WO2009080437A1 - Procédé d'analyse de la résistance aux médicaments par les micro-arn - Google Patents

Procédé d'analyse de la résistance aux médicaments par les micro-arn Download PDF

Info

Publication number
WO2009080437A1
WO2009080437A1 PCT/EP2008/066239 EP2008066239W WO2009080437A1 WO 2009080437 A1 WO2009080437 A1 WO 2009080437A1 EP 2008066239 W EP2008066239 W EP 2008066239W WO 2009080437 A1 WO2009080437 A1 WO 2009080437A1
Authority
WO
WIPO (PCT)
Prior art keywords
hsa
mir
cancer
disease
microrna
Prior art date
Application number
PCT/EP2008/066239
Other languages
English (en)
Other versions
WO2009080437A9 (fr
Inventor
Lars Kongsbak
Ralf SØKILDE
Thomas Litman
Søren Møller
Original Assignee
Exiqon A/S
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Exiqon A/S filed Critical Exiqon A/S
Publication of WO2009080437A1 publication Critical patent/WO2009080437A1/fr
Publication of WO2009080437A9 publication Critical patent/WO2009080437A9/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/16—Primer sets for multiplex assays
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/178—Oligonucleotides characterized by their use miRNA, siRNA or ncRNA

Definitions

  • the invention relates to the analysis of samples, such as disease samples, such as cancer samples, isolated from patients to determine or predict the phenotype of the patient or disease, such as cancer, with respect to the resistance or susceptibility of the patient or disease to treatment, such as cancer treatment.
  • the analysis is based on determination of the abundance of microRNAs which are associated with resistance against the treatment, such as extreme drug resistance (EDR).
  • EDR extreme drug resistance
  • MicroRNAs have rapidly emerged as an important class of short endogenous RNAs that act as post-transcriptional regulators of gene expression by base-pairing with their target mRNAs.
  • microRNAs are differentially expressed in human cancers and a series of recent publication show that microRNA classify human cancers; in some cases improvement over mRNA classification is observed. Indeed, in a series of publications during recent years, it has become clear that microRNAs are extensively involved in cancer pathogenesis, and microRNA has been shown to be differentially expressed in a number of cancers (Breast cancer: Iorio et al Cancer Res 2005; 65: 7065. Lung cancer: Yanaihara et al Cell Science 2006; 9: 189-198. Chronic lymphocytic leukaemia (CLL) : GaNn et al PNAS, 2004 101(32) : 11755-11760.
  • CLL Chronic lymphocytic leukaemia
  • Colon cancer Cummins et al PNAS 2006, 103 (10) :3687-3692.
  • Prostate cancer Volinia et al PNAS 2006; 103: 2257).
  • Lu et al demonstrated that differential expression of microRNA in multiple cancers types, and that signatures based on approximately 200 microRNAs improve classification of poorly differentiated cancers over mRNA profiles.
  • microRNA'nome The expected complexity of the "microRNA'nome” is far smaller than the human transcriptome with the total number of microRNAs being approximately limited to between 800 and 1000. Therefore, a microRNA cancer signature can be predicted to include from 5 - 20 microRNAs, suggesting that microRNA based theranostics will be of limited complexity and far more robust than mRNA profiles.
  • the therapy out come predication may be the prediction of the suitability of the treatment of the cancer to combined adjuvant therapy.
  • the therapy may be herceptin, which is frequently used for the treatment of oestrogen receptor positive cancers (such as breast cancer).
  • microRNAs oligonucleotides which comprise nucleotide analogues, such as locked nucletic acids (LNAs).
  • LNAs locked nucletic acids
  • WO2005/098029 discloses a method using oligonucleotides for the detection, quantification, monitoring of expression of miRNA. It is suggested that the method can be used for determining the differences between nucleic acid samples from e.g. a cancer patient.
  • the Sanger Institute publishes known miRNA sequences in the miRBase database (http://microrna.sanqer.ac.uk/sequences/index.shtml). To date there are 533 human miRNAs present in the miRBase database.
  • the Extreme Drug Resistance (EDR®, Oncotech Inc.) assay is an in vitro test that measures the ability of pharmaceutical agents and other chemotherapies to stop cancer cells from dividing and growing - it has been reported that the assay identifies patients that will not respond to a particular cancer treatment with over 99% accuracy and is used to exclude agents unlikely to provide a therapeutic benefit in the treatment of cancer in an individual patient, as well as in providing information which can be used to select those agents which are likely to be clinically effective, resulting in improved response rates and prolonged survival of cancer patients.
  • EDR® Extreme Drug Resistance
  • the EDR® assay method involves the isolation of fresh viable tumor tissue which is minced and digested with enzymes to disaggregate the tumor cells. The cells are then placed in soft agar to encourage cell proliferation before being exposed to the chemotherapeutic agents, typically for a period of five days and at an elevated dosage, during the latter period of drug exposure tritiated thymidine is added as a measure of cell proliferation. By comparing the level of label incorporated into drug treated and untreated controls, the degree of cell proliferation under the drug treatment is determined, and thereby the resistance phenotype of the cancer cells.
  • the assay requires a relatively large amount of tumour tissue, and takes about 7 days to perform. There is therefore a need for improved drug resistance assays, which use less cancer tissue and may be performed in a shorter time period.
  • US 2004/0214203 reports on methods for prognosis, diagnosis, staging and disease progression in human cancer patients related to expression of levels of a plurality of genes that are differentially expressed in chemotherapeutic drug resistant and drug sensitive tumour cells.
  • US 2006/0160114 reports on methods for prognosis, diagnosis, staging and disease progression in human cancer patients related to expression of levels of one or a plurality of genes or genetic loci that are differentially deleted, amplified, expressed or amplified and over-expressed in chemotherapeutic drug resistant tumor cells.
  • the invention is based upon the discovery that microRNA profiling of cancer cells or tissues may be used as an efficient, effective and rapid indicator of a drug resistance or drug susceptibility phenotype of cancer cells.
  • microRNA profiling may be used as a method of predicting the phenotype of a subject suffering from a disease, or or the phenotype of a sample or cell(s) obtained from said patient, which may, suitably consist or comprise of a sample of diseased tissue or cells, such as a cancer sample (or cell(s)), with respect to the resistance or susceptibility of the subject or sample or cell(s) to one or more treatments of the disease.
  • the invention provides for a method for determining whether a disease or state of disease shows resistance to, or susceptibility to, at least one treatment of said disease, such as administration of at least one therapeutic compound, said method comprising the steps of
  • a Isolating or obtaining a sample of tissue from a subject; b. assaying the abundance of at least one microRNA present in said sample,
  • microRNA is correlated to the resistance or susceptibility of the disease or state of disease to said administration of at least one treatment of said disease.
  • the disease is cancer
  • the at least one treatment is a cancer treatment, such as at least one chemotherapeutic drug.
  • the sample referred to in step a) is a sample of said cancer.
  • the invention provides for a method for determining whether a cancer shows resistance (or is resistant to) or susceptibility to at least one cancer treatment, such as at least one chemotherapeutic drug, said method comprising the steps of:
  • the invention provides for a method for determining whether a cancer shows or is resistant to, or is susceptible to at least one cancer treatment, said method comprising the step of assaying the abundance of at least one microRNA present in said cancer, wherein over or under abundance of said at least one microRNA is correlated to the resistance or susceptibility of the cancer to said at least one cancer treatment.
  • the invention provides for a method for the prognosis or diagnosis of at least one disease, such as cancer treatment in a subject suffering from said disease, such as cancer, said method comprising the steps of:
  • prognosis the likely prognosis for the subject if said at least one disease treatment were to be administered (prognosis).
  • the sample isolated or obtained from the subject is or comprises diseased tissue or cells, such as is a cancer sample.
  • the disease is preferably a cell hyperproliferative disease such as cancer.
  • the invention further provides for the use of one (or more) detection probe(s) which, (independently) comprises a contiguous nucleobases sequence which is complementary to a microRNA sequence (or is capable of specifically hybridising to said microRNA), for the detection of the abundance of the microRNA in a disease sample (e.g. isolated from a patient), in order to determine whether the disease sample (such as the disease present in the patient) has a disease treatment resistant or disease treatment susceptible phenotype, wherein over or under abundance of said at least one microRNA is correlated to the resistance or susceptibility of the disease to at least one disease treatment.
  • a disease sample e.g. isolated from a patient
  • the invention further provides for a method of treatment of a disease, such as cancer, in a subject suffering from said disease, said method comprising the steps of performing the method according to one of the above embodiment to identify one or more disease treatments, such as cancer treatments, which have a positive prognosis in treatment of said disease, and subsequently administering said one or more disease treatments which have a positive prognosis to said subject.
  • a disease such as cancer
  • the invention further provides for a method for identifying one or more microRNAs which are indicators of either the resistance or the susceptibility of a disease, such as cancer, to at least one treatment, such as cancer treatment, said method comprising the steps of:
  • At least one disease sample such as cancer sample which is identified as being sensitive to said at least one disease treatment
  • step b comparing the abundance of each member of a population of independent microRNAs in the fractions obtained in i) and ii) of step a) to identify those microRNAs whose abundance is either correlated with the resistant of the disease to the at least one disease, or the susceptibility of the disease to the at least one disease treatment.
  • the method may be performed on a population of samples, such as disease or cancer samples, which may represent a disease or cancer samples isolated from a population of subjects suffering from the disease, such as cancer patients, which, suitably, are (or were) suffering from the disease, such as a particular form of cancer, such as those referred to herein.
  • samples such as disease or cancer samples
  • cancer samples which may represent a disease or cancer samples isolated from a population of subjects suffering from the disease, such as cancer patients, which, suitably, are (or were) suffering from the disease, such as a particular form of cancer, such as those referred to herein.
  • the invention provides a method for identifying one or a plurality of microRNAs having a pattern of expression that is different in a tumor cell sensitive to at least one cancer treatment compared to the expression pattern in a cancer cell resistant to the at least one cancer treatment, the method comprising the steps of:
  • FIGURES c) identifying at least one microRNA having an expression pattern that is different in the cancer treatment resistant cells than in the cancer treatment sensitive cells.
  • Figure 1 provides a list of cancer types and the therapeutic agents which are commonly used to treat the cancer type which are typically amenable to the EDR® assay, and therefore may be suitable cancer types and cancer treatments according to the present invention.
  • Figure 2 is a diagram representing the steps involved in performing the classical EDR® assay.
  • FIG. 3 shows the frequency of single and multiple drug resistance (EDR) of various colon cancer samples.
  • Figure 4 shows a Venn diagram illustrating the correlation of specific miRNAs with the EDR status of these chemotherapeutic agents in various colon cancer samples.
  • Figure 5 shows the frequency of single and multiple LDR status of various colon cancer samples.
  • Figure 6 shows a summary of the groups of EDR, LDR and IDR status of the colon samples.
  • Figure 7 shows LDA plot based on the 40 most significant miRs (p ⁇ 0.05) after standard deviation (SD) filtering showing near-perfect separation between EDR to irinotecan (red/light grey) and EDR to Oxaliplatin (blue/dark grey) for formalin fixed, paraffin embedded (FFPE) specimens.
  • SD standard deviation
  • Figure 8 shows unsupervised hierarchical clustering based on the 33 miRNAs that vary most between EDR-Oxaliplatin and EDR-Irinotecan samples (p ⁇ 0.05, logR>0.2) for FFPE specimens.
  • Figure 9 shows LDA plot based on the 37 most significant miRNAs (p ⁇ 0.05) after SD filtering. Perfect separation between EDR to irinotecan (red/light grey) and EDR to 5-FU (blue/dark grey) for FFPE specimens.
  • Figure 10 shows unsupervised hierarchical clustering based on the 34 miRNAs that vary most between EDR-5-FU and EDR-Irinotecan samples (p ⁇ 0.05, logR>0.2) for FFPE specimens.
  • Figure 11 shows LDA plot based on the 33 most significant miRs (p ⁇ 0.01) after SD filtering. Perfect separation between EDR to Oxaliplatin (red/light grey) and EDR to 5-FU (blue/dark grey) for FFPE specimens.
  • Figure 12 shows unsupervised hierarchical clustering based on the 33 miRNAs that vary most between EDR-5-FU and EDR-Oxalilpatin samples (p ⁇ 0.01) for FFPE specimens.
  • Figure 13 shows LDA plot based on the 28 most significant miRNAs (p ⁇ 0.05). Perfect separation between EDR to irinotecan (red/light grey) and EDR to Oxaliplatin (blue/dark grey) for fresh frozen specimens.
  • Figure 14 shows unsupervised hierarchical clustering based on the 28 miRNAs that vary most between EDR-Oxaliplatin and EDR-Irinotecan samples (p ⁇ 0.05) for fresh frozen specimens.
  • Ligands means something, which binds.
  • Ligands may comprise biotin and functional groups such as: aromatic groups (such as benzene, pyridine, naphtalene, anthracene, and phenanthrene), heteroaromatic groups (such as thiophene, furan, tetrahydrofuran, pyridine, dioxane, and pyrimidine), carboxylic acids, carboxylic acid esters, carboxylic acid halides, carboxylic acid azides, carboxylic acid hydrazides, sulfonic acids, sulfonic acid esters, sulfonic acid halides, semicarbazides, thiosemicarbazides, aldehydes, ketones, primary alcohols, secondary alcohols, tertiary alcohols, phenols, alkyl halides, thiols, disulphides, primary amines, secondary amines, tertiary amines, hydrazines,
  • a cell includes a plurality of cells, including mixtures thereof.
  • a nucleic acid molecule includes a plurality of nucleic acid molecules.
  • Sample refers to a sample of cells, or tissue or fluid isolated from an organism or organisms, including but not limited to, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumors, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components).
  • Detection probes or “detection probe” or “detection probe sequence” refer to an oligonucleotide or oligonucleotide analogue, which oligonucleotide or oligonucleotide analogue comprises a recognition sequence complementary to a nucleotide target, such as an RNA (or DNA) target sequence. It is preferable that the detection probe(s) are oligonucleotides, preferably where said recognition sequence is substituted with high-affinity nucleotide analogues, e.g. LNA, to increase the sensitivity and specificity of conventional oligonucleotides, such as DNA oligonucleotides, for hybridization to short target sequences, e.g. mature miRNAs, stem-loop precursor miRNAs.
  • high-affinity nucleotide analogues e.g. LNA
  • miRNA refers to about 18-25 nt non-coding RNAs derived from endogenous genes. They are processed from longer (ca 75 nt) hairpin-like precursors termed pre-miRNAs. MicroRNAs assemble in complexes termed miRNPs and recognize their targets by antisense complementarity. If the microRNAs match 100% their target, i.e. the complementarity is complete, the target mRNA is cleaved, and the miRNA acts like a siRNA. If the match is incomplete, i.e. the complementarity is partial, then the translation of the target mRNA is blocked.
  • microRNA precursor or “miRNA precursor” or “pre-miRNA” or “premature miRNA” refer to polynucleotide sequences (approximately 70 nucleotides in length) that form hairpin- like structures having a loop region and a stem region.
  • the stem region includes a duplex cre-ated by the pairing of opposite ends of the pre-miRNA polynucleotide sequence.
  • the loop region connects the two halves of the stem region.
  • the pre-miRNAs are transcribed as mono- or poly-cistronic, long, primary precursor transcripts (pri-miRNAs) that are then cleaved into individual pre-miRNAs by a nuclear RNAse Ill-like enzyme.
  • pre-miRNA hairpins are exported to the cytoplasm where they are processed by a second RNAse Ill-like enzyme into miRNAs.
  • the target nucleic acid may be present in a premature miRNA sequence.
  • the fragments from the opposing arm, called the miRNA* (or "miRNA-star") sequences (Lau et al, Science (2001) 294:858-862) are found in libraries of cloned miRNAs but typically at much lower frequency than are the miRNAs. For example, in an effort that identified over 3400 clones representing 80 C. elegans miRNAs, only 38 clones representing 14 miRNAs* were found.
  • the target nucleic acid may be present in a miRNA* sequence.
  • miRNA precursor loop sequence or "loop sequence of the miRNA precursor” or “loop region” of an miRNA precursor is the portion of an miRNA precursor that is not present in the stem region and that is not retained in the mature miRNA (or its complement) upon cleavage by a RNAse Ill-like enzyme.
  • miRNA precursor stem sequence or “stem sequence of the miRNA precursor” or “stem region” of an miRNA precursor is the portion of an miRNA precursor created by the pairing of opposite ends of the pre-miRNA polynucleotide sequence, and including the portion of the miRNA precursor that will be retained in the "mature miRNA.”
  • Recognition sequence refers to a nucleotide sequence that is complementary to a region within the target nucleotide sequence essential for sequence-specific hybridization between the target nucleotide sequence and the recognition sequence.
  • the recognition seqeunce comprises or consists of a contiguous nucleobase sequence which corresponds to a contiguous nucleotide seqeunce present in the miRNA target.
  • nucleobase sequences which "correspond to" a miRNA target therefore have between 8 and 30 contiguous nucleobases which form a sequence which is found with i) either the one or more of the miRNA(s), or ii) the reverse complement thereof.
  • Nucleotide analogues are compared directly to their equivalent or corresponding natural nucleotides. Sequences which form the reverse complement of a target miRNA are referred to as the complement sequence of the miRNA.
