WO2009060122A2 - Use of oligonucleotides with modified bases as antiviral agents - Google Patents

Use of oligonucleotides with modified bases as antiviral agents Download PDF

Info

Publication number
WO2009060122A2
WO2009060122A2 PCT/FI2008/050633 FI2008050633W WO2009060122A2 WO 2009060122 A2 WO2009060122 A2 WO 2009060122A2 FI 2008050633 W FI2008050633 W FI 2008050633W WO 2009060122 A2 WO2009060122 A2 WO 2009060122A2
Authority
WO
WIPO (PCT)
Prior art keywords
compound
oligonucleotide
virus
modified
oligonucleotides
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/FI2008/050633
Other languages
English (en)
French (fr)
Other versions
WO2009060122A3 (en
Inventor
Mart Saarma
Andres Merits
Mati Karelson
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Baltic Technology Development Ltd
Original Assignee
Baltic Technology Development Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority to US12/741,531 priority Critical patent/US20110171287A1/en
Priority to MX2010004983A priority patent/MX2010004983A/es
Priority to AU2008324066A priority patent/AU2008324066A1/en
Priority to JP2010532629A priority patent/JP5710977B2/ja
Priority to CA2704549A priority patent/CA2704549A1/en
Priority to CN2008801234555A priority patent/CN101970662A/zh
Priority to BRPI0819191A priority patent/BRPI0819191A2/pt
Priority to EP08846868A priority patent/EP2212420A2/en
Application filed by Baltic Technology Development Ltd filed Critical Baltic Technology Development Ltd
Priority to PCT/FI2009/050400 priority patent/WO2009144365A1/en
Publication of WO2009060122A2 publication Critical patent/WO2009060122A2/en
Publication of WO2009060122A3 publication Critical patent/WO2009060122A3/en
Anticipated expiration legal-status Critical
Priority to ZA2010/03234A priority patent/ZA201003234B/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • C12N15/1132Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/16Antivirals for RNA viruses for influenza or rhinoviruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • A61P31/18Antivirals for RNA viruses for HIV
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/111General methods applicable to biologically active non-coding nucleic acids
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/11Antisense
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3511Conjugate intercalating or cleaving agent
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2320/00Applications; Uses
    • C12N2320/50Methods for regulating/modulating their activity
    • C12N2320/51Methods for regulating/modulating their activity modulating the chemical stability, e.g. nuclease-resistance

