'-3'): atggcgcagaaaagcttgtttcctaaaaattaccatttaaagatgataaagaccccatcttcgttattgacgggagttcttttgt ttaccgggcttactatgccataagagggcatctatcaaaccgcaaagggctcccaaccaaggcggtctttgggttacccag atgcttttaaagcttttgcgtgagatgaaccctgagtatgtggtggtgtgttgcgtgagatgaaccctgagtatgtggtggtgtgctttgacgccaaagggcctacttttcgccacgag atgtacaaagaatacaaagccaaccgcccccga
- the nucleotide of SEQ ID NO:35 encodes the T. indicus full length DNA polymerase I of SEQ ID NO:34 as follows:
- nucleic acids as defined below.
- a host cell transformed with the nucleic acid or the vector of the invention.
- a recombinant polypeptide expression from the host cell is also encompassed by the invention.
- kits comprising the polypeptide as described herein and/or the composition described herein and/or the isolated nucleic acid as described herein and/or the vector as described herein and/or the host cell as described herein, together with packaging materials therefor.
- the kit may, for example, comprise components including the polypeptide for carrying out a reaction requiring DNA polymerase activity, such as PCR or LAMP.
- the invention further provides a method of amplifying a sequence of a target nucleic acid using a thermocycling reaction, for example PCR, comprising the steps of: (1) contacting the target nucleic acid with the polypeptide having thermostable DNA polymerase activity as described herein; and
- Another aspect of the invention encompasses a method of amplifying a sequence of a target nucleic acid using an isothermal reaction, for example LAMP, comprising the steps of:
- the present invention also encompasses structural variants of the polypeptides as defined herein.
- a "variant" means a polypeptide in which the amino acid sequence differs from the base sequence from which it is derived in that one or more amino acids within the sequence are substituted for other amino acids.
- Amino acid substitutions may be regarded as "conservative” where an amino acid is replaced with a different amino acid with broadly similar properties. Non-conservative substitutions are where amino acids are replaced with amino acids of a different type.
- conservative substitution is meant the substitution of an amino acid by another amino acid of the same class, in which the classes are defined as follows:
- Nonpolar A, V, L, I, P, M, F, W
- altering the primary structure of a peptide by a conservative substitution may not significantly alter the activity of that peptide because the side-chain of the amino acid which is inserted into the sequence may be able to form similar bonds and contacts as the side chain of the amino acid which has been substituted out. This is so even when the substitution is in a region which is critical in determining the peptides conformation. Non-conservative substitutions are possible provided that these do not interrupt with the function of the DNA binding domain polypeptides.
- variants may have a sequence which is at least 55% identical, 60% identical, 65% identical, for example at least 70% or 75% identical, such as at least 80%, 85%, 90%, 95%, 96%, 97%, 98% or even 99% identical to the sequence of any of SEQ ID NOs: 1, 2, 32 or 34.
- the invention encompasses a polypeptide having thermostable DNA polymerase activity and comprising or consisting essentially of an amino acid sequence of SEQ ID NOs: 1, 2, 32 or 34 with up to about one third of the amino acid sequence from the N- or C-terminus having been deleted, or having at least 55% sequence identity to such a sequence.
- up to about 300 amino acids may be removed from either the N- or C-terminus of SEQ ID NOs :2 or 34; up to about 205 amino acids may be removed from either the N- or C-terminus of SEQ ID NOs: 1 or 32.
- nucleic acid may be DNA or RNA, and where it is a DNA molecule, it may for example comprise a cDNA or genomic DNA.
- the invention encompasses variant nucleic acids encoding the polypeptides of the invention.
- variant in relation to a nucleic acid sequences means any substitution of, variation of, modification of, replacement of, deletion of, or addition of one or more nucleic acid(s) from or to a polynucleotide sequence providing the resultant polypeptide sequence encoded by the polynucleotide exhibits at least the same properties as the polypeptide encoded by the basic sequence.
- the term therefore includes allelic variants and also includes a polynucleotide which substantially hybridises to the polynucleotide sequence of the present invention. Such hybridisation may occur at or between low and high stringency conditions.