  • the term complementary refers to fully or perfectly complementary.
  • corresponding means identical to or complementary to the designated nucleotide or nucleobase sequence.
  • a corresponding or complementary oligonucleotide or detection probe referred to herein is not necessarily physically derived from any existing or natural sequence but may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription or a combination thereof.
  • the term 'natural allelic variants' and the term 'allelic variants' encompasses both variants which although have a slightly different sequence (such as a homologue, fragment or variant), originate from the same chromosomal position, or the same position on an allelic chromosome, as the non-coding RNAs, and precursors thereof herein listed.
  • allelic variants' and the term 'allelic variants' also encompasses mature non-coding RNAs encompasses, which may be differentially processed by the processing enzymes, as this may lead to variants of the same microRNAs having different lengths e.g. shortened by 1 or 2 nucleotides, despite originating from the same allelic chromosome position.
  • label refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein. Labels may provide signals detectable by fluorescence, radioactivity, colorimetric, X- ray diffraction or absorption, magnetism, enzymatic activity, and the like.
  • nucleic acid refers to primers, probes, oligomer fragments to be detected, oligomer controls and unlabeled blocking oligomers and shall be generic to polydeoxyribonucleotides (containing 2-deoxy-D- ribose), to polyribonucleotides (containing D-ribose), to any other type of polynucleotide which is an N glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases, and in one embodiment, nucleobases (a collective term used to describe both nucleotides and nucleotide analogues, such as LNA).
  • nucleobases a collective term used to describe both nucleotides and nucleotide analogues, such as LNA
  • nucleic acid refers only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single stranded RNA.
  • the oligonucleotide is comprised of a sequence of approximately at least 3 nucleotides, preferably at least about 6 nucleotides, and more preferably at least about 8 - 30 nucleotides corresponding to a region of the designated target nucleotide sequence.
  • oligonucleotide or “nucleic acid” intend a polynucleotide of genomic DNA or RNA, cDNA, semi synthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of the polynucleotide with which it is associated in nature; and/or (2) is linked to a polynucleotide other than that to which it is linked in nature; and (3) is not found in nature.
  • an end of an oligonucleotide is referred to as the "5' end” if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end” if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring.
  • a nucleic acid sequence even if internal to a larger oligonucleotide, also may be said to have a 5' and 3' ends.
  • the 3' end of one oligonucleotide points toward the 5' end of the other; the former may be called the "upstream” oligonucleotide and the latter the "downstream” oligonucleotide.
  • SBC nucleobases Selective Binding Complementary nucleobases, i.e. modified nucleobases that can make stable hydrogen bonds to their complementary nucleobases, but are unable to make stable hydrogen bonds to other SBC nucleobases.
  • the SBC nucleobase A' can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, T.
  • the SBC nucleobase T' can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, A.
  • the SBC nucleobases A' and T' will form an unstable hydrogen bonded pair as compared to the base pairs A'-T and A-T'.
  • a SBC nucleobase of C is designated C and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase G
  • a SBC nucleobase of G is designated G' and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase C
  • C and G' will form an unstable hydrogen bonded pair as compared to the base pairs C-G and C-G'.
  • a stable hydrogen bonded pair is obtained when 2 or more hydrogen bonds are formed e.g. the pair between A' and T, A and T', C and G', and C and G.
  • An unstable hydrogen bonded pair is obtained when 1 or no hydrogen bonds is formed e.g. the pair between A' and T', and C and G'.
  • SBC nucleobases are 2,6-diaminopurine (A', also called D) together with 2-thio- uracil (U', also called 2S U)(2-thio-4-oxo-pyrimidine) and 2-thio-thymine (T', also called 2S T)(2- thio-4-oxo-5-methyl-pyrimidine).
  • A' 2,6-diaminopurine
  • U 2-thio- uracil
  • T' 2-thio-thymine
  • Figure 4 in PCT Publication No. WO 2004/024314 illustrates that the pairs A- 2S T and D-T have 2 or more than 2 hydrogen bonds whereas the D- 2S T pair forms a single (unstable) hydrogen bond.
  • SBC nucleobases pyrrolo-[2,3- d]pyrimidine-2(3H)-one (C, also called PyrroloPyr) and hypoxanthine (G', also called I)(6- oxo-purine) are shown in Figure 4 in PCT Publication No. WO 2004/024314 where the pairs PyrroloPyr-G and C-I have 2 hydrogen bonds each whereas the PyrroloPyr-I pair forms a single hydrogen bond.
  • SBC LNA oligomer refers to a "LNA oligomer” containing at least one LNA monomer where the nucleobase is a "SBC nucleobase”.
  • LNA monomer with an SBC nucleobase is meant a “SBC LNA monomer”.
  • SBC LNA oligomers include oligomers that besides the SBC LNA monomer(s) contain other modified or naturally occurring nucleotides or nucleosides.
  • SBC monomer is meant a non-LNA monomer with a SBC nucleobase.
  • isosequential oligonucleotide an oligonucleotide with the same sequence in a Watson-Crick sense as the corresponding modified oligonucleotide e.g. the sequences agTtcATg is equal to agTscD 2S Ug where s is equal to the SBC DNA monomer 2-thio-t or 2- thio-u, D is equal to the SBC LNA monomer LNA-D and 2S U is equal to the SBC LNA monomer LNA 2S U.
  • nucleic acid sequence refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association.”
  • Bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention include, for example, inosine and 7-deazaguanine. Complementarity may not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases.
  • nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, percent concentration of cytosine and guanine bases in the oligonucleotide, ionic strength, and incidence of mismatched base pairs.
  • T m melting temperature
  • the term "internal reference marker”, refers to a genetic sequence, such as a DNA or RNA sequence, whose abundance does not differ significantly across samples, such as between a diseased and a comparative non-disease cell.
  • the internal reference marker in one embodiment may be a non-coding RNA, or a mRNA.
  • house keeping genes or their respective RNA species, which show constitutive expression in most cell types, such as in the cell types where the cancer sample was isolated or obtained, are selected as internal reference markers.
  • nucleobase covers the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturally occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N 5 -methyladenine, 7-deazaxanthine, 7-deazaguanine,
  • nucleobase thus includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non naturally occurring nucleobases include those disclosed in U.S. Patent No. 3,687,808; in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993; in Englisch, et al., Angewandte Chemie, International Edition, 30: 613-722, 1991 (see, especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley & Sons, pages 858-859, 1990, Cook, Anti-Cancer DrugDesign 6: 585-607, 1991, each of which are hereby incorporated by reference in their entirety).
  • nucleoside base or “nucleobase analogue” is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain "universal bases” that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases.
  • a universal base is 3-nitropyrrole or a 5-nitroindole.
  • Other preferred compounds include pyrene and pyridyloxazole derivatives, pyrenyl, pyrenylmethylglycerol derivatives and the like.
  • Other preferred universal bases include, pyrrole, diazole or triazole derivatives, including those universal bases known in the art.
  • oligonucleotide By “oligonucleotide,” “oligomer,” or “oligo” is meant a successive chain of monomers (e.g., glycosides of heterocyclic bases) connected via internucleoside linkages.
  • LNA LNA nucleoside or LNA nucleotide
  • LNA oligomer e.g., an oligonucleotide or nucleic acid
  • nucleic acids 99/14226 are in general particularly desirable modified nucleic acids for incorporation into an oligonucleotide of the invention.
  • the nucleic acids may be modified at either the 3' and/or 5' end by any type of modification known in the art. For example, either or both ends may be capped with a protecting group, attached to a flexible linking group, attached to a reactive group to aid in attachment to the substrate surface, etc.
  • Desirable LNA monomers and their method of synthesis also are disclosed in US 6,043,060, US 6,268,490, PCT Publications WO 01/07455, WO 01/00641, WO 98/39352, WO 00/56746, WO 00/56748 and WO 00/66604 as well as in the following papers: Morita et al., Bioorg. Med. Chem. Lett. 12(l) :73-76, 2002; Hakansson et al., Bioorg. Med. Chem. Lett. ll(7) :935-938, 2001; Koshkin et al., J. Org. Chem.
  • LNA monomers also referred to as "oxy-LNA” are LNA monomers which include bicyclic compounds as disclosed in PCT Publication WO 03/020739 wherein the bridge between R 4 and R 2 as shown in formula (I) below together designate -CH 2 -O- or -CH 2 -CH 2 -O-.
  • LNA modified oligonucleotide or "LNA substituted oligonucleotide” is meant a oligonucleotide comprising at least one LNA monomer of formula (I), described infra, having the below described illustrative examples of modifications:
  • X is selected from -O-, -S-, -N(R N )-, -C(R 5 R 5* )-, -0-C(R 7 R 7* )-, -C(R 5 R 5* )-O-, -S- C(R 7 R 7* )-, -C(R 5 R 5* )-S-, -N(R N* )-C(R 7 R 7* )-, -C(R 5 R 5* )-N(R N* )-, and -C(R 5 R 5* )-C(R 7 R 7* ).
  • B is selected from a modified base as discussed above e.g.
  • an optionally substituted carbocyclic aryl such as optionally substituted pyrene or optionally substituted pyrenylmethylglycerol, or an optionally substituted heteroalicylic or optionally substituted heteroaromatic such as optionally substituted pyridyloxazole, optionally substituted pyrrole, optionally substituted diazole or optionally substituted triazole moieties; hydrogen, hydroxy, optionally substituted Ci- 4 -alkoxy, optionally substituted Ci- 4 -alkyl, optionally substituted Ci -4 - acyloxy, nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands.
  • P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group, such internucleoside linkage or 5'-terminal group optionally including the substituent R 5 .
  • One of the substituents R 2 , R 2* , R 3 , and R 3* is a group P* which designates an internucleoside linkage to a preceding monomer, or a 2'/3'-terminal group.
  • Each of the substituents R 1* , R 2 , R 2* , R 3 , R 4* , R 5 , R 5* , R 5 and R 5* , R 7 , and R 7* which are present and not involved in P, P * or the biradical(s), is independently selected from hydrogen, optionally substituted Ci_i 2 -alkyl, optionally substituted C 2 _i 2 -alkenyl, optionally substituted C 2 -i 2 -alkynyl, hydroxy, Ci_i 2 -alkoxy, C 2 _i 2 -alkenyloxy, carboxy, Ci_i 2 -alkoxycarbonyl, Ci -I2 - alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di-(Ci- 6 - al
  • Exemplary 5', 3', and/or 2' terminal groups include -H, -OH, halo (e.g., chloro, fluoro, iodo, or bromo), optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g., methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g.
  • acetyl or benzoyl aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, acylamino, aroylamino, alkylsulfonyl, arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl, heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio, aralkylthio, heteroaralkylthio, amidino, amino, carbamoyl, sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl, 4,4'-dimethoxytrityl, monomethoxytrityl, or tr
  • references herein to a nucleic acid unit, nucleic acid residue, LNA monomer, or similar term are inclusive of both individual nucleoside units and nucleotide units and nucleoside units and nucleotide units within an oligonucleotide.
  • a “modified base” or other similar terms refer to a composition (e.g., a non-naturally occurring nucleobase or nucleosidic base), which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturally occurring nucleobase or nucleosidic base.
  • the modified base provides a T m differential of 15, 12, 10, 8, 6, 4, or 2 0 C or less as described herein.
  • Exemplary modified bases are described in EP 1 072 679 and WO 97/12896.
  • the term "chemical moiety” refers to a part of a molecule. "Modified by a chemical moiety” thus refer to a modification of the standard molecular structure by inclusion of an unusual chemical structure. The attachment of said structure can be covalent or non-covalent.
  • inclusion of a chemical moiety in an oligonucleotide probe thus refers to attachment of a molecular structure.
  • chemical moiety include but are not limited to covalently and/or non-covalently bound minor groove binders (MGB) and/or intercalating nucleic acids (INA) selected from a group consisting of asymmetric cyanine dyes, DAPI, SYBR Green I, SYBR Green II, SYBR Gold, PicoGreen, thiazole orange, Hoechst 33342, Ethidium Bromide, l-O-(l-pyrenylmethyl)glycerol and Hoechst 33258.
  • MGB covalently and/or non-covalently bound minor groove binders
  • INA intercalating nucleic acids
  • Other chemical moieties include the modified nucleobases, nucleosidic bases or LNA modified oligonucleotides.
  • Oligonucleotide analogue refers to a nucleic acid binding molecule capable of recognizing a particular target nucleotide sequence.
  • a particular oligonucleotide analogue is peptide nucleic acid (PNA) in which the sugar phosphate backbone of an oligonucleotide is replaced by a protein like backbone.
  • PNA peptide nucleic acid
  • nucleobases are attached to the uncharged polyamide backbone yielding a chimeric pseudopeptide-nucleic acid structure, which is homomorphous to nucleic acid forms.
  • High affinity nucleotide analogue or “affinity-enhancing nucleotide analogue” refers to a non-naturally occurring nucleotide analogue that increases the "binding affinity" of an oligonucleotide probe to its complementary recognition sequence when substituted with at least one such high-affinity nucleotide analogue.
  • a probe with an increased "binding affinity" for a recognition sequence compared to a probe which comprises the same sequence but does not comprise a stabilizing nucleotide refers to a probe for which the association constant (K 3 ) of the probe recognition segment is higher than the association constant of the complementary strands of a double- stranded molecule.
  • the association constant of the probe recognition segment is higher than the dissociation constant (K d ) of the complementary strand of the recognition sequence in the target sequence in a double stranded molecule.
  • Monomers are referred to as being "complementary” if they contain nucleobases that can form hydrogen bonds according to Watson-Crick base-pairing rules (e.g. G with C, A with T or A with U) or other hydrogen bonding motifs such as for example diaminopurine with T, 5- methyl C with G, 2-thiothymidine with A, inosine with C, pseudoisocytosine with G, etc.
  • the term “succeeding monomer” relates to the neighbouring monomer in the 5'-terminal direction and the "preceding monomer” relates to the neighbouring monomer in the 3'- terminal direction.
  • the "target” or “target nucleic acid” or “target ribonucleic acid” refers to any relevant nucleic acid of a single specific sequence, e. g., a biological nucleic acid, e. g., derived from a subject or human being.
  • the "target” is a human miRNA or precursor thereof, or in one embodiment, a molecule which retains the genetic sequence information contained therein - such as all or (a sufficient) part of the seqeunce of nucleobases or reverse complement thereof.
  • Target sequence refers to a specific nucleic acid sequence (or corresponding nuceltobase seqeunce) within any target nucleic acid.
  • stringent conditions is the “stringency” which occurs within a range from about T m -5° C. (5° C. below the melting temperature (T m ) of the probe) to about 20° C. to 25° C. below T m .
  • T m melting temperature
  • the stringency of hybridization may be altered in order to identify or detect identical or related polynucleotide sequences.
  • Hybridization techniques are generally described in Nucleic Acid Hybridization, A Practical Approach, Ed. Hames, B. D. and Higgins, S. J., IRL Press, 1985; Gall and Pardue, Proc. Natl. Acad. ScL, USA 63: 378-383, 1969; and John, et al. Nature 223: 582-587, 1969.
  • the term "specifically hybridise” is determined by whether the oligonucleotide or compound of the invention hybridises to the target nucleic acid sequence under stringent conditions.
  • nucleobase sequence and “contiguous nucleobase sequence” are used interchangeably.
  • the methods and uses according to the present invention may be used for determining whether a disease or state of disease shows resistance to or susceptibility to a treatment
  • the preferred embodiment refers to the disease being cancer.
  • the embodiments may also be used to refer to a disease or disease state in general.
  • the invention provides for a method for determining whether a cancer, or a sample thereof, or a cancer cell or a population of cancer cells, shows resistance (or is resistant to) or susceptibility to at least one cancer treatment, such as at least one chemotherapeutic drug, said method comprising the steps of:
  • said at least one microRNA is correlated to the either resistance or susceptibility of the cancer, or the sample thereof, or the cancer cell or the population of cancer cells, to said at least one cancer treatment.
  • the method for determining whether a cancer (or cancer sample) shows resistance or is susceptible to at least one cancer treatment is suitably an in vitro method, although, in one optional embodiment, it may comprise the step of obtaining the cancer sample from the subject.
  • the determination of the cancer (or cancer sample) resistance or susceptibility to the cancer treatment is an in vitro determination, which may, subsequent to the method be used to predict whether a given form of cancer treatment may be effective in treating the cancer in the subject, and therefore to assist the medical practitioner in selecting an appropriate form of cancer treatment for the subject.
  • the EDR® assay was highly effective for determining a negative predictive value was above 99% (Kern and Weisenthal, 1990 - J. Nat. Cancer. Inst. 82: 582 - 588) - i.e. over 99% of the tumours which were found to be resistant to treatment in the EDR® in vitro assay, were also found to be resistant in vivo.
  • the accuracy of the positive predictive value was found to be 52% - which was significantly higher than the overall response of 29%.
  • the profile of the (relative) abundance of independent microRNAs in a cancer sample can be used to predict the likely performance of cancer cells derived from that sample in an EDR® assay, and as such, assaying the (relative) abundance of miRNAs (i.e. miRNA profiling) in the cancer sample provides an assay that requires considerably less tissue, and an efficient and quick assay for determining the in vitro resistance (negative predictive value) or susceptibility (positive predictive value) phenotype of the cancer sample.
