WO2012052953A1 - Miarn - Google Patents

Miarn Download PDF

Info

Publication number
WO2012052953A1
WO2012052953A1 PCT/IB2011/054686 IB2011054686W WO2012052953A1 WO 2012052953 A1 WO2012052953 A1 WO 2012052953A1 IB 2011054686 W IB2011054686 W IB 2011054686W WO 2012052953 A1 WO2012052953 A1 WO 2012052953A1
Authority
WO
WIPO (PCT)
Prior art keywords
mir
mirna
cells
protein
cell
Prior art date
Application number
PCT/IB2011/054686
Other languages
English (en)
Inventor
Michele De Palma
Luigi Naldini
Mario Leonardo Squadrito
Original Assignee
Fondazione Centro San Raffaele Del Monte Tabor
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Fondazione Centro San Raffaele Del Monte Tabor filed Critical Fondazione Centro San Raffaele Del Monte Tabor
Publication of WO2012052953A1 publication Critical patent/WO2012052953A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09—Recombinant DNA-technology
    • C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/11—Antisense
    • C12N2310/113—Antisense targeting other non-coding nucleic acids, e.g. antagomirs
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00—Structure or type of the nucleic acid
    • C12N2310/10—Type of nucleic acid
    • C12N2310/14—Type of nucleic acid interfering N.A.
    • C12N2310/141—MicroRNAs, miRNAs