Definitions

  • the present invention relates to use of oligonucleotide analogs that contain specifically modified nucleotide bases to inhibit gene expression and/or replication of viruses.
  • the oligonucleotides are optionally bound to organic complexes of lanthanides with highly selective artificial nuclease activity.
  • an antisense oligonucleotide to a target can thus be used to alter gene expression, in a variety of circumstances, e.g., to interfere with viral life cycles, or the growth of cancerous cells.
  • Many important infectious diseases afflicting centuries are caused by viruses. Many of these diseases, including hepatitis, immune deficiencies and various encephalitic diseases, are frequently fatal. Others are significant in that they are highly contagious and create acute discomfort such as influenza, measles, mumps and chickenpox, as well as respiratory or gastrointestinal disorders. Others such as rubella and cytomegalovirus can cause congenital abnormalities.
  • Viral genomes can consist of either DNA or RNA.
  • two groups of viruses, which use both DNA and RNA phases during their replication cycle, are known.
  • Viral genomic DNA may be double-stranded or single-stranded, circular or linear.
  • the size of the DNA can be as small as 4.5 kb or as big as 1.2 Mbp; the number of genes varies from 3 to up to 911. DNA genomes do not serve as targets for suggested antivirals.
  • virus encoded mRNAs micro-RNAs as well as mRNAs encoding host-factors, crucial for virus infection, may be used as antisense targets. Accordingly, this approach will not lead to direct destruction of the viral genome, but can suppress virus replication and/or gene expression and eventually lead to the clearance of the virus genome from the cells. Additionally, targeting of viral mRNAs encoding proteins which are essential for suppression of host immune responses may enhance virus elimination by host immune system.
  • Targeting of the viral gene products essential for inhibition of host cell apoptosis may lead to premature death of infected cells and thus eliminate the virus infection, while targeting of virus gene products essential for maintenance of latent viruses (mRNAs or in some cases micro-RNAs) may lead to elimination of latently infected cells and removal of latent virus from the infected organism.
  • mRNAs or in some cases micro-RNAs latent viruses
  • Retroviruses do not have a DNA genome, but at the first stage of their infection they synthesize the cDNA copy of their genomic RNA, which is then integrated into the cellular DNA and thus becomes a part of the host genome (so called provirus DNA). This DNA is often transcriptionally silent and cells carrying these proviruses cannot be targeted by conventional anti- viral agents or systems (this is one of the biggest problems in anti- HIV therapy). Although the provirus cannot be targeted or eliminated by antisense technology, certain steps of the infection process can.
  • These steps include: targeting of the viral genome in newly infected cells before the reverse transcription reaction takes place- the genomic RNA at this stage is enclosed with viral proteins in a "core" particle; targeting of viral receptors or co-receptors (in case of HIV chemokine receptors) to prevent virus entry; targeting of cellular cofactors essential for virus cDNA nuclear transport and integration in host genome (a number of such factors are known for HIV-I); targeting of the mRNAs expressed from provirus and thus suppressing the retrovirus replication cycle; targeting of the viral genomic RNAs before their encapsidation and preventing formation of new virions.
  • These strategies may be efficient for inhibiting the HIV genome, which encodes multiple regulatory proteins for which expression can be blocked.
  • Genomes of riboviruses can be directly targeted with sequence-specific anti-RNA agents. Therefore the infection caused by riboviruses can be totally eliminated by use of these kinds of drugs alone. In practice, however, the targeting of the genomes may be complicated since the viral genomes are often protected; but even then the viral mRNAs and mRNAs of cellular co factors essential for the virus may be targeted.
  • RNA of viruses with double-stranded RNA genomes is always packed in protein particles (viral core) and is never released to the cytoplasm of an infected cell. Thus, most likely only mRNAs and host factors can be targeted with anti-RNA agents.
  • the genome of viruses with single-stranded negative RNA genomes is always protected by viral nucleoprotein, but it does not form a specific core-particle. Thus, it would be possible to target both the virus genomes as well as their essential mRNAs.
  • Viruses with single-stranded positive RNA genomes are the only viruses in which the genomic RNA is directly used as mRNA and is, at least at some stage of infection, in naked (unprotected) form.
  • the genome and its complementary strand are usually packed in membranous structures. Therefore it is possible that the initial stages of infection (before formation of the replicase complex) may be more sensitive to the RNA degrading agents.
  • additional factors may have very important roles as well.
  • the abundance of target RNA is especially important if the antiviral agent is limited to a single action such as blocking one RNA molecule (antisense oligonucleotide) or cleaving just one RNA molecule (this is often the case with anti- viral ribozymes).
  • the abundance of viral RNA varies greatly depending on the type of virus and the stage of infection. It is hypothesized that antisense agents are more efficient at the stages of the infection where the copy-number of viral RNA (genomes or mRNAs) is low (typically this corresponds to the early stages of infection).
  • Polarity of the target is important for inhibition of positive-sense riboviruses, which have highly asymmetric RNA synthesis, e.g., the number of positive (genomic) strands of these viruses is often 100 or more times higher than that of negative strands. This would make the negative strand a preferable target, however it is known that the negative strands of these viruses are often (possibly always) presented in form of a double- stranded RNA intermediate and hidden in membranous replication complexes. It would, therefore, be important to determine if the proposed antiviral agent also binds to dsRNA complexes (specific degradation of negative strands has been reported in experiments using RNAi).
  • the site of virus replication inside of the infected cell depends on the type of the virus and can be carried out in the nucleus (retroviruses, most DNA viruses and influenza virus) or cytoplasm (all riboviruses, except influenza viruses, bornaviruses and nucleorhabdo viruses and DNA-genomic poxviruses).
  • nucleus retroviruses, most DNA viruses and influenza virus
  • cytoplasm all riboviruses, except influenza viruses, bornaviruses and nucleorhabdo viruses and DNA-genomic poxviruses.
  • viruses replicating inside the cytoplasm different virus-specific structures (often named “virus factories” or "viroplasms") are observed.
  • virus factories of specific sites (e.g., nucleus, membrane complexes, and "virus factories”) can protect viral genomes from therapeutic agents; nevertheless it has been reported that at least RNAi is active against nuclear RNA molecules.
  • the importance of the intracellular localization of viral replication complexes may have a relatively minor effect, especially if the following considerations are taken into account: all viruses use free mRNAs to express their genes and thus have molecules which can be targeted by the RNA degrading agent(s), and all positive strand RNA viruses (the only viruses whose genomes can be easily targeted) replicate in the cytoplasm.
  • the site of virus replication inside an infected organism likely has much greater impact. Again, the site of replication depends from the type of the virus. Most of the viruses have certain tissue-specificity - some infect epithelial cells, some viruses infect hepatocytes, etc. Many viruses infect different cell types. The infection may start from peripheral tissues (portal of entry), but the disease is caused due to replication in other cell type(s) (target cells). There are a number of viruses where the two cells are rather different (measles virus etc), but there are also many examples where these cells are identical (influenza virus). [0014] The consequences of the different replication sites inside the organism vary.
  • the methods of drug delivery can be relatively simple. This means that effective but highly unstable compounds like siRNAs can be used to treat these infections in vivo. If the virus replicates in tissues other than epithelia, a specific drug-delivery system is needed at least for siRNA technology.
  • the therapeutic agent can theoretically be liver- specific nanoparticles or liver-specific viral particles expressing siRNA precursors (shRNA).
  • shRNA liver-specific viral particles expressing siRNA precursors
  • Viruses infecting humans and animals generally use one of several infection strategies.
  • the "hit and run” strategy acute infections
  • the virus enters the host, replicates quickly and actively and is ultimately eliminated by the host immune response; the only alternative is the death of the infected host. Infection time is typically short (up to a few weeks) and viral amounts during acute infection are very high. This strategy is used by many "classical” viruses (as example - influenza virus).
  • the "hit and hide” strategy latent infections
  • the infection starts and proceeds as in the above scenario, but instead of complete elimination, virus establishes life-long latent infection. During latency viral gene expression is minimized and no infectious virus is produced.
  • virus re-activates and causes new disease (either similar or different from the initial one).
  • viruses are very common and include, for example herpes simplex virus (HSV). In many cases these viruses present serious problems due to the tendency to cause severe or fatal diseases in immuno compromised patients (such as AIDS patients).
  • HSV herpes simplex virus
  • a "chronic" or “persistent” infection generally starts with a short acute phase. This phase can be asymptomatic and can end with complete elimination of virus. The outcome, however, depends on both virus and host: up to 95% of hepatitis B virus (HBV) infections in adults end with elimination of virus.
  • virus may establish chronic infection (for example, up to 70% of HCV infections and possibly 100% of HIV infections). During chronic infection the viral replication remains active (in contrast to that in latent infection) and a large amount of virions may be produced (HCV typically forms up to 10 12 particles per day). Nevertheless the immune system is unable to eliminate the infection.
  • Chronic viruses represent a major healthcare problem since up to 500 million people are infected with HBV or HCV and around 40 million people are infected with HIV-I. [0019] The requirements for elimination of different types of infection may be drastically different. With acute diseases the treatment must be done as early as possible and most likely should be rather short. In this case the treatment has a clear aim, slow down the virus infection and give the immune system time to eliminate the virus (complete virus inhibition by treatment may not be possible and in many cases may not be needed). It is not clear what should be the minimal efficiency of the used agent - in some cases a minor inhibition of replication may provide considerable protection, in other cases almost complete inhibition may be required.
  • latent viruses With latent viruses the major problem is the elimination of the latently infected cells - a reservoir, from where new infections may start. Currently the mechanisms of viral latency are poorly understood and that is one of the reasons why current treatments cannot eliminate the latent virus. In theory, these viruses and latent cells can be targeted with sequence-specific RNA degrading agents against viral co factors (if they are known) or against essential viral gene products. For example, in a study of HSV it was recently demonstrated that the virus encoded micro-RNA may be the main factor responsible for latent infection, which may provide a desirable target for inhibition of viral replication.
  • the treatment may aim toward either prevention of the spread of infection (for example in case of liver transplantation to HCV patients), to eliminate the infection in all or in many cells or, at least, to keep virus replication under some kind of control.
  • the treatment of chronic infection is a long process - currently life-long for HIV patients and for many months for HBV and HCV patients. Due to this fact the side effects of the treatment are very important as is seen in long term effects with anti-HIV, -HCV and -HBV treatment.
  • HCV genotypes can be as low as 60%. In essence, this indicates that neither HIV-I nor HCV represent a single pathogen; instead they are names used (largely for historical reasons) for groups of related pathogens. This huge diversity has seriously hampered the construction of efficient vaccines against either of these viruses.
  • HCV, HIV as well as other riboviruses do not have a fixed genome sequence as such, instead they have a sort of consensus sequence (individual genomes generally differ for that) and therefore exist as quasi-species. It has been shown that even inside of one single patient the individual sequences of HCV RNAs differ from each other in 1-3% of nucleotide positions. Thus, considerable sequence variability already exists in any chronically infected patient.
  • RNA tolerates several changes, but is a far less efficient silencer). Further, due to the redundancy of the genetic code the nucleic acid sequence can change without affecting the sequence of encoded protein. Viral proteins do also have considerable plasticity - many amino-acid changes are tolerated (this is evident from the data about the anti-HIV drug resistance as well). Changes can affect not only RNA sequence but also its secondary structure and thus inhibit its recognition by siRNA.
  • siRNAs can be used to treat viral infection. It has been shown that such treatment is more effective than treatment with a single siRNA and significantly reduces the appearance of resistant mutants. Therefore a similar strategy should be strongly recommended for other nucleic acid based therapeutic agents as well.
  • siRNAs can be targeted to highly conserved sequences or those having multiple overlapping functions. Such sequences cannot be easily changed without affecting crucial functions. Examples of such sequences are primer binding regions in the HIV-I genome or 5' UTR region with IRES element in the HCV genome.
  • compositions comprising oligonucleotides wherein the oligonucleotides comprise modified nucleobases, and optionally chelating moieties, which increase their binding ability to complementary nucleic acids and exhibit antiviral activity.
  • the invention provides a method of inhibiting replication of a virus in a subject comprising administering to the subject an oligonucleotide having from 5 to 150 nucleobases, wherein at least one nucleobase is a mercapto-modif ⁇ ed tautomeric or ionic base (mercaptonucleobase) or a hydroxyl-modif ⁇ ed tautomeric or ionic base (hydroxynucelobase) .
  • the invention contemplates a method of inhibiting translation of a target nucleic acid comprising contacting the target nucleic acid with a composition comprising an oligonucleotide having from 5 to 150 nucleobases under conditions that permit hybridizing of the oligonucleotide to the target nucleic acid, wherein the hybridized oligonucleotide inhibits translation of the target nucleic acid, wherein the target nucleic acid is associated with viral replication, and wherein the oligonucleotide comprises at least one modified nucleobase selected from the group consisting of a mercapto -modified tautomeric or ionic base (mercaptonucleobase) and a hydroxy-modified tautomeric or ionic base (hydroxynucleobase).
  • a composition comprising an oligonucleotide having from 5 to 150 nucleobases under conditions that permit hybridizing of the oligonucleotide to the target nucleic acid, wherein the hybridized
  • the invention provides a method of inhibiting replication of a viral genome in a subject or viral pathogen, comprising predicting or determining a nucleotide sequence of a target nucleic acid in a subject, wherein the target nucleic acid is associated with viral replication, and administering to the subject a composition comprising an oligonucleotide having from 5 to 150 nucleobases, wherein at least one nucleobase is a mercapto -modified tautomeric or ionic base (mercaptonucleobase) or a hydroxy-modified tautomeric or ionic base (hydroxynucleobase), and wherein under physiological conditions of the subject, said compound is sufficiently complementary to the nucleotide sequence of the target sequence to hybridize thereto in the subject and inhibit viral replication.
  • a composition comprising an oligonucleotide having from 5 to 150 nucleobases, wherein at least one nucleobase is a mercapto -modified tautomeric or i
  • the invention further contemplates use of an oligonucleotide to inhibt viral replication in a subject, wherein the oligonucletide is formulated for administration to the subject and comprises from 5 to 150 nucleobases, wherein at least one nucleobase is a mercapto -modified tautomeric or ionic base (mercaptonucleobase) or a hydroxy-modified tautomeric or ionic base (hydroxynucleobase).
  • the invention provides for use of an oligonucleotide in the manufacture of a medicament to inhibit translation of a target nucleic acid, wherein the target nucleic acid is contacted with a composition comprising an oligonucleotide under conditions that permit hybridizing of the oligonucleotide to the target nucleic acid, wherein the hybridized oligonucleotide inhibits translation of the target nucleic acid, wherein the target nucleic acid is associated with viral replication, and wherein the oligonucleotide comprises at least one modified nucleobase selected from the group consisting of a mercapto -modified tautomeric or ionic base (mercaptonucleobase) and a hydroxy-modified tautomeric or ionic base (hydroxynucleobase).
  • a composition comprising an oligonucleotide under conditions that permit hybridizing of the oligonucleotide to the target nucleic acid, wherein the hybridized oligonucleo
  • the invention provides for use of an oligonucleotide in the manufacture of a medicament to inhibit replication of a viral genome in a subject, the use comprising predicting or determining a nucleotide sequence of a target nucleic acid in a subject or a viral pathogen, wherein the target nucleic acid is associated with viral replication, and administering to the subject a medicament comprising an oligonucleotide having from 5 to 150 nucleobases, wherein at least one nucleobase is a mercapto -modified tautomeric or ionic base (mercaptonucleobase) or a hydroxy-modif ⁇ ed tautomeric or ionic base (hydroxynucleobase), and wherein under physiological conditions of the subject, said compound is sufficiently complementary to the nucleotide sequence of the target sequence to hybridize thereto in the subject and inhibit viral replication.
  • a medicament comprising an oligonucleotide having from 5 to 150 nucleobases, wherein at least one
  • the oligonucleotide useful in The method or use or compound ofthe invention comprises at least one mercaptonucleobase.
  • the mercaptonucleobases is selected from the group consisting of 5- mercaptocytosine, 5-mercaptouracil, 8-mercaptoguanine and 8-mercaptoadenine.
  • the invention comprises at least one hydroxynucleobase.
  • the hydroxynucleobase is selected from the group consisting of 5- hydroxycytosine, 5-hydroxyuracil, 8 -hydroxy adenine and 8 -hydroxy guanine.
  • the oligonucleotide further comprises an organic nuclease attached thereto.
  • the organic nuclease comprises a chelating organic moiety complexed with a lanthanide metal.
  • the lanthanide metal is selected from the group consisting of lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium.
  • the oligonucleotides described herein are useful to inhibit replication of various virus strains.
  • the virus is a positive-strand RNA virus.
  • the virus is a DNA virus.
  • the virus is a fast acute virus.
  • the fast acute virus is an alphavirus.
  • the virus is a chronic virus.
  • the chronic virus is hepatitis C virus.
  • the virus is a papillomavirus.
  • the papilloma virus is selected from the group consisting of bovine papilloma virus 1 and human papilloma virus.
  • the oligonucleotide hybridizes to a viral gene encoding a transcription or regulatory factor, and inhibits replication of a virus with a DNA genome.
  • the oligonucleotide hybridizes to a viral replication factor and inhibits replication of a virus with a DNA genome.
  • the oligonucleotide hybridizes to a virus using reverse transcription in its replication cycle.
  • the oligonucleotide hybridizes to a viral gene encoding a transcription or a regulatory factor to inhibit replication of a virus replicating by use of reverse transcription.
  • the virus using reverse transcription is a retrovirus.
  • the retrovirus is human immunodeficiency virus 1.
  • the oligonucleotide hybridizes to a host factor associated with viral replication, and inhibits viral replication. In a still further embodiment, the oligonucleotides are useful to treat uninfected cells to decrease the viral gene expression and replication in these cells.
  • the oligonucleotide useful in the methods of the invention are from 5 to 150 nucleobases in length, from 10 to 100 nucleobases in length, 10 to 50 nucleobases in length, from 10 to 30 nucleobases in length, from 20 to 30 nucleobases in length, or from 21 to 23 nucleobases in length. All integer lengths from 5 to 150 nucleobases, and also subranges within 5 to 150 nucleobases, are specifically contemplated for practice of the invention.
  • nucleobases in the modified oligonucleotide are modified nucleobases.
  • 10% to 90% of the nucleobases are modified nucleobases.
  • 20% to 80% of the nucleobases are modified nucleobases.
  • 30% to 70%, 40% to 60% or 50% of the nucleobases are modified nucleobases.
  • 10, 20 30, 40, 50, 60, 70, 80 or 90% of the nucleobases are modified nucleobases.
  • the oligonucleotide comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, up to 30, up to 40, up to 50, up to 100 or more modified nucleobases, wherein the modified nucleobase is a hydroxynucleobase or a mercaptonucleobase.
  • the entirety of a 150-base oligonucleotide may comprise all modified oligonucleotides.
  • the oligonucleotide hybridizes to a non- coding region of a viral genome or hybridizes to a coding region of a viral genome.
  • the oligonucleotide hybridizes to the coding region of an RNA virus.
  • the method or use or compound ofthe invention also provides that, in one aspect, at least two oligonucleotides having different sequences are administered to the subject, wherein the oligonucleotides hybridize to different target sequences.
  • the invention further provides for use of at least two oligonucleotides having different sequences in the manufacture of a medicament for administration to a subject, wherein the oligonucleotides hybridize to different target sequences. In one embodiment, two different oligonucleotides are administered to the subject.
  • the oligonucleotides are specific for different target sequences in the same viral genome. In another embodiment, the oligonucleotides are specific for target sequences in the same functional unit. In yet another embodiment, the oligonucleotides are specific for target sequences in different functional units.