  • Negative predictive value The EDR assay will be high in the discrimination of drugs that will not work - higher drug concentration than in vivo
  • PSV Positive predictive value
  • the determination is a determination of a predictive value of the effect of the cancer treatment on the cancer, or a sample thereof, or a cancer cell or a population of cancer cells.
  • the determination is a predictive determination of a cancer treatment resistant, or cancer treatment susceptible phenotype, such as the EDR, IDR and LDR phenotypes referred to herein.
  • the abundance of the at least one microRNA is a relative abundance of the microRNA present in said sample as compared to
  • the abundance of the at least one microRNA present in at least one further sample such as at least one further cancer sample or a population of such further samples, with a known treatment resistance phenotype, such as known cancer resistance phenotype;
  • a genetic marker associated with the disease suitably the mRNA or protein level of such a genetic marker.
  • the abundance of the at least one microRNA is a relative abundance of the microRNA present in said cancer sample as compared to the abundance of the at least one microRNA present in at least one further cancer sample, or a population of cancer samples, with a known cancer treatment resistance phenotype.
  • the at least one further (e.g. cancer) sample has a characterised drug resistance phenotype, such as extreme (EDR) or intermediate drug resistance (IDR) phenotype with respect to said at least one (e.g. cancer) treatment.
  • the relative abundance of the at least one microRNA is compared to the abundance of the at least one microRNA present in at least one further (cancer) sample with a drug susceptibility phenotype, such as a low drug resistance (LDR) phenotype with respect to said at least one (cancer) treatment.
  • a drug susceptibility phenotype such as a low drug resistance (LDR) phenotype with respect to said at least one (cancer) treatment.
  • the abundance of more than one microRNA correlated to the resistance of the disease or cancer to said at least one disease or cancer treatment is assessed.
  • the resistance to more than one (e.g. cancer) treatment is determined.
  • the present invention provides a method for identifying microRNAs (and microRNA expression patterns) that are predictive of the clinical effectiveness of drug treatment therapies, such as anticancer drug treatment therapies.
  • the relative abundance of the at least one microRNA is compared to the abundance of the at least one microRNA present in a population of at least two further samples.
  • the population of at least two further samples comprises both i) one or more members which exhibit a characterised susceptibility phenotype, and ii) one or more members which exhibit a characterised resistance phenotype, with respect to the at least one treatment.
  • population of at least two further samples comprises more than 2 independent samples (i.e. individual members of the population), such as at least 5 members, at least 10 members, at least 20 members, at least 40 members or at least 50 members. In one embodiment, between 2 and 1000 members, such as between 10 and 500 members. In one embodiment between 50 and 200 members.
  • the population contains between 10 - 90%, such as between 20 - 80%, such as between 30 - 70% of samples which exhibit resistance to the disease treatment.
  • the population contains between 10 - 90%, such as between 20 - 80%, such as between 30 - 70% of samples which exhibit susceptibility to the disease treatment.
  • the abundance of the at least one microRNA is a relative abundance of the microRNA present in said sample as compared to the abundance of the at least one internal reference marker present in said sample, such as a non-coding RNA, such as a non-coding RNA selected form the group consisting of U6B, SNORD7, SNORD24, SNORD38B, SNORD43, SNORD44, SNORD48, SNORD49A, SNORD66, RNU19, 5.8S rRNA, and 5S rRNA.
  • a non-coding RNA such as a non- coding RNA selected form the group consisting of U6B, SNORD7, SNORD24, SNORD38B, SNORD43, SNORD44, SNORD48, SNORD49A, SNORD66, RNU19, 5.8S rRNA, and 5S rRNA.
  • mRNA reference markers such as those commonly used internal controls in gene expression analysis in molecular biology may also be used, for example GADPH, histones, actin mRNA levels, or equivalents, are often used as controls.
  • GADPH histones
  • actin mRNA levels or equivalents
  • a list of potential "housekeeping genes / reference genes/miRs can be found at 335.
  • the subject is typically a human being who is suffering from a disease or a disease state, or is likely to develop a disease or disease state.
  • the subject is typically a human being who has cancer.
  • the patient may be male or female, although this may depend on the type of tissue/cancer being investigated (e.g. ovarian cancer effects only women).
  • sample may be normal tissue from the subject, it is recognised that in a preferred embodiment, the sample is or comprises diseased tissue or cells, such as cancer tissue or cells.
  • the cancer (test) sample is typically obtained from the subject by biopsy or tissue sampling.
  • the Cancer (test) sample is typically obtained from the subject by biopsy or tissue sampling.
  • the cancer may be selected from the group consisting of: breast cancer, colon cancer, lung cancer, pancreatic cancer, prostate cancer, cancer in the stomach, head and neck cancer, ovary cancer, testicular cancer, cervix cancer, liver cancer, thyroid cancer, epithelial cancer, urothelial cancer, nasopharyngeal cancer, myelodysplastic cancer, leukemias such as chronic lymphocytic leukaemia (CLL), acute lymphocytic leukaemia (ALL), chronic myeloid leukaemia (CML), acute myeloid leukaemia (AML), prolymphocytic leukaemia and erythroleukemia, lymphomas such as Hodgkin's lymphoma and non-Hodgkin's lymphoma such as follicular lymphoma and Burkitt's lymphoma, blastomas such as glioblastoma, neuroblastoma and retinoblastoma, and adenomas
  • the cancer is a carcinoma.
  • the carcinoma is typically selected from the group consisting of malignant melanoma, basal cell carcinoma, ovarian carcinoma, breast carcinoma, thyroid papillary carcinoma, hepatocellular carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, stomach carcinoma, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, laryngeal papillomatosis, colon carcinoma, colorectal carcinoma and carcinoid tumors. More typically, said carcinoma is selected from the group consisting of malignant melanoma, non-small cell lung cancer, breast carcinoma, colon carcinoma and renal cell carcinoma.
  • the malignant melanoma is typically selected from the group consisting of superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral melanoma, amelanotic melanoma and desmoplastic melanoma.
  • the cancer may suitably be a sarcoma.
  • the sarcoma is typically in the form selected from the group consisting of osteosarcoma, Ewing's sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma and Kaposi's sarcoma.
  • the cancer may, suitably comprise neoplastic cells.
  • the cancer is in the form of a tumour, suitably a malignant tumour.
  • the cancer may be selected from the group consisting of: brain, breast, colorectal, endometrial, kidney (e.g. renal-cell), lung (e.g. non-small-cell), melanoma, ovarian, pancreatic, sarcoma, stomach or an unknown primary cancer.
  • Figure 1 illustrates a selection of cancer treatments which are used to treat each of these forms of cancer, and therefore provide examples of the cancer treatment according to the invention.
  • the cancer is colon cancer.
  • the cancer is breast cancer.
  • the cancer may be a haematological neoplasm, such as leukemia, lymphoma or multiple myeloma.
  • the sample is a cancer sample.
  • the cancer used in the method is in the form of a cancer sample or biopsy obtained from a patient.
  • the sample isolated from the subject used in the present invention may be less than 2gms, such as less than 1.5gms, less than lgm, less than 0.5gm, less than 0.2gm, less than O.lgm, less than O.Olgm, less than 0.05gm.
  • the weight of the sample is at least O.OOOlgm, such as at least O.OOlgm.
  • the sample is in the form of a body fluid such as blood or lymph fluid, which may undergo a step of enrichment for, e.g. cancer cells.
  • Suitable methods of tumour tissue handling are widely known in the art, such as those provided in US 2006/0160114, US 2004/0214203, and will depend on the type and amount of tissue available.
  • the sample used is obtained directly from the patient, and is used without the removal of non-cancerous cells (once isolated from the subject's body).
  • an advantage of the present method is the ability to isolate small quantities of sample, thereby reducing the risk of sample contamination by surrounding healthy tissues, or non-cancerous tissues which may be intricately associated with the cancer - for example vascular tissue or dead cells.
  • the methods of the invention which refer to obtaining or isolating the sample, may comprise the steps of:
  • sample is enriched for the cancer cells prior to analysis of the at least one miRNA present in the cancer (sample).
  • Panomics Cancer cell isolation kit Panomics Inc
  • Veridex Cellsearch system for isolation of circulating tumor cells from for example blood samples
  • Lacer capture microdissection (LCM) or equivalent technologies for isolation of cell populations from heterogonous tissue specimens.
  • a contacting the mixed population of cells with a vital stain or fluorescent dye; b. contacting the mixed population of cells with a detectably-labelled immunological reagent that specifically binds to cancer cells; and c. selecting the cells in the mixed population that are not stained with the vital stain and that bind the immunological reagent.
  • a cancer treatment refers to conventionally used cancer treatments, such as drug therapy, including chemotherapy, and, in one embodiment, radiotherapy.
  • chemotherapeutic agents are used in the treatment of human cancer these include the plant alkaloids vincristine, vinblastine, vindesine, and VM-26; the antibiotics actinomycin-D, doxorubicin, daunorubicin, mithramycin, mitomycin C and bleomycin; the antimetabolites methotrexate, 5-fluorouracil, 5-fluorodeoxyuridine, 6-mercaptopurine, 6- thioguanine, cytosine arabinoside, 5-aza-cytidine and hydroxyurea; the alkylating agents cyclophosphamide, melphalan, busulfan, CCNU, MeCCNU, BCNU, streptozotocin, chlorambucil, bis-diamminedichloroplatinum, azetidinylbenzoquinone; and the miscellaneous agents dacarbazine, mAMSA and mitoxantrone.
  • the chemotherapeutic agents
  • Suitable chemotherapeutic drugs are provided in the following table.
  • the at least one cancer treatment is or comprises one or more chemotherapeutic drugs, such as one or more chemotherapeutic drugs selected from the group consisting of: Gemcitabine, Vinblastine, Temozolomide, Navelbine, Oxaliplatin, Vincristine, Fluorouracil, Floxuridine, Cyclophosphamide, Mitomycin C, Carboplatin, Ifosfamide, Etoposide, Taxol, Doxorubicin, Cisplatin, Carmustine, Capecitabine, 5 FU, 5 FU + Leucovorin, Topotecan, Taxotere, Irinotecan, 5 FU + Irinotecan, Alpha Interferon, Doxil, Interferon, Interferon + Vinblastine, Interleukin 2, Alpha Interferon, Taxotere + Navelbine, Cisplatin + Gemcitabine, and Doxil.
  • chemotherapeutic drugs selected from the group consisting of: Gemcitabine, Vinblastine, Temozolomide
  • the at least one cancer treatment is or comprises one or more chemotherapeutic drugs, such as one or more chemotherapeutic drugs selected from the group consisting of: 5FU (optionally +Leucovorin (FULEU)), Irinotecan (SN38), Oxaliplatin (Oxapl) and Topotecan (topo).
  • chemotherapeutic drugs selected from the group consisting of: 5FU (optionally +Leucovorin (FULEU)), Irinotecan (SN38), Oxaliplatin (Oxapl) and Topotecan (topo).
  • the at least one cancer treatment is or comprises at least one chemotherapeutic drug selected from the group consisting of: anti-metabolites, such as azathioprine or mercaptopurine; plant alkaloids and terpeoids, such as vinca alkaloids and taxanes; thymidylate synthase inhibitors, such as 5-fluoro uracil (5-FU) and citrovorin, topoisomerase (TSI) acting drugs, such as SN-38 (Irinotecan) and camptothecin, alylating agents such as Oxaliplatin, monoclonal antibodies, such as Herceptin (Trastuzumab), Avastin (Bevacizumab), Erbitux (Cetuximab), Rituxan (Rituximab) , (anti-)hormonal treatments such as Tamoxifen, and the armoatase inhibitor letrozole.
  • anti-metabolites such as azathioprine or mercaptopurine
  • the at least one cancer treatment is or comprises combined adjuvant therapy.
  • the at least one cancer treatment is or comprises herceptin, which is frequently used for the treatment of oestrogen receptor positive cancers (such as breast cancer).
  • the method according to the invention may refer to more than one cancer treatment - in this regards the miRNA profile of cancer samples may be indicative of the cancer treatment resistance phenotype of more than one cancer treatment.
  • the miRNA profile of the cancer sample can be indicative of the resistance phenotype to several cancer treatments, and as such may be used to predict which cancer treatments are likely to exhibit a EDR, IDR or LDR phenotype in the EDR® assay.
  • the method according to the invention can be utilised by the medical practitioner in their decision as to the most appropriate form of therapy, and not necessarily whether only one treatment is likely to be of benefit or not.
  • At least one therefore may refer to at least two, two, at least three, three, at least four, four, at least five, five, at least six, six, at least seven, seven, at least eight, eight, at least 9, nine, at least 10, or 10, for example.
  • the at least one cancer treatment may comprise of radiotherapy and chemotherapy, such as one or more of the chemotherapeutic drugs referred to herein, such as one or more of the following: 5-FU (optionally in combination with Leucovorin), Capecitabine, Floxuridine, Fluorouracil (optionally in combination with Irinotecan), Irinotecan, Oxaliplatin, Topotecan, And Leucovorin.
  • chemotherapy such as one or more of the chemotherapeutic drugs referred to herein, such as one or more of the following: 5-FU (optionally in combination with Leucovorin), Capecitabine, Floxuridine, Fluorouracil (optionally in combination with Irinotecan), Irinotecan, Oxaliplatin, Topotecan, And Leucovorin.
  • the at least one cancer treatment is selected from the group consisting of 5-FU (optionally in combination with Leucovorin), Capecitabine, Floxuridine, Fluorouracil (optionally in combination with Irinotecan), Irinotecah, Oxaliplatin, Topotecan, And Leucovorin.
  • the at least one cancer treatment is selected from the group consisting of: 5-FU (5'fluoro Uracil), Leucovorin, Oxaliplatin, and Inninitecan.
  • the at least one cancer treatment is a monoclonal antibody treatment, such as Bevacizumab or Cetuximab.
  • the at least one cancer treatment is a Taxol, such as Paclitaxel.
  • the chemotherapeutic cancer treatments include Irinotecan, Topotecan, Oxalipatin, and/or 5'FU (optionally in combination with Leucovorin).
  • Figure 3 shows the frequency of single and multiple drug resistance (EDR - see next section) of various colon cancer samples.
  • Figure 4 shows a Venn diagram illustrating the correlation of specific miRNAs with the EDR status of these chemotherapeutic agents in various colon cancer samples.
  • Figure 5 shows a Venn diagram illustrating the correlation of specific miRNAs with the LDR status of these chemotherapeutic agents in the same various colon cancer samples.
  • the degree of resistance of a cancer to a cancer treatment may not be complete, i.e. the cancer may be partially susceptible to the cancer treatment, i.e. show a reduced rate of cell proliferation in the presence of the cancer treatment, as compared to an untreated control.
  • the use of the EDR® assay for determining resistance or susceptibility to radiation treatment (radiotherapy) is disclosed in US 6,008,007 and US 6,261,795, which are hereby incorporated by reference.
  • the degree of resistance to a cancer treatment may be determined using the EDR® assay, as described in the above mentioned references and Holloway et al., 2002, Gynecologic Oncology 87, 8-16, and Meht et al., 2001, Breast Cancer Research and Treatment 66, 225- 237), both hereby incorporated by reference.
  • cancer (samples) which shows an extreme resistance are referred to as having a growth rate greater than 1 standard deviation above the median.
  • cancer (samples) which show an intermediate drug resistance have a growth rate greater than the median, but of less than 1 standard deviation.
  • cancer (samples) which show a low drug resistance have a tumor cell growth less than the median growth.
  • PCI percent cell inhibition
  • Both extreme drug resistance and intermediate drug resistance are therefore characteristics of cancer cells which are able to proliferate in vitro in the presence of, or after exposure to, the drug treatment, such as determined by the EDR® assay.
  • the EDR® assay method involves the isolation of fresh viable tumor tissue which is minced and digested with enzymes to disaggregate the tumor cells. The cells are then placed in soft agar to encourage cell proliferation before being exposed to the cancer treatment such as chemotherapeutic agents, typically for a period of five days and at an elevated dosage, during the latter period of drug exposure (such as the final two days) tritiated thymidine is added as a measure of cell proliferation. By comparing the level of label incorporated into drug treated and untreated controls, the degree of cell proliferation under the drug treatment is determined, and thereby the resistance phenotype of the cancer cells.
  • the dosage of treatment used in the EDR® assay will vary depending upon the agent used, and as such, in one embodiment, the dosage level may be selected by determining the effective concentration or dose of the therapeutic agent which is sufficient to prevent significant incorporation of the radio label into the cells in control samples which have a susceptible phenotype, or in one embodiment, healthy cells which are obtained from the same tissue type as the disease sample was obtained or isolated from.
  • the dosage level of the cancer treatment used to determine the degree of resistance may, in one embodiment, between 5 - 80 times greater, such as between 10 and 50 times greater, than the appropriate in vivo dose of the treatment agent.
  • microRNA or "miRNA”, in the context of the present invention, means an RNA oligonucleotide consisting of between 18 to 25 nucleotides. In functional terms miRNAs are typically regulatory endogenous RNA molecules.
  • target microRNA or “target miRNA” or “miRNA target” refer to a microRNA which comprises the reverse complement of the contiguous nucleobase sequence of the oligonucleotide or detection probes referred to herein.
  • the Sanger Institute publishes known miRNA sequences in the miRBase database
  • miRBase release 10.0 is hereby incorporated by reference, including all the miRNA mature and pre-mature sequences disclosed therein.
  • the at least one microRNA is a oncomiR (i.e a microRNA whose aberrant (i.e. over or under expression) is associated with a cancer phenotype.
  • a oncomiR i.e a microRNA whose aberrant (i.e. over or under expression) is associated with a cancer phenotype.
  • Novel miRNAs which are associated with cancer are disclosed in PCT/EP2007/061210, hereby incorporated by reference.