Definitions

  • the present invention relates to methods and compositions involving microRNA (miR As) molecules. Certain aspects of the invention relate to applications of miRNA therapy for diseases or conditions that involve angiogenesis. Certain aspects of the invention relate to applications of miRNA therapy for diseases or conditions associated with tumours.
  • angiogenesis (also referred to as “neovascularisation”) is a general term used to denote the growth of new blood vessels both in normal and pathological conditions.
  • Angiogenesis is an important natural process that occurs during embryogenesis, fetal and post-natal growth and in the adult healthy body in the process of wound healing, and in restoration of blood flow back into injured tissues. In females, angiogenesis also occurs during the monthly reproductive cycle to build up the uterus lining and to support maturation of oocytes during ovulation, and in pregnancy when the placenta is formed, in the process of the establishment of circulation between the mother and the fetus.
  • the aim was to control or diminish excessive and pathological angiogenesis that occurs in diseases such as cancer, diabetic blindness, age related macular degeneration, rheumatoid arthritis, psoriasis, and additional conditions.
  • diseases such as cancer, diabetic blindness, age related macular degeneration, rheumatoid arthritis, psoriasis, and additional conditions.
  • the new blood vessels feed the diseased tissue, for example the tumor tissue, providing it with essential oxygen and nutrients thus enabling its pathological growth.
  • the pathological angiogenesis may destroy the normal tissue.
  • the new blood vessels, formed for example in the tumor tissue enable the tumor cells to escape into the circulation and metastasize in other organs.
  • excessive angiogenesis occurs when diseased cells produce abnormal amounts of angiogenetic growth factors, overwhelming the effect of the natural angiogenesis inhibitors present in the body.
  • Anti-angiogenetic therapies developed recently, are aimed at preventing new blood vessel growth through the targeting and neutralization of any of the stimulators that encourage the formation of new bl ood vessels.
  • a contrasting indication of regulating angiogenesis is the stimulation of production of neovascularization in conditions where insufficient angiogenesis occurs.
  • these conditions are diseases such as coronary artery diseases, stroke, and delayed wound healing (for example in ulcer lesions).
  • insufficient angiogenesis occurs when the tissues do not produce adequate amounts of angiogenetic growth-factors, and therapeutic angiogenesis is aimed at stimulating new blood vessels' growth by the use of growth factors or their mimics.
  • the present invention seeks to provide a solution to the aforementioned needs.
  • TAMs downregulates Rock2; (ii) reduces their expression of several ECM genes, including collagens and other fibrous proteins; (iii) broadly and specifically attenuates the expression of genes that define the protumoral gene signature of MRC1 + TAMs; (iv) reduces tumor growth in mice.
  • constitutive ROCK activation in epithelial cells induces ⁇ -catenin stabilization, cell hyperproliferation, and enhanced collagen synthesis and ECM stiffening, leading to increased tumor incidence and progression 1 .
  • TAMs represent a major component of the tumor stroma, their modulation of ROCK2 and ECM-protein synthesis by miR-5 l l-3p may have the potential to influence stromal dynamics in the tumor microenvironment.
  • a method for stimulating angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of an inhibitor of miR-511, preferably an inhibitor of miR-511 -3 -p, or an inhibitor of a nucleic acid molecule comprising an miRNA sequence that is or comprises miR-511-3-p.
  • a method for reducing angiogenesis in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511-3-p.
  • a method for inhibiting tumor growth in a subject or tissue comprising administering to the subject or tissue an effective amount of a nucleic acid molecule comprising a miRNA sequence that is or comprises miR-511 -3-p.
  • the present invention is directed to and relates to uses of miR-511-3-p, and not miR- 51 l-5p and modulators, including inhibitors thereof.
  • the miR-51 1 -3p active strand of the present invention is:
  • AAUGUGUAGCAAAAGACAGAAU human miR-51 l-3p sequence, or hsa-miR- 511-3p
  • AAUGUGUAGCAAAAGACAGGAU (mouse miR-51 l-3p sequence, or mmu-miR- 511-3p)
  • a method for selecting an angiogenesis therapy for a patient comprising: measuring an expression profile of miR-511 of the invention, optionally in a sample; and selecting a therapy based on a comparison of the miRNA expression profile in the patient sample to an expression profile of a normal or nonpathogenic sample, wherein a difference between the expression profiles is indicative of a pathological condition.
  • An altered expression for the miRNA may indicate that the patient should be treated with a coiTesponding therapeutic directed towards the altered miRNA or condition indicated by such altered miRNA.
  • the method includes a step of generating a miRNA profile for a sample.
  • miRNA profile refers to data regarding the expression pattern of a miRJSTA(s) in the sample (including the miRNA of the invention).
  • the miRNA profile can be obtained using known hybridization techniques.
  • a miRNA profile is generated by steps that include one or more of: (a) labeling miRNA in the sample; (b) hybridizing miRNA to a number of probes, or amplifying a number of miRNAs, and/or (c) determining miRNA hybridization to the probes or detecting miRNA amplification products, wherein miRNA expression levels are determined or evaluated.
  • Methods of the invention include determining a diagnosis or prognosis for a patient based on miRNA expression or expression levels, hi certain embodiments, the elevation or reduction in the level of expression of the miRNA of the present invention or set of miRNAs including the miRNA of the present invention in a cell is correlated with a disease state as compared to the expression level of that miRNA or set of miRNAs in a normal cell or a reference sample or digital reference. This correlation allows for diagnostic methods to be carried out when the expression level of a miRNA is measured in a biological sample being assessed.
  • Methods can further comprise normalizing the expression levels of miRNA. Normalizing includes, but is not limited to adjusting expression levels of miRNA relative to expression levels of one or more nucleic acid in the sample.
  • Embodiments of the invention include methods for diagnosing, assessing a condition, and/or prognosing a disease or condition associated with or having an accompanying aberrant vascularization in a patient comprising evaluating or determining the expression or expression levels of one or more mi ' RNAs, including the miRNA of the present invention, in a sample from the patient.
  • the difference in the expression in the sample from the patient and a reference, such as expression in a normal or non-pathologic sample is indicative of a pathologic or diseased condition associated with neovascularization and/or angiogenesis.
  • the miRNA expression level is compared to the expression level of a normal cell or a reference sample or a digital reference. Comparing miRNA expression levels includes comparing miRNA expression levels in a sample to miRNA expression levels in a normal tissue sample or reference tissue sample.
  • a normal tissue sample can be taken from the patient being evaluated and can be a normal adjacent tissue to the area being assessed or evaluated.
  • Embodiments of the invention include kits for analysis of a pathological sample by assessing a miRNA profile for a sample comprising, in suitable container means, one or more miRNA probes and/or amplification primers, wherein the miRNA probes detect or primer amplify one or more miRNA described herein.
  • the invention also relates to a recombinant expression vector comprising a recombinant nucleic acid operatively linked to an expression control sequence, wherein expression, i.e. transcription and optionally further processing results in a miRNA-molecule or miRNA precursor molecule as described above.
  • the vector is preferably a DNA-vector, e.g. a viral vector or a plasmid, particularly an expression vector suitable for nucleic acid expression in eukaryotic, more particularly mammalian cells.
  • the recombinant nucleic acid contained in said vector may be a sequence which results in the transcription of the miRNA-molecule as such, a precursor or a primary transcript thereof, which may be further processed to give the miRNA-molecule .
  • the present invention also includes compositions comprising the miRNA of the invention or inhibitors thereof.
  • the miRNA molecules of the present invention may act as target for therapeutic screening procedures, e.g. inhibition or activation of miRNA molecules might modulate a cellular differentiation process, e.g. apoptosis.
  • the present invention further relates to a method for identifying a proangiogenic cell comprising detecting the expression of the miRNA of the present invention.
  • miRNA microRNA
  • Mrcl mannose receptor
  • miR-511 -3p targeted Rho-dependent- kinase2 (Rock2), decreased TAM expression of extra-cellular matrix (ECM) genes, and tuned-down the protumoral "gene signature" of MRC1 + TAMs.
  • ECM extra-cellular matrix
  • the composition and biophysical properties of the ECM influence tumor growth. Increased collagen deposition and ECM density/stiffness stimulate tumor cell proliferation, invasion and malignancy 2 3 .
  • ECM fibrous proteins are mainly produced by epithelial cells and fibroblasts in tumors 2 ' 4 , there is also evidence that several collagen genes are robustly expressed by in vitro cultured macrophages 5 . Macrophage deficiency impairs tissue remodeling, angiogenesis and growth both during organ healing 6 and tumor progression 7 ' 8 .
  • TAMs The protumoral functions of TAMs are thought to depend, at least in part, on their production of growth, proangiogenic and ECM-remodeling factors (e.g., collagenases), which enhance tumor cell motility, activate fibroblasts and facilitate angiogenesis 7 ' 8 .
  • ECM-remodeling factors e.g., collagenases
  • TAMs may exert either pro- or antitumoral functions 7 ' 8 .
  • TAMs can be divided into at least two main subsets: MRCl + CDl lc ⁇ and CDl lc + MRCl low macrophages.
  • MRC1 + TAMs express a gene signature that is consistent with enhanced proangiogenic, protumoral and tissue-remodelling activity and lower proinflammatory activity compared to CDl lc 1 TAMs 7,9,10 .
  • These MRC1 + TAMs are reminiscent of M2 -polarized, "alternatively activated" macrophages u .
  • CDl lc + TAMs express higher levels of proinflammatory mediators and angiostatic cytokines than MRC1 + TAMs 7 ' 9,10 , have antiangiogenic and antitumoral activity 12 ' 13 , and display features of Ml-polarized, "classically activated" macrophages 11 .
  • M2-like TAMs 1 Although several bioeffector molecules have been identified that may account for the protumoral activity of M2-like TAMs 1 , little is known of the intrinsic signals that modulate TAM' s pro- vs. antitumoral functions.
  • miRNAs are single stranded RNAs of -22 nt in length that are generated from endogenous hairpin-shaped transcripts (primary miRNAs).
  • miRNAs expressed in each cell type determines the fine tuning of hundreds of mRNAs, thus regulating gene expression and cell function 14 .