  • composition further comprises a pharmaceutical carrier or excipient as described herein.
  • the subject is a mammal. In a related embodiment, the subject is human.
  • the composition for use in The method or use or compound ofthe invention is administered in a liposome.
  • the composition may be administered in a nanoparticulate pharmaceutical such as a micelle or a nanoparticle.
  • the hybridizing ofthe oligonucleotide to a target sequence induces cleavage ofthe target nucleic acid.
  • the oligonucleotide exhibits at least 70% homology to the target nucleic acid.
  • the oligonucleotide is 75%, 80%, 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% homologous to the target nucleic acid.
  • the invention includes, as an additional aspect, all embodiments ofthe invention narrower in scope in any way than the variations specifically mentioned above.
  • Figure 1 shows the suppression of E2 dependent replication of BPV origin containing plasmids by antisense modified oligonucleotides targeted against E2 mRNA.
  • Figure 2 illustrates the effect of antisense oligonucleotides with modified 5-OH- dC bases on the replication of recombinant virus. Inhibition of replication of recombinant virus is monitored by measuring Rluc activity expressed from genomic RNA of the virus LF - lipofectamine treated control cells. Results from one of the reproducible experiments are shown in the figure.
  • Figure 3 shows the additive effect of the nuclease complex on the antiviral effect of oligonucleotides with modified 8-oxo-dG bases. Inhibition of replication of recombinant virus is monitored by measuring Rluc activity expressed from genomic RNA of the virus.
  • Figure 4 demonstrates the reduction of effective dose 50 (EC50) for HM0 9 by the presence of the nuclease (compound designated HMO 9E).
  • This present invention relates to the use of oligonucleotides containing one or more modified bases, which optionally may be linked to an organic nuclease complex, for suppression of the replication and/or gene expression of viruses pathogenic to humans and animals.
  • the current invention provides compounds that comprise a chelating moiety and an oligonucleotide having properties for use in antisense inhibition of viral gene expression and/or replication.
  • the compounds of the invention include antisense oligonucleotides having (a) one or more modified nucleobases having high binding efficiency to natural nucleobases and, optionally, (b) one chelating moiety. These compounds can hydro lyze phosphodiester bonds of oligonucleotides, RNA, and/or DNA, and are useful in antisense therapies.
  • HIV human immunodeficiency virus
  • HAART Highly Active AntiRetro viral Treatment
  • HAART therapies typically comprise two nucleoside reverse transcriptase inhibitors drugs with a third drug, either a protease inhibitor or a non-nucleoside reverse transcriptase inhibitor.
  • Clinical studies have shown that HAART is the most effective means of reducing viral loads and minimizing the likelihood of drug resistance.
  • HAART is the most effective means of reducing viral loads and minimizing the likelihood of drug resistance.
  • HCV infection is the most common chronic bloodborne infection in the United States where the number of infected patients likely exceeds 4 million and 150 million worldwide. This common viral infection is a leading cause of cirrhosis and liver cancer, and is now the leading reason for liver transplantation in the United States. Recovery from infection is uncommon, and about 85 percent of infected patients become chronic carriers of the virus and 10 to 20 percent develop cirrhosis. It is estimated that there are currently 170 million people worldwide who are chronic carriers. According to the Centers for Disease Control and Prevention, chronic hepatitis C causes between 8,000 and 10,000 deaths and leads to about 1,000 liver transplants in the United States alone each year. There is no vaccine available for hepatitis C. Prolonged therapy with interferon alpha, or the combination of interferon with Ribavirin, is effective in only about 40 percent of patients and causes significant side effects.
  • HPV human papillomaviruses
  • HPV human papillomaviruses
  • HPV causes benign skin warts, or papillomas.
  • Many HPVs are transmitted through sexual contact.
  • Genital HPV infection is very common, with estimates suggesting that up to 75% of women will become infected with one or more of the sexually transmitted HPV types at some point during adulthood.
  • Persistent infection with "high-risk" sexually transmitted HPVs HPV- 16, -18 and some others
  • HPVs are medically important (up to 500,000 cancer cases/year).
  • effective vaccines became available against the four most prevalent HPV species, however a number of HPV strains and species are not covered by these vaccines.
  • Alphaviruses are representatives of the viruses which are causing mostly acute infections. More than 10 members of this genus are known human pathogens. They are often widespread but their medical importance was considered to be moderate, and as such, there is no effective vaccine for humans against alphavisruses.
  • the overall economic damage caused by Chikungunya virus on Reunion Island alone is estimated to be over 100 million euros (235,000 infections, ca 200 death cases), the damage caused by this virus in India is taking the scale of a national medical disaster (estimates are as high as 6 million infections). Chikungunya virus is still rapidly spreading and in late 2007 a mosquito-born outbreak was first detected in Europe (Italy).
  • viruses listed above represent only a fraction of the known viral pathogens for humans and domestic animals, however they essentially cover all variety of the different viral genome types (DNA, RNA, retroviral); target tissue (epithelia, immune system, liver specif ⁇ ty and viruses with a broad range of target cells) and replication sites
  • cytoplasm or nucleus cytoplasm or nucleus
  • specificity and the type of the infection (acute, chronic or latent).
  • viruses also represent typical viruses causing cell death (alphaviruses, HIV), no appearent cell damage (HCV) or cell transformation (papillomaviruses).
  • HIV alphaviruses
  • HCV no appearent cell damage
  • papillomaviruses papillomaviruses
  • Zamecnik et al. have used oligonucleotides (ONs) specifically targeted to the reverse transcriptase primer site and to splice donor/acceptor sites (Zamecnik, et al (1986) Proc. Natl. Acad. Sci. USA 83:4143-) (Goodchild & Zamecnik (1989) U.S. Pat. No. 4,806,463).
  • ONs oligonucleotides
  • Oligonucleotides or oligonucleotide analogs targeting CMV (cytomegalovirus) mRNAs coding for IEl, IE2 or DNA polymerase were reported by Anderson et al (1997) (U.S. Pat. No. 5,591,720).
  • Cohen et al. describe antiviral activity of antisense PS-ODNs specific to a viral sequence. They also describe testing polyA, polyT and polyC PS-ODN sequences of 14, 18, 21 and 28-mers and indicate an antiviral effect of those PS-ODNs.
  • Gao et al ((1989) J Biol Chem 264 : 11521-11526), describe the inhibition of replication of HSV-2, by PS-ODNs by testing of polyA, polyT and polyC PS-ODN sequences in sizes of 7, 15, 21 and 28 nucleotides.
  • Antisense ODNs developed as anticancer agents, antiviral agents, or to treat others diseases are typically approximately 20 nucleotides in length.
  • the length of an antisense oligonucleotide must be optimized: If the antisense oligonucleotide is either too long or too short, an element of specificity is lost. At the present time, the optimal length for an antisense oligonucleotide seems to be roughly 16-20 nucleotides".
  • Crooke, S T (2000) Methods Enzymol.
  • a phosphorothioate oligodeoxynucleotide has a T m approximately -2.2° C lower per unit. This means that to be effective in vitro, phosphorothioate oligodeoxynucleotides must typically be 17- to -20-mer in length . . . "
  • Caruthers and co-workers (Marshall et al. (1992) Proc. Natl. Acad. Sci. USA 89:6265-6269) reported anti-HIV activity of phosphorodithioate ODNs (PS2-ODNs) for a 12-mer polycytidine-PS2-ODN and for a 14-mer PS2-ODN. No other sizes were tested for anti-HIV activity. They also reported the inhibition of HIV reverse transcriptase (RT) for 12-, 14-, 20- and 28-mer polycytidine-PS2-ODNs. Later, this group (Marshal et al (1993) Science 259:1564-1570) reported results showing sequence specific inhibition of the HIV RT.
  • PS2-ODNs phosphorodithioate ODNs
  • RT HIV reverse transcriptase
  • Oligonucleotides modified at the 2' position of the ribose and their uses in antisense strategies have been evaluated, e.g., as described in the references cited below.
  • oligonucleotides i.e., oligonucleotides having unmodified and 2'-O- methylribonucleotides
  • Oligonucleotides with 2'-sugar modifications including 2'-O-methyl, 2'-O-propyl, 2'-O-pentyl, and 2'-fluoro were analyzed for antisense activity. Evaluation of antisense activities of uniformly 2'-modified oligonucleotides revealed that these compounds were completely ineffective in inhibiting gene expression. Activity was restored if the compound contained a stretch of at least five 2'-deoxyribonucleotide residues. This minimum deoxyribonucleotide length correlated perfectly with the minimum length required for efficient RNase H activation in vitro. (Monia et al., 1993, J. Biol. Chem. 268:14514.)
  • Agrawal and Kandimalla ((2000) MoI. Med. Today 6:72-81) say that mixed backbone oligonucleotides, including 2'-O-methyl modifications, have become the choice for second-generation antisense oligonucleotides for their improved characteristics including RNAse H activation.
  • An antisense oligo should possess certain important characteristics such as the ability to activate RNAse H upon binding to the target RNA. (Agrawal and Kandimalla, 2001, Current Cancer Drug Target 1:197-209). For most antisense approaches, targeting RNA cleavage by RNAse H is desired in order to increase antisense potency. (Kurreck, 2003, Eur. J. Biochem. 270:1628-1644).
  • Target viruses contemplated for use in the invention include, but are not limited to, positive strand RNA viruses causing acute infection (such as Semliki Forest virus, SFV, genus Alphavirus, family Togaviridae), positive strand RNA viruses causing chronic infection (such as Hepatitic C virus, HCV, genus Hepacivirus, family Flaviviridae), retroviruses causing acute infection as well as long-lasting chronic disease (such as Human Innunodeficiency virus type 1, HIV-I, genus Lentivirus, family Retroviridae) and viruses with DNA genomes (such as Bovine Papillomavirus Type 1, BPV-I, family Papillomaviridae) .
  • positive strand RNA viruses causing acute infection such as Semliki Forest virus, SFV, genus Alphavirus, family Togaviridae
  • positive strand RNA viruses causing chronic infection such as Hepatitic C virus, HCV, genus Hepacivirus, family Fla
  • the present disclosure demonstrates that a single administration of the modified oligonucleotides to cell cultures infected with these viruses, transfected with their genomes or containing their gene expression units results in specific suppression of their gene expression and (in case of RNA viruses and papillomaviruses) replication. These effects are proportional to the amount of the oligonucleotide inhibitor and increased by the presence of modified bases in the compound and further increased by the presence of the organic nuclease complex.
  • the present disclosure also demonstrates that the antiviral effect is increased and the effective concentration of the inhibitor is reduced if the modified bases are changed from hydroxynucleobases to mercaptonucleobases.
  • oligonucleotide refers to an oligomer or polymer of deoxyribonucleic acid (DNA) or mimetics, chimeras, analogs and homo logs thereof.
  • This term includes oligonucleotides composed of naturally occurring nucleobases, sugars and covalent internucleoside (backbone) linkages as well as oligonucleotides having non-naturally occurring portions which function in a similar manner as naturally occurring oligonucleotides when, e.g., hybridizing to target nucleic acids or interacting with complementary oligonucleotides.
  • Such modified or substituted oligonucleotides are often preferred over native forms because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for a target nucleic acid and increased stability in the presence of nucleases.
  • modified nucleobases or other analogs having zwitterionic or ionic tautomers have at least one nucleobase having modified nucleobases or other analogs having zwitterionic or ionic tautomers.
  • the modified nucleobase is a hydroxynucleobase selected from 5-hydroxycytosine and 8 -hydroxy guanine or a mercaptonucleobase selected from 5-mercaptocytosine, 5-mercaptouracil, 8- mercaptoguanine, and 8-mercaptoadenine.
  • the acidic tautomeric group in the modified nucleobases can be any other acidic group such as the -SH, -COOH, -SO3H, etc.
  • an oligonucleotide comprises one or more tautomeric forms of the 5-hydroxyuracil anion.
  • the compounds of the present invention include the hydroxybase 5-hydroxycytosine.
  • the hydroxybase is a tautomeric form of the 8 -hydroxy adenine and its anion.
  • Another embodiment of the invention provides compounds of the present invention modified by tautomeric forms of the 8-hydroxyguanine and its anion. Tautomeric forms of these nucleobases are described in further detail in WO 2007/125173.
  • Additional modified nucleobases contemplated herein include mercapto- modified nucleobases.
  • Modified nucleobases have also been contemplated for use in polymerase chain reaction (PCR), hybridization of nucleic acids and siRNA-mediated gene silencing in co- owned and co-pending application numbers (Attorney Docket Number 28113/43435A) and U.S. provisional application 60/985,552, which are hereby incorporated by reference in its entirety.
  • PCR polymerase chain reaction
  • siRNA-mediated gene silencing in co- owned and co-pending application numbers
  • U.S. provisional application 60/985,552 which are hereby incorporated by reference in its entirety.
  • each of the hydroxynucleobases is considered complementary to a nucleobase when it stably hydrogen bonds to the opposite nucelobase. Therefore, in some cases, 5-hydroxyuracil is complementary to adenine, 5-hydroxycytosine is complementary to guanine, 8 -hydryoxy adenine is complementary to uracil and/or thymine, and 8-hydroxyguanine is complementary to cytosine.
  • Other stable hydrogen bonding of a hydroxynucleobase with a nucleobase of a target nucleic acid can occur, and, therefore, a hydroxynucleobase is considered complementary to the nucleobases of the target nucleic acid to which stable hydrogen bonding occurs.
  • the number of hydroxynucleobases and/or mercaptonucleobases in a given compound of the present invention is at least 1% up to 100% of the total number of nucleobases of the oligonucleotide portion of the compound.
  • the hydroxynucleobases of mercaptonucleobases may be the same or different (in any combination of different bases and/or types of modifications). It is contemplated that 10% to 90%, 20% to 80%, 30% to 70%, 40% to 60% or 50% of the nucleobases in an oligonucleotide described herein are modified nucleobases. It is further contemplated that 10, 20, 30, 40, 50, 60, 70, 80, 90, 91, 92, 93, 94, 95, 96, 97, 98, or 99% of the nucleobases are modified nucleobases.
  • the compounds in accordance with this invention preferably comprise from about 5 to about 150 nucleobases (i.e. from about 5 to about 150 linked nucleosides).
  • nucleobases i.e. from about 5 to about 150 linked nucleosides.
  • the compounds of the invention are 10 to 100 nucleobases in length.
  • this embodies compounds of 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, or 100 nucleobases in length.
  • the compounds of the invention are 10 to 50 nucleobases in length.
  • the compounds of the invention are 20 to 30 nucleobases in length.
  • Particularly preferred compounds are oligonucleotides from about 10 to about
  • the oligonucleotide may contain 100% modified nucleobases.
  • the oligonucleotide may contain 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109
  • the compound of the present invention optionally further comprises a chelating moiety.
  • Chelating moieties function as metal ligands. They can stably chelate a metal ion. Certain metal-ligand complexes have been shown to be effective in cleaving phosphodiester bonds.
  • the efficacy of the oligonucleotide in inhibiting a target nucleic acid increases due to its ability to degrade or cleave one or more phosphodiester bonds of the target nucleic acid. Therefore, the compounds of the present invention further comprise chelating moieties capable of chelating a metal ion.
  • the metal ion is selected from the group consisting of lanthanum, cerium, praseodymium, neodymium, promethium, samarium, europium, gadolinium, terbium, dysprosium, holmium, erbium, thulium, ytterbium, and lutetium.
  • preferred ions are ions of europium or lanthanum.
  • Ions of the metals can be any stable ion, such as +1, +2, +3, +4, or +5.
  • Preferred ions are La(III), Eu(III), Ho(III), and Ce(IV).
  • Contemplated chelating moieties include those represented by formulas as described below.
  • Rl is selected from hydrogen, C 1-8 alkane, C2-8 alkene, C2-8 alkyne, acylCl- 8alkane, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, Cl-8alkylaryl, and Cl- 8alkylheteroaryl
  • R2 is independently selected from C 1-8 alkyl, C2-8 alkene, C2-8 alkyne, aryl, heteroaryl, Cl-8alkylaryl, Cl-8alkylheteroaryl, and acylCl-8alkane, and
  • R3 is independently selected from the group consisting of hydrogen, C 1-8 alkane, C2-8 alkene, C2-8 alkyne, acylCl-8alkane, cycloalkyl, heterocycloalkyl, aryl, heteroaryl, Cl-8alkylaryl, and Cl-8alkylheteroaryl.
  • alkyl includes straight chained and branched hydrocarbon groups containing the indicated number of carbon atoms, typically methyl, ethyl, and straight chain and branched propyl and butyl groups.
  • the hydrocarbon group can contain up to 16 carbon atoms.
  • alkyl includes "bridged alkyl,” e.g., a C6-C16 bicyclic or poly cyclic hydrocarbon group, for example, norbornyl, adamantyl, bicyclo[2.2.2]octyl, bicyclo[2.2.1]heptyl, bicyclo[3.2.1]octyl, and decahydronaphthyl.”
  • the term “alkyl” also encompasses alkyl groups which are optionally substituted with, e.g., one or more halogen atoms, one or more hydroxyl groups, or one or more thiol groups.
  • cycloalkyl is defined as a cyclic C3-C8 hydrocarbon group, e.g., cyclopropyl, cyclobutyl, cyclohexyl, and cyclopentyl.
  • Heterocycloalkyl is defined similar to cycloalkyl, except at least one heteroatom is present in the cyclic structure. Suitable heteroatoms include N, S, and O.
  • alkenyl and alkynyl are defined identically as “alkyl,” except for containing a carbon-carbon double bond or carbon-carbon triple bond, respectively.
  • Cycloalkenyl is defined similarly to cycloalkyl, except a carbon-carbon double bond is present in the ring.
  • alkylene refers to an alkyl group having a substituent.
  • Cl-3alkylenearyl refers to an alkyl group containing one to three carbon atoms, and substituted with an aryl group.
  • halo or “halogen” is defined herein to include fluorine, bromine, chlorine, and iodine.
  • aryl groups include phenyl, naphthyl, tetrahydronaphthyl, 2-chlorophenyl, 3- chlorophenyl, 4-chlorophenyl, 2-methylphenyl, 4-methoxyphenyl, 3- trifluoromethylphenyl, 4-nitrophenyl, and the like.
  • arylC 1-3 alkyl and “heteroarylC 1-3 alkyl” are defined as an aryl or heteroaryl group having a Cl-3alkyl substituent.
  • heteroaryl is defined herein as a monocyclic or bicyclic ring system containing one or two aromatic rings and containing at least one nitrogen, oxygen, or sulfur atom in an aromatic ring, and which can be unsubstituted or substituted, for example, with one or more, and in particular one to three, substituents, like halo, alkyl, hydroxy, hydroxyalkyl, alkoxy, alkoxyalkyl, haloalkyl, nitro, amino, alkylamino, acylamino, alkylthio, alkylsulf ⁇ nyl, and alkylsulfonyl.
  • heteroaryl groups include thienyl, furyl, pyridyl, oxazolyl, quinolyl, isoquinolyl, indolyl, triazolyl, isothiazolyl, isoxazolyl, imidizolyl, benzothiazolyl, pyrazinyl, pyrimidinyl, thiazolyl, and thiadiazolyl.
  • Het is defined as monocyclic, bicyclic, and tricyclic groups containing one or more heteroatoms selected from the group consisting of oxygen, nitrogen, and sulfur.
  • Nonlimiting examples of Het groups include 1,3-dioxolanyl, 2-pyrazolinyl, pyrazolidinyl, pyrrolidinyl, piperazinyl, a pyrrolinyl, 2H-pyranyl, 4H-pyranyl, morpholinyl, thiopholinyl, piperidinyl, 1 ,4-dithianyl, and 1,4-dioxane.
  • hydroxy is defined as -OH.
  • alkoxy is defined as -OR, wherein R is alkyl.
  • alkoxyalkyl is defined as an alkyl group wherein a hydrogen has been replaced by an alkoxy group.
  • (alkylthio)alkyl is defined similarly as alkoxyalkyl, except a sulfur atom, rather than an oxygen atom, is present.
  • hydroxyalkyl is defined as a hydroxy group appended to an alkyl group.
  • amino is defined as -NH2
  • alkylamino is defined as - NR2, wherein at least one R is alkyl and the second R is alkyl or hydrogen.
  • alkylthio is defined as -SR, wherein R is alkyl.
  • alkylsulfmyl is defined as RSO2-, wherein R is alkyl.
  • alkylsulfonyl is defined as RSO3-, wherein R is alkyl.
  • nitro is defined as -NO2.
  • trifluoromethyl is defined as -CF3.
  • trifluoromethoxy is defined as -OCF3.
  • the calculated nuclease efficiency of a compound of the present invention comprising a chelating moiety complexed to a metal ion increases, depending on the nature of the number of modified nucleobases, up to 10 3 -10 9 times in comparison to naturally- occurring nucleases, allowing a corresponding lowering of the effective concentration, and keeping at the same time high specificity of the compound.
  • oligonucleotides are a preferred form of the compound of the invention, the present invention comprehends other families of compounds, including, but not limited to oligonucleotide analogs and mimetics.
  • Additional antisense compounds contemplated for use in the compositions and methods of the invention include but are not limited to, oligonucleotides containing modified backbones (e.g., with or without a phosphorous atom) or non-natural internucleoside linkages, oligonucleosides, modified oligonucleotide backbones that do not include a phosphorus atom which have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages (e.g., morpholino linkages; siloxane backbones; sulfide, sulfoxide and sulfone backbones; formacetyl and thioformacetyl backbones; methylene formacetyl and thioformacetyl backbones;
  • PNA peptide nucleic acid
  • oligonulceotides having one or more substituted sugar moieties, including but not limited to, one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted C 1 to C 10 alkyl or C 2 to C 10 alkenyl and alkynyl, Locked
  • PNA peptide nucleic acid
  • Nucleic Acids in which the 2'-hydroxyl group is linked to the 3 ' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety
  • oligonucleotides with synthetic and natural nucleobases including but not limited to, 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl (-C ⁇ C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil and
  • nucleobases include tricyclic pyrimidines such as phenoxazine cytidine( 1 H-pyrimido [5 ,4-b] [ 1 ,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1 H-pyrimido [5, 4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone, oligonucleotides chemically linked to primary or secondary hydroxyl groups, including but not limited to, chelating moieties, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, polyethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • the modifications set out above are further described in WO 2007/125173.
  • Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid.
  • contemplated antisense compounds useful in this invention include oligonucleotides containing modified backbones or non-natural internucleoside linkages.
  • oligonucleotides having modified backbones include those that retain a phosphorus atom in the backbone and those that do not have a phosphorus atom in the backbone.
  • modified oligonucleotides that do not have a phosphorus atom in their internucleoside backbone can also be considered to be oligonucleosides.
  • Contemplated modified oligonucleotide backbones containing a phosphorus atom therein include, for example, phosphorothioates, chiral phosphorothioates, phosphorodithioates, phosphotriesters, aminoalkylphosphotriesters, methyl and other alkyl phosphonates including 3'-alkylene phosphonates, 5'-alkylene phosphonates and chiral phosphonates, phosphinates, phosphoramidates including 3 '-amino phosphoramidate and aminoalkylphosphoramidates, thionophosphoramidates, thionoalkylphosphonates, thionoalkylphosphotriesters, selenophosphates and boranophosphates having normal 3 '-5' linkages, 2'-5' linked analogs of these, and those having inverted polarity wherein one or more internucleotide linkages is a 3' to 3', 5' to 5' or
  • Contemplated oligonucleotides having inverted polarity comprise a single 3' to 3' linkage at the 3'-most internucleotide linkage i.e. a single inverted nucleoside residue which may be abasic (the nucleobase is missing or has a hydroxyl group in place thereof).
  • Various salts, mixed salts and free acid forms are also included.
  • Representative United States patents that teach the preparation of the above phosphorus-containing linkages include, but are not limited to, U.S.: 3,687,808; 4,469,863; 4,476,301; 5,023,243; 5,177,196; 5,188,897; 5,264,423; 5,276,019; 5,278,302; 5,286,717; 5,321,131; 5,399,676; 5,405,939; 5,453,496; 5,455,233; 5,466,677; 5,476,925; 5,519,126; 5,536,821; 5,541,306; 5,550,111; 5,563,253; 5,571,799; 5,587,361; 5,194,599; 5,565,555; 5,527,899; 5,721,218; 5,672,697 and 5,625,050, each of which is herein incorporated by reference.
  • Contemplated modified oligonucleotide backbones that do not include a phosphorus atom therein have backbones that are formed by short chain alkyl or cycloalkyl internucleoside linkages, mixed heteroatom and alkyl or cycloalkyl internucleoside linkages, or one or more short chain heteroatomic or heterocyclic internucleoside linkages.
  • morpholino linkages formed in part from the sugar portion of a nucleoside
  • siloxane backbones sulfide, sulfoxide and sulfone backbones
  • formacetyl and thio formacetyl backbones methylene formacetyl and thio formacetyl backbones
  • riboacetyl backbones alkene containing backbones; sulfamate backbones; methyleneimino and methylenehydrazino backbones; sulfonate and sulfonamide backbones; amide backbones; and others having mixed N, O, S and CH2 component parts.
  • Representative United States patents that teach the preparation of the above oligonucleosides include, but are not limited to, U.S.: 5,034,506; 5,166,315; 5,185,444; 5,214,134; 5,216,141; 5,235,033; 5,264,562; 5,264,564; 5,405,938; 5,434,257; 5,466,677; 5,470,967; 5,489,677; 5,541,307; 5,561,225; 5,596,086; 5,602,240; 5,610,289; 5,602,240; 5,608,046; 5,610,289; 5,618,704; 5,623,070; 5,663,312; 5,633,360; 5,677,437; 5,792,608;
  • both the sugar and the internucleoside linkage (i.e. the backbone), of the nucleotide units are replaced with novel groups.
  • the nucleobase units are maintained for hybridization with an appropriate target nucleic acid.
  • an oligonucleotide mimetic that has been shown to have excellent hybridization properties, is referred to as a peptide nucleic acid (PNA).
  • PNA peptide nucleic acid
  • the sugar-backbone of an oligonucleotide is replaced with an amide containing backbone, in particular an aminoethylglycine backbone.
  • nucleobases are retained and are bound directly or indirectly to aza nitrogen atoms of the amide portion of the backbone.
  • Representative United States patents that teach the preparation of PNA compounds include, but are not limited to, U.S.: 5,539,082; 5,714,331; and 5,719,262, each of which is herein incorporated by reference. Further teaching of PNA compounds can be found in Nielsen et al, Science, 1991, 254:1497-1500.
  • Certain embodiments of the invention are oligonucleotides with phosphorothioate backbones and oligonucleosides with heteroatom backbones, and in particular -CH2-NH-O-CH2-, -CH2-N(CH3)-O-CH2- [known as a methylene (methylimino) or MMI backbone], -CH2-O-N(CH3)-CH2-, -CH2-N(CH3)-N(CH3)-CH2- and -O-N(CH3)-CH2-CH2- (wherein the native phosphodiester backbone is represented as -O-P-O-CH2-) of the above referenced U.S.
  • Modified sugars may also contain one or more substituted sugar moieties.
  • Contemplated oligonucleotides comprise one of the following at the 2' position: OH; F; O-, S-, or N-alkyl; O-, S-, or N-alkenyl; O-, S- or N-alkynyl; or O-alkyl-0-alkyl, wherein the alkyl, alkenyl and alkynyl may be substituted or unsubstituted Cl to ClO alkyl or C2 to ClO alkenyl and alkynyl.
  • Particularly preferred are O[(CH2)nO]mCH3, O(CH2)nOCH3, O(CH2)nNH2, O(CH2)nCH3, O(CH2)nONH2, and
  • oligonucleotides comprise one of the following at the 2' position: Cl to ClO lower alkyl, substituted lower alkyl, alkenyl, alkynyl, alkaryl, aralkyl, O-alkaryl or O-aralkyl, SH, SCH3, OCN, Cl, Br, CN, CF3, OCF3, SOCH3, SO2CH3, ONO2, NO2, N3, NH2, heterocycloalkyl, heterocycloalkaryl, aminoalkylamino, polyalkylamino, substituted silyl, an RNA cleaving group, a reporter group, an intercalator, a group for improving the pharmacokinetic properties of an oligonucleotide, or a group for improving the pharmacodynamic properties of an oligonucleotide, and other substituents having similar properties.
  • a contemplated modification includes 2'-methoxyethoxy (2'-O- CH2CH2OCH3, also known as 2'-O-(2-methoxyethyl) or 2'-MOE) (Martin et al, HeIv. Chim. Acta, 1995, 78, 486-504) i.e., an alkoxyalkoxy group.
  • a further contemplated modification includes 2'-dimethylaminooxyethoxy, i.e., a O(CH2)2ON(CH3)2 group, also known as 2'-DMAOE, as described in examples hereinbelow, and T- dimethylaminoethoxyethoxy (also known in the art as 2'-O-dimethyl-amino-ethoxy-ethyl or 2'-DMAEOE), i.e., 2'-O-CH2-O-CH2-N(CH3)2, also described in examples hereinbelow.
  • the 2'-modification may be in the arabino (up) position or ribo (down) position.
  • a preferred 2'-arabino modification is 2'-F.
  • Oligonucleotides may also have sugar mimetics such as eye Io butyl moieties in place of the pentofuranosyl sugar.
  • a further preferred modification of the sugar includes Locked Nucleic Acids (LNAs) in which the 2'-hydroxyl group is linked to the 3' or 4' carbon atom of the sugar ring, thereby forming a bicyclic sugar moiety.
  • the linkage is preferably a methylene (- CH2-)n group bridging the T oxygen atom and the 4' carbon atom wherein n is 1 or 2.
  • LNAs and preparation thereof are described in WO 98/39352 and WO 99/14226. Natural and Modified Nucleobases
  • Oligonucleotides may also include nucleobase (often referred to in the art simply as “base”) modifications or substitutions.
  • nucleobases include the purine bases adenine (A) and guanine (G), and the pyrimidine bases thymine (T), cytosine (C) and uracil (U).
  • Modified nucleobases include other synthetic and natural nucleobases such as 5-methylcytosine (5-me-C), 5- hydroxymethyl cytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-methyl and other alkyl derivatives of adenine and guanine, 2-propyl and other alkyl derivatives of adenine and guanine, 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-halouracil and cytosine, 5- propynyl (-C ⁇ C-CH3) uracil and cytosine and other alkynyl derivatives of pyrimidine bases, 6-azo uracil, cytosine and thymine, 5-uracil (pseudouracil), 4-thiouracil, 8-halo, 8- amino, 8-thiol, 8-thioalkyl, 8-hydroxyl and other 8-substituted adenines and guanines,
  • nucleobases include tricyclic pyrimidines such as phenoxazine cytidine( 1 H-pyrimido [5 ,4-b] [ 1 ,4]benzoxazin-2(3H)-one), phenothiazine cytidine (1 H-pyrimido [5, 4-b][l,4]benzothiazin-2(3H)-one), G-clamps such as a substituted phenoxazine cytidine (e.g.
  • nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in United States Patent No. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, pages 858-859,
  • Conjugates [00152] Another modification of the oligonucleotides of the invention involves chemically linking to the oligonucleotide one or more moieties or conjugates which enhance the activity, cellular distribution or cellular uptake of the oligonucleotide. These moieties or conjugates can include conjugate groups covalently bound to functional groups such as primary or secondary hydroxyl groups.
  • Conjugate groups of the invention include chelating moieties, intercalators, reporter molecules, polyamines, polyamides, polyethylene glycols, poly ethers, groups that enhance the pharmacodynamic properties of oligomers, and groups that enhance the pharmacokinetic properties of oligomers.
  • Typical conjugate groups include cholesterols, lipids, phospholipids, biotin, phenazine, folate, phenanthridine, anthraquinone, acridine, fluoresceins, rhodamines, coumarins, and dyes.
  • Groups that enhance the pharmacodynamic properties include groups that improve uptake, enhance resistance to degradation, and/or strengthen sequence-specific hybridization with the target nucleic acid.
  • Groups that enhance the pharmacokinetic properties include groups that improve uptake, distribution, metabolism or excretion of the compounds of the present invention. Representative conjugate groups are disclosed in International Patent
  • Conjugate moieties include but are not limited to lipid moieties such as a cholesterol moiety, cholic acid, a thioether, e.g., hexyl-S-tritylthiol, a thiocholesterol, an aliphatic chain, e.g., dodecandiol or undecyl residues, a phospholipid, e.g., di-hexadecyl- rac-glycerol or triethylammonium l ⁇ -di-O-hexadecyl-rac-glycero-S-H-phosphonate, a polyamine or a polyethylene glycol chain, or adamantane acetic acid, a palmityl moiety, or an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety.
  • lipid moieties such as a cholesterol moiety, cholic acid, a
  • Oligonucleotides of the invention may also be conjugated to active drug substances, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fenbufen, ketoprofen, (S)-(+)-pranoprofen, carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indomethicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic. Oligonucleotide-drug conjugates and their preparation are described in United States Patent Application
  • Representative United States patents that teach the preparation of such oligonucleotide conjugates include, but are not limited to, U.S.: 4,828,979; 4,948,882; 5,218,105; 5,525,465; 5,541,313; 5,545,730; 5,552,538; 5,578,717, 5,580,731; 5,580,731; 5,591,584; 5,109,124; 5,118,802; 5,138,045; 5,414,077; 5,486,603; 5,512,439; 5,578,718; 5,608,046; 4,587,044; 4,605,735; 4,667,025; 4,762,779; 4,789,737; 4,824,941; 4,835,263; 4,876,335; 4,904,582; 4,958,013; 5,082,830; 5,112,963; 5,214,136; 5,082,830; 5,112,963; 5,214,136; 5,245,022; 5,25
  • antisense inhibition is typically based upon hydrogen bonding-based hybridization of oligonucleotide strands or segments such that at least one strand or segment is cleaved, degraded, or otherwise rendered inoperable. In this regard, it is presently preferred to target specific nucleic acid molecules and their functions for such antisense inhibition.
  • the functions of DNA to be inhibited include replication and transcription.
  • Replication and transcription for example, can be from an endogenous cellular template, a vector, a plasmid construct or otherwise.
  • the functions of RNA to be interfered with can include functions such as translocation of the RNA to a site of protein translation, translocation of the RNA to sites within the cell which are distant from the site of RNA synthesis, translation of protein from the RNA, splicing of the RNA to yield one or more RNA species, and catalytic activity or complex formation involving the RNA which may be engaged in or facilitated by the RNA.
  • modulation and modulation of expression mean either an increase (stimulation) or a decrease (inhibition) in the amount or levels of a nucleic acid molecule encoding the gene, e.g., DNA or RNA. Inhibition is often the preferred form of modulation of expression and mRNA is often a preferred target nucleic acid.
  • hybridization means the pairing of complementary strands of oligomeric compounds.
  • the preferred mechanism of pairing involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds.
  • hydrogen bonding which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleoside or nucleotide bases (nucleobases) of the strands of oligomeric compounds.
  • nucleobases nucleoside or nucleotide bases
  • adenine and thymine are complementary nucleobases which pair through the formation of hydrogen bonds.
  • Hybridization can occur under varying circumstances.
  • An antisense compound is specifically hybridizable when binding of the compound to the target nucleic acid interferes with the normal function of the target nucleic acid to cause a loss of activity, and there is a sufficient degree of complementarity to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences under conditions in which specific binding is desired, i.e., under physiological conditions in the case of in vivo assays or therapeutic treatment, and under conditions in which assays are performed in the case of in vitro assays.
  • stringent conditions refers to conditions under which a compound of the invention will hybridize to its target sequence, but to a minimal number of other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances and in the context of this invention, "stringent conditions" under which oligomeric compounds hybridize to a target sequence are determined by the nature and composition of the oligomeric compounds and the assays in which they are being investigated.
  • One exemplary set of conditions is as follows: Hybridization at 42°C in 50% formamide, 5X SSC, 20 mM Na » PO 4 , pH 6.8; and washing in IX SSC at 55°C for 30 minutes. Formulas for calculating equivalent hybridization conditions and/or selecting other conditions to achieve a desired level of stringency are well known.
  • Complementary refers to the capacity for precise pairing between two nucleobases of an oligomeric compound. For example, if a nucleobase at a certain position of an oligonucleotide (an oligomeric compound), is capable of hydrogen bonding with a nucleobase at a certain position of a target nucleic acid, said target nucleic acid being a DNA, RNA, or oligonucleotide molecule, then the position of hydrogen bonding between the oligonucleotide and the target nucleic acid is considered to be a complementary position.
  • oligonucleotide and the further DNA, RNA, or oligonucleotide molecule are complementary to each other when a sufficient number of complementary positions in each molecule are occupied by nucleobases which can hydrogen bond with each other.
  • “specifically hybridizable” and “complementary” are terms which are used to indicate a sufficient degree of precise pairing or complementarity over a sufficient number of nucleobases such that stable and specific binding occurs between the oligonucleotide and a target nucleic acid.
  • an antisense compound need not be 100% complementary to that of its target nucleic acid to be specifically hybridizable.
  • an oligonucleotide may hybridize over one or more segments such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure or hairpin structure).
  • the oligonucleotide portion of the compounds of the present invention comprise at least 70% sequence complementarity to a target region within the target nucleic acid, more preferably that they comprise at least 85% or 90% sequence complementarity, and may comprise at least 95%, 96%, 97%, 98% or 99% sequence complementarity to the target region within the target nucleic acid sequence to which they are targeted.
  • a compound of the present invention in which 18 of 20 nucleobases of the compound are complementary to a target region, and would therefore specifically hybridize would represent 90 percent complementarity.
  • the remaining noncomplementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases.
  • a compound which is 18 nucleobases in length having 4 (four) noncomplementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention.
  • Percent complementarity of a compound with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul et al, J. MoI. Biol, 1990, 215:403-410; Zhang et al, Genome Res., 1997, 7:649-656).
  • BLAST programs basic local alignment search tools
  • PowerBLAST programs known in the art
  • complementarity can be assessed by the synthetic analogs specificity for a particular nucleobase of the target nucleic acid.
  • antisense compound is a single-stranded antisense oligonucleotide
  • dsRNA double-stranded RNA
  • RNA interference RNA interference
  • the compounds described herein are used in vitro or in vivo for limiting the gene expression and proliferation of pathogens such as viruses, including viruses with DNA genomes, RNA genomes and viruses using reverse transcription.
  • the compounds may be administered to an organism which is subject to or in a diseased state.
  • the compounds may be used to treat infection by a variety of pathogens.
  • "treat” refers to administration of the olgonucleotides of the invention to a subject in need in a dosage/amount sufficient to produce a desired result on a health condition, pathology, and disease of a subject or for a diagnostic purpose.
  • the desired result may comprise a subjective or objective improvement in the recipient of the dosage.
  • Treatment refers to prophylactic treatment or therapeutic treatment or diagnostic treatment.
  • a "subject” of diagnosis or treatment is a human or non-human animal, including a mammal or a primate.
  • a “Therapeutically effective amount” refers to that amount of a composition effective to produce the intended beneficial effect on health.
  • the compounds may be used to modulate the function of immune system cells such as specific B-cells; specific T-cells, such as helper cells, suppressor cells, cytotoxic T- lymphocytes (C), and natural killer (NK) cells. Modulation of immune function using the compounds of the present invention can be useful in treatment of a variety of diseases such as chronic diseases caused by viral pathogens.
  • the compounds may be selected which are capable of interfering with transcription and/or expression of proteins by any of the mechanisms involved with the binding of the oligonucleotide of the compound to its target sequence. These mechanisms include, but are not limited to, interference with processing, inhibition of transport across the nuclear membrane, cleavage by endonucleases, formation of replicase complexes or the like.
  • the compounds described herein may be used in the treatment of infectious diseases.
  • the target nucleic acid sequences include, but are not limited to, those genes of pathogenic viruses such as HIV, CMV, HSV, HCV, etc., as well as genes encoding host factors for these viruses or otherwise involved in disease development and/or progression.
  • the target nucleic acid sequences can be DNA or RNA associated with oncogenes or viruses with oncogenic properties, tumor suppressor genes, and related genes. Additionally, the compounds of the present invention may also target genes associated with drug resistance and their gene products.
  • the targeting process usually also includes determination of at least one target region, segment, or site within the target nucleic acid for the antisense interaction to occur such that the desired effect, e.g., modulation of expression, will result.
  • region refers to a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.
  • regions of target nucleic acids are segments.
  • Segments refers to smaller or sub-portions of regions within a target nucleic acid.
  • Sites refer to positions within a target nucleic acid.
  • compositions describd herein are used in combination to hybridize to two different regions or segments within the same viral genome.
  • a target the considerations include: localization of the target in a region of the viral genome which is important for virus multiplication (target must be essential region). If possible a preferred target should be in a region which is conserved among different strains and genotypes of the virus (often this also indicates the functional significance of the sequences).
  • the regions encoding highly conserved domains of proteins are good targets; also the regions containing overlapping functional elements (coding sequences overlapping with cis-active elements) are good targets.
  • the target site should have a nucleotide composition that enables construction of an oligonucleotide inhibitor with desirable nucleotide content and/or composition of modified nucleobases, and preferably the target does not contain strong secondary structural elements. Further, the sequence of the target should not overlap with that of essential host genes, especially host mRNAs. Additionally, the positions of modified nucleobases should not match a host sequence. The cluster of C or G nucleotides (three or more) should be avoided. Experiments have shown that target sites inside coding regions are better than those in non-coding regions and that in the case of RNA viruses, the positive strand is a better target than the negative strand.
  • RNAse or DNAse complex Due to the unique mechanism of nucleic acid destruction (e.g., by RNAse or DNAse complex) it is not necessary to target the modified oligonucleotide to the translation initiation sequence. This is in contrast to the case of morpholino oligonucleotides, which cannot initiate RNA degradation and are most (or exclusively) effective if targeted to the regions containing an initiation codon for translation. Such restriction does not exist for the currently described modified oligonucleotides.
  • each site should satisfy several of the criteria set out above. Sequences of the targets should be different and not complementary to each other to avoid aggregation of the oligonucleotide and the targets could represent different sequences from one and the same functional unit, for example from the same enzyme, or, from different units. In most cases the second option is the preferred to minimize the possibility of generation of resistant mutations.
  • the term "functional unit" refers to a polypeptide or polynucleotide sequence having a function in viral replication or gene expression, e.g., different replication factors, transcription factors, etc.
  • Oligonucleotides that bind the same functional units bind different target sequences but in the same polypeptide or polynucleotide functional unit, e.g., within the HIV Tat protein. Oligonucleotides contemplated by the invention that bind different functional units bind to polypeptide or polynucleotide having different functions in viral replication or gene expression, e.g., HIV Tat andRev genes or proteins.
  • a functional unit associated with viral replicaion or gene expression can readily understand the meaning of a functional unit associated with viral replicaion or gene expression.
  • the translation initiation codon is typically 5' AUG (in transcribed mRNA molecules; 5' ATG in the corresponding DNA molecule), the translation initiation codon is also referred to as the "AUG codon,” the “start codon” or the “AUG start codon”.