  • table 5 in PCT/EP2007/061210 disclose specific mature miRNA sequences, which in the following may be referred to with an "454_hsa" extension.
  • miR_2147 may be referred to as "454_hsa_miR_2147”.
  • hsa-miR-93 family such as the following human microRNAs: miR-93, miR-106b, miR-20b, miR-20a, miR-106a, miR-17, miR-18a, and miR-18b.
  • the present inventors have found that multiple members of the hsa-miR-93 family are upregulated in cells with a high resistance to 5-FU and/or leucoverin.
  • Targets of the miR-93 family include the E2F transcription factor which is an activator of cell cycle progression.
  • the at least one miRNA include miRPIus_28431 and/or hsa-miR-129-5p, which, for example, have, in the present work, been correlated to oxaliplatin resistance.
  • the at least one miRNA include hsa-miR-148, hsa-miR-148* and/or hsa- miR-203, which have been associated, for example, with SN-38 (topoisomerase 1 inhibitor) resistance.
  • ROS_ _hsa_ miR_ . 1714 cagagcuuagcugauuggugaaca
  • the EDR status of cancers and in particular colorectal cancer based on the tumor's miRNA profile,such as described in example 2.
  • miRNAs that are most differentially expressed in cancer samples with EDR towards at least two different treatments, such as at least two different chemotherapeutic agents.
  • a selection of miRNAs, that are most differentially expressed in cancer samples with EDR towards at least two different treatments may be used to determine whether a patient sample has EDR towards one of the at least two different treatments.
  • the cancer specimens are fresh frozen and in some embodiments they are formalin fixed, paraffin embedded specimens.
  • the cancers of which the EDR status may be determined are resistant to 5-FU/Leucovorin, Oxaliplatin, or Irinotecan. Accordingly the present invention enables the identification of tumors that are EDR to 5-FU/Leucovorin, Oxaliplatin, or Irinotecan, based solely on the tumor cell's microRNA profiles.
  • the at least one miRNA, which is most differentially expressed in samples with an EDR phenotype in respect to Irinotecan and samples with an EDR phenotype with respect to Oxaliplatin is selected from the list consisting of hsa-miR-133a, 454_hsa_miR_2147, hsa-miR-520c, hsa-miR-591, 454_hsa_miR_2364, hsa-miR-200b*, 454_hsa_miR_1975, hsa-miR-617, hsa-miR-629, hsa-miR-502-3p, hsa-miR-525-3p, hsa- miR-425*, hsa-miR-15b*, hsa-miR-29a*, hsa-miR-594, hsa-miR-124
  • the at least one miRNA which is most differentially expressed in samples with an EDR phenotype in respect to 5FU and samples with an EDR phenotype with respect to Irinotecan is selected from the list consisting of hsa-miR-122, hsa-miR-206, 454_hsa_miR_1994, hsa-miR-595, hsa-miR-147, hsa-miR-32*, 454_hsa_miR-2056, hsa- miR-297, 454_hsa_miR-2370, ROC_hsa_miR_1674, hsa-miR-574-5p, 454_hsa_miR-2069, 454_hsa_miR-2116, hsa-miR-603, hsa-miR-105, hsa-miR-329, hsa-miR
  • the at least one miRNA, which is most differentially expressed in samples with an EDR phenotype in respect to 5FU and samples with an EDR phenotype with respect to Oxaliplatin is selected from the list consisting of has-miR-184, 454_hsa_miR-2010, 454_hsa_miR-2092, 454_hsa_miR-2134, 454_hsa_miR-2039, hsa-miR-594, hsa-miR-512- 5p, 454_hsa_miR-2068, 454_hsa_miR-1628, hsa-miR-370, 454_hsa_miR-2159, hsa-miR- 617, 454_hsa_miR-2136, hsa-miR-370, hsa-miR-200b*, 454_hsa_miR-2119, 4
  • the at least one miRNA, which is most differentially expressed in samples with an EDR phenotype in respect to Oxaliplatin and samples with an EDR phenotype with respect to Irinotecan is selected from the list consisting of hsa-miR-146a, hsa-miR-148a, hsa-miR-29c, hsa-miR-16, hsa-miR-27b, hsa-miR-101, hsa-miR-26b, hsa-miR-99a*, hsa- miR-140-5p, ROS_hsa_miR_0876, hsa-miR-92b, hsa-miR-203, ROS_hsa_miR_1759, hsa- miR-18a, hsa-miR-608, hsa-miR-92a, hsa-m
  • the term 'isolating' a microRNA fraction may involve the separation of a microRNA containing fraction for the sample
  • the microRNA abundance is measured in situ within the sample - for example using in situ hybridisation, which is an effective means for determining microRNA's within tissues.
  • in situ hybridisation is an effective means for determining microRNA's within tissues.
  • microRNA fraction isolation protocols are widely available, such as the mirVanaTM miRNA Isolation Kit (Ambion) or the miRNeasy Kit (Qiagen).
  • microRNA fraction may be a total RNA fraction, which may for example be obtained using a standard Trizol extraction.
  • the control marker may be a genetic marker which is correlated to, or an indication of the disease or disease condition.
  • the control marker may be an oncogene or mRNA or protein product deriving therefore.
  • the control marker may be a mutation in the genetic code which is associated to the disease, or an mRNA or an aberrant mRNA (such as an alternatively spliced mRNA), or a protein product derived (encoded) therefrom, whose presence (or absence) or abundance, is correlated to the disease or disease condition, such as cancer.
  • step c) comprises the assaying the presence or absence or the abundance of at least one control marker of said disease, such as a genetic mutation associated with said disease, or a the expression levels of a mRNA or protein which is associated with said disease.
  • control marker may be, for example, selected from the group consisting of CD31, BAX, BCL-2, EGFR, ER receptor, HER2, Ki-67, MDR-I, p53, PR receptor, Thrombospondin 1, Thymidylate Synthase, and VEGV.
  • control samples may, suitably be the at least one further samples referred to herein - and as such a preferred control sample reflects a population of characterised disease samples, which are characterised with respect to their disease resistance/susceptibility phenotype, for example by the EDR® assay.
  • control samples may also be utilised.
  • the control sample or sample(s) may be a sample taken previously, e.g. a sample or collection of samples of the same type of cancer/tumor, taken from one or more patients whose cancers have a defined phenotype to the at least one cancer treatment.
  • control sample may be taken from healthy tissue, for example tissue taken adjacent to the cancer, such as within 1 or 2 cm diameter from the external edge of said cancer.
  • control sample may be taken from an equivalent position in the patients body, for example in the case of breast cancer, tissue may be taken from the breast which is not cancerous.
  • control sample may also be obtained from a different patient, e.g. it may be a control sample, or a collection of control samples, representing different types of cancer, for example those listed herein (i.e. cancer reference samples). Comparison of the test sample data with data obtained from such cancer reference samples may for example allow for the characterisation of the test cancer to a specific type and/or stage of cancer.
  • At least one control sample is obtained, and a second population of nucleic acids from the at least one control sample is, in addition to the test sample, presented and hybridised against at least one detection probe.
  • control sample may be obtained from a non tumorous tissue, such as from tissue adjacent to said putative tumor, and/or from an equivalent position elsewhere in the body.
  • the at least one control sample may be obtained from a non tumorous tissue selected from the group consisting; brain tissue, breast tissue, colorectal tissue, endometrial tissue, kidney tissue, lung tissue, ovarian tissue, pancreatic tissue, stomach tissue.
  • the at least one control sample may be obtained from a cancerous tissues may include brain cancer, breast cancer, colorectal cancer, endometrial cancer, kidney cancer (e.g. renal-cell), lung cancer (e.g. non-small-cell), melanoma, ovarian cancer, pancreatic cancer, sarcoma, stomach cancer or unknown primary cancer.
  • a cancerous tissues may include brain cancer, breast cancer, colorectal cancer, endometrial cancer, kidney cancer (e.g. renal-cell), lung cancer (e.g. non-small-cell), melanoma, ovarian cancer, pancreatic cancer, sarcoma, stomach cancer or unknown primary cancer.
  • the at least one control sample or samples may be a haematological sample, such as a haematological neoplasm, such as leukemia, lymphoma or multiple myeloma.
  • a haematological sample such as a haematological neoplasm, such as leukemia, lymphoma or multiple myeloma.
  • RNA/ miRNA (enriched) fraction The RNA/ miRNA (enriched) fraction
  • the miRNA may remain within the test sample, such as remain in the cells of the biopsy or tissue sample, for example for in situ hybridisation.
  • the cells may still be living, or they may be dead.
  • the cells may also be prepared for in situ hybridisation using methods known in the art, e.g. they may be treated with an agent to improve permeability of the cells; the cells may also be fixed or partially fixed.
  • miRNA fraction may be isolated from the cancer (or control) sample.
  • the fraction isolates miRNA the cells of the sample, and preferably enriches the miRNAs present in the sample as compared with the concentration of other soluble cellular components such as DNA or protein.
  • the enrichment may be of the total RNA of the samples - i.e. a total RNA fraction.
  • the miRNA fraction suitably contains a population of nucleic acids, which comprises a population of miRNAs - the population of miRNAs is preferably representative of the miRNAs present in the sample.
  • the miRNA fraction may be derived from the miRNAs present in the sample - i.e. retain the biological information regarding the miRNA sequences and abundance thereof in the sample.
  • the miRNA fraction preferably comprises small RNAs such as those less than 100 bases in length.
  • the miRNA fraction may also comprise other RNA fractions such as mRNA, and/or in siRNAs and/or piRNAs.
  • the miRNA fraction comprises snRNAs.
  • the miRNA fraction may also comprise other nucleic acids, for example the miRNA fraction may be part of a total nucleic acid fraction which also comprises DNA, such as genomic and/or mitochondrial DNA.
  • the miRNA fraction may be purified. Care should be taken during miRNA extraction to ensure at least a proportion of the miRNA are retained during the extraction. Suitably, specific protocols for obtaining RNA fractions comprising or enriched with small RNAs, such as miRNAs may be used.
  • the fraction may undergo further purification to obtain an enriched miRNA fraction. This can be achieved, for example, by removing mRNAs by use of affinity purification, e.g. using an oligodT column.
  • the miRNA fraction is used directly in the hybridisation with the at least one detection probe.
  • the miRNA fraction may comprise the target molecule, e.g. the miRNA fraction obtained from a test sample, the presence of the target molecule within the miRNA fraction may indicate a particular phenotype.
  • the miRNA fraction may not comprise the target molecule, e.g. the miRNA fraction obtained from a test sample, the absence of the target (complementary) molecule within the RNA fraction may indicate a particular phenotype.
  • the miRNA fraction prior to (or even during) said hybridisation, may be used as a template to prepare a complement of the miRNA present in the fraction, said compliment may be synthesised by template directed assembly of nucleoside, nucleotide and/or nucleotide analogue monomers, to produce, for example an oligonucleotides, such as a DNA oligonucleotide.
  • the complement may be further copied and replicated.
  • the compliment may represent the entire template miRNA molecule, or may represent a population of fragments of template molecules, such as fragments than, preferably in average, retain at least 8 consecutive nucleoside units of said miRNA template, such as at least 12 of said units or at least 14 of said units.
  • nucleoside units of said complementary target are retained.
  • the complementary target is a precursor miRNA, or a molecule derived therefore, if is preferred that at least part of the loop structure of the precursor molecule is retained, as this will allow independent detection over the mature form of the miRNA, or molecule derived there from.
  • the miRNA fraction itself is not used in the hybridisation, but a population of molecules, such as population of oligonucleotides which are derived from said RNA fraction, and retain sequence information contained within said miRNA fraction, are used. It is envisaged that the population of molecules derived from said miRNA fraction may be further manipulated or purified prior to the hybridisation step - for example they may be labelled, or a sub-fraction may be purified there from.
  • the target molecule (complementary target) may therefore be derived from miRNA, but may actually comprise an alternative oligo backbone, for example DNA. The target molecule may, therefore also be a complement to the original miRNA molecule, or part of the original RNA molecule from which it is derived.
  • the miRNA fraction is analysed and the population of target miRNAs and optionally control nucleic acids are determined.
  • the miRNA fraction, or a nucleic acid fraction derived there from may be undergo quantitative analysis for specific target and control sequences, for example using oligonucleotide based sequencing, such as oligonucleotide micro-array hybridization.
  • the data from the quantitative analysis may then be used in a virtual hybridisation with a detection probe sequence.
  • the assessment of the abundance of a microRNA may be determination or estimation of an absolute abundance, but it may, in one embodiment be a comparative assessment as compared to the abundance in previously determined value or values (e.g. obtained by analysis of the at least one microRNA(s) present in control cancer samples of known drug resistance phenotype (e.g. EDR, IDR or LDR), or an equivalent reference sample, or samples.
  • EDR drug resistance phenotype
  • the abundance of the at least one microRNA is a relative abundance of the microRNA present in said cancer sample as compared to the abundance of the at least one microRNA present in at least one control sample, such as at least one further cancer sample, or a population of cancer samples, with a known cancer treatment resistance phenotype.
  • the abundance of the at least one microRNA is a relative abundance of the microRNA present in said cancer sample as compared to the abundance of the at least one microRNA present in at least one further cancer sample, or a population of cancer samples, with a known cancer treatment resistance phenotype.
  • an increased (relative) abundance of a microRNA present in the sample may be indicative of a drug resistance phenotype (such as EDR or IDR), or a drug susceptible phenotype.
  • a decreased (relative) abundance of a microRNA present in the sample may be indicative of a drug resistance phenotype (such as EDR or IDR), or a drug susceptible phenotype.
  • the method of the invention comprises the determination of the abundance, such as the relative abundance of more than one microRNA, such a population of microRNAs, suitably by the use of a corresponding population of detection probes.
  • the abundance of population of individual microRNAs is determined. Therefore, in one embodiment the abundance of at least two microRNAs is determined, such as the abundance of at least three, such as at least four, such as at least five, such as at least six, such as at least seven, such as at least eight, such as at least nine, such as at least 10 microRNAs is determined - wherein the over or under abundance of the miRNAs are correlated to either the resistance or susceptibility of the disease or state of disease to the administration of the individual members of the population of miRNAs. In one embodiment the population comprises between 5 and 60 individual microRNAs whose abundance is correlated to either the resistance or susceptibility of the disease, such as between 10 - 40 or 15 - 40 of such members.
  • the abundance of other miRNAs, and other molecular markers, which are not correlated to the resistance/susceptibility phenotype of the disease may also be analysed, and as such in one embodiment, the total population of miRNAs analysed may be higher, such as up to 500, or 1000, or even more, and as such a majority or even all of the known human microRNAs may be analysed - for example using the arrays of detection probes referred to herein.
  • the abundance of at least 2, such as at least five, such as at least 10, independent microRNAs are determined, such as the microRNAs independently selected from those referred to herein. In one embodiment, at least 60 independent microRNAs are determined.
  • the abundance of each of the independent members of a population of microRNAs is determined, such as a population comprising microRNAs referred to or selected from those referred to in any one of the preceding claims, wherein the over or under abundance of each of the independent members of a population of microRNAs may be correlated to the resistance of the cancer to one or more of the cancer treatments referred to herein.
  • the method of the invention comprises hybridising the microRNA fraction to a population of detection probes, wherein said population of detection probes comprises independent members which correspond to each of, or a proportion of, such as at least 25%, 50% or 75%, of the independent members of a population of microRNAs, such as the populations (groups) of microRNAs referred to herein.
  • the determination of the abundance of the miRNA therefore may typically involve the collection of a signal caused by the hybridisation of one, or more (for example in the case of PCR based methods) detection probes (or oligonucleotides) from an assay performed on the cancer sample, or a microRNA enriched fraction obtained therefrom. This signal is typically compared to a control.
  • control to which the abundance (signal) from the at least one microRNA may be compared may be an internal control, such as a housekeeping gene and/or the median abundance in a population of further samples.
  • the control may be in the form of data obtained by a separate analysis, such as a previous analysis of the microRNA abundance in a population of further samples, such as the data generated by the method for identifying one or more microRNAs which are indicators of the susceptibility or resistance of a disease to a disease treatment, as referred to herein.
  • An internal control i.e. the relative abundance of the miRNA is measured proportional to the abundance of a molecular marker present in the sample or microRNA fraction.
  • This may for example be a RNA species such as a miRNA or an mRNA whose abundance is independent of the application of a cancer treatment.
  • a non-cancerous tissue - such as healthy tissue obtained from the same origin as the cancer sample, for example this may be healthy equivalent tissue or tissue adjacent to the cancer, and may be collected from the subject.
  • the average abundance of microRNA in a population of cancer samples of the same type such as tissue of origin, or histology types
  • a population of cancer samples referred to herein - i.e. compared to the median abundance in cancer samples of the same type (see the examples - which utilise a collection of colon cancer samples).
  • access to collections of cancer tissue samples are available from Oncotech Inc.
  • the relative abundance of multiple microRNA(s) between the samples may be used to identify the drug resistant and drug sensitive members of the population of cancer samples, both with a single cancer treatment, but also multiple cancer treatments.