- low stringency conditions can be defined a hybridisation in which the washing step takes place in a 0.330-0.825 M NaCl buffer solution at a temperature of about 40-48 0 C below the calculated or actual melting temperature (T m ) of the probe sequence (for example, about ambient laboratory temperature to about 55 0 C), while high stringency conditions involve a wash in a 0.0165-0.0330 M NaCl buffer solution at a temperature of about 5-10 0 C below the calculated or actual T m of the probe(for example, about 65°C).
- the buffer solution may, for example, be SSC buffer (0.15M NaCl and 0.015M tri-sodium citrate), with the low stringency wash taking place in 3 x SSC buffer and the high stringency wash taking place in 0.1 x SSC buffer. Steps involved in hybridisation of nucleic acid sequences have been described for example in Sambrook et al. (1989; Molecular Cloning, Cold Spring Harbor Laboratory Press, Cold Spring Harbor).
- variants typically have 55% or more of the nucleotides in common with the nucleic acid sequence of the present invention, more typically 60%, 65%, 70%, 80%, 85%, or even 90%, 95%, 98% or 99% or greater sequence identity.
- Variant nucleic acids of the invention may be codon-optimised for expression in a particular host cell.
- DNA polymerases and nucleic acids of the invention may be prepared synthetically using conventional synthesisers. Alternatively, they may be produced using recombinant DNA technology or isolated from natural sources followed by any chemical modification, if required.
- a nucleic acid encoding the chimeric protein is incorporated into a suitable expression vector, which is then used to transform a suitable host cell, such as a prokaryotic cell such as E. coli.
- the transformed host cells are cultured and the protein isolated therefrom.
- Vectors, cells and methods of this type form further aspects of the present invention.
- Sequence identity between nucleotide and amino acid sequences can be determined by comparing an alignment of the sequences. When an equivalent position in the compared sequences is occupied by the same amino acid or base, then the molecules are identical at that position. Scoring an alignment as a percentage of identity is a function of the number of identical amino acids or bases at positions shared by the compared sequences. When comparing sequences, optimal alignments may require gaps to be introduced into one or more of the sequences to take into consideration possible insertions and deletions in the sequences. Sequence comparison methods may employ gap penalties so that, for the same number of identical molecules in sequences being compared, a sequence alignment with as few gaps as possible, reflecting higher relatedness between the two compared sequences, will achieve a higher score than one with many gaps. Calculation of maximum percent identity involves the production of an optimal alignment, taking into consideration gap penalties.
- MatGAT v2.03 is freely available from the website http://bitincka.com/ledion/matgat/ (accessed on 11 February 2009) and has also been submitted for public distribution to the Indiana University Biology Archive (IUBIO).
- Gap and FASTA are available as part of the Accelrys GCG Package Version 11.1 (Accelrys, Cambridge, UK), formerly known as the GCG Wisconsin Package.
- the FASTA program can alternatively be accessed publically from the European Bioinformatics Institute (http://www.ebi.ac.uk/fasta) (accessed on 11 February 2009) and the University of Virginia (http://fasta.biotech.virginia. edu/fasta_www/cgi or http://fasta.bioch.virginia.edu/fasta_www2/fasta_list2.shtml as accessed on 11 February 2009).
- FASTA may be used to search a sequence database with a given sequence or to compare two given sequences (see http://fasta.bioch.virginia.edu/fasta_www/cgi/search_frm2.cgi, accessed on 11 February 2009).
- default parameters set by the computer programs should be used when comparing sequences. The default parameters may change depending on the type and length of sequences being compared.
- sequence identity is determined using the MatGAT program v2.03 using default parameters as noted above.
- DNA polymerase refers to any enzyme that catalyzes polynucleotide synthesis by addition of nucleotide units to a nucleotide chain using a nucleic acid such as DNA as a template.
- the term includes any variants and recombinant functional derivatives of naturally occurring nucleic acid polymerases, whether derived by genetic modification or chemical modification or other methods known in the art.