  • a minority of genes have a translation initiation codon having the RNA sequence 5' GUG, 5' UUG or 5' CUG, and 5' AUA, 5' ACG and 5' CUG have been shown to function in vivo.
  • translation initiation codon and “start codon” can encompass many codon sequences, even though the initiator amino acid in each instance is typically methionine (in eukaryotes) or formylmethionine (in prokaryotes). It is also known in the art that eukaryotic and prokaryotic genes may have two or more alternative start codons, any one of which may be preferentially utilized for translation initiation in a particular cell type or tissue, or under a particular set of conditions.
  • start codon and “translation initiation codon” refer to the codon or codons that are used in vivo to initiate translation of an mRNA transcribed from a gene encoding Interleukin 18, regardless of the sequence(s) of such codons. It is also known in the art that a translation termination codon (or "stop codon") of a gene may have one of three sequences, i.e., 5' UAA, 5' UAG and 5' UGA (the corresponding DNA sequences are 5' TAA, 5' TAG and 5' TGA, respectively).
  • start codon region and “translation initiation codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation initiation codon.
  • stop codon region and “translation termination codon region” refer to a portion of such an mRNA or gene that encompasses from about 25 to about 50 contiguous nucleotides in either direction (i.e., 5' or 3') from a translation termination codon. Consequently, the "start codon region” (or “translation initiation codon region”) and the “stop codon region” (or “translation termination codon region”) are all regions which may be targeted effectively with the antisense compounds of the present invention.
  • a preferred region is the intragenic region encompassing the translation initiation or termination codon of the open reading frame (ORF) of a gene.
  • target regions include the 5' untranslated region (5'UTR), known in the art to refer to the portion of an mRNA in the 5' direction from the translation initiation codon, and thus including nucleotides between the 5' cap site and the translation initiation codon of an mRNA (or corresponding nucleotides on the gene), and the 3' untranslated region (3'UTR), known in the art to refer to the portion of an mRNA in the 3' direction from the translation termination codon, and thus including nucleotides between the translation termination codon and 3' end of an mRNA (or corresponding nucleotides on the gene).
  • 5'UTR 5' untranslated region
  • 3'UTR 3' untranslated region
  • the 5' cap site of an mRNA comprises an N7-methylated guanosine residue joined to the 5'-most residue of the mRNA via a 5'-5' triphosphate linkage.
  • the 5' cap region of an mRNA is considered to include the 5' cap structure itself as well as the first 50 nucleotides adjacent to the cap site. It is also preferred to target the 5' cap region.
  • introns regions which are excised from a transcript before it is translated.
  • exons regions which are excised from a transcript before it is translated.
  • targeting splice sites i.e., intron-exon junctions or exon-intron junctions may also be particularly useful in situations where aberrant splicing is implicated in disease, or where an overproduction of a particular splice product is implicated in disease. Aberrant fusion junctions due to rearrangements or deletions are also preferred target sites.
  • RNA transcripts produced via the process of splicing of two (or more) mRNAs from different gene sources are known as "fusion transcripts.” It is also known that introns can be effectively targeted using antisense compounds targeted to, for example, DNA or pre-mRNA.
  • Alternative RNA transcripts can be produced from the same genomic region of DNA. These alternative transcripts are generally known as "variants”. More specifically, “pre-mRNA variants” are transcripts produced from the same genomic DNA that differ from other transcripts produced from the same genomic DNA in either their start or stop position and contain both intronic and exonic sequence.
  • pre-mRNA variants Upon excision of one or more exon or intron regions, or portions thereof during splicing, pre-mRNA variants produce smaller "mRNA variants.” Consequently, mRNA variants are processed pre-mRNA variants and each unique pre-mRNA variant must always produce a unique mRNA variant as a result of splicing. These mRNA variants are also known as "alternative splice variants.” If no splicing of the pre-mRNA variant occurs then the pre-mRNA variant is identical to the mRNA variant.
  • Variants can be produced through the use of alternative signals to start or stop transcription and pre-mRNAs and mRNAs can possess more than one start codon or stop codon.
  • Variants that originate from a pre-mRNA or mRNA that use alternative start codons are known as "alternative start variants" of that pre-mRNA or mRNA.
  • Those transcripts that use an alternative stop codon are known as “alternative stop variants” of that pre- mRNA or mRNA.
  • One specific type of alternative stop variant is the "polyA variant” in which the multiple transcripts produced result from the alternative selection of one of the "polyA stop signals" by the transcription machinery, thereby producing transcripts that terminate at unique polyA sites.
  • the types of variants described herein are also preferred target nucleic acids.
  • RNA viruses contain fragments of their genomes used for the initiation of the synthesis of new genomic strands. Their segments are designated as replication origins and are variable by structure, number (copies per genome) and by mode of action.
  • replication origins typically contain sequences of both ends of RNA molecule.
  • the sequence of replication origin is typically recognized by virus-encoded proteins, called origin recognition factors which are involved in initiation of replication and, in many cases, performing the replication process (in the latter case they are designated as
  • Viral replicases can consist almost completely from virus encoded proteins (as in case of HSV), from host- and viral subunits or be mostly encoded by host cells.
  • Cis-acting sequences may have specific primary and/or secondary structure required for their functioning and these elements can be located in different positions of viral genomes (including in coding sequences). Cis -acting elements may overlap with each other as well as with coding sequences encoding corresponding trans-acting factors.
  • RNA viruses with single stranded genomes the genome can be represented by the coding mRNA sequence (positive- strand RNA viruses) or by RNA complementary to that strand, packed into nucleocapsid protein (negative strand RNA viruses). During the replication in cells these viruses synthesize the RNA with opposite polarity defined as "antigenome” which is negative RNA for positive-strand RNA viruses and positive RNA for negative-strand RNA viruses. This strand may form a duplex with the genomic RNA (positive strand viruses) or not (negative strand RNA viruses). The duplex between positive- and negative-strands is defined as "replicating form” or “replicating intermediate” and, in the cells infected by positive-strand RNA viruses, it is bound to replicase proteins and cellular membranes.
  • preferred target segments are herein below referred to as "preferred target segments.”
  • preferred target segment is defined as at least a 5-nucleobase portion of a target region to which an active antisense compound is targeted. While not wishing to be bound by theory, it is presently believed that these target segments represent portions of the target nucleic acid which are accessible for hybridization.
  • Target segments 5-150 nucleobases in length comprising a stretch of at least five consecutive nucleobases selected from within the illustrative preferred target segments are considered to be suitable for targeting as well.
  • Target segments can include DNA or RNA sequences that comprise at least the 5 consecutive nucleobases from the 5 '-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately upstream of the 5 '-terminus of the target segment and continuing until the DNA or RNA contains about 5 to about 150 nucleobases).
  • preferred target segments are represented by DNA or RNA sequences that comprise at least the 5 consecutive nucleobases from the 3 '-terminus of one of the illustrative preferred target segments (the remaining nucleobases being a consecutive stretch of the same DNA or RNA beginning immediately downstream of the 3 '-terminus of the target segment and continuing until the DNA or RNA contains about 5 to about 150 nucleobases).
  • preferred target segments illustrated herein will be able, without undue experimentation, to identify further preferred target segments.
  • antisense compounds are synthesized which are sufficiently complementary to the target, i.e., hybridize sufficiently well and with sufficient specificity, to give the desired effect, and incorporate at least one hydroxynucleobase or mercaptonucleobase which is complementary to a nucleobase in the sequence of the target regeion, segment, or site, and further incorporates a chelating moiety as described herein.
  • the antisense compound is then contacted with an ion of a metal to allow for complexation of the ion to the compound. This resulting compound can then be used in antisense therapy mechanisms.
  • Alphaviruses are an example of a RNA virus that causes acute infection.
  • Mosquitos, birds and different mammals can all become infected by Semliki Forest virus (SFV).
  • SFV Semliki Forest virus
  • the genome of SFV is positive strand RNA approximately 11.5 kb in length. It contains two large open reading frames (ORFs) - one at the 5 ' region and another at 3 ' region (Fig. 1).
  • the first ORF encodes non-structural proteins - the viral subunits of RNA replication system.
  • the second ORF encodes virion proteins and is not needed for the RNA replication as such. Genomes of all known alphaviruses are organized in a similar manner.
  • SFV replicates in the cytoplasm of infected cells; the replication process takes place on cellular membranes of endosomal and lysosomal origin. Typically the infection in mammalian cells leads to the almost complete shutdown of cellular RNA and protein synthesis and results in death of the infected cell at 12-24 h post infection. Thus, SFV is generally a highly cytotoxic and rapid virus.
  • SFV proteins can be monitored by use of SFV genomes with marker genes (Renilla Luciferase, Rluc) inserted in structural or nonstructural regions; the expression level of marker in infected cells is proportional to the copy number of viral RNAs (genomic RNAs if the marker is inserted in a non-structural region and subgenomic RNAs if the marker is inserted in a structural region) in infected cells (Kiiver et al., 2008).
  • the monitoring of the Rluc activity by using EnduRen or any other appropriate substrate provides adequate information about the viral replication (accumulation of viral RNAs and proteins) in infected cells.
  • Hepatitis C virus is an example of a RNA virus that causes chronic infection.
  • HCV is non-cytopathic member of the family Flaviviridae. It has positive sense RNA genome about 9.6 kb in length. HCV genome lacks 5' cap, but instead it carries an internal ribosomal entry site (IRES) within the 5'-UTR. HCV genome encodes for a single polyprotein, which becomes proteolytically cleaved into 10 individual proteins: four structural proteins and six non-structural proteins. Five of these non-structural proteins are required for replication of the HCV genome. The replication occurs in the cytoplasm of infected cells, where viral proteins and RNA together with cellular factors form a "membranous web" which serves as scaffold for the genome in replication complex. HCV replication is asymmetric (positive strands are more abundant). HCV virions are assembled on ER membranes and exit the cell through the secretory pathway. HCV does not induce general shutdown of host cell metabolism or cell death; instead it induces highly specific shutdown of the cellular anti- viral mechanisms.
  • HCV replication-deficient genomes are used as negative controls.
  • HCV Ib The initial stages of HCV infection are difficult to reproduce in cell culture. Only limited HCV variants are capable to infect cultivated cells (JFHl from genotype 2 and few recombinats based on the JFHl); so far it is not reported for the medically most important Ib genotype.
  • the initial stages of infection of HCV Ib can be modeled, however, by using hybrid viruses containing a replicase part of non-cyto toxic mutant of SFV (Tamm et al, 1 : J Gen Virol. 89:676-86, 2008) with inserted Rluc reporter and fragments of HCV replicase region cloned under the control of subgenomic promoter of SFV. These hybrid genomes can be packed into virus like particles with SFV structural proteins and used for infection of huh7 cells treated with anti-HCV and/or anti SFV compounds.
  • HIV-I as an example of a pathogenic retrovirus.
  • HIV-I belongs to genus Lentivirus, family Retroviridae. The genome organization of HIV-I is more complex than that of simple retroviruses.
  • Genomic RNA of HIV is about 9 kb long and contains several genes. Some of these genes are expressed directly from the genome-size RNA, others are expressed by well-regulated alternative splicing.
  • the gene expression of HIV is regulated by both viral and host factors.
  • the best known viral regulators are Tat (transcriptional activator) and Rev (regulator of splicing and nuclear export). These proteins are expressed from the spliced RNA transcripts and their expression activates the subsequent transcription (Tat activity) and changes splicing pattern (Rev activity).
  • Tat-mediated activation of the HIV promoter is a model system which can be used for evaluation of antiviral compounds.
  • activation requires the interaction of HIV-encoded Tat-protein and Tar-element in viral mRNA.
  • Tat protein Without Tat protein, the transcription from the HIV promoter is very inactive and inclusion of Tat activates the promoter 300-fold. As a consequence, no active HIV gene expression can take place in the absence of Tat and Tar elements.
  • the system for analysis is based on the Tat-activation of Tar-containing HIV promoter and contains the luciferase marker gene cloned under the control of HIV promoter (LTR) and this construct has been used to construct a stable Jurkat cell line.
  • the expression of the luciferase marker takes place at a very low basal level.
  • the expression can be activated by use of the Tat gene from B-clade virus HAN-2, delivered to these reporter cells by transfection. This process can be repressed by antiviral oligonucleotides.
  • Papillomaviruses as example of viruses with DNA genomes.
  • Papillomaviruses are a group of small non-enveloped viruses with circular double-stranded DNA genomes.
  • the replication cycle of papillomaviruses correlates strictly with development of epithelial tissue; virus maturates only in mature epithelial cells. In cells not developed to terminal stage, the papillomavirus genome replicates as a high copy (50-400 copies) per cell extrachromosomal plasmid.
  • the DNA genome of papillomavirus is approximately 8 kbp long and encodes 10-12 proteins and replicates in the nucleus of the infected cell. The replication depends from two virus encoded proteins, El and E2.
  • E2 is also involved in the regulation of viral gene expression.
  • the effects of the modified oligonucleotides on papillomavirus replication can be analyzed by monitoring the E2-mediated activation of gene expression.
  • the reporter gene firefly luciferase, Luc
  • E2 encoding plasmid By co -transfection of this reporter plasmid with E2 encoding plasmid the activation effect (and its modulation by antiviral oligonucleotides) can be measured.
  • Analysis of BPV replication in cells is another model for analysis of the effects of antiviral compounds.
  • the viral copy number can be analyzed by quantitative PCR or Southern blotting.
  • the compounds of the invention may also be admixed, encapsulated, conjugated or otherwise associated with other molecules, molecule structures or mixtures of compounds, as for example, liposomes, carriers, diluents, receptor-targeted molecules, oral, rectal, topical or other formulations, for assisting in uptake, distribution and/or absorption.
  • the antisense compounds of the invention encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other compound which, upon administration to an animal, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Accordingly, for example, the disclosure is also drawn to prodrugs and pharmaceutically acceptable salts of the compounds of the invention, pharmaceutically acceptable salts of such prodrugs, and other bioequivalents. [00201]
  • prodrug indicates a therapeutic agent that is prepared in an inactive form that is converted to an active form (i.e., drug) within the body or cells thereof by the action of endogenous enzymes or other chemicals and/or conditions.
  • prodrug versions of the oligonucleotides of the invention are prepared as SATE ((S acetyl-2- thioethyl) phosphate) derivatives according to the methods disclosed in WO 93/24510 to Gosselin et al, published December 9, 1993 or in WO 94/26764 and U.S. 5,770,713 to Imbach et al.
  • SATE (S acetyl-2- thioethyl) phosphate
  • compositions and formulations which include the antisense compounds of the invention.
  • the pharmaceutical compositions of the present invention may be administered in a number of ways depending upon whether local or systemic treatment is desired and upon the area to be treated.
  • Administration may be topical (including ophthalmic and to mucous membranes including vaginal and rectal delivery), pulmonary, e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer; intratracheal, intranasal, epidermal and transdermal), oral or parenteral.
  • Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal or intramuscular injection or infusion; or intracranial, e.g., intrathecal or intraventricular, administration.
  • Oligonucleotides with at least one 2'-O-methoxyethyl modification are believed to be particularly useful for oral administration.
  • compositions and formulations for topical administration may include transdermal patches, ointments, lotions, creams, gels, drops, suppositories, sprays, liquids and powders.
  • Conventional pharmaceutical carriers, aqueous, powder or oily bases, thickeners and the like may be necessary or desirable.
  • Coated condoms, gloves and the like may also be useful.
  • the pharmaceutical formulations of the present invention may be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of bringing into association the active ingredients with the pharmaceutical carrier(s) or excipient(s). In general, the formulations are prepared by uniformly and intimately bringing into association the active ingredients with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product.
  • compositions of the present invention may be formulated into any of many possible dosage forms such as, but not limited to, suspensions in aqueous, non-aqueous or mixed media.
  • Aqueous suspensions may further contain substances which increase the viscosity of the suspension including, for example, sodium carboxymethylcellulose, sorbitol and/or dextran.
  • the suspension may also contain stabilizers.
  • compositions useful in the present invention include, but are not limited to, solutions, emulsions, foams and liposome-, micelle-, or nanoparticle-containing formulations.
  • the pharmaceutical compositions and formulations of the present invention may comprise one or more penetration enhancers, carriers, excipients, diluents, or other active or inactive ingredients.
  • Emulsions are typically heterogenous systems of one liquid dispersed in another in the form of droplets usually exceeding 0.1 ⁇ m in diameter. Emulsions may contain additional components in addition to the dispersed phases and the active drug which may be present as a solution in either the aqueous phase, oily phase or itself as a separate phase.
  • Microemulsions are included as an embodiment of the present invention. Emulsions and their uses are well known in the art and are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • Formulations useful in the present invention include liposomal formulations.
  • liposome means a vesicle composed of amphiphilic lipids arranged in a spherical bilayer or bilayers. Liposomes are unilamellar or multilamellar vesicles which have a membrane formed from a lipophilic material and an aqueous interior that contains the composition to be delivered. Cationic liposomes are positively charged liposomes which are believed to interact with negatively charged DNA molecules to form a stable complex. Liposomes that are pH sensitive or negatively charged are believed to entrap DNA rather than complex with it. Both cationic and noncationic liposomes have been used to deliver DNA to cells, and can be used to deliver compounds of the invention.
  • Liposomes also include "sterically stabilized" liposomes, a term which, as used herein, refers to liposomes comprising one or more specialized lipids that, when incorporated into liposomes, result in enhanced circulation lifetimes relative to liposomes lacking such specialized lipids.
  • sterically stabilized liposomes are those in which part of the vesicle- forming lipid portion of the liposome comprises one or more gly co lipids or is derivatized with one or more hydrophilic polymers, such as a polyethylene glycol (PEG) moiety.
  • PEG polyethylene glycol
  • Liposomes containing the compositions described herein may also be conjugated or otherwise linked to a cell- penetrating peptide, such that the liposome is targeted into tissue and across a cell mmembrane.
  • Cell-penetrating peptides include the HIV tat peptide, antibodies or binding fragments thereof, biotin, and other compositions known in art (Sawant et al., Bioconjug Chem. 17:943-9 (2006); Sapra et al., Curr Drug Deliv. 2:369-81 (2005)).
  • nanoparticulate pharmaceutical carriers such as micelles and nanoparticles are contemplated for delivery of the compositions desecribed herein in vivo.
  • Techniques for synthesizing and administering such nanopharmaceuticals are known in the art and described for example in Torchilin, VP., (Biopolymers. March 31, 2008), Torchilin,
  • compositions of the present invention may also include surfactants.
  • surfactants used in drug products, formulations and in emulsions is well known in the art. Surfactants and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • the present invention employs various penetration enhancers to affect the efficient delivery of nucleic acids, particularly oligonucleotides.
  • penetration enhancers also enhance the permeability of lipophilic drugs.
  • Penetration enhancers may be classified as belonging to one of five broad categories, i.e., surfactants, fatty acids, bile salts, chelating agents, and non-chelating non-surfactants. Penetration enhancers and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • formulations are routinely designed according to their intended use, i.e. route of administration.
  • Preferred formulations for topical administration include those in which the compounds of the invention are in admixture with a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • a topical delivery agent such as lipids, liposomes, fatty acids, fatty acid esters, steroids, chelating agents and surfactants.