  • miRNAs are highly expressed in human macrophages cultured in vitro 15 ' 16 , little is known of the miRNA expression profile of TAMs and their subsets.
  • miR-511-3p a novel miRNA, miR-511-3p, that is embedded within the fifth intron of the mouse/human Mrcl/MRCl gene and that is specifically and highly expressed in MRC1 + TAMs among tumor-infiltrating myeloid cells.
  • RNAi small interfering RNAs
  • siRNAs small interfering RNAs
  • RISC RNA-induced silencing complex
  • miRNA short hairpin RNA
  • shRNA short hairpin RNA
  • miRNA microRNAs
  • pri-miRNAs long primary transcripts
  • the pri-miRNA is cleaved by the nuclear Drosha-DGCR8 complex to produce pre-miRNA, which are further processed in the cytoplasm to mature miRNA duplex.
  • the expression of many of these miRNAs is restricted to specific cell lineages and developmental stages, and recent data suggest that they exert profound influence on gene regulation in a wide range of conditions and diseases including cancer (Skaftnesmo et al (2007) Curr Pharm Biotechnol 8, 320-5).
  • miRNAs are single stranded RNAs (ssRNAs) of -22 nt in length that are generated from endogenous hairpin-shaped transcripts 14 ' 17 .
  • miRNAs function as guide molecules in post-transcriptional gene regulation by base pairing with target mRNAs, which are generally located in the 3' untranslated region (UTR) of the gene. Binding of a miRNA to the target mRNA generally leads to translational repression and mRNA degradation. Over one third of human genes are predicted to be directly targeted by miRNAs 17 .
  • the unique combination of miRNAs in each cell type determines the fine tuning of thousands of mRNAs' 4 ' 7 .
  • miRNAs are generated from noncoding transcription units (TUs), whereas others are encoded in protein coding TUs 17 .
  • TUs noncoding transcription units
  • Approximately 50% of all miRNA loci are located either in the intronic or exonic region of noncoding TUs.
  • -40% of all miRNA loci are found in intronic regions of protein-coding TUs 17 .
  • the miRNA is under the transcriptional control of the hosting gene promoter, although there may be rare cases in which individual miRNAs are derived from separate gene promoters located within introns 18 .
  • the expression of the miRN A most often correlates with that of the host gene 19 .
  • the present invention also encompasses the use of modified miRNA.
  • modified is used to indicate that the genomic miRNA-encoding sequence comprises one or more mutations, such that it produces a modified pre-miRNA which is different from the pre- miRNA sequence which would have been produced, had the genomic sequence not been mutated.
  • the genomic pre-miRNA-encoding sequence is endogenous, in the sense that its sequence, prior to modification, occurs naturally within the genome.
  • the present invention involves methods which employ the detection of miRNA expression.
  • a number of techniques have been developed to determine miRNA expression and any appropriate technique may be employed in the present invention.
  • miRNA array technology offers a powerful high-throughput tool to monitor the expression of thousands of miRNAs at once.
  • Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) is another reliable and highly sensitive technique for miRNA detection, which only requires very small amounts of input total RNA.
  • Northern blotting has also been employed to detect and validate miRNA expression levels.
  • techniques are available to detect miRNAs by in situ hybridization. Although various miRNAs have been detected from tissue sources, these methods require invasive techniques to collect the starting material. Therefore, procedures have also been established to measure miRNA expression in blood products to enable clinical feasibility of miRNA measurement (Chen X et al Cell Res 2008, 7:2643-2646). Recently, the advent of next generation sequencing technologies allows for the measurement of the absolute abundance.
  • the miRNA of the present invention may be used for the diagnosis of diseases associated with angiogensis, such as cancer.
  • miRNA expression profiles can be used to distinguish tumor from normal samples, identification of tissue of origin for tumors of unknown origin or in poorly differentiated tumors and to distinguish different subtypes of tumors.
  • Sample datasets can be stratified to show that certain alterations of miR As occur in patients at an early stage of cancer and other angiogenesis-related disease and thus may be useful for early detection of disease. Large tissue specimens are not needed for accurate miRNA detection since their expression can be easily measured in biopsy specimens.
  • studies may be conducted on tissue, recent studies have shown that miRNAs can be measured in formalin fixed paraffin embedded (FFPE) tissues.
  • FFPE formalin fixed paraffin embedded
  • miRNAs can be detected in serum, thus screening can be carried out via less invasive blood-based mechanisms.
  • the miRNA of the present invention may also be used in other clinical measures such as prognosis and treatment response.
  • the miRNA of the present invention may be useful as an indicator of clinical outcome in a number of angiogenesis-related diseases, such as cancer types.
  • the miRNA of the present invention may be used to predict the tendency for recurrence of disease.
  • a method of use that involves inhibiting or reducing the miRNA levels or their effect.
  • This may be achieved through a number of approaches.
  • anti-miRNA oligonucleotides AMOs
  • AMOs conjugated to cholesterol AMOs conjugated to cholesterol (antagomirs) have been also been generated and have been described to efficiently inhibit miRNA activity in vivo.
  • LNAs locked-nucleic-acid antisense oligonucleotides
  • Another method for reducing the interaction between miRNAs and their targets is the use of microRNA sponges. These sponges are synthetic mRNAs that contain multiple binding sites for an endogenous miRNA. Sponges designed with multimeric seed sequences have been shown to effectively repress miRNA families sharing the same seed sequence.
  • miRmasking uses a sequence with perfect complementarity to the target gene such that duplexing will occur with higher affinity than that between the target gene and its endogenous miRNA. The caveat of this approach is that the choice of target gene must be specific in order to effectively reduce the interaction.
  • Another strategy to increase specificity of effects is the use of small molecule inhibitors against specific microRNAs.
  • a method that involves overexpressing or increasing the miRNA levels or their effect. This can be achieved e.g. through techniques such as the use of viral or liposomal delivery mechanisms.
  • Other delivery systems include non-viral methods of gene transfer such as cationic liposome mediated systems.
  • MicroRNA mimics have also been used to increase miRNA expression. These small, chemically modified double-stranded RNA molecules mimic endogenous mature microRNA. These mimics are now commercially available and promising results have been reported with systemic delivery methods using lipid and polymer-based nanoparticles.
  • 'Treating' refers to treatment of a subject having a disease in order to ameliorate, cure or reduce the symptoms of the disease, or reduce or halt the progression of the disease.
  • the term 'preventing' is intended to refer to averting, delaying, impeding or hindering the contraction of a disease.
  • the present invention relates to' the treatment (including prevention) of angiogenesis or angiogenesis-related diseases.
  • Angiogenesis occurs in the healthy body for healing wounds and for restoring blood flow to tissues after injury or insult. In females, angiogenesis also occurs during the monthly reproductive cycle (to rebuild the uterus lining, to mature the egg during ovulation) and during pregnancy (to build the placenta, the circulation between mother and fetus).
  • Angiogenesis-dependent diseases result when new blood vessels either grow excessively or insufficiently.
  • Occurs in diseases such as cancer, diabetic blindness, age-related macular degeneration, rheumatoid arthritis, psoriasis, and more than 70 other conditions.
  • Antiangiogenic therapies aimed at halting new blood vessel growth, are used to treat these conditions.
  • the angiogenesis may be associated with, for example, tumor vascularization, retinopathies (e.g., diabetic retinopathy), rheumatoid arthritis, Crohn's disease, atherosclerosis, hyperstimulation of the ovary, psoriasis, endometriosis associated with neovascularization, restenosis due to balloon angioplasty, tissue overproduction due to cicatrization, peripheral vascular disease, hypertension, vascular inflammation, Raynaud's disease and phenomena, aneurism, arterial restenosis, thrombophlebitis, lymphangitis, lymphedema, tissue cicatrization and repair, ischemia, angina, myocardial infarction, chronic heart disease, cardiac insufficiencies such as congestive heart failure, age-related macular degeneration and osteoporosis.
  • retinopathies e.g., diabetic retinopathy
  • Crohn's disease Crohn's disease
  • Suitable pathological disorders include cardiac ischemia, atherosclerosis, renal vascular disease, stroke, a wound, placental insufficiency, unvascularized tissue related to grafts and transplants, disorders relating to endothelial cell apoptosis or necrosis, hemangiomas, proliferative retinopathy, and cancer.
  • the present invention also relates to a method for treating a pathological disorder in a patient which includes administering the miRNA of the invention in an amount effective to treat the pathological disorder by inducing angiogenesis in the manner described above.
  • the pathological disorder is ischemic cardiopathy and/or cerebrovascular disorders caused by insufficient cerebral circulation.
  • Thrombi or emboli due to atherosclerotic or other disorders commonly cause ischemic arterial obstruction.
  • the pathological disorder is a non-cardiac vascular disorder including atherosclerosis, renal vascular disease, and stroke.
  • the pathological disorder is a wound.
  • wounds include, but are not limited to, chronic stasis ulcers, diabetic complications, complications of sickle cell disease, thalassemia and other disorders of hemoglobin, and post-surgical wounds.
  • the pathological disorder is a condition of placental insufficiency. Such conditions include, but are not limited to, intrauterine growth retardation.
  • the pathological disorder unvascularized tissue related to grafts and transplants (see, e. g., PCT International Application No, WO 99/06073 to Isner, which is hereby incorporated by reference).
  • Another aspect of the present invention is a method of promoting vessel growth or stabilization which includes delivering an effective amount of an inhibitor of miRNA of the present invention in an amount effective to promote vessel growth or stabilization in the manner described above.
  • Yet another aspect of the present invention is a method for treating a pathological disorder in a patient which includes administering an inhibitor of miRNA of the invention in an amount effective to treat the pathological disorder by promoting vessel growth or stabilization in the manner described above.
  • the pathological disorder relates to endothelial cell apoptosis or necrosis.
  • An example of such a pathological disorder is vasculitis.
  • the pathological disorder of the present invention is a vascular proliferative disease.
  • Suitable vascular proliferative diseases include hemangiomas and proliferative retinopathy.
  • the pathological disorder is cancer.