- thermoostable DNA polymerase activity means DNA polymerase activity which is relatively stable to heat and which functions at high temperatures, for example 45-100 0 C, preferably 55-100 0 C, 65-100 0 C, 75-100 0 C, 85-100 0 C or 95- 100 0 C, as compared, for example, to a non-thermostable form of DNA polymerase.
- Figure 1 is a diagram illustrating a gene walking method employed in cloning a novel DNA polymerase from ⁇ iermodesulfatator indicus according to one embodiment of the invention
- Figure 2 is a diagram showing the structure of a new pET24a(+)HIS region used in cloning of the T. indicus DNA polymerase;
- Figure 3 is an SDS PAGE gel showing expression of Large fragments of the cloned T. indicus DNA polymerase.
- Lane 1 is a size marker
- lane 2 is induced control with pET24a(+)HIS vector without insert
- lane 3 is lOO ⁇ l T. indicus DNA polymerase, Large fragment with N-terminal HIS tag
- lane 4 is lOO ⁇ l T. indicus DNA polymerase, Large fragment without N-terminal HIS tag
- lane 5 is 20 ⁇ l T. indicus DNA polymerase, Large fragment with N-terminal HIS tag
- lane 6 is 20 ⁇ l T. indicus DNA polymerase, Large fragment without N-terminal HIS tag
- lane 7 is 5 ⁇ l T.
- indicus DNA polymerase Large fragment with N-terminal HIS tag
- lane 8 is 5 ⁇ l T. indicus DNA polymerase, Large fragment without N-terminal HIS tag
- lane 9 is 5Ou T. indicus DNA polymerase
- lane 10 is 12.5u KlenTaq DNA polymerase.
- Volumes refer to amount of protein loaded from that volume of induced E. coli KRX culture;
- Figure 4 is an SDS PAGE gel showing expression of full length embodiments of the cloned T. indicus DNA polymerase.
- Lane 1 is a size marker
- lane 2 is induced Control with pET24a(+)HIS vector without insert
- lane 3 is lOO ⁇ l T. indicus DNA Polymerase, full length with N-terminal HIS tag
- lane 4 is lOO ⁇ l T. indicus DNA Polymerase, full length without N-terminal HIS tag
- lane 5 is 25u Pfu DNA Polymerase.
- Volumes refer to amount of protein loaded from that volume of induced E.
- FIG. 1 is a lambda EcoR HHin ⁇ III Size Marker
- Lane 2 is a 500bp, 400bp, 350bp, 275bp, 225bp and 175bp size marker
- lane 3 shows amplification product using 1.25u Tag DNA polymerase
- lane 4 shows 2 ⁇ l induced T. indicus DNA polymerase, Large fragment without N-terminal HIS tag
- lane 5 shows 2 ⁇ l T. indicus DNA polymerase, Large fragment with N- terminal HIS tag
- lane 6 shows 8 ⁇ l T.
- indicus DNA polymerase Large fragment with N-terminal HIS tag and purified via single step chelating sepharose purification, lane 7 shows lO ⁇ l T. indicus DNA polymerase, full length with N-terminal HIS tag, and lane 8 shows amplification product using induced pET24a(+)HIS vector lacking insert (as negative control).
- Volumes refer to amount of protein loaded from that volume of induced E. coli KRX culture;
- Figure 6 is an agarose gel of LAMP reaction samples showing amplification results using the cloned T. indicus DNA polymerase.
- Lane 1 is a lambda EcoR I/Hind III Size Marker
- lane 2 is a 500bp, 400bp, 350bp, 275bp, 225bp and 175bp size marker
- lane 3 shows amplification product using 8u Bst DNA polymerase
- Large fragment lane 4 shows 2 ⁇ l T. indicus DNA polymerase, Large fragment without N-terminal HIS tag
- lane 5 shows 2 ⁇ l T. indicus DNA polymerase, Large fragment with N-terminal HIS tag
- lane 6 shows 8 ⁇ l T.
- indicus DNA polymerase Large fragment with N-terminal HIS tag and purified via single step chelating sepharose purification
- lane 7 shows lO ⁇ l T. indicus DNA polymerase, full length with N-terminal HIS tag
- lane 8 shows amplification product using induced pET24a(+)HIS vector lacking insert (as negative control).