  • Preferred lipids and liposomes include neutral (e.g. dioleoylphosphatidyl DOPE ethanolamine, dimyristoylphosphatidyl choline DMPC, distearolyphosphatidyl choline) negative (e.g. dimyristoylphosphatidyl glycerol DMPG) and cationic (e.g. dioleoyltetramethylaminopropyl DOTAP and dioleoylphosphatidyl ethanolamine DOTMA).
  • neutral e.g. dioleoy
  • compounds of the invention may be encapsulated within liposomes or may form complexes thereto, in particular to cationic liposomes.
  • compounds may be complexed to lipids, in particular to cationic lipids.
  • Preferred fatty acids and esters, pharmaceutically acceptable salts thereof, and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • Topical formulations are described in detail in United States patent application 09/315,298 filed on May 20, 1999, which is incorporated herein by reference in its entirety.
  • compositions and formulations for oral administration include powders or granules, microparticulates, nanoparticulates, suspensions or solutions in water or nonaqueous media, capsules, gel capsules, sachets, tablets or minitablets. Thickeners, flavoring agents, diluents, emulsif ⁇ ers, dispersing aids or binders may be desirable.
  • Preferred oral formulations are those in which compounds of the invention are administered in conjunction with one or more penetration enhancers, surfactants, and chelators.
  • Preferred surfactants include fatty acids and/or esters or salts thereof, bile acids and/or salts thereof. Preferred bile acids/salts and fatty acids and their uses are further described in U.S.
  • Patent 6,287,860 which is incorporated herein in its entirety.
  • penetration enhancers for example, fatty acids/salts in combination with bile acids/salts.
  • a particularly preferred combination is the sodium salt of lauric acid, capric acid and UDCA.
  • Further penetration enhancers include polyoxyethylene-9-lauryl ether, polyoxyethylene-20-cetyl ether.
  • Compounds of the invention may be delivered orally, in granular form including sprayed dried particles, or complexed to form micro or nanoparticles. Complexing agents and their uses are further described in U.S. Patent 6,287,860, which is incorporated herein in its entirety.
  • compositions and formulations for parenteral, intrathecal or intraventricular administration may include sterile aqueous solutions which may also contain buffers, diluents and other suitable additives such as, but not limited to, penetration enhancers, carrier compounds and other pharmaceutically acceptable carriers or excipients.
  • Certain embodiments of the invention provide pharmaceutical compositions containing one or more compounds of the invention and one or more chemotherapeutic agents which function by a non-antisense mechanism.
  • chemotherapeutic agents include but are not limited to cancer chemotherapeutic drugs such as daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubicin, esorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosurea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, hexamethylmelamine, pentamethylmelamine, mitoxantrone, amsacrine, chlorambucil, methylcyclohexyl
  • 5-fluorouracil 5-fluorodeoxyuridine
  • MTX methotrexate
  • colchicine taxol, vincristine, vinblastine, etoposide (VP- 16), trimetrexate, irinotecan, topotecan, gemcitabine, teniposide, cisplatin and diethylstilbestrol (DES).
  • chemotherapeutic agents When used with the compounds of the invention, such chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligonucleotide).
  • chemotherapeutic agents may be used individually (e.g., 5-FU and oligonucleotide), sequentially (e.g., 5-FU and oligonucleotide for a period of time followed by MTX and oligonucleotide), or in combination with one or more other such chemotherapeutic agents (e.g., 5-FU, MTX and oligonucleotide, or 5-FU, radiotherapy and oligon
  • Anti-inflammatory drugs including but not limited to nonsteroidal anti- inflammatory drugs and corticosteroids, and antiviral drugs, including but not limited to ribivirin, vidarabine, acyclovir and ganciclovir, may also be combined in compositions of the invention. Combinations of antisense compounds and other non-antisense drugs are also within the scope of this invention. Two or more combined compounds may be used together or sequentially.
  • compositions of the invention may contain one or more antisense compounds, particularly oligonucleotides, targeted to a first nucleic acid target and one or more additional antisense compounds targeted to a second nucleic acid target.
  • compositions of the invention may contain two or more antisense compounds targeted to different regions of the same nucleic acid target. Numerous examples of antisense compounds are known in the art. Two or more combined compounds may be used together or sequentially.
  • compositions and their subsequent administration are believed to be within the skill of those in the art, and determined, e.g., by dose-response, toxicity, and pharmacokinetic studies. Dosing is dependent on severity and responsiveness of the disease state to be treated, with the course of treatment lasting from several days to several months, or until a cure is effected or a diminution of the disease state is achieved. Dosing may continue indefinitely for chronic disease states or conditions for which diminution but no cure can be achieved. Optimal dosing schedules can be calculated from measurements of drug accumulation in the body of the patient.
  • Optimum dosages may vary depending on the relative potency of individual oligonucleotides, and can generally be estimated based on EC50s found to be effective in in vitro and in vivo animal models. In general, dosage is from 0.01 ⁇ g to 100 g per kg of body weight, and may be given once or more daily, weekly, monthly or yearly, or even once every 2 to 20 years. Persons of ordinary skill in the art can easily estimate repetition rates for dosing based on measured residence times and concentrations of the drug in bodily fluids or tissues.
  • oligonucleotide is administered in maintenance doses, ranging from 0.01 ⁇ g to 100 g per kg of body weight, once or more daily, to once every 20 years.
  • Kits and Diagnostic Tools The compounds of the present invention can be utilized for diagnostics, therapeutics, prophylaxis and as research reagents and kits. Furthermore, antisense oligonucleotides, which are able to inhibit gene expression with exquisite specificity, are often used by those of ordinary skill to elucidate the function of particular genes or to distinguish between functions of various members of a biological pathway. [00222] For use in kits and diagnostics, the compounds of the present invention, either alone or in combination with other compounds or therapeutics, can be used as tools in differential and/or combinatorial analyses to elucidate expression patterns of a portion or the entire complement of genes expressed within cells and tissues.
  • expression patterns within cells or tissues treated with one or more antisense compounds are compared to control cells or tissues not treated with antisense compounds and the patterns produced are analyzed for differential levels of gene expression as they pertain, for example, to disease association, signaling pathway, cellular localization, expression level, size, structure or function of the genes examined. These analyses can be performed on stimulated or unstimulated cells and in the presence or absence of other compounds which affect expression patterns.
  • Examples of methods of gene expression analysis known in the art include DNA arrays or microarrays (Brazma and ViIo, FEBS Lett., 2000, 480:17-24; Celis, et al, FEBS Lett., 2000, 480:2-16), SAGE (serial analysis of gene expression)(Madden, et al., Drug Discov. Today, 2000, 5:415-425), READS (restriction enzyme amplification of digested cDNAs) (Prashar and Weissman, Methods EnzymoL, 1999, 303:258-72), TOGA (total gene expression analysis) (Sutcliffe, et al., Proc. Natl. Acad. Sci.
  • antisense compounds have been employed as therapeutic moieties in the treatment of disease states in animals, including humans.
  • Antisense oligonucleotide drugs including ribozymes, have been safely and effectively administered to humans and numerous clinical trials are presently underway. It is thus established that antisense compounds can be useful therapeutic modalities that can be configured to be useful in treatment regimes for the treatment of cells, tissues and animals, especially humans.
  • a subject preferably a human, suspected of having a disease or disorder which can be treated by modulating the expression of a target nucleic acid is treated by administering antisense compounds in accordance with this invention.
  • the methods comprise the step of administering to the subject in need of treatment, a therapeutically effective amount of an antisense compound.
  • the compounds of the invention can be utilized in pharmaceutical compositions by adding an effective amount of a compound to a suitable pharmaceutically acceptable diluent or carrier. Use of the compounds and methods of the invention may also be useful prophylactically.
  • the compositions are useful to treat uninfected cells to decrease the viral gene expression and replication in these cells.
  • BHK-21 (Baby hamster kidney) cells were grown to confluency on a 35 mm diameter dish, the lipofectamine RNAiMAX (Invitrogen) was used to transfect cells with modified oligonucleotides with or without a metal nuclease (Eu). Transfection was done either at the moment of infection or prior to infection.
  • oligonucleotides were transfected with 30 picomol of oligonucleotides (irrelevant oligonucleotides with or without organic nuclease were used as controls) and infected at multiplicity of infection (moi) 0.05 with reporter virus SFV4 -stRLuc (self-replicating SFV vector with Renilla luciferase inserted into the structural region of the SFV genome).
  • SFV4 -stRLuc self-replicating SFV vector with Renilla luciferase inserted into the structural region of the SFV genome.
  • EnduRen Live Cell Substrate (Promega) was used to detect the R- Luc activity, measurements were done at 1.5, 2, 3, 4, 5, and 8 hours post infection in most experiments (later time-points were used in some experiments as well). Results from the experiment are shown in Table 2.
  • oligonucleotide A8 sense type oligos, target is antisense RNA
  • A6 antisense, target is 5'UTR of SFV
  • A7 oligonucleotides
  • EXAMPLE 2 Use of modified oligonucleotide for inhibition of the Hepatitis C virus [00232] To determine the effects of modified oligonucleotides on viral gene replication, antisense oligonucleotides against Hepatitis C virus (HCV), a slow (chronic) positive strand RNA virus from genus Hepacivirus, family Flaviviridae, were generated and inhibition of the viral genome replication measured.
  • HCV Hepatitis C virus
  • a slow (chronic) positive strand RNA virus from genus Hepacivirus family Flaviviridae
  • NS5B conserved part of the coding region for viral RNA polymerase, the non-structural protein 5B
  • HCV replicons contain Luc-marker gene and were delivered into Lunet cells as RNA transcripts.
  • HCV replicons (genotype Ib) with no selection marker, containing Luc-marker under control of HCV IRES and HCV nonstructural region (NS3- NS5B) with native 3' UTR of virus were used for the assay.
  • cDNAs from corresponding constructs were transcribed in vitro and transfected to huh7/Lunet cells by electroporation together with a modified oligonucleotide compound.
  • the HCV initiates transient replication where the expression of luciferase is proportional to the copy number of HCV genomes.
  • the luciferase activity was measured from 4-96 h post-transfection at 4 hours, 24 hours, 48 hours, 72 hours and 96 hours (in some experiments additional timepoints were also used).
  • the cell culture was split several times during the experiment and the luc- expression level was normalized to the total protein in samples.
  • HIV-I Human Immunodeficiency virus type 1
  • Tat- HIV encoded protein binds to Tar-element and activates the transcription of viral mRNAs and genomes from integrated provirus.
  • Jurkat cell lines with HIV promoter - luciferase reporter constructs were used for these experiments.
  • the activator of expression (Tat expressing plasmid, 5 ng) was delivered into cells together with oligonucleotide inhibitors (100 picomols).
  • the effect(s) of inhibitors were calculated by comparison of the levels of measured luciferase activities (24 hours post-induction). Results from the experiment are shown in Table 6.
  • the HIV-Tat sequence is an effective target for modified antisense oligonucleotides.
  • the inhibitory effect was detected only when the oligonucleotide contained modified bases and was further increased by the presence of RNA nuclease activity.
  • BPVl Eu 5' TAAACGTTCGCATGCTGTCTCCA 3' (SEQ ID NO. 11)
  • BPV replication was measured in CHO cells co-transfected with plasmid containing BPV-I minimal replication origin and expression plasmids for El and E2 proteins. Southern blotting was used to analyze the copy number of recombinant viral origins in transfected cells. In this assay all three anti E2-modif ⁇ ed oligonucleotides with nuclease complexes (BPVl EU, BPV2 EU and BPV3 EU) were analyzed. Results show that 100 picomol of BPVl EU caused slight inhibition of replication at 72 hours post- transfection. The same amount of BPV2 EU caused increased inhibition which was detectable both at 48 and 72 hours post-infection. The same amount of BPV3 EU demonstrated little if any suppression of replication. Results are illustrated in Figure 1.
  • oligonucleotides with modified hydroxybases reduce replication of hepatitis C virus (HCV) in a transient expression model was described in Example 2.
  • HCV hepatitis C virus
  • the inhibitory effect of 100 picomols of oligonucleotide B4 N (containing 2 5-OH-dC bases) or 100 picomol of agent B6-N (containing 2 8-oxo-dG bases) is measured in a replication assay as described previously.
  • Results show that the mercapto-oligonucleotides caused a reduction in HCV replication.
  • oligonucleotides containing the same nucleotide sequence except that the 5-OH-dC bases of B4-N were substituted with 5- SH-dC bases and 8-oxo-dG bases of B6-N were substituted with 8-SH-dG bases (Table 7) the inhibitory effects caused by B4S-N and B6S-N were detectable at 40 picomol amounts, demonstrating that substitution of the hydroxybases with mercaptobases reduced the amount of inhibitor required to achieve the inhibition of HCV replication in a transient system by approximately 2.5 fold.
  • the effect of the increase of the number of modified bases per oligonucleotide is illustrated by the example of inhibition of HCV replication by modified oligonucleotide containing increasing number of modified 8-oxo-dG residues.
  • the sequence of the inhibitor was antisense to the region of NS5B of HCV Ib genotype and had the sequence: 5' GGGCGGGTCCCCAGGGGGGGCAG 3' (SEQ ID NO. 16) where zero, one, five, ten or thirteen G-residues were substituted with 8-oxo-dG residues.
  • HMO l used in higher amounts demonstrated inhibition similar to the first three modified oligonucleotides. These results show that the increase in the number of 8'- oxo-dG bases in the oligo inhibitor results in increased antiviral effects detected at 30 picomols per million treated cells.
  • Nuclease complex increases antiviral efficiency of oligonucleotides with high content of modified 8-oxo-dG, 5-oxo-dC or 6-OH-dU bases
  • the sequence of the inhibitor was antisense to the region of NS4B of HCV Ib genotype and had sequence: 5' CTGCACAGCCCCCTCCCCTGGGC 3'(SEQ ID NO. 21) where zero, five or ten C-residues were substituted with 5'-OH-dC residues; the oligonucleotides either had nuclease complex or not.
  • These six compounds were used for inhibition of the replication of the hybrid virus, containing replicase part of non-cyto toxic SFV mutant with inserted marker and HCV fragment with respective target site (NS3-4B region).
  • the cells were treated with two-fold dilutions of antiviral oligonucleotides and their anti- viral efficiency was analyzed by reduction of the replication of recombinant virus containing the corresponding target site Figure 4). Inhibition of replication of recombinant virus was monitored by measuring Rluc activity expressed from genomic RNA of the virus.
  • an oligonucleotide containing nine 6-OH-dU residues is used in an inhibition assay as described above.
  • An inhibitor antisense to the region of NS3 of HCV Ib genotype and having the sequence: 5' AGTTGTCTCCTGCCTGCTTAGTC 3' (SEQ ID NO. 26) where zero or nine T-residues are substituted with 6'-OH-dT residues (Table 12). These two compounds are used for inhibition of the replication of the hybrid virus containing a replicase part of the non- cytotoxic SFV mutant with inserted marker and HCV fragment with respective target site (NS3-4B region) as described previously.
  • oligonucleotides having multiple 5-SH-dC or 8-SH-dG bases per oligonucleotide are generated and antiviral activity is compared to oligonucleotides containing hydroxynucleobases at the corresponding positions.
  • An inhibition assay measuring HCV replication by modified oligonucleotides containing seven 5-SH-dC residues or five 8-SH-dG residues is carried out.
  • the inhibitors are antisense to the region of NS3 of HCV Ib genotype and comprise the sequence: 5'
  • AGTTGTCTCCTGCCTGCTTAGTC 3' (SEQ ID NO. 26) and having zero modified residues, seven 5-SH-dC bases or 5-OH-dC residues (substituting all C-residues), or five 8- SH-dG or 8-oxo-dG residues (substituting all G-residues).
  • These five compounds (Table 13) are used for inhibition of the replication of the hybrid virus containing a replicase part of the non-cytotoxic SFV mutant with inserted marker and HCV fragment with respective target site (NS3-4B region) as described above.
  • These three compounds together with HM0 13 and HM0 14 (Table 14) are used for inhibition of the replication of the hybrid virus containing a replicase part of the non-cytotoxic SFV mutant with inserted marker and HCV fragment with respective target site (NS3-4B region) as above.
  • oligonucleotide inhibitors antisense to the region of NS3 of HCV Ib genotype and having the sequence: 5' AGTTGTCTCCTGCCTGCTTAGTC 3 , containing seven 5-SH-dC and five 8-SH-dG residues, seven 5-OH-dC and five 5-oxo-dG residues or nine 6-OH-dU and seven 5-OH- dC residues (Table 15).
  • oligonucleotides are used which substitute all C-residues and G-residues with modified nucleotides or substituting all T- and C-nucleotides.
  • HM0 13, HM0 14, HM0 15 and HM0 16 are used for inhibition of the replication of the hybrid virus as described above.
  • a strong antiviral effect is expected, possibly better in the oligos expressing mercaptonucleobases than those having hydroxynucleobases.
  • the previous results suggest that any type of modifications (mercapto/hydroxyl and/or different nucleobases) can be combined and this will result in enhanced antiviral effects. Any number of possible combinations are contemplated.
  • any highly active compound can be additionally activated by the presence of nuclease due to the additive effect of nuclease complex on highly active antisense oligonucleotides with any combination and number of modified nucleobases.
  • the huh7 cells are treated with differently modified oligonucleotides targeted to the same site (samples are selected from compounds HM O l 1 to HM0 21 as described previously) or to different target sites: one compound is selected from the list of compounds HMO l 1 to HMO-21 and another from list HMOJ to HMO l O.
  • Combinations of oligonucleotides wherein none of the compounds, either of the compounds or both of the compounds contain a nuclease group are tested.
  • the amount of oligonucleotides used for treatment are as follows: 15 picomols of each (together 30 picomoles) or amounts corresponding to effective dose 50 for each of the compounds.
  • Combinations of compounds are used for inhibition of the replication of the hybrid virus, as in the assays described above. It is expected that the use of oligonucleotides targeted to different sites is more effective than the use of differently modified oligonucleotides targeted to the same site, and that inhibitory effects of treatment with modified oligonucleotides is increased by use of several different oligonucleotides. Also, treatment with the modified oligonucleotides (by analogy with siRNA treatments described in the art) will reduce the appearance of viral genomes carrying mutations in target regions and thus decrease the resistance to the antiviral treatments.
  • HCV-persistent infection is modeled by transfection of huh7 cell lines with HCV replicons carrying an antibiotic resistance marker and luciferase of renilla luciferase reporter genes. HCV replication is monitored by analysis of reporter protein expression levels. Cells are treated with modified antisense oligonucleotides (if needed, multiple times) and their efficiency monitored by measurement of luciferase activity at selected timepoints post-treatment.
  • the assay is similar to those set out above using the oligonucleotide compositions described in the previous examples.
  • the assay is carried out using oligonucleotides having mercaptonucleobases, hydroxynucleobases, the compositions complexed with nucleases using chelating agents and metal ions. It is expected that the compounds will also have an effect against viruses which have established chronic infection (thus it is relevant to the chronic infection of HCV in patients which is the most important disease condition caused by HCV.
  • EXAMPLE 14 Modified antisense oligonucleotides suppress expression of HCV transgenes in transiently transfected mice
  • HCV does not replicate in rodents and there is no good small animal model for the virus.
  • mice transfected with hydrodynamic shock method were used as a model.
  • the expression constructs, transcribing mRNAs containing coding region of destabilized renilla luciferease reporter and HCV region(s) containing target site(s) for antisense modified oligonucleotides are constructed.
  • the DNA plasmid containing that expression unit are delivered into the liver of subject mice by using the hydrodynamic shock method (Yeikilis et al, World J Gastroenterol. 12:6149-55.(2006); Andrianaivo et al, J Gene Med. 6:877- 83(2004)) and expression of the HCV sequence-containing mRNAs is quantified by measurement of the reporter activity in liver tissue
  • Modified antiviral oligonucleotides antisense to the HCV-specific region in the expression construct are delivered to the liver of the mouse using either co-transfection with the expression construct or repeated delivery of the compound before, together and/or after the delivery of expression construct.
  • the compounds described in Examples 3-11 as well as their combinations described in Example 12 are used in the assay.
  • modified oligonucleotides exhibit effective antivral activity and inhibit replication of the viral transgene in vivo.
  • Modified oligonucleotides are also measured against other therapeutically relevant viruses using appropritate animal models well-known in the art.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • Virology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Zoology (AREA)
  • General Chemical & Material Sciences (AREA)
  • Plant Pathology (AREA)
  • Veterinary Medicine (AREA)
  • Biochemistry (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Physics & Mathematics (AREA)
  • Biophysics (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Communicable Diseases (AREA)
  • AIDS & HIV (AREA)
  • Pulmonology (AREA)
  • Tropical Medicine & Parasitology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
PCT/FI2008/050633 2007-11-05 2008-11-05 Use of oligonucleotides with modified bases as antiviral agents Ceased WO2009060122A2 (en)