  • non-Hodgkin's lymphoma Hodgkin's lymphoma
  • leukemia e.g., acute leukemia such as acute lymphocytic leukemia, acute myelocytic leukemia, chronic myeloid leukemia, chronic lymphocytic leukemia, multiple myeloma
  • colon carcinoma rectal carcinoma, pancreatic cancer, breast cancer, ovarian cancer, prostate cancer, renal cell carcinoma, hepatoma, bile duct carcinoma, choriocarcinoma, cervical cancer, testicular cancer, lung carcinoma, bladder carcinoma, melanoma, head and neck cancer, brain cancer, cancers of unknown primary site, neoplasms, cancers of the peripheral nervous system, cancers of the central nervous system, tumors (e.g., fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteogenic sarcoma, chordom
  • tumors e.g., fibros
  • the subject of the invention may be a mammalian subject, such as a human.
  • the technology may also be used in model animals, such as mouse models of a disease.
  • the claimed miRNA molecules or its inhibitors are preferably provided as a pharmaceutical composition.
  • This pharmaceutical composition comprises as an active agent at least one nucleic acid molecule as described above and optionally a pharmaceutically acceptable carrier.
  • the administration of the pharmaceutical composition may be carried out by known methods, wherein a nucleic acid is introduced into a desired target cell in vitro or in vivo.
  • the composition may be in form of a solution, e.g. an injectable solution, a cream, ointment, tablet, suspension or the like.
  • the composition may be administered in any suitable way, e.g. by injection, by oral, topical, nasal, rectal application etc.
  • the carrier may be any suitable pharmaceutical carrier.
  • a carrier is used, which is capable of increasing the efficacy of the miRNA molecules to enter the target-cells.
  • Suitable examples of such carriers are liposomes, particularly cationic liposomes.
  • the choice of delivery system may depend of the number and type of subjects to be treated.
  • the method and pharmaceutical composition of the invention may be used to treat a human or animal subject. Typically, a physician will determine the actual dosage which will be most suitable for an individual subject and it will vary with the age, weight and response of the particular subject.
  • the routes for administration (delivery) in mammalian subjects may include, but are not limited to, one or more of oral (e.g. as a tablet, capsule, or as an ingestable solution), topical, mucosal (e.g. as a nasal spray or aerosol for inhalation), nasal, parenteral (e.g.
  • an injectable form by an injectable form), gastrointestinal, intraspinal, intraperitoneal, intramuscular, intravenous, intrauterine, intraocular, intradermal, intracranial, intratracheal, intratumoural, intravaginal, intracerebro ventricular, intracerebral, subcutaneous, ophthalmic (including intravitreal or intracameral), transdermal, rectal, buccal, vaginal, epidural, sublingual or systemic.
  • composition administered may optionally comprise a pharmaceutically acceptable carrier, diluent, excipient or adjuvant.
  • a pharmaceutically acceptable carrier diluent, excipient or adjuvant.
  • the choice of pharmaceutical carrier, excipient or diluent can be selected with regard to the intended route of administration and standard pharmaceutical practice.
  • the pharmaceutical compositions may comprise as (or in addition to) the carrier, excipient or diluent, any suitable binder(s), lubricant(s), suspending agent(s), coating agent(s), solubilising agent(s), and other carrier agents known in the art.
  • the compositions are best used in the form of a sterile aqueous solution which may contain other agents, for example enough salts or monosaccharides to make the solution isotonic with blood.
  • miR-511-3p is the active strand of mouse pre-miR-511
  • A Genomic region comprising the mouse miR-51 1 locus and the surrounding Mrcl gene on mouse chromosome 2, as retrieved by the UCSC (NCBB7/mm9) genome browser.
  • B Stem-loop structure of the mouse pre-miR-511. miR-511 -5p and -3p sequences are shown.
  • C Schematic of the proviral LV used to measure miR-511 activity (miRT-511 LV). The miRT sequences are cloned downstream to the GFP expression cassette, which is regulated by a bidirectional PGK promoter.
  • D Schematic of the proviral LV used to overexpress miR-511 (SFFV.miR-51 1 LV). The sequence of the primary miR-511 is cloned within the EFla intron, downstream to a SFFV promoter.
  • E miR-511 -5p and -3p activity in 293T cells overexpressing miR-511.
  • the cells are transduced with the SFFV.miR-511 (overexpressing) LV and subsequently with the miRT- 511-5p, -3p or no-miRT (GFP-reporter) LVs.
  • Dot plots show GFP and ALNGFR expression from the indicated GFP-reporter LVs.
  • F Stem-loop structures of the mouse pre-miR-511 and pre-miR-511-mut.
  • miR-511 -5p and - 3p sequences are shown together with mutated nucleotides. Note that both pre-miR-511 and pre-miR-511-mut generate a wild-type miR-511 -5p sequence upon processing of the pre- miRNA.
  • ROCK2 is a direct target of both mouse and human miR-511-3p
  • A Firefly luciferase activity in 293T cells untransduced or overexpressing either mouse miR- 511 or -511-mut.
  • the 3'-UTR of mouse Pdpn, Sema3a, Rock2 (miR-511-3p target genes) and CD 163 (a miR-511-3p non-target gene) were tested, together with a UTR-less plasmid (miRGLO).
  • the Rock2 UTR was split into 2 fragments (Rock2(l) and Rock2(2)).
  • E miR-511 -3p and -5p activity in U937 cells either overexpressing human miR-511 or -511 - mut.
  • Statistical analysis of the data was performed on fold- repression values by Two-Way ANOVA with Bonferroni post-test. ***: p ⁇ 0.001.
  • F Western blot analysis of ROCK2 in U937 cells either overexpressing human miR-511 or - 511-mut. One representative blot is shown on the left. The scatter plot shows intensity of ROCK2 signal (arbitrary units [a.u.] vs. GAPDH; 9 independent experiments). Statistical analysis of the data by paired Student's t-test. *: p ⁇ 0.05.
  • A: LLC growth in mice either overexpressing miR-51 lor -511-mut in hematopoietic cells. Data show tumor volumes (mean values ⁇ SEM; n 11 mice/group). Statistical analysis of the data by unpaired Student's t-test. **: p ⁇ 0.01; ***: p ⁇ 0.001. One representative experiment of two performed is shown.
  • G-I Cumulative distribution of fold-changes in the whole transcriptome (13,747 genes; transcripts with less than 10 reads and miR-51 l-3p predicted targets were excluded) of TAMs overexpressing miR-511 (vs. -511-mut). Also shown are the cumulative distribution of fold- changes in transcripts that contain M8-A1 8mer target sites for miR-511-3p, -5p or -3p-mut. Also shown are the cumulative distribution of fold-changes in transcripts that contain M8 7mer target sites for miR-511-3p, -5p or -3p-mut. Note the global repression of miR-511-3p target genes.
  • J Cumulative distribution of fold-changes in the whole transcriptome (16,355 genes) of TAMs overexpressing miR-511 (vs. -51 1 -mut). Also shown are the cumulative distribution of fold-changes in the transcripts that are upregulated in MRC1 + TAMs (vs. CDl lc + TAMs; 1,365 genes); also shown are the cumulative distribution of fold-changes in the transcripts that are upregulated in CDl lc + TAMs (vs. MRC1 + TAMs; 1,596 genes).
  • FIG. 5 (related to Figure 1). Immunophenotyping of P388D1 and RAW monocytic cells and gene expression in MRC1 + and CDllc + TAMs.
  • P388D1 cells were stained with the indicated antibodies to measure the expression of myeloid (CDl lb, CDl lc), monocyte-macrophage (F4/80), B-cell (CD19) and T-cell (CD3) markers (top row). Unstained cells (fluorescence-minus one, FMO) are shown in the bottom row. RAW cells were stained with the indicated antibodies to measure the expression of myeloid (CDl lb, CDl lc), monocyte-macrophage (F4/80) and T-cell (CD3) markers (top row). Unstained cells (FMO) are shown in the bottom row. Note that both P388D1 and RAW cells express the monocyte-macrophage-specific marker, F4/80.
  • FIG. 6 (Related to Figure 2). Identification of tumor-infiltrating hematopoietic cells in LLCs.
  • CDl lb + MRC CDl lc ⁇ GR ⁇ TAMs CDl lb + CDl lc + MRCrGR ⁇ TAMs
  • Figure 7 (Related to Figure 3). Stem-loop structures of the human pre-miR-511 and pre- miR-51 l-mut.
  • niiR-511-5p and -3p The sequence of niiR-511-5p and -3p are shown. Mutated nucleotides are shown. Note that both pre-miR-511 and pre-miR-51 l-mut generate a wild-type miR-511-5p sequence upon processing of the miRNA.
  • FIG 8 (Related to Figure 4). Hematopoietic chimerism in the blood and identification of tumor-infiltrating hematopoietic cells in LLCs of miR-511-overexpressing mice.
  • Predicted mmu-miR-511-3p target genes Predicted mouse miR-511-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 .
  • Predicted miR-511-3p target genes human
  • Predicted human miR-5 l l-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 .
  • Table 4 Clusterization of predicted miR-511-3p target genes by DAVID Bioinformatic Resources 6.7 (human). Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO). Table 5. Genes differentially expressed in the TAMs of SFFV.miR-511 and SFFV.miR- 511-mut mice.
  • C57BL/6 and CD45.1/C57BL/6 mice were purchased by Charles River Laboratory (Calco, Milan, Italy).
  • FVB/MMTV-PyMT mice were obtained from the NCI-Frederick Mouse Repository (MD) and established as a colony at the San Raffaele animal facility. All procedures were performed according to protocols approved by the Animal Care and Use Committee of the Fondazione San Raffaele del Monte Tabor (IACUC 324, 335 and 447) and communicated to the Ministry of Health and local authorities according to the Italian Law.
  • miR-511 target (miRT) sequences were designed based on miRNA sequences obtained from the miRNA Registry (http ://microrna. Sanger, ac.uk/) . Oligonucleotides used to generate miRT sequences are shown in the Supplemental experimental procedures.
  • miR-511 we designed (GenArt Invitrogen) DNA fragments encompassing mmu-miR-511, hsa-miR-51 1, or their mutated forms.
  • MFI is the mean fluorescence activity of either GFP or ALNGFR measured by flow cytometry.
  • Human 293T, mouse RAW264.7, mouse P388D1 and mouse LLC cells were maintained in Iscove's modified Dulbecco's medium (MDM; Sigma) supplemented with 10% fetal bovine serum (FBS; Gibco) and a combination of penicillin-streptomycin and glutamine.
  • Human U937 cells were maintained in RPMI supplemented as above.
  • RAW cells were polarized by culturing them in the presence of IL4 (20 ng/ml, Peprotech) for hrs before analysis.
  • P388D1 cells were polarized by LPS (100 ng/ml, Sigma) + EFN- ⁇ (200 U/ml, Peprotech) for 7 hrs before analysis.
  • miRNA sequences Human and mouse miR-511 target (miRT) sequences were designed based on miRNA sequences obtained from the miRNA Registry (http://microrna.sanger.ac.uk/). Oligonucleotides used for generating miRT sequences are shown below.
  • the Sense 1 (S I), Sense 2 (S2), Antisense 1 (AS1), and Antisense 2 (AS2) oligonucleotides were annealed and ligated into the 3'-UTR of the GFP gene contained in a LV co-expressing ALNGFR and GFP from a bidirectional PGK promoter 23 .
  • S I Sense 1
  • S2 Sense 2
  • AS1 Antisense 1
  • AS2 Antisense 2
  • the light grey box identifies the miR-511-5p sequence;
  • the darker grey box identifies the miR-511-3p sequence;
  • the mutated nucleotides are highlighted in dark grey.
  • Vescicular stomatitis virus (VSV)-pseudotyped, third-generation LVs were produced by transient four-plasmid cotransfection into 293T cells and concentrated by ultracentrifugation, as described 24 .