  • microRNAs in the cancer sample typically involves the use of hybridisation technologies, where a compound (such as an oligonucleotide) which has a complementary nucleobase sequence to a corresponding nucleotide seqeunce present in the microRNA target (or an equivalent complementary structure), is used to specifically hybridise to the target microRNA.
  • a compound such as an oligonucleotide which has a complementary nucleobase sequence to a corresponding nucleotide seqeunce present in the microRNA target (or an equivalent complementary structure)
  • the target is labelled with a signal.
  • the population of miRNA, present in the miRNA (enriched) fraction are labelled with a signal which can be detected.
  • the hybridisation or the target molecules to the detection probe which may be fixed to a solid surface, and subsequent removal of the remaining nucleic acids, including the remaining miRNA, from the population, and therefore allows the determination of the level of signal from those labelled target which is bound to the detection probe. This may be appropriate when screening immobilised probes, such as arrays of detection probes.
  • the detection probe is labelled with a signal. This may be appropriate, for example, when performing in situ hybridisation and northern blotting, where the miRNA present in the miRNA fraction (population of nucleic acids) are immobilised.
  • both population of miRNAs and detection probes are labelled.
  • they may be labelled with fluorescent probes, such as pairs of FRET probes (Fluorescence resonance energy transfer), so that when hybridisation occurs, the FRET pair is formed, which causes a shift in the wavelength of fluorescent light emited.
  • pairs of detection probes may be used designed to hybridise to adjacent regions of the target molecule, and each detection probe carrying one half of a FRET pair, so that when the probes hybridise to their respective positions on the target, the FRET pair is formed, allowing the shift in fluorescence to be detected.
  • probes such as the preferred LNA substituted detection probes are preferably chemically synthesized using commercially available methods and equipment as described in the art (Tetrahedron 54: 3607-30, 1998).
  • the solid phase phosphoramidite method can be used to produce short LNA probes (Caruthers, et al., Cold Spring Harbor Symp. Quant. Biol. 47:411- 418, 1982, Adams, et al., J. Am. Chem. Soc. 105: 661 (1983).
  • Detection probes such as LNA-containing-probes
  • Detection probes can be labelled during synthesis.
  • the flexibility of the phosphoramidite synthesis approach furthermore facilitates the easy production of detection probes carrying all commercially available linkers, fluorophores and labelling-molecules available for this standard chemistry.
  • Detection probes, such as LNA- modified probes may also be labelled by enzymatic reactions e.g.
  • T4 polynucleotide kinase and gamma- 32 P-ATP by kinasing using T4 polynucleotide kinase and gamma- 32 P-ATP or by using terminal deoxynucleotidyl transferase (TDT) and any given digoxygenin-conjugated nucleotide triphosphate (dNTP) or dideoxynucleotide triphosphate (ddNTP).
  • T4 polynucleotide kinase and gamma- 32 P-ATP by using terminal deoxynucleotidyl transferase (TDT) and any given digoxygenin-conjugated nucleotide triphosphate (dNTP) or dideoxynucleotide triphosphate (ddNTP).
  • TTT terminal deoxynucleotidyl transferase
  • dNTP digoxygenin-conjugated nucleotide
  • Detection probes according to the invention can comprise single labels or a plurality of labels.
  • the plurality of labels comprise a pair of labels which interact with each other either to produce a signal or to produce a change in a signal when hybridization of the detection probe to a target sequence occurs.
  • the detection probe comprises a fluorophore moiety and a quencher moiety, positioned in such a way that the hybridized state of the probe can be distinguished from the unhybridized state of the probe by an increase in the fluorescent signal from the nucleotide.
  • the detection probe comprises, in addition to the recognition element, first and second complementary sequences, which specifically hybridize to each other, when the probe is not hybridized to a recognition sequence in a target molecule, bringing the quencher molecule in sufficient proximity to said reporter molecule to quench fluorescence of the reporter molecule. Hybridization of the target molecule distances the quencher from the reporter molecule and results in a signal, which is proportional to the amount of hybridization.
  • reporter means a reporter group, which is detectable either by itself or as a part of a detection series.
  • functional parts of reporter groups are biotin, digoxigenin, fluorescent groups (groups which are able to absorb electromagnetic radiation, e.g.
  • DANSYL (5- dimethylamino)-l-naphthalenesulfonyl), DOXYL (N-oxyl-4,4-dimethyloxazolidine), PROXYL (N-oxyl-2,2,5,5-tetramethylpyrrolidine), TEMPO (N-oxyl-2,2,6,6-tetramethylpiperidine), dinitrophenyl, acridines, coumarins, Cy3 and Cy5 (trademarks for Biological Detection Systems, Inc.), erythrosine, coumaric acid, umbelliferone, Texas red, rhodamine, tetramethyl rhodamine, Rox, 7-nitrobenzo-2-oxa-l-diazole (NBD), pyrene, fluorescein, Europium, Ruthenium, Sam
  • substituted organic nitroxides or other paramagnetic probes (e.g. Cu 2+ , Mg 2+ ) bound to a biological molecule being detectable by the use of electron spin resonance spectroscopy).
  • paramagnetic probes e.g. Cu 2+ , Mg 2+
  • the determination of the abundance of the at least one microRNA is performed using at least one detection probe which comprises a complementary nucleobase sequence to at least 6 contiguous nucleotides present in said at least one microRNA.
  • the complementary nucleobase sequence is complementary to a contiguous nucleotide sequence present in said at least on microRNA (target).
  • the complementary nucleobase sequence is complementary to the entire contiguous nucleotide sequence present in said at least on microRNA (target).
  • the complementary nucleobase sequence consists of between 8 and 25 contiguous nucleobases, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, or 25 contiguous nucleobases, or between 12 and 20 nucleobases, such as between 8 and 14 contiguous nucleobases.
  • the nucleobase sequence consists of between 15 and 23 contiguous nucleobases, and may for example be 15 or 23 contiguous nucleobases.
  • the complementary nucleobase sequence consists of nucleotide analogues inserted between the nucleoside analogues with regular spacing over part or the entire nucleobases sequence.
  • the regular spacing is a nucleotide analogue at every second, third or fourth nucleobase position, or combination thereof.
  • the complementary nucleobase sequence comprises LNA nucleotide analogues.
  • all the nucleotide analogues present in the complementary nucleobase sequence are LNA nucleotide analogues.
  • the detection probe is preferably in the form of an oligonucleotide, or, such as in the case of PCT a set oligonucleotides, which are used to amplify the microRNA sequence present in the sample, or a molecule derived therefrom.
  • the oligonucleotide or detection probe referred to herein may include a plurality of nucleotide analogue monomers.
  • the oligonucleotide or detection probe hybridizes to a miRNA or miRNA precursor.
  • the nucleotide analogue is LNA, such as alpha and/or xylo LNA monomers.
  • the oligonucleotide probe hybridizes to the loop sequence of a miRNA precursor, e.g., to 5 nucleotides of the miRNA precursor loop sequence or to the center of the miRNA precursor loop sequence.
  • the oligonucleotide probe may or may not also hybridize to the stem sequence of the miRNA precursor.
  • the oligonucleotide probe may have a number of nucleotide analogue monomers corresponding to 20% to 40% of the probe oligonucleotides.
  • the probes may also have a spacing between nucleotide analogue monomers such that two of the plurality of nucleotide analogue monomers are disposed 3 or 4 nucleotides apart, or a combination thereof.
  • each nucleotide analogue monomer in a probe may be spaced 3 or 4 nucleotides from the closest nucleotide analogue monomer.
  • nucleotide analogue monomers are spaced apart, only naturally-occurring nucleotides are disposed between the nucleotide analogue monomers.
  • two, three, four, or more nucleotide analogue monomers may be disposed adjacent to one another.
  • the adjacent nucleotide analogue monomers may or may not be disposed at the 3' or 5' end of the oligonucleotide probe or so that one of the nucleotide analogue monomers hybridizes to the center of the loop sequence of the miRNA precursor.
  • the probe may include none or at most one mismatched base, deletion, or addition. Desirably, the probe hybridizes to the miRNA or precursor thereof under stringent conditions or high stringency conditions.
  • the melting point of the duplex formed between the probe and the miRNA precursor is at least 1° C higher, e.g., at least 5°C, than the melting point of the duplex formed between the miRNA precursor and a nucleic acid sequence not having a nucleotide analogue monomer, or any modified backbone.
  • the probe may include at least 70% DNA; at least 10% nucleotide analogue monomers; and/or at most 30% nucleotide analogue monomers.
  • the probe may further include a 5' or 3' amino group and/or a 5' or 3' label, e.g., a fluorescent (such as fluorescein) label, a radioactive label, or a label that is a complex including an enzyme (such as a complex containing digoxigenin (DIG).
  • a fluorescent label such as fluorescein
  • a radioactive label such as radioactive label
  • a label that is a complex including an enzyme such as a complex containing digoxigenin (DIG).
  • DIG digoxigenin
  • the probe is for example 8 nucleotides to 30 nucleotides long, e.g., 12 nucleotides long or 15 nucleotides long. Other potential modifications of probes are described herein.
  • the probe when hybridized to the miRNA or precursor thereof may or may not provide a substrate for RNAse H.
  • the probes of the invention exhibit increased binding affinity for the target sequence by at least two-fold, e.g., at least 5-fold or 10-fold, compared to probes of the same sequence without nucleotide analogue monomers, under the same conditions for hybridization, e.g., stringent conditions or high stringency conditions.
  • oligonucleotide probes may be designed as reverse complementary sequences to the loop-region of the pre-miRNA.
  • a stretch of 25 nucleotides are identified centered around the loop-region and a capture probe is designed for this 25-mer sequence using the same design rules as for capture probes for the mature miRNAs.
  • This design process takes into account predictions of T m of the capture probe, self-hybridization of the capture probe to it-self and intra-molecular secondary structures and the difference between T m and self-hybridization T m .
  • Further criteria to the capture probe design includes that, in one embodiment, LNA-residues are not allowed in the 3'-end to enhance synthesis yield. Inter-probe comparison of capture probes against different miRNAs ensure that capture probes are designed against regions of the miRNAs that differ the most from other miRNAs in order to optimize the discrimination between different miRNAs.
  • Each detection probe comprises a recognition sequence consisting of nucleobases or equivalent molecular entities.
  • the recognition sequence of the diagnostic probe according to the invention corresponds to the target nucleotide sequence or sequences as referred to herein, and typically comprises of a contiguous sequence which corresponds to a contiguous nucleotide sequence present in the microRNA target sequence.
  • the length of the contiguous nucleobase sequence may be as short as 6 nucleotides, such as 6 or 7 nucleobases, or may represent a nucleobase sequence which corresponds to the majority or even full length of the microRNA target.
  • the detection probe or probes are capable of specifically hybridising to the precursor form of the miRNA, but are not capable of specifically hybridising to the mature form of the miRNA.
  • Suitable detection probes are routinely designed and made utilising the sequence information available, e.g. by selecting a detection probe which at least partially hybridises to the loop structure which is cleaved during miRNA processing. It should be noted that several mature miRNAs may originate from more than one precursor, hence by designing specific probes for a particular precursor, highly specific detection probes for use in the invention may be used.
  • the target sequence are the miRNA or pre-miRNA precursors themselves, in one embodiment, the target sequence may be a further nucleotide or nucleobase sequence which retains the sequence information from the corresponding miRNA/pre-miRNA.
  • the detection element of the detection probes according to the invention may be single or double labelled (e.g. by comprising a label at each end of the probe, or an internal position).
  • the detection probe comprises two labels capable of interacting with each other to produce a signal or to modify a signal, such that a signal or a change in a signal may be detected when the probe hybridizes to a target sequence.
  • the two labels comprise a quencher and a reporter molecule.
  • a particular detection aspect of the invention referred to as a "molecular beacon with a stem region" is when the recognition segment is flanked by first and second complementary hairpin-forming sequences which may anneal to form a hairpin.
  • a reporter label is attached to the end of one complementary sequence and a quenching moiety is attached to the end of the other complementary sequence.
  • the stem formed when the first and second complementary sequences are hybridized i.e., when the probe recognition segment is not hybridized to its target
  • keeps these two labels in close proximity to each other causing a signal produced by the reporter to be quenched by fluorescence resonance energy transfer (FRET).
  • FRET fluorescence resonance energy transfer
  • the proximity of the two labels is reduced when the probe is hybridized to a target sequence and the change in proximity produces a change in the interaction between the labels.
  • Hybridization of the probe thus results in a signal (e.g. fluorescence) being produced by the reporter molecule, which can be detected and/or quantified.
  • the compound of the invention such as the detection probes of the invention
  • the compound of the invention are modified in order to increase the binding affinity of the probes for the target sequence by at least two-fold compared to probes of the same sequence without the modification, under the same conditions for hybridization or stringent hybridization conditions.
  • the preferred modifications include, but are not limited to, inclusion of nucleobases, nucleosidic bases or nucleotides that have been modified by a chemical moiety or replaced by an analogue to increase the binding affinity.
  • the preferred modifications may also include attachment of duplex-stabilizing agents e.g., such as minor-groove-binders (MGB) or intercalating nucleic acids (INA).
  • MGB minor-groove-binders
  • INA intercalating nucleic acids
  • the preferred modifications may also include addition of non- discriminatory bases e.g., such as 5-nitroindole, which are capable of stabilizing duplex formation regardless of the nucleobase at the opposing position on the target strand.
  • non- discriminatory bases e.g., such as 5-nitroindole
  • multi-probes composed of a non-sugar-phosphate backbone, e.g. such as PNA, that are capable of binding sequence specifically to a target sequence are also considered as a modification.
  • All the different binding affinity-increasing modifications mentioned above will in the following be referred to as "the stabilizing modification(s)", and the tagging probes and the detection probes will in the following also be referred to as "modified oligonucleotide". More preferably the binding affinity of the modified oligonucleotide is at least about 3-fold, 4- fold, 5-fold, or 20-fold higher than the binding of a probe of the same sequence but without the stabilizing modification(s).
  • the stabilizing modification(s) is inclusion of one or more LNA nucleotide analogs.
  • Probes from 8 to 30 nucleotides according to the invention may comprise from 1 to 8 stabilizing nucleotides, such as LNA nucleotides. When at least two LNA nucleotides are included, these may be consecutive or separated by one or more non-LNA nucleotides.
  • LNA nucleotides are alpha-L-LNA and/or xylo LNA nucleotides as disclosed in PCT Publications No. WO 2000/66604 and WO 2000/56748..
  • each detection probe preferably comprises affinity enhancing nucleobase analogues, and wherein the recognition sequences exhibit a combination of high melting temperatures and low self-complementarity scores, said melting temperatures being the melting temperature of the duplex between the recognition sequence and its complementary DNA or RNA sequence.
  • This design provides for probes which are highly specific for their target sequences but which at the same time exhibits a very low risk of self-annealing (as evidenced by a low self- complementarity score) - self-annealing is, due to the presence of affinity enhancing nucleobases (such as LNA monomers) a problem which is more serious than when using conventional deoxyribonucleotide probes.
  • affinity enhancing nucleobases such as LNA monomers
  • the recognition sequences exhibit a melting temperature (or a measure of melting temperature) corresponding to at least 5°C higher than a melting temperature or a measure of melting temperature of the self-complementarity score under conditions where the probe hybridizes specifically to its complementary target sequence (alternatively, one can quantify the "risk of self-annealing" feature by requiring that the melting temperature of the probe-target duplex must be at least 5°C higher than the melting temperature of duplexes between the probes or the probes internally).
  • all of the detection probes include recognition sequences which exhibit a melting temperature or a measure of melting temperature corresponding to at least 5°C higher than a melting temperature or a measure of melting temperature of the self- complementarity score under conditions where the probe hybridizes specifically to its complementary target sequence.
  • this temperature difference is higher, such as at least 10 0 C, such as at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, and at least 50 0 C higher than a melting temperature or measure of melting temperature of the self-complementarity score.
  • the affinity-enhancing nucleobase analogues are regularly spaced between the nucleobases in said detection probes.
  • One reason for this is that the time needed for adding each nucleobase or analogue during synthesis of the probes of the invention is dependent on whether or not a nucleobase analogue is added.
  • the affinity enhancing nucleobase analogues are conveniently regularly spaced as every 2 nd , every 3 rd , every 4 th or every 5 th nucleobase in the recognition sequence, and preferably as every 3 rd nucleobase. Therefore, the affinity enhancing nucleobase analogues may be spaced at a mixture of, for example every 2 nd , every 3 rd , every 4 th nucleobase.