Priority Applications (10)

Application Number Priority Date Filing Date Title
BRPI0819191A BRPI0819191A2 (pt) 2007-11-05 2008-11-05 uso de oligonucleotídeos com bases modificadas como agentes antivirais.
AU2008324066A AU2008324066A1 (en) 2007-11-05 2008-11-05 Use of oligonucleotides with modified bases as antiviral agents
JP2010532629A JP5710977B2 (ja) 2007-11-05 2008-11-05 抗ウイルス薬としての修飾塩基を含むオリゴヌクレオチドの使用
CA2704549A CA2704549A1 (en) 2007-11-05 2008-11-05 Use of oligonucleotides with modified bases as antiviral agents
CN2008801234555A CN101970662A (zh) 2007-11-05 2008-11-05 带有修饰碱基的寡核苷酸作为抗病毒剂的应用
US12/741,531 US20110171287A1 (en) 2007-11-05 2008-11-05 Use of Oligonucleotides with Modified Bases as Antiviral Agents
MX2010004983A MX2010004983A (es) 2007-11-05 2008-11-05 Uso de oligonucleotidos con bases modificadas como agentes antivirales.
EP08846868A EP2212420A2 (en) 2007-11-05 2008-11-05 Use of oligonucleotides with modified bases as antiviral agents
PCT/FI2009/050400 WO2009144365A1 (en) 2008-05-30 2009-05-14 Use of oligonucleotides with modified bases as antiviral agents
ZA2010/03234A ZA201003234B (en) 2007-11-05 2010-05-07 Use of oligonucleotides with modified bases as antiviral agents

Applications Claiming Priority (4)

Application Number Priority Date Filing Date Title
US98554807P 2007-11-05 2007-11-05
US60/985,548 2007-11-05
US5768508P 2008-05-30 2008-05-30
US61/057,685 2008-05-30

Publications (2)

Publication Number Publication Date
WO2009060122A2 true WO2009060122A2 (en) 2009-05-14
WO2009060122A3 WO2009060122A3 (en) 2009-06-25

Family

ID=40551515

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/FI2008/050633 Ceased WO2009060122A2 (en) 2007-11-05 2008-11-05 Use of oligonucleotides with modified bases as antiviral agents

Country Status (10)

Country Link
US (1) US20110171287A1 (cg-RX-API-DMAC7.html)
EP (1) EP2212420A2 (cg-RX-API-DMAC7.html)
JP (1) JP5710977B2 (cg-RX-API-DMAC7.html)
CN (1) CN101970662A (cg-RX-API-DMAC7.html)
AU (1) AU2008324066A1 (cg-RX-API-DMAC7.html)
BR (1) BRPI0819191A2 (cg-RX-API-DMAC7.html)
CA (1) CA2704549A1 (cg-RX-API-DMAC7.html)
MX (1) MX2010004983A (cg-RX-API-DMAC7.html)
WO (1) WO2009060122A2 (cg-RX-API-DMAC7.html)
ZA (1) ZA201003234B (cg-RX-API-DMAC7.html)

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009060124A3 (en) * 2007-11-05 2009-08-13 Baltic Technology Dev Ltd Use of oligonucleotides with modified bases in hybridization of nucleic acids
WO2009144365A1 (en) * 2008-05-30 2009-12-03 Baltic Technology Development, Ltd. Use of oligonucleotides with modified bases as antiviral agents
FR2997705A1 (fr) * 2012-11-08 2014-05-09 Nicolas Ugolin Nucleotide 3' bloquant la traduction des proteines (sasb)
EP4319879A4 (en) * 2022-06-13 2025-01-01 Fikrettin Sahin Use of lutetium salt compounds for antiviral effect

Families Citing this family (43)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8097712B2 (en) 2007-11-07 2012-01-17 Beelogics Inc. Compositions for conferring tolerance to viral disease in social insects, and the use thereof
US8962584B2 (en) 2009-10-14 2015-02-24 Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. Compositions for controlling Varroa mites in bees
NZ601784A (en) 2010-03-08 2014-08-29 Monsanto Technology Llc Polynucleotide molecules for gene regulation in plants
BR112014005951A2 (pt) 2011-09-13 2017-04-04 Monsanto Technology Llc métodos e composições para controle de erva daninha
US9840715B1 (en) 2011-09-13 2017-12-12 Monsanto Technology Llc Methods and compositions for delaying senescence and improving disease tolerance and yield in plants
AU2012308686B2 (en) 2011-09-13 2018-05-10 Monsanto Technology Llc Methods and compositions for weed control
US9416363B2 (en) 2011-09-13 2016-08-16 Monsanto Technology Llc Methods and compositions for weed control
US10806146B2 (en) 2011-09-13 2020-10-20 Monsanto Technology Llc Methods and compositions for weed control
EP2756086B1 (en) 2011-09-13 2018-02-21 Monsanto Technology LLC Methods and compositions for weed control
BR112014005963A2 (pt) 2011-09-13 2020-12-08 Monsanto Technology Llc métodos de controle de planta, de redução de expressão de um gene als em uma planta, de identificação de polinucleotídeos úteis na modulação de expressão do gene als, de fazer um polinucleotídeo, composições compreendendo um polinucleotídeo e um agente de transferência ou um herbicida, cassete de expressão microbiana, bem como molécula de polinucleotídeo
WO2013040117A1 (en) 2011-09-13 2013-03-21 Monsanto Technology Llc Methods and compositions for weed control
AU2012308753B2 (en) 2011-09-13 2018-05-17 Monsanto Technology Llc Methods and compositions for weed control
US10829828B2 (en) 2011-09-13 2020-11-10 Monsanto Technology Llc Methods and compositions for weed control
WO2013040057A1 (en) 2011-09-13 2013-03-21 Monsanto Technology Llc Methods and compositions for weed control
US10760086B2 (en) 2011-09-13 2020-09-01 Monsanto Technology Llc Methods and compositions for weed control
US9920326B1 (en) 2011-09-14 2018-03-20 Monsanto Technology Llc Methods and compositions for increasing invertase activity in plants
EP2855680B8 (en) 2012-05-24 2020-04-15 Monsanto Technology LLC Compositions and methods for silencing gene expression
WO2013185067A1 (en) * 2012-06-08 2013-12-12 Shire Human Genetic Therapies, Inc. Nuclease resistant polynucleotides and uses thereof
WO2014047653A2 (en) 2012-09-24 2014-03-27 Seminis Vegetable Seeds, Inc. Methods and compositions for extending shelf life of plant products
US10077451B2 (en) 2012-10-18 2018-09-18 Monsanto Technology Llc Methods and compositions for plant pest control
US10260089B2 (en) 2012-10-29 2019-04-16 The Research Foundation Of The State University Of New York Compositions and methods for recognition of RNA using triple helical peptide nucleic acids
AU2013371825B2 (en) 2013-01-01 2019-10-24 A.B. Seeds Ltd. Methods of introducing dsRNA to plant seeds for modulating gene expression
US10683505B2 (en) 2013-01-01 2020-06-16 Monsanto Technology Llc Methods of introducing dsRNA to plant seeds for modulating gene expression
CA2897458A1 (en) 2013-01-15 2014-07-24 Monsanto Technology Llc Methods and compositions for plant pest control
US10000767B2 (en) 2013-01-28 2018-06-19 Monsanto Technology Llc Methods and compositions for plant pest control
BR112015022797A2 (pt) 2013-03-13 2017-11-07 Monsanto Technology Llc método para controle de ervas daninhas, composição herbicida, cassete de expressão microbiano e método de produção de polinucleotídeo
EP2971185A4 (en) 2013-03-13 2017-03-08 Monsanto Technology LLC Methods and compositions for weed control
US20140283211A1 (en) 2013-03-14 2014-09-18 Monsanto Technology Llc Methods and Compositions for Plant Pest Control
US10568328B2 (en) 2013-03-15 2020-02-25 Monsanto Technology Llc Methods and compositions for weed control
US9850496B2 (en) 2013-07-19 2017-12-26 Monsanto Technology Llc Compositions and methods for controlling Leptinotarsa
MX359191B (es) 2013-07-19 2018-09-18 Monsanto Technology Llc Composiciones y métodos para controlar leptinotarsa.
UA120426C2 (uk) 2013-11-04 2019-12-10 Монсанто Текнолоджі Елелсі Композиція та спосіб для боротьби з членистоногими паразитами та зараженням шкідниками
UA119253C2 (uk) 2013-12-10 2019-05-27 Біолоджикс, Інк. Спосіб боротьби із вірусом у кліща varroa та у бджіл
BR112016016337A2 (pt) 2014-01-15 2017-10-03 Monsanto Technology Llc Composição e métodos para controlar crescimento, desenvolvimento ou a capacidade de reprodução de uma planta, e para sensibilizar uma planta para um herbicida inibidor de epsps
CN110506752B (zh) 2014-04-01 2022-02-18 孟山都技术公司 用于控制虫害的组合物和方法
EP3158067B1 (en) 2014-06-23 2020-08-12 Monsanto Technology LLC Compositions and methods for regulating gene expression via rna interference
WO2015200539A1 (en) 2014-06-25 2015-12-30 Monsanto Technology Llc Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression
US10378012B2 (en) 2014-07-29 2019-08-13 Monsanto Technology Llc Compositions and methods for controlling insect pests
EP3183007B1 (en) * 2014-08-19 2020-06-17 Northwestern University Protein/oligonucleotide core-shell nanoparticle therapeutics
UA124255C2 (uk) 2015-01-22 2021-08-18 Монсанто Текнолоджі Елелсі Інсектицидна композиція та спосіб боротьби з leptinotarsa
UY36703A (es) 2015-06-02 2016-12-30 Monsanto Technology Llc Composiciones y métodos para la administración de un polinucleótido en una planta
AU2016270913A1 (en) 2015-06-03 2018-01-04 Monsanto Technology Llc Methods and compositions for introducing nucleic acids into plants
EP3408390A4 (en) 2016-01-26 2019-10-09 Monsanto Technology LLC COMPOSITIONS AND METHODS FOR COMBATING INSECTS

Family Cites Families (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH05501058A (ja) * 1989-12-04 1993-03-04 アイシス・ファーマシューティカルス・インコーポレーテッド 乳頭腫ウイルス属のアンチセンスオリゴヌクレオチド阻害
JP2823959B2 (ja) * 1991-10-24 1998-11-11 アイシス・ファーマシューティカルス・インコーポレーテッド 改良された取り込みおよびその他の性質を持つ誘導化オリゴヌクレオチド
US5684149A (en) * 1993-01-22 1997-11-04 Research Foundation Of State University Of New York Metal complexes for promoting catalytic cleavage of RNA by transesterification
DE4415370A1 (de) * 1994-05-02 1995-11-09 Hoechst Ag Modifizierte Oligonukleotide, deren Herstellung sowie deren Verwendung
US20040171030A1 (en) * 1996-06-06 2004-09-02 Baker Brenda F. Oligomeric compounds having modified bases for binding to cytosine and uracil or thymine and their use in gene modulation
US20030064944A1 (en) * 2001-06-21 2003-04-03 Isis Pharmaceuticals Inc. Antisense modulation of transforming growth factor beta receptor II expression
AU2003241621A1 (en) * 2002-05-24 2003-12-12 Isis Pharmaceuticals, Inc. Oligonucleotides having modified nucleoside units
WO2003106477A1 (en) * 2002-06-01 2003-12-24 Isis Pharmaceuticals, Inc. Oligomeric compounds that include carbocyclic nucleosides and their use in gene modulation
US20080009455A9 (en) * 2005-02-24 2008-01-10 Coley Pharmaceutical Group, Inc. Immunostimulatory oligonucleotides
JP2009535383A (ja) * 2006-05-03 2009-10-01 バルティック テクロノジー デヴェロプメント,リミテッド 強く結合した塩基で修飾されたオリゴヌクレオチドと人工ヌクレアーゼを組み合わせたアンチセンス作用物質

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2009060124A3 (en) * 2007-11-05 2009-08-13 Baltic Technology Dev Ltd Use of oligonucleotides with modified bases in hybridization of nucleic acids
WO2009144365A1 (en) * 2008-05-30 2009-12-03 Baltic Technology Development, Ltd. Use of oligonucleotides with modified bases as antiviral agents
FR2997705A1 (fr) * 2012-11-08 2014-05-09 Nicolas Ugolin Nucleotide 3' bloquant la traduction des proteines (sasb)
EP4319879A4 (en) * 2022-06-13 2025-01-01 Fikrettin Sahin Use of lutetium salt compounds for antiviral effect

Also Published As

Publication number Publication date
CN101970662A (zh) 2011-02-09
WO2009060122A3 (en) 2009-06-25
CA2704549A1 (en) 2009-05-14
JP5710977B2 (ja) 2015-04-30
US20110171287A1 (en) 2011-07-14
EP2212420A2 (en) 2010-08-04
BRPI0819191A2 (pt) 2017-03-21
ZA201003234B (en) 2011-06-29
MX2010004983A (es) 2010-07-29
AU2008324066A1 (en) 2009-05-14
JP2011502501A (ja) 2011-01-27

Similar Documents

Publication Publication Date Title
JP5710977B2 (ja) 抗ウイルス薬としての修飾塩基を含むオリゴヌクレオチドの使用
Haasnoot et al. RNA interference against viruses: strike and counterstrike
Alvarez-Salas Nucleic acids as therapeutic agents
AU2008324068A1 (en) Use of oligonucleotides with modified bases in hybridization of nucleic acids
WO2013159109A1 (en) Modulation of hepatitis b virus (hbv) expression
AU2007245599B2 (en) Antisense agents combining strongly bound base - modified oligonucleotide and artificial nuclease
JP7634542B2 (ja) B型肝炎ウイルス感染症を処置するためのsept9阻害剤の使用
JP2025166835A (ja) B型肝炎ウイルス感染を処置するためのscamp3阻害剤の使用
JP2025094072A (ja) B型肝炎ウイルス感染を処置するためのcops3阻害剤の使用
WO2021122993A1 (en) Use of saraf inhibitors for treating hepatitis b virus infection
WO2022038211A2 (en) Use of a1cf inhibitors for treating hepatitis b virus infection
WO2009144365A1 (en) Use of oligonucleotides with modified bases as antiviral agents
CN120712352A (zh) 高级rna靶向(arnatar)
WO2021122910A1 (en) Use of sbds inhibitors for treating hepatitis b virus infection
KR20240014533A (ko) 신규한 유전자 침묵 기술로서의 짧은 듀플렉스 dna 및 이의 용도
HK40077333A (en) Use of saraf inhibitors for treating hepatitis b virus infection
HK40078456A (en) Use of sbds inhibitors for treating hepatitis b virus infection
HK40078459A (en) Use of scamp3 inhibitors for treating hepatitis b virus infection
HK40071185A (en) Use of sept9 inhibitors for treating hepatitis b virus infection

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 200880123455.5

Country of ref document: CN

121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08846868

Country of ref document: EP

Kind code of ref document: A2

WWE Wipo information: entry into national phase

Ref document number: 2704549

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: MX/A/2010/004983

Country of ref document: MX

WWE Wipo information: entry into national phase

Ref document number: 2008324066

Country of ref document: AU

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2010532629

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2008846868

Country of ref document: EP

ENP Entry into the national phase

Ref document number: 2008324066

Country of ref document: AU

Date of ref document: 20081105

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 2022/KOLNP/2010

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 12741531

Country of ref document: US

ENP Entry into the national phase

Ref document number: PI0819191

Country of ref document: BR

Kind code of ref document: A2

Effective date: 20100505