  • Expression titers of OFP- or ALNGFR-expressing LVs were determined on HeLa cells by limiting dilution.
  • Vector particle content was measured by HTV-1 Gag p24 antigen immunocapture (NEN Life Science Products; Waltham, MA).
  • Vector infectivity was calculated as the ratio between titer and particle content.
  • Titer of 293T conditioned medium ranged from 10 6 to 10 7 transducing units/ml and infectivity from 10 4 to 10 5 transducing units/ng of p24.
  • 293T, RAW264.7, P388D1, and U937 cells were transduced with LV doses ranging from 10 4 to 10 5 transducing units/ml.
  • the fraction of ALNGFR + or OFP + cells was always greater than 80% (miRT reporter LVs) or 90% (overexpressing LVs) in each experiment.
  • Sequential transduction was performed by (i) transducing the cells with the first LV for 12 hrs; (ii) washing and replating the cells; (iii) transducing the cells with the second LV (superinfection) on day 5-7 after the first transduction, for 12 hrs in standard conditions.
  • HS PC Hematopoietic stem/progenitor cell
  • BM-lin " cells) enriched in HS/PCs were isolated from BM using a cell purification kit (StemCell Technologies) and transduced by concentrated LVs, as described 25 .
  • 10 6 cells/ml were pre-stimulated for 6 hours in serum-free StemSpan medium (StemCell Technologies) containing a cocktail of cytokines (IL-3 (20 ng/ml), SCF (100 ng/ml), TPO (100 ng/ml) and FLT-3L (100 ng/ml), all from Peprotech) and then transduced with miRT-reporter or miR- 511-overexpressing LVs with a dose equivalent to 10 s LV Transducing Units/ml, for 12 hours in medium containing cytokines, as described 2S . After transduction, 10 6 cells were infused into the tail vein of lethally irradiated, 5.5-week-old, female C57BL/6 mice (radiation dose: 1150 cGy split in 2 doses).
  • IL-3 20 ng/ml
  • SCF 100 ng/ml
  • TPO 100 ng/ml
  • FLT-3L 100 ng/ml
  • Targetscan 20 We used two distinct bioinformatics tools, Targetscan 20 and Diana microT 21 to search for miR-511-3p target genes.
  • the analysis retrieved a list of putative target genes that we analyzed by using David Bioinformatic resources 6.7 .
  • Sema3A Fw primer: TGCGCCACCTCCCAAAACCTC; Rv primer:
  • Pdpn Fw primer: ACAGGTTGTTCTCCCAACACATCTG; Rv primer:
  • CD 163 Fw primer: GCCTTGACAGGACAGCCAGCT; Rv primer:
  • Untransduced 293T cells or cells expressing exogenous miR-511 sequences were transfected using Lipofectamine 2000 (Invitrogen) with 50 ng of the pmir-GLO-bsLsed plasmids. Cells were lysed after 24 hours using the Dual-Luciferase Reporter Assay protocol (Promega). Renilla luciferase was used to normalize firefly luciferase activity.
  • Mouse (P388D1, RAW) and human (U937) monocytic cell lines were transduced with the SFFV-miR-511 and -511-mut LVs, expanded in culture for at least 2 weeks, collected and directly stored at -80°C.
  • Each cell line was homogenized in lOx volume of RTF A lysis buffer (lOmM Tris-Cl, pH 7.2, 150mM NaCl, lmM EDTA pH 8) with 1% Triton X-100, 1% deoxycholate, 0,1% SDS, protease and phosphatase inhibitor mixture (Roche). Samples were then diluted in Laemmli's SDS-sample buffer.
  • Proteins (-60 ⁇ g) were separated by electrophoresis on 8% polyacrilamide (Sigma) gels and transferred onto trans-blot nitrocellulose membranes (Amersham). Ponceau staining (Sigma) was performed to confirm that the samples were loaded equally. The membranes were blocked in 5% nonfat dry milk in TBS-T (pH 7.4, with 0.1% Tween 20) for lh at room temperature. Primary antibodies were diluted in 3% bovine serum albumine (BSA, Sigma) in TBS-T, and the membranes were incubated overnight at 4°C.
  • BSA bovine serum albumine
  • the primary antibody was removed, and the blots washed in TBS- T and then incubated for 1 hr at room temperature in horseradish peroxidase-conjugated secondary antibodies (Amersham).
  • the primary antibodies used were: mouse anti-ROCK2 (BD, Transduction Laboratories); mouse anti-GAPDH (Sigma). Reactive proteins were visualized using LiteBlot (Euroclone, Celbio) or SuperSignal West Femto chemiluminescence reagent (Pierce Biotechnology, Rockford, EL) and exposure to x-ray film (BioMax MR; Kodak, Rochester, NY). Each experiment was performed with samples from at least 3 independent experiments and 7 independent loadings. Results for ROCK2 were quantitated by scanning densitometry and analyzed by ImageJ software using GAPDH as an internal loading control. The intensity levels were expressed in arbitrary units (a.u.).
  • LLC/3LL cells (5 x 10 6 ) were injected s.c. in syngenic C57BL76 mice, and tumors grown for 3-4 weeks. Tumor size was determined by caliper measurements, and tumor volume calculated by a rational ellipse formula (mi x mi ⁇ m 2 x 0.5236, where mi is the shorter axis and m 2 is the longer axis), as described 27 .
  • tumors were taken by careful dissection, and placed in a 50% mixture of water and glycerin. At successive 24-hour intervals, the glycerin concentration was raised to 75%, then 85%, and finally pure glycerin.
  • the analysis of the tumor-associated vasculature was performed on 200 ⁇ -thick slices obtained from the tumor periphery (4 slices) and inner tumor mass (4 slices) of each tumor. The whole tumor slice was photographed at low magnification (4x). Pictures for morphometric analysis were taken using a Zeiss Axio Imager connected to an Axiocam MRc5 camera (Zeiss) and analysis was performed using Neuron J application of Image J software.
  • Flow cytometry used a BD FACSCanto (BD Bioscience) apparatus. All cell suspensions were incubated with rat anti-mouse FcyUm receptor (CD16/CD32) blocking antibodies (4 ⁇ ; BD Inc.) together with the antibodies listed above. After antibody staining, the cells were washed, stained with fluorochrome-labeled streptavidin (if required) and re-suspended in 7- ammo-actinomycin D (7-AAD)-containing buffer, to exclude nonviable cells from further analyses. OFP was acquired as direct fluorescence in the FL2 channel.
  • Peripheral blood cells Peripheral blood cells. Peripheral blood was collected from the tail vein. After red blood cell lysis and 7-AAD vital staining, cells were immunostained with the appropriate antibodies.
  • Inflammatory monocytes 7-AADXD1 lb + CDl 15 + GR1 + cells ( Figures 2 and 6);
  • Granulocytes 7-AAD " CDl lb + CDl 15 ⁇ GR1 + cells ( Figures 2 and 6).
  • Donor-derived hematopoietic cells 7-AAD ⁇ CD45.1 + or 7-AADXD45.1 + OFP + cells ( Figure 8).
  • Tumors. LLCs were excised and made into single cell suspensions by collagenase IV (0.2 mg/ml, Worthington), dispase (2 mg/inl, Gibco) and DNasel (0.1 mg/ml, Roche) treatment in IMDM medium.
  • collagenase IV 0.2 mg/ml, Worthington
  • dispase 2 mg/inl, Gibco
  • DNasel 0.1 mg/ml, Roche
  • MRCl + TAMs 7AAD7CD45 + / GR17F4/80 " 7MRCl7CD 11C " cells ( Figures 2, 6 and 8);
  • CDl lc + TAMs 7AAD7CD45 + / GR17F4/80 + /MRC17CDl lc + cells ( Figures 2, 6 and 8); Granulocytes/iMCs: 7AAD7 CD45 + / GR17F4/807MRC17CD1 lc " cells ( Figures 2, 6 and 8); Total TAMs: 7AAD7CD45 + /F4/807Grr cells ( Figure 8);
  • B-cells 7AAD7CD457CD19 + ( Figure 8);
  • T-cells 7AAD7CD457CD3 + ( Figure 8);
  • NK-cells 7AAD7CD45 + NKl.r ( Figure 8);
  • Tumors were excised, made into single-cell suspensions and stained with the antibodies listed above.
  • To sort cells we used a MoFlo apparatus (Dako). After sorting, purity of the cells was always > 90%. Five-50 x 10 4 cells were obtained from each sorting session.
  • Sorted TAMs were washed and lysed in QiaZol or RLT buffer (Qiagen) for total RNA extraction.
  • qPCR For qPCR of mRNAs, we retrotranscribed RNA with Superscript ⁇ (Vilo kit, Invitrogen). All qPCR analyses used TaqMan probes from Applied Biosystems. qPCR (miRNA and mRNA) was run for 40 cycles in standard mode using an ABI7900HT apparatus (Applied Biosystems). The SDS 2.2.1 software was used to extract raw data (C T ) and to perform gene expression analysis. To determine gene expression, the difference (AC T ) between the threshold cycle (C T ) of each mRNA/miRNA and that of the reference gene was calculated by applying an equal threshold (0.02).
  • Sequencing was performed on a HiSeq 2000 (Illumina) using paired- end cBot v2 and TraSeq SBS reagents. Libraries were sequenced using 2 x 50 bp paired-end reads, with two indexed samples run per lane, yielding 89-115 million reads (4.4-5.8 Gb) per sample. The sequencing was setup and monitored by HiSeq Control Software (HCS) version 1.1.37.19. Image analysis and base calling was performed using Illumina's real time analysis (RTA) software version 1.7.48. Reads were filtered to remove those with low base call quality using Illumina's default chastity criteria. The results were then demultiplexed and converted to fastq format files by CASAVA version 1.7.
  • HCS HiSeq Control Software
  • RTA real time analysis
  • RNA isolated from MRC1 + and CDl lc + TAMs of LLC tumors did not undergo rRNA depletion, but was processed using the poly-T oligonucleotide coated magnetic beads provided with the Illumina TruSeq RNA Sample Preparation kit as directed by the manufacturer. RNA fragmentation with "Elute, Prime, Fragment Mix” was again performed for 4 minutes at 94°C. Sequencing was performed as above, except that 100 bp paired-end reads were generated, yielding 69-84 million reads (6.9- 8.4 Gb) per sample.
  • TAMs Tumor-associated macrophages support tumor progression in mouse models of cancer 7 ' 8 .
  • the protumoral functions of TAMs are thought to depend, at least in part, on their production of growth, proangiogenic and ECM-remodeling factors, which enhance tumor cell motility, activate fibroblasts, facilitate angiogenesis, and suppress antitumor activity 7 ' 8 ' 29 .
  • TAMs comprise distinct subsets, which appear to contribute differentially to tumor progression.
  • MRC1 + TAMs express a gene signature that is consistent with proangiogenic, tissue-remodelling and protumoral functions.
  • CDl lc + TAMs express a proinflammatory and angiostatic phenotype, and perhaps exert antitumoral functions 9 ' 10 ' 12 - 13 .
  • TAM phenotypes 7 ' 8,29 the intrinsic signals that modulate pro- vs. antitumoral functions of the distinct TAM subsets are poorly defined.
  • the mouse Mrcl gene which is highly expressed by protumoral TAMs 7 , contains a precursor miRNA sequence, pre-miR-511, located within the fifth intron of the gene ( Figure 1A).
  • the pre-miR-511 is processed by Dicer into both miR-51 1-5p (located at the 5 '-end of the pre- miRNA) and miR-51 l-3p (located at the 3 '-end of the pre-miRNA) mature miRNAs ( Figure IB).
  • LV lentiviral vector
  • the microRNA machinery will degrade the miRT-containing GFP transcript only in cells that express the cognate miRNA, in a manner that is dependent on miRNA abundance and/or activity.
  • expression of ALNGFR is independent on miRNA activity and is used as an internal normalizer to calculate GFP suppression by the miRNA of interest 30 .
  • HS/PC hematopoietic stem/progenitor cell
  • miR-511 -3p is the active strand of the mouse pre-miR-511, and demonstrate that endogenous miR-511 -3p is preferentially active in MRC1 + TAMs among tumor-infiltrating and circulating myeloid cells.
  • Targetscan 20 and Diana microT 31 to identify miR-511 -3p predicted targets.
  • the analysis retrieved a list of 145 genes (Table 1) that we analyzed by David Bioinformatic resources 6.7 26 . A significant proportion of these genes are involved in biological processes related to "cell morphogenesis" (Table 2).
  • Table 2 We then validated a panel of miR-51 l-3p predicted targets by dual-luciferase assays performed on miR-511-overexpressing RAW cells.