- Volumes refer to amount of protein loaded from that volume of induced E. coli KRX culture.
- DNA polA DNA polymerase A gene
- a Large (or Klenow) fragment of the DNA polymerase I was found to be highly efficient in both PCR and LAMP reactions.
- the PoIATFl primer has the sequence:
- the PoIATR primer has the sequence:
- Taq DNA Polymerase 5u/ ⁇ l 0.25 ⁇ l Water To 50 ⁇ l.
- PCR cycling conditions were 4 minute initial denaturation at 94°C followed by 45 cycles of: 10 seconds denaturation at 94°C, 30 seconds annealing at 42°C, 30 second extension at 72°C. Final extension at 72°C for 7mins. 4°C hold.
- a ⁇ 570bp amplified product was TA cloned (Invitrogen pCR2.1 kit. Cat#K2000-01) and sequenced using M13 Forward (5'-TGT AAA ACG ACG GCC AGT-3')(SEQ ID NO:7) and Reverse (5'-AGC GGA TAA CAA TTT CAC ACA GGA-3')(SEQ ID NO: 8) primers on an ABI-3100 DNA sequencer. Sequencing data confirmed the fragment was DNA polymerase A (DNA polA) gene.
- DNA polA DNA polymerase A
- IOng gDNA was digested individually with 5u of various 6 base pair-cutter restriction endonucleases in lO ⁇ l reaction volume and incubated for 3 h at 37°C. 12 individual digest reactions were run, using a unique 6-cutter restriction enzyme (RE) for each. 5 ⁇ l digested template was then self-ligated using 12.5u T4 DNA Ligase, l ⁇ l 10x ligase buffer in 50 ⁇ l reaction volume, with an overnight incubation at 16°C. Self-ligated DNA was then used as template in two rounds of PCR. As illustrated in
- Figure 1 the first round of PCR employed primers 2 and 3 (see below), while a second round (nested-round) used primers 1 and 4 (see below) to give specificity to amplification.
- the first round PCR reaction mix was as follows:
- Cycling conditions were 4 minute initial denaturation at 94°C followed by 35 cycles of: 10 seconds denaturation at 94°C, 10 seconds annealing at 55°C, 5 minute extension at 72°C. Final extension at 72°C for 7mins. 4°C hold.
- Primer 2 [15286_2_(pos.2085)] has the sequence: 5'- AATCAAGGTTTCATCTCCCG-S ' (SEQ ID NO.-9);
- Primer 3 [15286 3 _(pos.2453)] has the sequence:
- Second round (nested) PCR The second round PCR reaction mix was as follows: First round PCR reaction 1 ⁇ l
- Cycling conditions were 4 minute initial denaturation at 94°C followed by 25 cycles of: 10 seconds denaturation at 94°C, 10 seconds annealing at 55°C, 5 minute extension at 72°C. Final extension at 72°C for 7 minutes. 4°C hold.
- Primer 1 [15286_1 Jpos.2063)] has the sequence:
- Primer 4 [15286 4 _(pos.2521)] has the sequence:
- Amplified PCR fragments were ExoSAP treated and sequenced using the nested primers to reveal further DNA polA sequence data from which new gene walking primers could be designed. Two further separate steps of gene walking were required to generate fragments reaching the start and end of the T. indicus DNA polA gene.
- Primer 5 [15286_5_(pos.l036)] has the sequence: 5' - TCT CGC TTT GTT TTA ACC C - 3' (SEQ ID NO: 13);
- Primer 6 [15286_6_(pos.l013)] has the sequence:
- Primer 7 [15286_7 (pos.1008)] has the sequence: 5' - ACT TTA TCC GGG TCA AGA AC - 3' (SEQ ID NO: 15);
- Primer 8 [15286_8 (pos.941)] has the sequence:
- PCR fragments between ⁇ 750bp and 2kb were obtained from Hr ⁇ d III, Pst I, and Kpn I digested/self-ligated reaction templates.
- a start and stop for the Large (Klenow) fragment could be predicted (based on alignment with known DNA polA sequences, for example the Taq KlenTaq fragment), allowing specific primers to be designed to amplify the entire Large fragment gene ( ⁇ 1.7kb).