  • the presence of the affinity enhancing nucleobases in the recognition sequence preferably confers an increase in the binding affinity between a probe and its complementary target nucleotide sequence relative to the binding affinity exhibited by a corresponding probe, which only include nucleobases. Since LNA nucleobases/monomers have this ability, it is preferred that the affinity enhancing nucleobase analogues are LNA nucleobases.
  • the 3' and 5' nucleobases are not substituted by affinity enhancing nucleobase analogues.
  • affinity enhancing nucleobase analogues As detailed herein, one huge advantage of such probes for use in the method of the invention is their short lengths which surprisingly provides for high target specificity and advantages in detecting small RNAs and detecting nucleic acids in samples not normally suitable for hybridization detection strategies.
  • the probes comprise a recognition sequence is at least a 6-mer, such as at least a 7-mer, at least an 8-mer, at least a 9-mer, at least a 10-mer, at least an 11-mer, at least a 12-mer, at least a 13-mer, at least a 14-mer, at least a 15-mer, at least a 16-mer, at least a 17-mer, at least an 18-mer, at least a 19-mer, at least a 20-mer, at least a 21-mer, at least a 22-mer, at least a 23-mer, and at least a 24-mer.
  • a 6-mer such as at least a 7-mer, at least an 8-mer, at least a 9-mer, at least a 10-mer, at least an 11-mer, at least a 12-mer, at least a 13-mer, at least a 14-mer, at least a 15-mer, at least a 16-mer, at least a 17-mer, at least an 18-
  • the recognition sequence is preferably at most a 25-mer, such as at most a 24-mer, at most a 23-mer, at most a 22-mer, at most a 21-mer, at most a 20-mer, at most a 19-mer, at most an 18-mer, at most a 17-mer, at most a 16- mer, at most a 15-mer, at most a 14-mer, at most a 13-mer, at most a 12-mer, at most an 11-mer, at most a 10-mer, at most a 9-mer, at most an 8-mer, at most a 7-mer, and at most a 6-mer.
  • the preferred length is between 15mer-23mer, including collections of detection probes which may comprise or consist of 15mer, 16, 17, 18, 19, 20, 21, 22 and 23mers, or mixtures thereof.
  • the number of nucleoside analogue corresponds to from 20 to 40% of the oligonucleotide of the invention.
  • the nucleoside analogue is LNA.
  • the detection probe sequences comprise a photochemically active group, a thermochemically active group, a chelating group, a reporter group, or a ligand that facilitates the direct of indirect detection of the probe or the immobilisation of the oligonucleotide probe onto a solid support.
  • the photochemically active group, the thermochemically active group, the chelating group, the reporter group, or the ligand includes a spacer (K), said spacer comprising a chemically cleavable group; or
  • the photochemically active group, the thermochemically active group, the chelating group, the reporter group, or the ligand is attached via the biradical of at least one of the LNA(s) of the oligonucleotide.
  • the invention features detection probes whose sequences have been furthermore modified by Selectively Binding Complementary (SBC) nucleobases, i.e. modified nucleobases that can make stable hydrogen bonds to their complementary nucleobases, but are unable to make stable hydrogen bonds to other SBC nucleobases.
  • SBC Selectively Binding Complementary
  • the SBC nucleobase A' can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, T.
  • the SBC nucleobase T' can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, A.
  • the SBC nucleobases A' and T' will form an unstable hydrogen bonded pair as compared to the base pairs A'-T and A-T'.
  • a SBC nucleobase of C is designated C and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase G
  • a SBC nucleobase of G is designated G' and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase C
  • C and G' will form an unstable hydrogen bonded pair as compared to the base pairs C-G and C-G'.
  • a stable hydrogen bonded pair is obtained when 2 or more hydrogen bonds are formed e.g. the pair between A' and T, A and T', C and G', and C and G.
  • SBC nucleobases are 2,6-diaminopurine (A', also called D) together with 2-thio-uracil (U', also called 2SU)(2-thio-4-oxo-pyrimidine) and 2-thio-thymine (T', also called 2ST)(2-thio-4-oxo-5-methyl-pyrimidine).
  • A' 2,6-diaminopurine
  • U' also called 2SU
  • T' 2-thio-thymine
  • the detection probe sequences of the invention are covalently bonded to a solid support by reaction of a nucleoside phosphoramidite with an activated solid support, and subsequent reaction of a nucleoside phosphoramide with an activated nucleotide or nucleic acid bound to the solid support.
  • the solid support or the detection probe sequences bound to the solid support are activated by illumination, a photogenerated acid, or electric current.
  • the detection probe sequences contain a spacer, e.g. a randomized nucleotide sequence or a non-base sequence, such as hexaethylene glycol, between the reactive group and the recognition sequence.
  • Such covalently bonded detection probe sequence populations are highly useful for large-scale detection and expression profiling of mature miRNAs and stem-loop precursor miRNAs.
  • a collection of (detection) probes comprises at least 10 detection probes, 15 detection probes, such as at least 20, at least 25, at least 50, at least 75, at least 100, at least 200, at least 500, at least 1000, and at least 2000 members.
  • the collection of probes according to the present invention consists of no more than 500 detection probes, such as no more than 200 detection probes, such as no more than 100 detection probes, such as no more than 75 detection probes, such as no more than 50 detection probes, such as no more that 50 detection probes, such as no more than 25 detection probes, such as no more than 20 detection probes.
  • the collection of probes according to the present invention has between 3 and 100 detection probes, such as between 5 and 50 detection probes, such as between 10 and 25 detection probes.
  • the affinity-enhancing nucleobase analogues are regularly spaced between the nucleobases in at least 80% of the members of said collection, such as in at least 90% or at least 95% of said collection (in one embodiment, all members of the collection contains regularly spaced affinity-enhancing nucleobase analogues).
  • all members contain affinity enhancing nucleobase analogues with the same regular spacing in the recognition sequences.
  • the collection of probes of the invention is one wherein at least 80% of the members comprise recognition sequences of the same length, such as at least 90% or at least 95%.
  • the nucleobases in the recognition sequence are selected from ribonucleotides and deoxyribonucleotides, preferably deoxyribonucleotides. It is preferred that the recognition sequence consists of affinity enhancing nucleobase analogues together with either ribonucleotides or deoxyribonucleotides.
  • each member of a collection is covalently bonded to a solid support.
  • a solid support may be selected from a bead, a microarray, a chip, a strip, a chromatographic matrix, a microtiter plate, a fiber or any other convenient solid support generally accepted in the art.
  • the collection may be so constituted that at least 90% (such as at least 95%) of the recognition sequences exhibit a melting temperature or a measure of melting temperature corresponding to at least 5°C higher than a melting temperature or a measure of melting temperature of the self-complementarity score under conditions where the probe hybridizes specifically to its complementary target sequence (or that at least the same percentages of probes exhibit a melting temperature of the probe-target duplex of at least 5°C more than the melting temperature of duplexes between the probes or the probes internally).
  • each detection probe in a collection of the invention may include a detection moiety and/or a ligand, optionally placed in the recognition sequence but also placed outside the recognition sequence.
  • the detection probe may thus include a photochemically active group, a thermochemically active group, a chelating group, a reporter group, or a ligand that facilitates the direct of indirect detection of the probe or the immobilisation of the oligonucleotide probe onto a solid support.
  • the collection of detection probes may be in the form of an array or micro-array to which (optionally labeled) miRNA fraction is applied.
  • a miRNA fraction obtained from one or more control samples may be applied to the same array (for example using a different label for the control fraction), or an equivalent array, so that the relative abundance of miRNAs present in each of the fractions may be obtained.
  • Arrays may be in the form of micro-arrays, bioarrays, biochips, biochip arrays etc - these are defined in US 2006/0160114.
  • Hybridisation refers to the bonding of two complementary single stranded nucleic acid polymers (such as oligonucleotides), such as RNA, DNA or polymers comprising or consisting of nucleotide analogues (such as LNA oligonucleotides).
  • Hybridisation is highly specific, and may be controlled by regulation of the concentration of salts and temperature.
  • Hybridisation occurs between complementary sequences, but may also occur between sequences which comprise some mismatches.
  • the probes used in the methods of the present invention may, therefore be 100% complementary to the target molecule. Alternatively, in one embodiment the detection probes may comprise one or two mismatches.
  • mismatches typically a single mismatch will not unduly affect the specificity of binding, however two or more mismatches per 8 nucleotide/nucleotide residues usually prevents specific binding of the detection probe to the target species.
  • the position of the mismatch may also be of importance, and as such the use of mismatches may be used to determine the specificity and strength of binding to target RNAs, or to allow binding to more than one allelic variant of mutation of a target species.
  • the detection probe consists of no more than 1 mismatch with the miRNA target.
  • the detection probe consists of no more than 1 mismatch per 8 nucleotide/nucleotide analogue bases.
  • hybridisation may also occur between a single stranded target molecule, such as a miRNA and a probe which comprises a complementary surface to the said target molecule, in this respect, it is the ability of the probe to form the specific bonding pattern with the target which is important.
  • Suitable methods for hybridisation include RNA in-situ hybridisation, dot blot hybridisation, reverse dot blot hybridisation, northern blot analysis, RNA protection assays, or expression profiling by microarrays. Such methods are standard in the art.
  • the detection probe is capable of binding to the target non coding RNA sequence under stringent conditions, or under high stringency conditions.
  • Exiqon provide microarrays suitable for use in the methods of the invention (microRNA Expression Profiling with miRCURYTM LNA Array).
  • the detection probe such as each member of a collection of detection probes, may be bound (such as conjugated) to a bead.
  • Luminex Texas, USA
  • Panomics QuantigenePlexTM http://www.panomics.com/pdf/qgplexbrochure.pdf.
  • RNAs which are targets for the detection probes are too short to be detected by amplification by standard PCR
  • methods of amplifying such short RNAs are disclosed in WO2005/098029. Therefore, the hybridisation may occur during PCR, such as RT-PCT or quantitative PCR (q-PCR).
  • tumor markers including CD31, BAX, BCL- 2, EGFR, ER receptor, HER2, Ki-67, MDR-I, p53, PR receptor, Thrombospondin 1, Thymidylate Synthase, and VEGV.
  • the EDR® assay was performed on the cancer samples by Oncotech Inc. using their commercially available service. For each tumor sample, cells were analyzed for their EDR status to the following drugs: 5FU+LEUCOVORIN (FULEU), IRINOTECAN (SN38),
  • EDR OXALIPLATIN
  • TOPO TOPOTECAN
  • the status of EDR, IDR or LDR was calculated based on the method descried in US2006/0160114 (Example 1) :
  • the EDR assay is an agarose-based culture system, using tritiated thymidine incorporation to define in vitro drug response. This assay is predictive of clinical response (Kern et al., 1990, "Highly specific prediction of antineoplastic resistance with an in vitro assay using suprapharmacologic drug exposures," J. Nat. Cancer Inst. 82: 582-588). Tumors are cut with scissors into pieces of 2 mm or smaller in a Petri dish containing 5 ml_ of complete medium.
  • the resultant slurries are mixed with complete media containing 0.03% DNAase (2650 Kunitz units/ml_) and 0.14% collagenase I (both enzymes obtained from Sigma Chemical Co., St. Louis, Mo.), placed into 50 ml_ Erlenmeyer flasks with stirring, and incubated for 90 min at 37. degree. C. under a humidified 5% CO. sub.2 atmosphere. After enzymatic dispersion into a near single cell suspension, tumor cells are filtered through nylon mesh, and washed in complete media.
  • DNAase 2650 Kunitz units/ml_
  • collagenase I both enzymes obtained from Sigma Chemical Co., St. Louis, Mo.
  • a portion of the cell suspension is used for cytospin slide preparation and stained with Wright-Giemsa for examination by a medical pathologist in parallel with Hematoxylin-Eosin stained tissue sections to confirm the diagnosis and to determine the tumor cell count and viability.
  • Tumor cells are then suspended in soft agarose (0.13%) and plated at 20,000-50,000 cells per well onto an agarose underlayer (0.4%) in 24-well plates. Tumor cells are incubated under standard culture conditions for 4 days in the presence or absence of the cancer treatment, which is typically dosed at between 5 and 80 times the in vivo dosage. For example 2.45 .mu.M paclitaxel may be used.
  • Cells are pulsed with tritiated thymidine (New Life Science Products, Boston, Mass.) at 5 .mu.Ci per well for the last 48 hours of the culture period. After labeling, cell culture plates are heated to 96. degree. C. to liquify the agarose, and the cells are harvested with a micro-harvester (Brandel, Gaithersburg, Md.) onto glass fiber filters. The radioactivity trapped on the filters is counted with an LS-6500 scintillation Counter (Beckman, Fullerton, Calif.). Untreated cells served as a negative control. In the positive (background) control group, cells are treated with a supratoxic dose of Cisplatin (33 .mu.M), which causes 100% cell death.
  • Cisplatin 33 .mu.M
  • Detectable radioactivity for this group is considered non-specific background related to debris trapping of tritiated thymidine on the filter.
  • RNA extraction Specimens were classified as EDR to the cancer treatment if the PCI was 19% or less; Specimens were classified as LDR to the cancer treatment if the PCI was 43% or greater: A PCI of above 19% but below 43% is indicative of an intermediate drug resistance (IDR).
  • IDR intermediate drug resistance
  • RNA extraction was performed at Oncotech (Tustin, CA) by a standard Trizol extraction method.
  • a RNA reference pool consisting of RNA from all colon samples was made and aliquots of the reference stock were stored at -8O 0 C for later use in the hybridization.
  • the 12-chamber TECAN HS4800Pro hybridization station was used for hybridization. 25 ⁇ l_ 2x hybridization buffer was added to each sample, vortexed and spun.
  • the slides were washed at 60 0 C for 1 min with Buffer A twice, at 23 0 C for 1 min with Buffer B twice, at 23 0 C for 1 min with Buffer C twice, at 23 0 C for 30 sec with Buffer C once.
  • the slides were dried for 5 min.
  • Image analysis and spot identification was done using Imagene 7.0.0 software (Biodiscovery). Within slide normalized was done with a Lowess smooth fitting using Genesight 4.1.6 Lite edition software (Biodiscovery).
  • Ratios of tumor/reference pool were calculated and Iog2 transformed from the Lowess normalized data sets.
  • Raw values Lowess normalized values
  • median scaled for comparison between samples.
  • the Iog2 ratios between the common reference and the sample channel for each patient were used in the statistical evaluation of the data set.
  • Table Ic EDR status for Irinotecan.
  • Table Id EDR status for Topotecan.
  • Gene ID Gene name mean LDR group SD mean EDR gorup SD P-value
  • Gene ID Gene name mean SD mean EDR gorup SD P-value
  • Gene ID Gene name mean LDR group SD mean EDR gorup SD P-value
  • Gene ID Gene name mean LDR group SD mean SD P-value
  • Example 2 Increasing evidence suggests that microRNAs play a key role in the initiation and progression of cancer, and therefore, may comprise a novel class of molecular biomarkers with prognostic and predictive potential.
  • Drug resistance is a major impediment to the successful chemotherapeutic treatment of cancer.
  • Current tests assay the ex vivo growth of a tumor in the presence of chemotherapeutic drugs but new molecular tests are needed.
  • Each sample's microRNA expression pattern was assayed on an LNA (Locked Nucleic Acid) enhanced microarray platform, which allows for very sensitive and specific detection of small RNA targets like microRNAs.
  • LNA Locked Nucleic Acid
  • mDR molecular Drug Resistance
  • Table 3 Mature sequences for the miRNAs detected in the miRCURYTM LNA Discovery array.
  • ROC hsa miR 1659 CGGGCAGCUCAGUACAGGAU
  • ROC hsa miR 1662 UUUGAAAGGCUAUUUCUUGGUC
  • ROS hsa miR 1712 CAACACCAGUCGAUGGGCUGUC
  • ROS hsa miR 1714 CAGAGCUUAGCUGAUUGGUGAACA
  • ROS hsa miR 1800 ACAACCCUAGGAGAGGGUGCCA
  • ROS hsa miR 1800 ACAACCCUAGGAGAGGGUGCCA
  • RNA labeling and hybridization was performed as described above. All hybridizations were made against a common reference pool.
  • the Iog2 ratios between the common reference and the sample channel for each patient i.e. the Hy3 over Hy5, wherein Hy5 is the common reference consisiting of a mixture of all ratios) were used in the statistical evaluation of the data set.
  • Figures show LDA plots and unsupervised hierarchial clustering for all comparisons based on the miRs that vary most between samples with EDR to one drug and samples with EDR to the other.
  • Figure 7 shows LDA plot based on the 40 most significant miRs (p ⁇ 0.05) after standard deviation (SD) filtering showing near-perfect separation between EDR to irinotecan (red/light grey) and EDR to Oxaliplatin (blue/dark grey) for FFPE specimens.
  • Figure 8 shows unsupervised hierarchical clustering based on the 33 miRNAs that vary most between EDR-Oxaliplatin and EDR-Irinotecan samples (p ⁇ 0.05, logR>0.2) for FFPE specimens.
  • Figure 9 shows LDA plot based on the 37 most significant miRNAs (p ⁇ 0.05) after SD filtering. Perfect separation between EDR to irinotecan (red/light grey) and EDR to 5-FU (blue/dark grey) for FFPE specimens.
  • Figure 10 shows unsupervised hierarchical clustering based on the 34 miRNAs that vary most between EDR-5-FU and EDR-Irinotecan samples (p ⁇ 0.05, logR>0.2) for FFPE specimens.
  • Figure 11 shows LDA plot based on the 33 most significant miRs (p ⁇ 0.01) after SD filtering. Perfect separation between EDR to Oxaliplatin (red/light grey) and EDR to 5-FU (blue/dark grey) for FFPE specimens.
  • Figure 12 shows unsupervised hierarchical clustering based on the 33 miRNAs that vary most between EDR-5-FU and EDR-Oxalilpatin samples (p ⁇ 0.01) for FFPE specimens.
  • Figure 13 shows LDA plot based on the 28 most significant miRNAs (p ⁇ 0.05). Perfect separation between EDR to irinotecan (red/light grey) and EDR to Oxaliplatin (blue/dark grey) for fresh frozen specimens.
  • Figure 14 shows unsupervised hierarchical clustering based on the 28 miRNAs that vary most between EDR-Oxaliplatin and EDR-Irinotecan samples (p ⁇ 0.05) for fresh frozen specimens.
  • EDR Extreme Drug Resistance