  • ROCK2 is a serine/threonine kinase that regulates actin stress fibers and focal adhesions; it was recently shown to play important mechanoregulatory functions by linking the contractility of the cell cytoskeleton to external forces generated by the ECM, and to regulate collagen biosynthesis 1,s2 .
  • miR-511 -3p downregulated ROCK2 both at the protein ( Figure 3B) and mRNA ( Figure 3C) level. Together, these data strongly suggest that ROCK2 is a direct target of mouse miR-51 l-3p.
  • the human MRC1 gene also contains a miR-511 sequence (hsa-miR-511) located in the fifth intron of the gene.
  • miR-511 sequence hsa-miR-5111 located in the fifth intron of the gene.
  • the mature miR-511 -3p but not -5p sequence is conserved in M. musculus and H. sapiens ( Figure 3D).
  • Figure 3D We then asked whether miR-511 -3p activity is conserved in the two species.
  • miR-511- 3p is the active strand of the human pre-miR-511 (Figure 7).
  • predicted targets of the human miR-511 -3p (Table 3) comprise genes involved in biological processes related to "cell morphogenesis” (Table 4).
  • human miR-511 -3p downregulated ROCK2 in U937 cells ( Figure 3F).
  • miR-51 1-3p overexpression neither affected the recruitment of F4/80 + TAMs (which represent up to 60% of all tumor-infiltrating hematopoietic cells in this tumor model), GR1 + neutrophils, NEC, T and B-cells to the tumors (Figure 8B), nor the relative frequency of MRC1 + and CD1 lc + TAM subsets (Figure 8C).
  • miRNA seed/3'-UTR interactions comprise M8-A1 8mers (the mRNA sequence binds to the miRNA from position 2 to 8 and contains an Adenosine in position 1) and M8 7mers (the mRNA sequence matches the miRNA from position 2 to 8) I4 .
  • Serpinhl a chaperon protein for collagen export, and caveolin-1 ⁇ Cavl
  • a component of the endocytic caveolae and important regulator of ECM remodeling 33 were also downregulated.
  • Downregulated genes further included genes that regulate the synthesis and remodeling of the ECM, such as TGFb-family proteins ⁇ gfbrS, Bmpl, Bmprla, Ltbpl) and macrophage scavenger receptors ⁇ Sparc, Mrc2 and ScaraS).
  • MRC1 + TAMs are protumoral and express a distinguishing gene signature in mouse models of cancer 7,9 ''°.
  • miR- 51 l-3p overexpression in TAMs inhibited tumor growth by decreasing their protumoral activity.
  • CDl lc + TAMs Figure 4J; Table 9.
  • genes globally upregulated in MRC1 + vs. CDl lc + TAMs identify the protumoral gene signature of TAMs 7 ' 29 , these findings may imply that miR-51 l-3p negatively regulates the protumoral genetic programs of MRC1 + TAMs - at least in part - by decreasing their production of ECM/ECM-remodeling proteins.
  • ECM fibrous proteins are mainly produced by epithelial cells and fibroblasts in tumors 2 ' 4 , there is also evidence that several ECM genes, such as collagens, are robustly expressed by in vitro cultured macrophages 5 . However, the significance of TAM-produced ECM fibrous proteins for tumor progression and vascularization has been largely ignored.
  • miR-51 1 -3p upregulation in TAMs (i) downregulates Rock2; (ii) reduces the expression of several genes involved in ECM synthesis and remodelling, including collagens, other fibrous proteins, proteases and scavenger receptors; (iii) broadly and specifically attenuates the expression of genes that define the protumoral gene signature of MRC1 + TAMs; (iv) dysregulates tumor blood vessel morphogenesis; and (v) reduces tumor growth.
  • ROCK2 has been identified recently as a key mechanoregulatory element that integrates physical cues from the ECM (e.g., extra-cellular tension) with cell's cytoskeletal contractility to regulate cell behaviour 1 ' 32 .
  • constitutive ROCK activation in epithelial cells induces ⁇ -catenin stabilization, cell hyperproliferation, enhanced collagen synthesis and ECM stiffening, leading to increased tumor incidence and progression 2 ' 3 .
  • the composition and biophysical properties of the ECM also influence vascular morphogenesis in tumors 34 . Indeed, ECM density regulates the extension speed of vascular sprouts, and a high matrix- fiber anisotropy (i.e., directional tension) provides strong contact guidance cues for endothelial cells and stimulates sprout branching 34 .
  • Certain tumor or T-cell cytokines can upregulate the expression of Mrcl in TAMs 7 ' 29 and induce them to acquire protumoral functions 35 .
  • the contextual upregulation of miR-51 l-3p in MRC1 + TAMs may thus function as a cell-autonomous, negative feed-back mechanism that limits their protumoral functions.
  • MRC1 + TAMs mostly reside around angiogenic blood vessels and regulate vascular growth by yet poorly defined paracrine signals likely involving cell-to-cell contacts with endothelial cells and their "guidance" to form complex vascular networks 36 ' 37 .
  • MRC1 + TAMs represent a major component of the perivascular tumor stroma and support vascular morphogenesis in tumors 7 ' 36 , intrinsic modulation of ROCK2 and ECM-protein synthesis/remodeling by miR-511 -3p in MRC1 + TAMs may have the potential to influence loco-regional ECM dynamics and blood vessel morphogenesis in the tumor microenvironment.
  • Table 1
  • Dcun1d3 DCN1 defective in cullin neddylation 1 , domain containing 3 (S. cerevisiae)
  • GABA Gabrb3 gamma-aminobutyric acid
  • Galnt7 UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 7 (GalNAc-T7)
  • Gjb1 gap junction protein beta 1 , 32kDa
  • Grm1 glutamate receptor metabotropic 1 Gtdd glycosyltransferase-like domain containing 1
  • H22ra2 interleukin 22 receptor, alpha 2
  • Map3k12 mitogen-activated protein kinase kinase kinase 12
  • Met met proto-oncogene hepatocyte growth factor receptor
  • Mfap3 microfibrillar-associated protein 3 [Source:MGI Acc:MGI:1924068]
  • Necabl EF hand calcium binding protein 1 [Source:MGI Acc:MGI:1916602]
  • Nrf1 nuclear respiratory factor 1 Nrf1 nuclear respiratory factor 1
  • Pcsk2 proprotein convertase subtilisin/kexin type 2
  • RNA III DNA directed polypeptide K [Source:MGI Acc:MGI:1914255]
  • Prpf40a PRP40 pre-mRNA processing factor 40 homolog A S. cerevisiae
  • Rabgapll RAB GTPase activating protein 1 -like [Source: GI Acc: GI:1352507]
  • Sema3a sema domain immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A
  • Slc29a3 solute carrier family 29 (nucleoside transporters)
  • Slc4a4 solute carrier family 4 sodium bicarbonate cotransporter, member 4
  • Slc7a2 solute carrier family 7 (cationic amino acid transporter
  • Slc8a1 solute carrier family 8 sodium/calcium exchanger
  • Spry2 sprouty homolog 2 (Drosophila)
  • Tfap2b transcription factor AP-2 beta activating enhancer binding protein 2 beta
  • Tjp1 tight junction protein 1 [Source:MGI Acc:MGI:98759]
  • Tnfrsf21 tumor necrosis factor receptor superfamily member 21
  • Treml2 triggering receptor expressed on myeloid cells-like 2 [Source:MGI Acc: GI:2147038]
  • Tsc22d3 TSC22 domain family member 3
  • Predicted mmu-miR-511-3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan (Lewis et al., 2005) and Diana microT (Maragkakis et al., 2009).
  • cell projection organization 12 9,1 2.70E-05 5 neuron projection development 10 7,6 3.80E-05 6,1 cell projection morphogenesis 9 6,8 1 ,40E-04 5,9 cell part morphogenesis 9 6,8 1 ,90E-04 5,6 axonogenesis 8 6,1 2.20E-04 6,5 cellular component morphogenesis 1 1 8,3 3.00E-04 4,1 neuron projection morphogenesis 8 6,1 3,60E-04 6 cell morphogenesis involved in neuron differentiation 8 6,1 4,40E-04 5,8 cell morphogenesis 10 7,6 5.20E-04 4,3 regulation of cell migration 6 4,5 6.30E-04 8,6
  • Alcohol dehydrogenase 1 B (EC 1.1.1.1) (Alcohol dehydrogenase beta subunit).
  • ADH1B,ADH1C [Source:Uniprot/SWISSPROT Acc:P00325]
  • Annexin A11 (Annexin-11 ) (Annexin XI) (Calcyclin-associated annexin 50) (CAP-50) (56
  • ARPP-21 cyclic A P-regulated phosphoprotein, 21 kD
  • CALM1 calmodulin 1 (phosphorylase kinase, delta)
  • Catenin delta-2 (Delta-catenin) (Neural plakophilin-related ARM-repeat protein) (NPRAP)
  • DCUN1D3 DCN1 defective in cullin neddylation 1 , domain containing 3 (S. cerevisiae)
  • DRP Density-regulated protein
  • DIP2B DIP2 disco-interacting protein 2 homolog B Disks large-associated protein 2 (DAP-2) (SAP90/PSD-95-associated protein 2) (SAPAP2) (PSD-95/SAP90-binding protein 2) (Fragment).
  • EGR-3 Early growth response protein 3 (EGR-3) (Zinc finger protein pilot).
  • EIF1B eukaryotic translation initiation factor 1 B
  • ETF1 eukaryotic translation termination factor 1
  • Heparin-binding growth factor 2 precursor (HBGF-2) (Basic fibroblast growth factor)
  • FGF2 FGF2 (BFGF) (Prostatropin). [Source:Uniprot/SWISSPROT Acc:P09038]
  • GABA gamma-aminobutyric acid
  • GALNT7 (GalNAc-T7)
  • GJB1 gap junction protein beta 1 , 32kDa
  • GLI3 GLI-Kruppel family member GLI3 (Greig cephalopolysyndactyly syndrome)
  • Glutamate [NMDA] receptor subunit epsilon-1 precursor N-methyl D- aspartate receptor
  • GRIN2A subtype 2A (NR2A) (NMDAR2A) (hNR2A).
  • GRM1 glutamate receptor, metabotropic 1
  • GTDC1 glycosyltransferase-like domain containing 1
  • HMG2L1 high-mobility group protein 2-like 1
  • Heterogeneous nuclear ribonucleoprotein AO (hnRNP AO).
  • MAML1 mastermind-like 1 (Drosophila)
  • MAP3K12 mitogen-activated protein kinase kinase kinase 12
  • MAP4K3 mitogen-activated protein kinase kinase kinase kinase kinase 3
  • NEGRI neuronal growth regulator 1 NEGRI neuronal growth regulator 1
  • NUAK1 NUA family SNF1-like kinase
  • PAPOLB poly(A) polymerase beta (testis specific)
  • Protocadherin-11 X-linked precursor Protocadherin-11 ) (Protocadherin on the X
  • PCDH11X chromosome PCDH-X
  • PCDH-S Protocadherin-S
  • PCGF5 [Source:Uniprot/SWISSPROT Acc:Q86SE9]
  • PCSK2 proprotein convertase subtilisin/kexin type 2
  • PIK3CD phosphoinositide-3-kinase catalytic, delta polypeptide
  • PPARGC1A peroxisome proliferator-activated receptor gamma coactivator 1 alpha PPP1R2 protein phosphatase 1 , regulatory (inhibitor) subunit 2
  • PRKAG2 protein kinase AMP-activated, gamma 2 non-catalytic subunit
  • PRPF40A PRP40 pre-mRNA processing factor 40 homolog A S. cerevisiae
  • Receptor-type tyrosine-protein phosphatase T precursor (EC 3.1.3.48) (R-PTP-T) (RPTP-
  • RAB3A-interacting protein (Rabin-3) (SSX2-interacting protein).
  • Rho-related GTP-binding protein RhoQ precursor (Ras-related GTP-binding protein
  • ROB02 roundabout axon guidance receptor
  • homolog 2 homolog 2 (Drosophila)
  • SLC12A6 solute carrier family 12 (potassium/chloride transporters), member 6
  • SLC2A12 solute carrier family 2 (facilitated glucose transporter), member 12
  • ADIP alpha-actinin-binding protein
  • SV2B Synaptic vesicle glycoprotein 2B. [SourceiUniprot/SWISSPROT Acc:Q7L112]
  • TBC1 domain family member 23 HCV non-structural protein 4A- transactivated protein 1 .
  • TFAP2B transcription factor AP-2 beta activating enhancer binding protein 2 beta
  • TNFRSF21 tumor necrosis factor receptor superfamily member 21
  • TSC22D3 TSC22 domain family member 3
  • TSHZ1 teashirt zinc finger homeobox 1
  • TTC39A tetratricopeptide repeat domain 39A
  • UBP1 upstream binding protein 1 (LBP-1 a)
  • ZNF248 zinc finger protein 248
  • ZNF518B zinc finger protein 518B
  • ZNF536 zinc finger protein 536
  • Predicted miR-511-3p target genes (human).
  • Predicted human miR-511- 3p target genes were retrieved by using two distinct bioinformatics tools, Targetscan (Lewis et al., 2005) and Diana microT (Maragkakis et al., 2009).
  • transcription 40 23,4 4J0E-05 1 ,9 regulation of transcription 44 25,7 2,60E-04 1 ,7
  • Bioinformatic Resources 6.7 human. Terms correspond to biological processes annotated in the UniProtKB-GoA group (EMBL) gene ontology database (QuickGO).
  • Rhobtb3 0.5 3.1E-04 3.0E-02
  • Nrxnl Acot3 Mtap2 Cstf2 Heatr5a Mstn