- the PCR reaction mix was as follows:
- Cycling conditions were 30 seconds initial denaturation at 98°C followed by 25 cycles of: 3 seconds denaturation at 98 0 C, 10 seconds annealing at 55°C, 1.5 minute extension at 72°C. Final extension at 72°C for 7 mins. 4°C hold.
- Example 5 pET24a(+)HIS vector construction
- the pET24a(+) vector (Novagen) was modified to add a 6x HIS tag upstream of Ndel site (see Figure 2).
- the HIS tag was inserted between Xbal and BamHI sites as follows.
- An overlapping primer pair of which an upper primer ⁇ Xbal has the sequence: 5' - TTC CCC TCT AGA AAT AAT TTT GTT TAA CTT TAA GAA GGA GAT ATA CTA TG CAC CA - 3' (SEQ ID NO:20), and
- a lower primer ⁇ BamHI has the sequence:
- T7_Promoter 5'-AAATTAATACGACTCACTATAGGG-S' (SEQ ID NO:22), T7_Terminator: 5'-GCTAGTTATTGCTCAGCGG-S' (SEQ ID NO:23).
- Example 6 Cloning of full length and Large fragment DNA polA PCR products from Example 4 were purified using Promega Wizard purification kit and then RE digested using Nde I/Sal I. DNA was phenol/chloroform extracted, ethanol-precipitated and resuspended in water.
- Example 7 Expression of full length and Large fi-agment DNA polymerases Recombinant colonies from Example 6 were grown up overnight in 5 ml Luria Broth
- T. indicus Large fragment DNA polymerase I was expressed at the predicted ⁇ 70kDa.
- FIG. 4 shows that T. indicus full length DNA polymerase I was expressed at the predicted ⁇ 103kDa.
- DNA polymerases are known to sometimes run slightly faster than expected on SDS PAGE gels, so that their apparent molecular weight is smaller than predicted.
- Example 8 PCR activity assay
- the PCR solution contained:
- the Upper ⁇ primer has the sequence:
- PCR proceeded with 35 cycles of: 3 seconds denaturation at 94°C, 10 seconds annealing at 55°C, 30 seconds extension at 72°C. Final extension at 72°C for 7mins. 4°C hold.
- Example 7 Samples obtained in Example 7 were also tested for loop-mediated isothermal amplification (LAMP) activity.
- LAMP loop-mediated isothermal amplification
- loopF Lambda-loopF-LAMP
- loopB Lambda-loopB-LAMP
- LAMP was performed in a total 25 ⁇ l reaction mixture containing 0.8 ⁇ M each of FIP and BIP, 0.2 ⁇ M each of F3 and B3, 0.4 ⁇ M each of loopF and loopB primers, 1.6mM dNTPs, IM betaine (Sigma), 2mM MgSO 4 , Ix Bst buffer (New England Biolabs), Ing ⁇ DNA, and either 8u Bst DNA polymerase large fragment (New England Biolabs; positive control) or l ⁇ l test sample (from Example 7), made up to volume with water. The mixture was incubated at 65°C for Ih and an aliquot run out on 1% agarose gel stained with ethidium bromide for detection of amplification.
- T. indicus Large fragment was tested using the 500bp ⁇ DNA PCR assay as described above in Example 7. Samples of the induced Large fragment were incubated at 95°C for 0, 2, 4, 6, 8, 10, 15 or 20 min, then used in the 500bp ⁇ DNA PCR assay. Under the conditions used, the Large fragment was found to be unaffected by up to 4 min incubation at 95 0 C, showed reduced PCR activity after 6 min incubation, and was unable to produce detectable PCR product after 8 min incubation (data not shown).