Abstract

L'invention concerne l'analyse d'échantillons, tels que des échantillons de cancers, isolés à partir de patients, pour déterminer ou prédire le phénotype du patient ou de la maladie, par exemple, cancer, en termes de résistance ou de sensibilité du patient ou de la maladie au traitement, tel qu'à un traitement anticancéreux. L'analyse se base sur la détermination de l'abondance des micro-ARN qui sont associés à une résistance au traitement, telle qu'une résistance extrême aux médicaments (EDR).
PCT/EP2008/066239 2007-12-21 2008-11-26 Procédé d'analyse de la résistance aux médicaments par les micro-arn WO2009080437A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US1579707P 2007-12-21 2007-12-21
DKPA200701843 2007-12-21
US61/015,797 2007-12-21
DKPA200701843 2007-12-21
DKPA200800535 2008-04-11
DKPA200800535 2008-04-11

Publications (2)

Publication Number Publication Date
WO2009080437A1 true WO2009080437A1 (fr) 2009-07-02
WO2009080437A9 WO2009080437A9 (fr) 2009-08-20

Family

ID=40318452

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2008/066239 WO2009080437A1 (fr) 2007-12-21 2008-11-26 Procédé d'analyse de la résistance aux médicaments par les micro-arn

Country Status (1)

Country Link
WO (1) WO2009080437A1 (fr)

Cited By (24)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011067346A1 (fr) * 2009-12-04 2011-06-09 Institut National De La Sante Et De La Recherche Medicale (Inserm) Procédé pour déterminer l'efficacité d'un traitement du cancer
WO2011149354A1 (fr) * 2010-05-28 2011-12-01 Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patiëntenzorg Arnmi impliqués dans la fonction de barrière hémato-encéphalique
WO2012052953A1 (fr) * 2010-10-20 2012-04-26 Fondazione Centro San Raffaele Del Monte Tabor Miarn
WO2011135459A3 (fr) * 2010-04-29 2012-06-07 Medical Prognosis Institute A/S Méthodes et dispositifs permettant de prédire l'efficacité d'un traitement
WO2012083969A3 (fr) * 2010-12-22 2012-08-09 Herlev Hospital Microarn pour le diagnostic du cancer du pancréas
EP2486929A1 (fr) * 2009-10-01 2012-08-15 National Cancer Center Agent thérapeutique anti-tumoral
US20120252907A1 (en) * 2011-04-01 2012-10-04 Indiana University Research And Technology Corporation Diagnostic methods and kit for detecting cancer
WO2012135817A3 (fr) * 2011-03-31 2012-12-27 University Of Houston Microarn-130a, b en tant que suppresseur de tumeur et agent de sensibilisation pour chimiothérapie
US20130078715A1 (en) * 2004-02-13 2013-03-28 Rockefeller University Anti-MicroRNA Oligonucleotide Molecules
WO2013063439A1 (fr) * 2011-10-27 2013-05-02 University Of Louisville Research Foundation, Inc. Caractérisation d'un mélanome
WO2013076282A1 (fr) 2011-11-25 2013-05-30 Integragen Procédé pour la prédiction de la sensibilité vis-à-vis d'un traitement par un inhibiteur d'egfr
EP2703488A1 (fr) * 2011-04-25 2014-03-05 Toray Industries, Inc. Composition pour la prédiction de la sensibilité à une thérapie par trastuzumab chez des patients atteints d'un cancer du sein, et procédé l'utilisant
WO2014111561A1 (fr) * 2013-01-21 2014-07-24 Deutsches Krebsforschungszentrum Arnmi-142-3p sérique utilisé comme marqueur de pronostic du cancer
WO2014145612A1 (fr) 2013-03-15 2014-09-18 Ajay Goel Biomarqueurs de miarn à base de tissu et de sang pour le diagnostic, le pronostic et le potentiel prédictif de métastases dans le cancer colorectal
WO2015056195A1 (fr) 2013-10-15 2015-04-23 Warszawski Uniwersytet Medyczny Utilisation de marqueurs microarn dans le diagnostic de lésions hépatiques
WO2015071876A2 (fr) 2013-11-14 2015-05-21 Warszawski Uniwersytet Medyczny Utilisation de microarn marqueurs pour le diagnostic de tumeurs de la thyroïde et panel de diagnostic contenant ces marqueurs
WO2015095632A1 (fr) * 2013-12-20 2015-06-25 Acetylon Pharmaceuticals, Inc. Biomarqueurs de l'histone-désacétylase 6 (hdac6) dans le myélome multiple
EP3000895A1 (fr) 2014-09-26 2016-03-30 Integragen Procédé de prédiction de la réactivité à un traitement avec un anticorps anti-EGFR
US10570457B2 (en) 2014-09-26 2020-02-25 Medical Prognosis Institute A/S Methods for predicting drug responsiveness
KR20200062721A (ko) * 2018-11-27 2020-06-04 강원대학교산학협력단 항암제 내성 진단 마커로서의 miR-143-3p 및 miR-373-5p, 및 이의 이용
US10907214B2 (en) 2016-12-30 2021-02-02 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
US11207269B2 (en) 2009-09-17 2021-12-28 Bio-Bedst Aps Medical use of sPLA2 hydrolysable liposomes
CN114214421A (zh) * 2020-03-30 2022-03-22 中国医学科学院肿瘤医院 用于肺癌诊断的试剂盒、装置及方法
US11421284B2 (en) 2016-10-07 2022-08-23 Allarity Therapeutics Europe ApS Methods for predicting drug responsiveness in cancer patients

Families Citing this family (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN104877960B (zh) * 2015-06-01 2017-09-19 东北农业大学 miR‑2400显著促进牛骨骼肌卫星细胞增殖的生物功能
CN107904310B (zh) * 2017-11-28 2020-09-01 中国科学院苏州纳米技术与纳米仿生研究所 用于大肠癌诊断的尿液microRNA生物标志物、试剂盒及其应用
CN107916292A (zh) * 2017-12-29 2018-04-17 唐山市人民医院 预测肺癌脑转移分子标记物miR‑423‑5p及在药物和诊断试剂盒中的应用

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008055158A2 (fr) * 2006-10-30 2008-05-08 University Of South Alabama Microarn en tant que biomarqueur dans le cancer
WO2008109519A2 (fr) * 2007-03-02 2008-09-12 University Of South Florida Profils de microarn associés au développement d'un cancer de l'endomètre et réponse à une chimiothérapie à base de cisplatine et de doxorubicine
WO2008112283A2 (fr) * 2007-03-12 2008-09-18 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Profil de la sensibilité aux androgènes
WO2008138578A2 (fr) * 2007-05-11 2008-11-20 Medical Prognosis Institute Procédés, coffrets et dispositifs pour identifier des biomarqueurs de réponse à un traitement et utilisation de ceux-ci pour prédire l'efficacité du traitement

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2008055158A2 (fr) * 2006-10-30 2008-05-08 University Of South Alabama Microarn en tant que biomarqueur dans le cancer
WO2008109519A2 (fr) * 2007-03-02 2008-09-12 University Of South Florida Profils de microarn associés au développement d'un cancer de l'endomètre et réponse à une chimiothérapie à base de cisplatine et de doxorubicine
WO2008112283A2 (fr) * 2007-03-12 2008-09-18 Government Of The United States Of America, As Represented By The Secretary, Department Of Health And Human Services Profil de la sensibilité aux androgènes
WO2008138578A2 (fr) * 2007-05-11 2008-11-20 Medical Prognosis Institute Procédés, coffrets et dispositifs pour identifier des biomarqueurs de réponse à un traitement et utilisation de ceux-ci pour prédire l'efficacité du traitement

Non-Patent Citations (7)

* Cited by examiner, † Cited by third party
Title
BERTINO JOSEPH R ET AL: "Pharmacogenomics of microRNA: a miRSNP towards individualized therapy.", PHARMACOGENOMICS DEC 2007, vol. 8, no. 12, December 2007 (2007-12-01), pages 1625 - 1627, XP002514636, ISSN: 1462-2416 *
BLOWER PAUL E ET AL: "MicroRNA expression profiles for the NCI-60 cancer cell panel", MOLECULAR CANCER THERAPEUTICS, vol. 6, no. 5, May 2007 (2007-05-01), pages 1483 - 1491, XP002514634, ISSN: 1535-7163 *
FILKOWSKI J N ET AL: "MicroRNAome de-regulation in breast cancer drug resistance.", ENVIRONMENTAL AND MOLECULAR MUTAGENESIS, vol. 48, no. 7, August 2007 (2007-08-01), & 38TH ANNUAL MEETING OF THE ENVIRONMENTAL-MUTAGEN-SOCIETY; ATLANTA, GA, USA; OCTOBER 20 -24, 2007, pages 555, XP002514637, ISSN: 0893-6692 *
FOJO TITO: "Multiple paths to a drug resistance phenotype: mutations, translocations, deletions and amplification of coding genes or promoter regions, epigenetic changes and microRNAs.", DRUG RESISTANCE UPDATES : REVIEWS AND COMMENTARIES IN ANTIMICROBIAL AND ANTICANCER CHEMOTHERAPY 2007 FEB-APR, vol. 10, no. 1-2, February 2007 (2007-02-01), pages 59 - 67, XP002514635, ISSN: 1368-7646 *
KOVALCHUK OLGA ET AL: "Involvement of microRNA-451 in resistance of the MCF-7 breast cancer cells to chemotherapeutic drug doxorubicin", MOLECULAR CANCER THERAPEUTICS, vol. 7, no. 7, July 2008 (2008-07-01), pages 2152 - 2159, XP002514638, ISSN: 1535-7163 *
SORRENTINO A ET AL: "Role of microRNAs in drug-resistant ovarian cancer cells", GYNECOLOGIC ONCOLOGY 200812 US, vol. 111, no. 3, December 2008 (2008-12-01), pages 478 - 486, XP002514639, ISSN: 0090-8258 1095-6859 *
WEIDHAAS JOANNE B ET AL: "MicroRNAs as potential agents to alter resistance to cytotoxic anticancer therapy", CANCER RESEARCH, vol. 67, no. 23, 1 December 2007 (2007-12-01), pages 11111 - 11116, XP002514633, ISSN: 0008-5472 *

Cited By (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20130078715A1 (en) * 2004-02-13 2013-03-28 Rockefeller University Anti-MicroRNA Oligonucleotide Molecules
US8816060B2 (en) * 2004-02-13 2014-08-26 Rockefeller University Anti-microRNA oligonucleotide molecules
US11207269B2 (en) 2009-09-17 2021-12-28 Bio-Bedst Aps Medical use of sPLA2 hydrolysable liposomes
US8921333B2 (en) 2009-10-01 2014-12-30 National Cancer Center Therapeutic agent for tumor
EP2486929A4 (fr) * 2009-10-01 2013-04-03 Nat Cancer Ct Agent thérapeutique anti-tumoral
EP2486929A1 (fr) * 2009-10-01 2012-08-15 National Cancer Center Agent thérapeutique anti-tumoral
WO2011067346A1 (fr) * 2009-12-04 2011-06-09 Institut National De La Sante Et De La Recherche Medicale (Inserm) Procédé pour déterminer l'efficacité d'un traitement du cancer
WO2011135459A3 (fr) * 2010-04-29 2012-06-07 Medical Prognosis Institute A/S Méthodes et dispositifs permettant de prédire l'efficacité d'un traitement
US9598734B2 (en) 2010-04-29 2017-03-21 Medical Prognosis Institute A/S Methods and devices for predicting treatment efficacy
AU2011246976B2 (en) * 2010-04-29 2016-01-28 Allarity Therapeutics Europe ApS Methods and devices for predicting treatment efficacy
US9297007B2 (en) 2010-05-28 2016-03-29 Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patientenzorg miRNAs involved in the blood brain barrier function
WO2011149354A1 (fr) * 2010-05-28 2011-12-01 Vereniging Voor Christelijk Hoger Onderwijs, Wetenschappelijk Onderzoek En Patiëntenzorg Arnmi impliqués dans la fonction de barrière hémato-encéphalique
WO2012052953A1 (fr) * 2010-10-20 2012-04-26 Fondazione Centro San Raffaele Del Monte Tabor Miarn
WO2012083969A3 (fr) * 2010-12-22 2012-08-09 Herlev Hospital Microarn pour le diagnostic du cancer du pancréas
US9192622B2 (en) 2011-03-31 2015-11-24 University Of Houston MicroRNA-130a,b as a tumor suppressor and sensitizing agent for chemotherapy
WO2012135817A3 (fr) * 2011-03-31 2012-12-27 University Of Houston Microarn-130a, b en tant que suppresseur de tumeur et agent de sensibilisation pour chimiothérapie
US20120252907A1 (en) * 2011-04-01 2012-10-04 Indiana University Research And Technology Corporation Diagnostic methods and kit for detecting cancer
US9200325B2 (en) * 2011-04-01 2015-12-01 Indiana University Research And Technology Corporation Diagnostic methods and kit for detecting cancer
US9873916B2 (en) 2011-04-25 2018-01-23 Toray Industries, Inc. Method for predicting response to trastuzumab therapy in breast cancer patients
EP2703488A4 (fr) * 2011-04-25 2015-02-25 Toray Industries Composition pour la prédiction de la sensibilité à une thérapie par trastuzumab chez des patients atteints d'un cancer du sein, et procédé l'utilisant
JP6026408B2 (ja) * 2011-04-25 2016-11-16 東レ株式会社 乳ガン患者のトラスツズマブに対する治療感受性予測用組成物及び方法
EP2703488A1 (fr) * 2011-04-25 2014-03-05 Toray Industries, Inc. Composition pour la prédiction de la sensibilité à une thérapie par trastuzumab chez des patients atteints d'un cancer du sein, et procédé l'utilisant
WO2013063439A1 (fr) * 2011-10-27 2013-05-02 University Of Louisville Research Foundation, Inc. Caractérisation d'un mélanome
US9493840B2 (en) 2011-10-27 2016-11-15 University Of Louisville Research Foundation, Inc. Characterizing melanoma
AU2012342397B2 (en) * 2011-11-25 2018-04-05 Assistance Publique - Hopitaux De Paris A method for predicting responsiveness to a treatment with an EGFR inhibitor
US10400284B2 (en) 2011-11-25 2019-09-03 Integragen Method for predicting responsiveness to a treatment with an EGFR inhibitor
WO2013076282A1 (fr) 2011-11-25 2013-05-30 Integragen Procédé pour la prédiction de la sensibilité vis-à-vis d'un traitement par un inhibiteur d'egfr
JP2014533960A (ja) * 2011-11-25 2014-12-18 アンテグラジャンＩｎｔｅｇｒａｇｅｎ Ｅｇｆｒ阻害剤による治療に対する応答性を予測するための方法
WO2014111561A1 (fr) * 2013-01-21 2014-07-24 Deutsches Krebsforschungszentrum Arnmi-142-3p sérique utilisé comme marqueur de pronostic du cancer
EP2971132A4 (fr) * 2013-03-15 2016-10-19 Baylor Res Inst Biomarqueurs de miarn à base de tissu et de sang pour le diagnostic, le pronostic et le potentiel prédictif de métastases dans le cancer colorectal
WO2014145612A1 (fr) 2013-03-15 2014-09-18 Ajay Goel Biomarqueurs de miarn à base de tissu et de sang pour le diagnostic, le pronostic et le potentiel prédictif de métastases dans le cancer colorectal
US9868992B2 (en) 2013-03-15 2018-01-16 Baylor Research Institute Tissue and blood-based miRNA biomarkers for the diagnosis, prognosis and metastasis-predictive potential in colorectal cancer
WO2015056195A1 (fr) 2013-10-15 2015-04-23 Warszawski Uniwersytet Medyczny Utilisation de marqueurs microarn dans le diagnostic de lésions hépatiques
WO2015071876A2 (fr) 2013-11-14 2015-05-21 Warszawski Uniwersytet Medyczny Utilisation de microarn marqueurs pour le diagnostic de tumeurs de la thyroïde et panel de diagnostic contenant ces marqueurs
WO2015095632A1 (fr) * 2013-12-20 2015-06-25 Acetylon Pharmaceuticals, Inc. Biomarqueurs de l'histone-désacétylase 6 (hdac6) dans le myélome multiple
US10570457B2 (en) 2014-09-26 2020-02-25 Medical Prognosis Institute A/S Methods for predicting drug responsiveness
EP3000895A1 (fr) 2014-09-26 2016-03-30 Integragen Procédé de prédiction de la réactivité à un traitement avec un anticorps anti-EGFR
US11421284B2 (en) 2016-10-07 2022-08-23 Allarity Therapeutics Europe ApS Methods for predicting drug responsiveness in cancer patients
US10907214B2 (en) 2016-12-30 2021-02-02 Oncology Venture ApS Methods for predicting drug responsiveness in cancer patients
KR102132222B1 (ko) * 2018-11-27 2020-07-09 강원대학교산학협력단 항암제 내성 진단 마커로서의 miR-143-3p 및 miR-373-5p, 및 이의 이용
KR20200062721A (ko) * 2018-11-27 2020-06-04 강원대학교산학협력단 항암제 내성 진단 마커로서의 miR-143-3p 및 miR-373-5p, 및 이의 이용
CN114214421A (zh) * 2020-03-30 2022-03-22 中国医学科学院肿瘤医院 用于肺癌诊断的试剂盒、装置及方法
CN114214421B (zh) * 2020-03-30 2023-06-23 中国医学科学院肿瘤医院 外泌体miR-3615、ARPC5等在肺癌诊断中的应用

Also Published As

Publication number Publication date
WO2009080437A9 (fr) 2009-08-20

Similar Documents

Publication Publication Date Title
WO2009080437A1 (fr) Procédé d'analyse de la résistance aux médicaments par les micro-arn
US20230046649A1 (en) Microrna assay for detection and management of pancreatic cancer precursors
US20080076674A1 (en) Novel oligonucleotide compositions and probe sequences useful for detection and analysis of non coding RNAs associated with cancer
EP2090665A2 (fr) Nouveaux micro ARN humains associés au cancer
Wu et al. Next-generation sequencing of microRNAs for breast cancer detection
US8188255B2 (en) Human microRNAs associated with cancer
Chen et al. MicroRNA analysis as a potential diagnostic tool for papillary thyroid carcinoma
Feber et al. MicroRNA prognostic signature for nodal metastases and survival in esophageal adenocarcinoma
US9493832B2 (en) Methods of detecting sepsis
EP2800820B1 (fr) Procédés et trousses pour détecter des sujets atteints d'un cancer du pancreas
AU2012265177B2 (en) Methods and devices for prognosis of cancer relapse
Li et al. Identification of aberrantly expressed miRNAs in rectal cancer
US20110160290A1 (en) Use of extracellular rna to measure disease
Hermansen et al. MicroRNA biomarkers in glioblastoma
US20100286044A1 (en) Detection of tissue origin of cancer
WO2006069584A2 (fr) Nouvelles compositions d'oligonucleotides et sequences de sondes utiles pour la detection et l'analyse de microarn et de leurs marn cibles
AU2012265177A1 (en) Methods and devices for prognosis of cancer relapse
KR20100084619A (ko) 마이크로―ＲＮＡ／ｍｉＲＮＡ 의 감별 검출을 이용한 특정 암에 대한 진단 및 예후
EP3143162A1 (fr) Signature d'expression d'arnmi dans la classification des tumeurs thyroïdiennes
GB2536374A (en) Biomarkers useful for detection of types, grades and stages of human breast cancer
WO2011154008A1 (fr) Classification de micro-arn de néoplasie folliculaire de la thyroïde
CN110628913B (zh) 一种与乳腺癌相关的lncRNA标志物
KR20110015013A (ko) 결장직장암의 평가 방법 및 여기에 사용하기 위한 조성물
JP2022536502A (ja) 癌を治療するための組成物および方法
CN110055333B (zh) Rp11-116o18.1作为分子标志物在肺癌中的应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08865495

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08865495

Country of ref document: EP

Kind code of ref document: A1