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Molecular Biology (AREA)
  • Organic Chemistry (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • Microbiology (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)

Abstract

L'invention concerne un procédé de réduction de l'angiogenèse ou de la croissance tumorale chez un sujet ou un tissu, comprenant l'administration au sujet ou au tissu d'une quantité efficace de miR-511-3-p.
PCT/IB2011/054686 2010-10-20 2011-10-20 Miarn WO2012052953A1 (fr)

Applications Claiming Priority (6)

Application Number Priority Date Filing Date Title
US39499510P 2010-10-20 2010-10-20
US61/394,995 2010-10-20
US201161525476P 2011-08-19 2011-08-19
US61/525,476 2011-08-19
US201161527897P 2011-08-26 2011-08-26
US61/527,897 2011-08-26

Publications (1)

Publication Number Publication Date
WO2012052953A1 true WO2012052953A1 (fr) 2012-04-26

Family

ID=45002078

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/IB2011/054686 WO2012052953A1 (fr) 2010-10-20 2011-10-20 Miarn

Country Status (1)

Country Link
WO (1) WO2012052953A1 (fr)

Cited By (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (fr) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb Microarn pour la régénération cardiaque par l'intermédiaire d'induction de la prolifération de cardiomyocytes
WO2018156945A1 (fr) * 2017-02-24 2018-08-30 University Of South Florida Prévention de la naissance prématurée (ptb) par inhibition de fkbp51
US10435757B1 (en) 2016-06-15 2019-10-08 University Of South Florida Methods of measuring C19MC miRNA in a post-natal tissue and uses thereof
US11479802B2 (en) 2017-04-11 2022-10-25 Regeneron Pharmaceuticals, Inc. Assays for screening activity of modulators of members of the hydroxy steroid (17-beta) dehydrogenase (HSD17B) family
US11485958B2 (en) 2017-01-23 2022-11-01 Regeneron Pharmaceuticals, Inc. HSD17B13 variants and uses thereof
US11702700B2 (en) 2017-10-11 2023-07-18 Regeneron Pharmaceuticals, Inc. Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999006073A1 (fr) 1997-07-31 1999-02-11 St. Elizabeth's Medical Center Of Boston, Inc. Procede de traitement des greffons
WO2008103135A2 (fr) * 2007-02-16 2008-08-28 The Johns Hopkins University Micro rnaome
WO2009062515A1 (fr) * 2007-11-14 2009-05-22 Dandrit Biotech A/S Micro-arn utilisés en tant que marqueurs de l'état fonctionnel d'une cellule dendritique
WO2009080437A1 (fr) * 2007-12-21 2009-07-02 Exiqon A/S Procédé d'analyse de la résistance aux médicaments par les micro-arn
WO2009137807A2 (fr) * 2008-05-08 2009-11-12 Asuragen, Inc. Compositions et procédés liés à la modulation de miarn de néovascularisation ou d’angiogenèse
WO2010129919A1 (fr) * 2009-05-08 2010-11-11 Research Development Foundation Expression d'arnmi dans une maladie allergique

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1999006073A1 (fr) 1997-07-31 1999-02-11 St. Elizabeth's Medical Center Of Boston, Inc. Procede de traitement des greffons
WO2008103135A2 (fr) * 2007-02-16 2008-08-28 The Johns Hopkins University Micro rnaome
WO2009062515A1 (fr) * 2007-11-14 2009-05-22 Dandrit Biotech A/S Micro-arn utilisés en tant que marqueurs de l'état fonctionnel d'une cellule dendritique
WO2009080437A1 (fr) * 2007-12-21 2009-07-02 Exiqon A/S Procédé d'analyse de la résistance aux médicaments par les micro-arn
WO2009137807A2 (fr) * 2008-05-08 2009-11-12 Asuragen, Inc. Compositions et procédés liés à la modulation de miarn de néovascularisation ou d’angiogenèse
WO2010129919A1 (fr) * 2009-05-08 2010-11-11 Research Development Foundation Expression d'arnmi dans une maladie allergique

Non-Patent Citations (59)

* Cited by examiner, † Cited by third party
Title
"Oligonucleotide Synthesis: A Practical Approach", IRL PRESS
AAGAARD, L., ROSSI, J. J., ADV DRUG DELIV REV, vol. 59, 2007, pages 75 - 86
AMENDOLA M, VENNERI MA, BIFFI A, VIGNA E, NALDINI L: "Coordinate dual-gene transgenesis by lentiviral vectors carrying synthetic bidirectional promoters", NAT BIOTECHNOL., vol. 23, 2005, pages 108 - 116, XP002389318, DOI: doi:10.1038/nbt1049
ANDREU P, JOHANSSON M, AFFARA NI ET AL.: "FcRgamma activation regulates inflammation- associated squamous carcinogenesis", CANCER CELL, vol. 17, pages 121 - 134
AUSUBEL, F. M. ET AL.: "Current Protocols in Molecular Biology", 1995, JOHN WILEY & SONS
B. ROE, J. CRABTREE, A. KAHN: "DNA Isolation and Sequencing: Essential Techniques", 1996, JOHN WILEY & SONS
BARTEL DP: "MicroRNAs: target recognition and regulatory functions", CELL, vol. 136, 2009, pages 215 - 233, XP055011377, DOI: doi:10.1016/j.cell.2009.01.002
BASKERVILLE S, BARTEL DP: "Microarray profiling of microRNAs reveals frequent coexpression with neighboring miRNAs and host genes", RNA, vol. 11, 2005, pages 241 - 247, XP002421559, DOI: doi:10.1261/rna.7240905
BAUER AL, JACKSON TL, JIANG Y: "Topography of extracellular matrix mediates vascular morphogenesis and migration speeds in angiogenesis", PLOS COMPUT BIOL., vol. 5, 2009, pages E1000445
BISWAS SK, MANTOVANI A: "Macrophage plasticity and interaction with lymphocyte subsets: cancer as a paradigm", NAT IMMUNOL, vol. 11, pages 889 - 896
BROWN BD, GENTNER B, CANTORE A ET AL.: "Endogenous microRNA can be broadly exploited to regulate transgene expression according to tissue, lineage and differentiation state", NAT BIOTECHNOL., vol. 25, 2007, pages 1457 - 1467, XP002471752, DOI: doi:10.1038/nbt1372
CHEN X ET AL., CELL RES, vol. 7, 2008, pages 2643 - 2646
CHO ET AL: "MicroRNAs: Potential biomarkers for cancer diagnosis, prognosis and targets for therapy", INTERNATIONAL JOURNAL OF BIOCHEMISTRY AND CELL BIOLOGY, EXETER, GB, vol. 42, no. 8, 1 August 2010 (2010-08-01), pages 1273 - 1281, XP027131521, ISSN: 1357-2725, [retrieved on 20100706] *
D. M. J. LILLEY, J. E. DAHLBERG: "Methods of Enzymology: DNA Structure Part A: Synthesis and Physical Analysis of DNA Methods in Enzymology", 1992, ACADEMIC PRESS
DE FOUGEROLLES ET AL., NAT REV DRUG DISCOV, vol. 6, 2007, pages 443 - 53
DE PALMA M, MAZZIERI R, POLITI LS ET AL.: "Tumor-targeted interferon-alpha delivery by Tie2- expressing monocytes inhibits tumor growth and metastasis", CANCER CELL, vol. 14, 2008, pages 299 - 3 11
DE PALMA M, NALDINI L: "Transduction of a gene expression cassette using advanced generation lentiviral vectors", METHODS ENZYMOL., vol. 346, 2002, pages 514 - 529
DE PALMA M, VENNERI MA, GALLI R ET AL.: "Tie2 identifies a hematopoietic lineage of proangiogenic monocytes required for tumor vessel formation and a mesenchymal population of pericyte progenitors", CANCER CELL, vol. 8, 2005, pages 211 - 226, XP055124188, DOI: doi:10.1016/j.ccr.2005.08.002
DENARDO DG, ANDREU P, COUSSENS LM: "Interactions between lymphocytes and myeloid cells regulate pro- versus anti-tumor immunity", CANCER METASTASIS REV, vol. 29, pages 309 - 316
E. M. SHEVACH, W. STROBER: "Current Protocols in Immunology", 1992, JOHN WILEY & SONS
EGEBLAD M, NAKASONE ES: "Werb Z. Tumors as organs: complex tissues that interface with the entire organism", DEV CELL, vol. 18, pages 884 - 901
F. PUCCI ET AL: "A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood "resident" monocytes, and embryonic macrophages suggests common functions and developmental relationships", BLOOD, vol. 114, no. 4, 23 July 2009 (2009-07-23), pages 901 - 914, XP055019330, ISSN: 0006-4971, DOI: 10.1182/blood-2009-01-200931 *
FANTIN A, VIEIRA JM, GESTRI G ET AL.: "Tissue macrophages act as cellular chaperones for vascular anastomosis downstream of VEGF-mediated endothelial tip cell induction", BLOOD, vol. 116, pages 829 - 840
GOETZ JG, MINGUET S, NAVARRO-LERIDA I ET AL.: "Biomechanical remodeling of the microenvironment by stromal caveolin-1 favors tumor invasion and metastasis", CELL, vol. 146, pages 148 - 163, XP028100091, DOI: doi:10.1016/j.cell.2011.05.040
GRIFFITHS-JONES ET AL., NUCLEIC ACIDS RES, vol. 36, 2008, pages D154 - 8
GRIMSON A, FARH KK, JOHNSTON WK, GARRETT-ENGELE P, LIM LP, BARTEL DP: "MicroRNA targeting specificity in mammals: determinants beyond seed pairing", MOL CELL, vol. 27, 2007, pages 91 - 105, XP002624728, DOI: doi:10.1016/j.molcel.2007.06.017
H. R. CHIANG ET AL: "Mammalian microRNAs: experimental evaluation of novel and previously annotated genes", GENES & DEVELOPMENT, vol. 24, no. 10, 15 May 2010 (2010-05-15), pages 992 - 1009, XP055019380, ISSN: 0890-9369, DOI: 10.1101/gad.1884710 *
HUANG DA W, SHERMAN BT, LEMPICKI RA: "Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources", NAT PROTOC., vol. 4, 2009, pages 44 - 57, XP009153774, DOI: doi:10.1038/nprot.2008.211
J. M. POLAK, JAMES O'D. MCGEE: "Situ Hybridization: Principles and Practice", 1984, OXFORD UNIVERSITY PRESS
J. SAMBROOK, E. F. FRITSCH, T. MANIATIS: "Molecular Cloning: A Laboratory Manual", vol. 1-3, 1989, COLD SPRING HARBOR LABORATORY PRESS
KALLURI R, ZEISBERG M: "Fibroblasts in cancer", NAT REV CANCER, vol. 6, 2006, pages 392 - 401, XP002538033, DOI: doi:10.1038/NRC1877
KARANTI SHAILAJA ET AL: "An atlas of the MicroRNA genome in human DLBCL", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 110, no. 11 Part 1, 11 December 2007 (2007-12-11), pages 173A, XP008149099, ISSN: 0006-4971, Retrieved from the Internet <URL:http://www.bloodjournal.org/> *
KIM VN, HAN J, SIOMI MC: "Biogenesis of small RNAs in animals", NAT REV MOL CELL BIOL., vol. 10, 2009, pages 126 - 139
LAGOS-QUINTANA, M. ET AL., CURR BIOL, vol. 12, 2002, pages 735 - 9
LEVENTAL KR, YU H, KASS L ET AL.: "Matrix crosslinking forces tumor progression by enhancing integrin signaling", CELL, vol. 139, 2009, pages 891 - 906, XP029533710, DOI: doi:10.1016/j.cell.2009.10.027
LEWIS BP, BURGE CB, BARTEL DP: "Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets", CELL, vol. 120, 2005, pages 15 - 20, XP055009844, DOI: doi:10.1016/j.cell.2004.12.035
LUERS AJ, LOUDIG OD, BERMAN JW: "MicroRNAs are expressed and processed by human primary macrophages", CELL IRNMUNOL, vol. 263, pages 1 - 8, XP027033656
MARAGKAKIS M, ALEXIOU P, PAPADOPOULOS GL ET AL.: "Accurate microRNA target prediction correlates with protein repression levels", BMC BIOINFORMATICS, vol. 10, 2009, pages 295, XP021055729, DOI: doi:10.1186/1471-2105-10-295
MARAGKAKIS M, RECZKO M, SIMOSSIS VA ET AL.: "DIANA-microT web server: elucidating microRNA functions through target prediction", NUCLEIC ACIDS RES., vol. 37, 2009, pages W273 - 276
MARIO LEONARDO SQUADRITO ET AL: "miR-511-3p Modulates Genetic Programs of Tumor-Associated Macrophages", CELL REPORTS, vol. 1, 1 February 2012 (2012-02-01), pages 1 - 14, XP055019397, ISSN: 2211-1247, DOI: 10.1016/j.celrep.2011.12.005 *
MAZZIERI R, PUCCI F, MOI D ET AL.: "Targeting the ANG2/TIE2 axis inhibits tumor growth and metastasis by impairing angiogenesis and disabling rebounds of proangiogenic myeloid cells", CANCER CELL, vol. 19, pages 512 - 526, XP028202041, DOI: doi:10.1016/j.ccr.2011.02.005
MIN HE ET AL: "MicroRNA-155 Regulates Inflammatory Cytokine Production in Tumor-associated Macrophages via Targeting C/EBPbeta", CELLULAR & MOLECULAR IMMUNOLOGY, vol. 6, no. 5, 1 October 2009 (2009-10-01), pages 343 - 352, XP055019729 *
MOVAHEDI K, LAOUI D, GYSEMANS C ET AL.: "Different tumor microenvironments contain functionally distinct subsets of macrophages derived from Ly6C(high) monocytes", CANCER RES, vol. 70, pages 5728 - 5739
NIELSEN CB, SHOMRON N, SANDBERG R, HOMSTEIN E, KITZMAN J, BURGE CB: "Determinants of targeting by endogenous and exogenous microRNAs and siRNAs", RNA, vol. 13, 2007, pages 1894 - 1910
NUCERA S, BIZIATO D, DE PALMA M: "The interplay between macrophages and angiogenesis in development, tissue injury and regeneration", INT J DEV BIOL
PASZEK MJ, ZAHIR N, JOHNSON KR ET AL.: "Tensional homeostasis and the malignant phenotype", CANCER CELL, vol. 8, 2005, pages 241 - 254
PUCCI F, VENNERI MA, BIZIATO D ET AL.: "A distinguishing gene signature shared by tumor-infiltrating Tie2-expressing monocytes, blood ''resident'' monocytes, and embryonic macrophages suggests common functions and developmental relationships", BLOOD, vol. 114, 2009, pages 90 - 94
QIAN BZ, POLLARD JW: "Macrophage diversity enhances tumor progression and metastasis", CELL, vol. 141, pages 39 - 51
RANA, T. M., NAT REV MOL CELL BIOL, vol. 8, 2007, pages 23 - 36
ROLNY C, MAZZONE M, TUGUES S ET AL.: "HRG inhibits tumor growth and metastasis by inducing macrophage polarization and vessel normalization through downregulation of PIGF", CANCER CELL, vol. 19, pages 31 - 44
SAMUEL MS, LOPEZ JI, MCGHEE EJ ET AL.: "Actomyosin-Mediated Cellular Tension Drives Increased Tissue Stiffness and beta-Catenin Activation to Induce Epidermal Hyperplasia and Tumor Growth", CANCER CELL, vol. 19, pages 776 - 791, XP028232338, DOI: doi:10.1016/j.ccr.2011.05.008
SCHNOOR M, CULLEN P, LORKOWSKI J ET AL.: "Production of type VI collagen by human macrophages: a new dimension in macrophage functional heterogeneity", J IMMUNOL., vol. 180, 2008, pages 5707 - 5719
SICA A, LARGHI P, MANCINO A ET AL.: "Macrophage polarization in tumour progression", SEMIN CANCER BIOL., vol. 18, 2008, pages 349 - 355, XP023519773, DOI: doi:10.1016/j.semcancer.2008.03.004
SKAFTNESMO ET AL., CURR PHARM BIOTECHNOL, vol. 8, 2007, pages 320 - 5
SQUADRITO ML, DE PALMA M: "Macrophage regulation of tumor angiogenesis: implications for cancer therapy", MOL ASPECTS MED, vol. 32, pages 123 - 145, XP028385724, DOI: doi:10.1016/j.mam.2011.04.005
SUNG-CHOU LI ET AL: "Intronic MicroRNA: Discovery and Biological Implications", DNA AND CELL BIOLOGY, MARY ANN LIEBERT, NEW YORK, NY, US, vol. 26, no. 4, 1 April 2007 (2007-04-01), pages 195 - 207, XP008124956, ISSN: 1044-5498 *
TOMBOL ZSOFIA ET AL: "Integrative molecular bioinformatics study of human adrenocortical tumors: microRNA, tissue-specific target prediction, and pathway analysis", ENDOCRINE-RELATED CANCER JOURNAL OF ENDOCRINOLOGY LTD, SOCIETY FOR ENDOCRINOLOGY, GB, vol. 16, no. 3, 1 September 2009 (2009-09-01), pages 895 - 906, XP002656495, ISSN: 1351-0088, DOI: 10.1677/ERC-09-0096 *
TSEREL L, RUNNEL T, KISAND K ET AL.: "microRNA expression profiles of human blood monocyte derived dendritic cells and macrophages reveal miR-511 as putative positive regulator of TLR4", J BIOL CHEM.
XIONG H, QIAN J, HE T, LI F: "Independent transcription of miR-281 in the intron of ODA in Drosophila melanogaster", BIOCHEM BIOPHYS RES COMMUN, vol. 378, 2009, pages 883 - 889, XP025841515, DOI: doi:10.1016/j.bbrc.2008.12.010