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Genetics & Genomics (AREA)
- Microbiology (AREA)
- Biotechnology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Enzymes And Modification Thereof (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Peptides Or Proteins (AREA)
Priority Applications (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/919,622 US8986968B2 (en) | 2008-02-28 | 2009-02-13 | Thermostable DNA polymerase |
| EP09714243.4A EP2247607B1 (en) | 2008-02-28 | 2009-02-13 | Enzyme |
| JP2010548164A JP5617075B2 (ja) | 2008-02-28 | 2009-02-13 | 酵素 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GB0803628.7 | 2008-02-28 | ||
| GB0803628A GB0803628D0 (en) | 2008-02-28 | 2008-02-28 | Enzyme |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2009106795A1 true WO2009106795A1 (en) | 2009-09-03 |
Family
ID=39284692
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2009/000411 Ceased WO2009106795A1 (en) | 2008-02-28 | 2009-02-13 | Enzyme |
Country Status (5)
| Country | Link |
|---|---|
| US (1) | US8986968B2 (https=) |
| EP (1) | EP2247607B1 (https=) |
| JP (1) | JP5617075B2 (https=) |
| GB (1) | GB0803628D0 (https=) |
| WO (1) | WO2009106795A1 (https=) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009087394A1 (en) * | 2008-01-11 | 2009-07-16 | Genesys Ltd | Cren7 chimeric protein |
| GB0804721D0 (en) * | 2008-03-14 | 2008-04-16 | Genesys Ltd | Enzyme |
| GB0804722D0 (en) * | 2008-03-14 | 2008-04-16 | Genesys Ltd | Enzyme |
| CN113637085B (zh) * | 2020-05-11 | 2024-01-30 | 苏州先达基因科技有限公司 | 融合dna聚合酶突变体及其在等温扩增中的应用 |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003048308A2 (en) * | 2001-11-30 | 2003-06-12 | Applera Corporation | Thermus brockianus nucleic acid polymerases |
| WO2006030455A1 (en) | 2004-09-17 | 2006-03-23 | Prokaria Ehf. | Dna polymerases having strand displacement activity |
| WO2007127893A2 (en) | 2006-04-28 | 2007-11-08 | Ge Healthcare Bio-Sciences Corp. | Thermostable dna polymerase from thermotoga naphthophila and thermotoga petrophellia |
Family Cites Families (27)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4952496A (en) | 1984-03-30 | 1990-08-28 | Associated Universities, Inc. | Cloning and expression of the gene for bacteriophage T7 RNA polymerase |
| US4965188A (en) | 1986-08-22 | 1990-10-23 | Cetus Corporation | Process for amplifying, detecting, and/or cloning nucleic acid sequences using a thermostable enzyme |
| US5079352A (en) | 1986-08-22 | 1992-01-07 | Cetus Corporation | Purified thermostable enzyme |
| US4889818A (en) | 1986-08-22 | 1989-12-26 | Cetus Corporation | Purified thermostable enzyme |
| US5374553A (en) | 1986-08-22 | 1994-12-20 | Hoffmann-La Roche Inc. | DNA encoding a thermostable nucleic acid polymerase enzyme from thermotoga maritima |
| US5047342A (en) | 1989-08-10 | 1991-09-10 | Life Technologies, Inc. | Cloning and expression of T5 DNA polymerase |
| US5270179A (en) | 1989-08-10 | 1993-12-14 | Life Technologies, Inc. | Cloning and expression of T5 DNA polymerase reduced in 3'- to-5' exonuclease activity |
| US5352778A (en) | 1990-04-26 | 1994-10-04 | New England Biolabs, Inc. | Recombinant thermostable DNA polymerase from archaebacteria |
| JP2709311B2 (ja) | 1990-09-28 | 1998-02-04 | エフ.ホフマン−ラ ロシュ アクチェンゲゼルシャフト | 熱安定性dnaポリメラーゼの5→3′のエキソヌクレアーゼ突然変異 |
| AU8906091A (en) | 1990-10-05 | 1992-04-28 | Wayne M. Barnes | Thermostable dna polymerase |
| US5948663A (en) | 1990-12-03 | 1999-09-07 | Stratagene | Purified thermostable pyrococcus furiosus DNA polymerase I |
| US5436149A (en) | 1993-02-19 | 1995-07-25 | Barnes; Wayne M. | Thermostable DNA polymerase with enhanced thermostability and enhanced length and efficiency of primer extension |
| US5512462A (en) | 1994-02-25 | 1996-04-30 | Hoffmann-La Roche Inc. | Methods and reagents for the polymerase chain reaction amplification of long DNA sequences |
| US5912155A (en) | 1994-09-30 | 1999-06-15 | Life Technologies, Inc. | Cloned DNA polymerases from Thermotoga neapolitana |
| US5614365A (en) | 1994-10-17 | 1997-03-25 | President & Fellow Of Harvard College | DNA polymerase having modified nucleotide binding site for DNA sequencing |
| JP3112148B2 (ja) | 1995-05-31 | 2000-11-27 | 東洋紡績株式会社 | 核酸の増幅方法およびその試薬 |
| US5773258A (en) | 1995-08-25 | 1998-06-30 | Roche Molecular Systems, Inc. | Nucleic acid amplification using a reversibly inactivated thermostable enzyme |
| US6627424B1 (en) | 2000-05-26 | 2003-09-30 | Mj Bioworks, Inc. | Nucleic acid modifying enzymes |
| EP1456394B2 (en) | 2001-11-28 | 2011-04-27 | Bio-Rad Laboratories, Inc. | Methods of using improved polymerases |
| US7666645B2 (en) | 2002-10-23 | 2010-02-23 | Bio-Rad Laboratories, Inc. | Sso7-polymerase conjugate proteins |
| CA2568998A1 (en) | 2004-06-04 | 2005-12-15 | Takara Bio Inc. | Polypeptides having dna polymerase activity |
| US20060228726A1 (en) | 2005-01-06 | 2006-10-12 | Martin Patrick K | Polypeptides having nucleic acid binding activity and compositions and methods for nucleic acid amplification |
| CA2615151A1 (en) | 2005-07-15 | 2007-01-25 | Stratagene California | Dna binding protein-polymerase chimeras |
| KR100777227B1 (ko) | 2005-10-08 | 2007-11-28 | 한국해양연구원 | 고호열성 dna 중합효소 및 이의 제조방법 |
| WO2009087394A1 (en) | 2008-01-11 | 2009-07-16 | Genesys Ltd | Cren7 chimeric protein |
| GB0804721D0 (en) | 2008-03-14 | 2008-04-16 | Genesys Ltd | Enzyme |
| GB0804722D0 (en) | 2008-03-14 | 2008-04-16 | Genesys Ltd | Enzyme |
-
2008
- 2008-02-28 GB GB0803628A patent/GB0803628D0/en not_active Ceased
-
2009
- 2009-02-13 WO PCT/GB2009/000411 patent/WO2009106795A1/en not_active Ceased
- 2009-02-13 JP JP2010548164A patent/JP5617075B2/ja active Active
- 2009-02-13 US US12/919,622 patent/US8986968B2/en active Active
- 2009-02-13 EP EP09714243.4A patent/EP2247607B1/en active Active
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003048308A2 (en) * | 2001-11-30 | 2003-06-12 | Applera Corporation | Thermus brockianus nucleic acid polymerases |
| WO2006030455A1 (en) | 2004-09-17 | 2006-03-23 | Prokaria Ehf. | Dna polymerases having strand displacement activity |
| WO2007127893A2 (en) | 2006-04-28 | 2007-11-08 | Ge Healthcare Bio-Sciences Corp. | Thermostable dna polymerase from thermotoga naphthophila and thermotoga petrophellia |
Non-Patent Citations (5)
| Title |
|---|
| GUO LI ET AL: "Biochemical and structural characterization of Cren7, a novel chromatin protein conserved among Crenarchaea.", NUCLEIC ACIDS RESEARCH MAR 2008, vol. 36, no. 4, March 2008 (2008-03-01), pages 1129 - 1137, XP002526277, ISSN: 1362-4962 * |
| MOUSSARD ET AL., INT. J. SYSTEMIC & EVOLUTIONARY MICROBIOL., vol. 54, 2004, pages 227 - 233 |