Cited By (9)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2013093870A1 (fr) 2011-12-23 2013-06-27 International Centre For Genetic Engineering And Biotechnology - Icgeb Microarn pour la régénération cardiaque par l'intermédiaire d'induction de la prolifération de cardiomyocytes
US10435757B1 (en) 2016-06-15 2019-10-08 University Of South Florida Methods of measuring C19MC miRNA in a post-natal tissue and uses thereof
US11485958B2 (en) 2017-01-23 2022-11-01 Regeneron Pharmaceuticals, Inc. HSD17B13 variants and uses thereof
US11753628B2 (en) 2017-01-23 2023-09-12 Regeneron Pharmaceuticals, Inc. HSD17B13 variants and uses thereof
US11845963B2 (en) 2017-01-23 2023-12-19 Regeneron Pharmaceuticals, Inc. HSD17B13 variants and uses thereof
WO2018156945A1 (fr) * 2017-02-24 2018-08-30 University Of South Florida Prévention de la naissance prématurée (ptb) par inhibition de fkbp51
US11197868B2 (en) 2017-02-24 2021-12-14 University Of South Florida Prevention of preterm birth (PTB) by inhibition of FKBP51
US11479802B2 (en) 2017-04-11 2022-10-25 Regeneron Pharmaceuticals, Inc. Assays for screening activity of modulators of members of the hydroxy steroid (17-beta) dehydrogenase (HSD17B) family
US11702700B2 (en) 2017-10-11 2023-07-18 Regeneron Pharmaceuticals, Inc. Inhibition of HSD17B13 in the treatment of liver disease in patients expressing the PNPLA3 I148M variation

Similar Documents

Publication Publication Date Title
Sheng et al. LSD1 ablation stimulates anti-tumor immunity and enables checkpoint blockade
Chen et al. Circular RNA circRHOBTB3 represses metastasis by regulating the HuR-mediated mRNA stability of PTBP1 in colorectal cancer
Zhang et al. Identification of the tumor‑suppressive function of circular RNA FOXO3 in non‑small cell lung cancer through sponging miR‑155
US20230295631A1 (en) Micrornas and methods of their use
Yungang et al. miR-370 targeted FoxM1 functions as a tumor suppressor in laryngeal squamous cell carcinoma (LSCC)
Yu et al. MicroRNA-378 functions as an onco-miR in nasopharyngeal carcinoma by repressing TOB2 expression
Bian et al. Novel circular RNA, hsa_circ_0025039 promotes cell growth, invasion and glucose metabolism in malignant melanoma via the miR-198/CDK4 axis
Ouimet et al. A childhood acute lymphoblastic leukemia-specific lncRNA implicated in prednisolone resistance, cell proliferation, and migration
Shang et al. LncRNA RNCR3 promotes Chop expression by sponging miR-185-5p during MDSC differentiation
Xu et al. MicroRNA-31 functions as a tumor suppressor and increases sensitivity to mitomycin-C in urothelial bladder cancer by targeting integrin α5
Cai et al. Role of miR-15a in intervertebral disc degeneration through targeting MAP3K9
Yamamoto et al. Uncovering direct targets of MiR-19a involved in lung cancer progression
Zhi et al. Circular RNA profiling identifies circ102049 as a key regulator of colorectal liver metastasis
Tong et al. Retracted: Long noncoding RNA NORAD is upregulated in epithelial ovarian cancer and its downregulation suppressed cancer cell functions by competing with miR‐155‐5p
US20230285439A1 (en) Methods for treating triple-negative breast cancer
Yu et al. Circular RNA CircCCNB1 sponges micro RNA-449a to inhibit cellular senescence by targeting CCNE2
WO2012052953A1 (fr) Miarn
Jiang et al. Quantitatively controlling expression of miR-17∼ 92 determines colon tumor progression in a mouse tumor model
Xu et al. The differential expression of miRNAs and a preliminary study on the mechanism of miR-194-3p in keloids
Jiang et al. MicroRNA-1468-5p inhibits glioma cell proliferation and induces cell cycle arrest by targeting RRM1
Wu et al. XIAP 3′-untranslated region as a ceRNA promotes FSCN1 function in inducing the progression of breast cancer by binding endogenous miR-29a-5p
Sato et al. MicroRNAs as therapeutic targets in lung disease: prospects and challenges
Li et al. Mutant ACTB mRNA 3′-UTR promotes hepatocellular carcinoma development by regulating miR-1 and miR-29a
CN111020032A (zh) miRNA-196b在作为非小细胞肺癌分子标志物和治疗靶点中的应用
Ohno et al. Nuclear microRNAs release paused Pol II via the DDX21-CDK9 complex

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 11785480

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 11785480

Country of ref document: EP

Kind code of ref document: A1