| MOUSSARD H ET AL: "Thermodesulfatator indicus gen. nov., sp. nov., a novel thermophilic chemolithoautotrophic sulfate-reducing bacterium isolated from the Central Indian Ridge.", INTERNATIONAL JOURNAL OF SYSTEMATIC AND EVOLUTIONARY MICROBIOLOGY, vol. 54, no. 1, January 2004 (2004-01-01), pages 227 - 233, XP002526275, ISSN: 1466-5026 * |
| NOTOMI ET AL., NUCLEIC ACIDS RES., vol. 28, 2000, pages 63 |
| SOUTHWORTH M W ET AL: "CLONING OF THERMOSTABLE DNA POLYMERASES FROM HYPERTHERMOPHILIC MARINE ARCHEA WITH EMPHASIS ON THERMOCOCCUS SP. 9 N-7 AND MUTATIONS AFFECTING 3'-5' EXONUCLEASE ACTIVITY", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF USA, NATIONAL ACADEMY OF SCIENCE, WASHINGTON, DC.; US, vol. 93, no. 11, 28 May 1996 (1996-05-28), pages 5281 - 5285, XP000652319, ISSN: 0027-8424 * |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2247607B1 (en) | 2013-10-02 |
| EP2247607A1 (en) | 2010-11-10 |
| US20110008848A1 (en) | 2011-01-13 |
| GB0803628D0 (en) | 2008-04-02 |
| JP5617075B2 (ja) | 2014-11-05 |
| JP2011512812A (ja) | 2011-04-28 |
| US8986968B2 (en) | 2015-03-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| KR100882711B1 (ko) | 사이크로박터 스피시스 hj147 균주 유래의 우라실-dna글리코실라제 및 이의 용도 | |
| Yan et al. | In vitro stabilization and in vivo solubilization of foreign proteins by the beta subunit of a chaperonin from the hyperthermophilic archaeon Pyrococcus sp. strain KOD1 | |
| EP2240576B1 (en) | Cren7 chimeric protein | |
| EP2252687B1 (en) | A thermostable dna polymerase from palaeococcus helgesonii | |
| US8986968B2 (en) | Thermostable DNA polymerase | |
| CN113637085B (zh) | 融合dna聚合酶突变体及其在等温扩增中的应用 | |
| WO2006030455A1 (en) | Dna polymerases having strand displacement activity | |
| CN111433373B (zh) | Dna聚合酶 | |
| EP2252692B1 (en) | A thermostable dna polymerase from palaeococcus ferrophilus | |
| KR100777227B1 (ko) | 고호열성 dna 중합효소 및 이의 제조방법 | |
| US20100297706A1 (en) | Mutant dna polymerases and their genes from thermococcus | |
| WO2008041825A1 (en) | Mutant dna polymerases and their genes | |
| US20080311626A1 (en) | Dna Polymerases Having Strand Displacement Activity | |
| WO2007117331A2 (en) | Novel dna polymerase from thermoanaerobacter tengcongenesis | |
| US20250297236A1 (en) | Identifying the minimal catalytic core of dna polymerase d and applications thereof | |
| JP7612678B2 (ja) | 海洋性dnaポリメラーゼi | |
| KR20100060283A (ko) | 신규한 내열성 dna 중합효소 | |
| Susanti et al. | Cloning, homological analysis, and expression of DNA Pol I from Geobacillus thermoleovorans | |
| KR101296882B1 (ko) | 써모코커스 와이오타푸엔시스 균주 유래의 dna 중합효소 변이체들 및 이의 이용 | |
| WO2024262588A1 (ja) | 核酸増幅における増幅バイアスの低減方法 | |
| WO2007076464A2 (en) | Thermostable dna polymerase from thermus filiformis | |
| Chalov et al. | Thermostable DNA-polymerase from the thermophilic archaeon microorganism Archaeoglobus fulgidus VC16 and its features | |
| JPH1042872A (ja) | 改変された耐熱性dnaポリメラーゼおよびその用途 | |
| JP2003508012A (ja) | ピロバクルム・イスランジカム(Pyrobaculumislandicum)由来のDNAポリメラーゼ | |
| HK1157399A1 (en) | Mutant dna polymerases and related methods |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 09714243 Country of ref document: EP Kind code of ref document: A1 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009714243 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12919622 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2010548164 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |