WO2008141449A1 - Anticorps à domaine unique et anticorps à chaîne lourde contre egfr et leurs utilisations - Google Patents

Anticorps à domaine unique et anticorps à chaîne lourde contre egfr et leurs utilisations Download PDF

Info

Publication number
WO2008141449A1
WO2008141449A1 PCT/CA2008/000966 CA2008000966W WO2008141449A1 WO 2008141449 A1 WO2008141449 A1 WO 2008141449A1 CA 2008000966 W CA2008000966 W CA 2008000966W WO 2008141449 A1 WO2008141449 A1 WO 2008141449A1
Authority
WO
WIPO (PCT)
Prior art keywords
egfr
seq
polypeptide
acid sequence
heavy chain
Prior art date
Application number
PCT/CA2008/000966
Other languages
English (en)
Inventor
Jianbing Zhang
Colin Roger Mackenzie
Andrea Bell
Original Assignee
National Research Council Of Canada
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National Research Council Of Canada filed Critical National Research Council Of Canada
Publication of WO2008141449A1 publication Critical patent/WO2008141449A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2863—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against receptors for growth factors, growth regulators
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K47/00—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient
    • A61K47/50—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates
    • A61K47/51—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent
    • A61K47/68—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment
    • A61K47/6835—Medicinal preparations characterised by the non-active ingredients used, e.g. carriers or inert additives; Targeting or modifying agents chemically bound to the active ingredient the non-active ingredient being chemically bound to the active ingredient, e.g. polymer-drug conjugates the non-active ingredient being a modifying agent the modifying agent being an antibody, an immunoglobulin or a fragment thereof, e.g. an Fc-fragment the modifying agent being an antibody or an immunoglobulin bearing at least one antigen-binding site
    • A61K47/6881—Cluster-antibody conjugates, i.e. the modifying agent consists of a plurality of antibodies covalently linked to each other or of different antigen-binding fragments covalently linked to each other
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00—Antineoplastic agents
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/22—Immunoglobulins specific features characterized by taxonomic origin from camelids, e.g. camel, llama or dromedary
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
    • C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
    • C07K2317/569—Single domain, e.g. dAb, sdAb, VHH, VNAR or nanobody®

Definitions

  • the present invention relates to the field of antibodies directed towards epidermal growth factor receptor (EGFR). More particularly, the present invention relates to anti-EGFR polypeptides (e.g. single-domain antibodies : sdAb) and nucleic acid sequences encoding same, directed towards and clones thereof, which target EGFR.
  • the invention also concerns an sdAb which is fused with a crystallizable fragment (Fc) of an immunoglobulin protein in order to generate a chimeric protein.
  • Fc crystallizable fragment
  • EGFRs Epidermal growth factor receptors
  • the EGFR family contains four members: EGFR1 (ErbB1 ), HER2 (ErbB2),
  • scFvs single chain variable fragments
  • scFvs are often cleared rapidly from circulation partly due to their low molecular weight (MW; ⁇ 60 kDa, the threshold of glomerular filtration) (Trejtnar, F. & Laznicek, M. (2002) Q J Nucl Med 46, 181-194).
  • MW molecular weight
  • scFvs usually have a serum half-life of less than 10 minutes and a peak tumor uptake of about 5 percent injected dose per gram tissue (% ID/g) (Jain, M., Chauhan, S. C, Singh, A.
  • ADCC antibody-dependent cellular cytotoxicity
  • CDC cell-dependent cytotoxicity
  • Fc engineering has become a major focus of antibody engineering in recent years, resulting in either extended serum half-life (Hinton, P. R., Xiong, J. M., Johlfs, M. G., Tang, M. T., Keller, S., & Tsurushita, N. (2006) J Immunol 176, 346- 356) or shortened serum half-life (Kenanova, V., Olafsen, T., Crow, D. M., Sundaresan, G., Subbarayan, M., Carter, N. H., IkIe, D. N., Yazaki, P. J., Chatziioannou, A. F., Gambhir, S.
  • ADCC enhanced ADCC
  • Single-domain antibodies also known as domain antibodies (dAbs) or nanobodies
  • sdAbs are the smallest antibody fragments with a size of 12-15 kDa. They are usually derived from the variable regions of heavy chain antibodies (HCAbs) of either camelid (Hamers-Casterman, C, Atarhouch, T., Muyldermans, S., Robinson, G.,
  • Camelids such as camel, llama and alpaca have HCAbs naturally devoid of light chains and consist only of V H , C H 2 and C H 3 domains (Hamers-Casterman, C, Atarhouch, T., Muyldermans, S., Robinson, G., Hamers, C 1 Songa, E. B., Bendahman, N., & Hamers, R. (1993) Nature 363, 446-448).
  • sdAbs derived from camelid HCAbs are excellent building blocks for novel antibody molecules (Revets, H., De Baetselier, P., & Muyldermans, S.
  • Anti- CEA sdAbs were isolated and fused to the ⁇ -lactamase of Enterobacter cloacae.
  • the fusion protein was shown to efficiently activate prodrug in an in vitro study and induce tumor regression in an established tumor xenograft model (Cortez-Retamozo, V., Backmann, N., Senter, P. D., Wernery, U., De Baetselier, P., Muyldermans, S., & Revets, H. (2004) Cancer research 64, 2853-2857).
  • a similar approach was used to link an sdAb against Type IV collagenase with an anti-tumor drug, lidamycin.
  • the fusion protein also demonstrated tumor growth inhibition (Miao, Q.
  • An embodiment of the present invention is to provide an antibody-like polypeptide specifically directed towards EGFR.
  • the present invention provides a polypeptide that specifically binds to Epidermal Growth Factor Receptor (EGFR) and comprises at least one of the following Complementarity Determining Regions (CDRs): - a CDR1 region comprising an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NOs: 1 , 2, 3 or 4;
  • CDRs Complementarity Determining Regions
  • CDR2 region comprising an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NOs: 5, 6, 7, 8 or 9;
  • CDR3 region comprising an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NOs: 10, 11 , 12 or 13.
  • Another embodiment of the present invention is to provide a composition comprising an acceptable carrier and a polypeptide that specifically binds to EGFR as defined above.
  • the invention provides a method for targeting an EGFR-overexpressing cell in a subject.
  • This in vivo targeting method comprises the step of administering the composition contemplated by the invention to a subject suspected of containing cells overexpressing EGFR to form a complex made of EGFR and the antibody-like polypeptide on the instant invention.
  • the targeting method further comprises the step of detecting the presence or absence of the EGFR: antibody-like polypeptide complex.
  • the invention also provides a method for targeting an EGFR-overexpressing cell in a sample.
  • This in vitro targeting method comprises the step of contacting the composition contemplated by the invention with a sample suspected of containing cells overexpressing EGFR to form a complex made of EGFR and the antibody-like polypeptide on the instant invention.
  • This targeting method further comprises the step of detecting the presence or absence of the EGFR: antibody-like polypeptide complex.
  • the present invention provides a method for treating a disease or a disorder associated with cells overexpressing EGFR.
  • This method of treatment comprises the step of administering the composition of the invention to a subject suffering from a disease or a disorder associated with cells overexpressing EGFR.
  • the targeting methods of the instant invention may find a multitude of in vitro and in vivo applications. Among others, the targeting methods contemplated by the invention may be advantageously used for the diagnostic of diseases or disorders associated with cells overexpressing EGFR.
  • the present invention provides a method of diagnostic comprising a step a) of labelling the polypeptide of the invention with a labelling agent such as but not limited to a contrast agent and a step b) of administering the labelled polypeptide to a subject suspected of containing cells overexpressing EGFR.
  • the diagnostic method of the invention further comprises a step c) of detecting cells overexpressing EGFR.
  • Such a detection step may be achieved by any processes or means suitable to one skilled in the art. Such means may be, but not limited to, positron emission tomography, optical imaging or magnetic resonance imaging.
  • Figure 1 is a flow chart of the steps followed for the generation of the sdAbs.
  • Figure 2 represents the amino acid sequences of 11 sdAbs specific for EGFR- extracellular domain (ECD) with complementarity determining regions CDR1 , CDR2 and CDR3 underlined. Based on the sequence identity of their CDRs, the sdAbs can be divided into four (4) groups, which are separated by horizontal lines in the column in which the sdAb clones are listed. Group 1 consists of EG2, EG5 and EG28; Group 2 consists of EG6 and EG10; Group 3 consists of EG7, EG16, EG29, EG30 and EG43; and Group 4 includes EG31. The frequency of the sequences for each clone is indicated in parentheses.
  • Figures 3A to 3C illustrate the characteristics of the sdAbs constructed.
  • Figure 3A is a schematic representation of the primary structures of an sdAb (EG2), a pentabody (V2C-EG2) and a cHCAb (EG2-hFc).
  • Figure 3B is an SDS-PAGE of 1 ⁇ g purified EG2 (lane 1), V2C-EG2 (lane 2) and EG2-hFc (lane 3).
  • Figure 3C represents size exclusion chromatography of EG2, V2C-EG2 and EG2-hFc following EG2 and V2C-EG2 expression in E. coli, and EG2-hFc expression in HEK293 cells.
  • Proteins were separated on an 8-25% gradient PhastGel (GE Healthcare) and Coomassie stained to visualize the proteins.
  • Gel filtration chromatography was performed on purified EG2, V2C-EG2 and EG2-hFc using a Superdex 200TM column (GE Healthcare). Superdex separations were carried out in PBS. The elution positions of molecular mass markers (GE Healthcare) are indicated. Data are normalized to a maximum 100 milliabsorbance unit (mAU).
  • Figure 4A to 4D show the interactions between EGFR-ECD and sdAbs as monitored by surface plasmon resonance.
  • Figure 4A shows sensorgrams of the binding of 0.5 ⁇ M EG2, EG10, EG31 and EG43 to EGFR-ECD. The antigen was immobilized at a density of 500 RU on a CM5 sensor chip. For calculation of the affinities of the sdAbs, at least three independent experiments were performed using sdAb concentrations ranging from 0.4 nM to 1 ⁇ M.
  • Figures 4B and 4C the binding of EG2, V2C-EG2 and EG2-hFc to surfaces with different antigen densities is shown.
  • EGFR-ECD was immobilized at a density of 400 RU in Figure 4B, and at a density of 1500 RU in Figure 4C. Binding of EG2, V2C-EG2 and EG2-hFc to antigen at different concentrations was analyzed; only that of 0.5 ⁇ M is shown for each antibody.
  • the data in Figures 4B and 4C were normalized to a maximum RU of 100 in order to compensate for the different molecular weights of the binding proteins and allow comparison of resulting sensorgrams.
  • Figure 4D shows the interaction of EGFR-ECD with immobilized antibodies. EG2, V2C-EG2 and EG2-hFc were immobilized at a density of 300 RU. Multiple concentrations of EGFR-ECD were used in the experiment, and only data at 0.5 ⁇ M is shown.
  • Figure 5A to 5C show fused microPET/CT images of a human pancreatic carcinoma model MIA PaCa-2.
  • Mice bearing the established tumor were i.v. injected with 64 Cu-DOTA-EG2 at a dose of 396 ⁇ Ci ( Figure 5A), 64 Cu-DOTA-V2C-EG2 at a dose of 393 ⁇ Ci ( Figure 5B) and 64 Cu-DOTA-EG2-hFc at a dose of 438 ⁇ Ci ( Figure 5C).
  • the mice were imaged at 1 hr, 4 hr and 20 hr post- injection.
  • the mouse was imaged at 1 hr, 4 hr, 20 hr and 44 hr post- injection.
  • the top row in each sub-figure contains surface rendering images performed using AmiraTM (Mercury Computer System Inc.) to show relative tumor location (arrows).
  • the bottom row in sub-figures 5A and 5B and top row in sub-figure 5C contains fused microPET/CT images. Images were acquired by FLEX Trimodality micro CT/PET/SPECT system (Gamma Medica-ldeas Inc.).
  • FIG 6A and 6B show the construction of chimeric heavy chain antibodies.
  • FIG 6A shows the vector pTT5-hFc used for the fusion of sdAbs to Fc of human IgGl PCMV, CMV promoter; TPL, adenovirus tripartite leader; SD, splice donor; enh MLP, adenovirus major late promoter enhancer; SA, splice acceptor; sig, signal peptide of heavy chain of human IgGI ; H, hinge of human IgGV 1 hFc, Fc of human IgGI ; pA, poly A; OriP, Epstein Barr virus origin of replication; bla, beta lactamase; pMBI ori, bacterial origin of replication; K, Kosac recognition sequence.
  • FIG 6B shows the fusion of sdAbs to hFc.
  • PCR1 was to amplify sdAb genes (sdAb) and to flank Kosac sequence (K) and DNA encoding signal peptide of human IgGI heavy chain (sig) to the 5'-end and DNA encoding hinge region (H) and the first seven residues of Fc of human IgGI to the 3'-end.
  • PCR2 was to amplify DNA for residues of 1 -65 of IgGI -Fc.
  • Overlap extension PCR was performed in PCR3 using the mixture PCR1 and PCR2 purducts as templates. The final PCR product was digested by EcoRI and Sacll and inserted into pTT5-hFc.
  • FIG 7. lmmunocytochemical stainings of cells by cHCAbs.
  • Breast carcinoma cells MDA-MB-468 were exposed to 10 ⁇ g/ml of EG2-hFc, and then to FITC conjugated goat anti-human IgG. Cells were counter-stained with DAPI to show cell nuclei.
  • FIG. 8 Glycosylation patterns of EG2-hFc.
  • Major ions were illustrated with their corresponding cartons.
  • ⁇ , •, O and ⁇ stand for N- acetylglucosamine, mannose, galactose and fucose, respectively.
  • HCAbs also called single-domain antibodies (sdAbs) or nanobodies
  • sdAbs single-domain antibodies
  • nanobodies directed towards EGFR.
  • sdAb and a chimeric protein which comprises such an sdAb.
  • the sdAb and chimeric protein contemplated by the present invention have been developed to be used to target EGFRs on cell surfaces.
  • These Anti-EGFR polypeptides of the invention advantageously find a particular use in the diagnosis and treatment of diseases or disorders associated with cells over-expressing EGFR.
  • binding refers to the ability of a ligand, such as a single domain antibody (sdAb), to specifically recognize and detectably bind, as assayed by standard in vitro assays, to a EGFR molecule.
  • binding is measured by the capacity of an anti-EGFR polypeptide of the invention to recognize an EGFR molecule on the surface of a cell using well described ligand-receptor binding assays, chemotaxis assays, histopathologic analyses, flow cytometry and confocal microscopic analyses, and other assays known to those of skill in the art and/or exemplified herein.
  • nucleic acid sequence or “polynucleotide” or “nucleotide sequence” as used interchangeably herein refers to any natural and synthetic linear and sequential arrays of nucleotides and nucleosides, for example cDNA, genomic DNA, mRNA, tRNA, oligonucleotides, oligonucleosides and derivatives thereof.
  • nucleic acids may be collectively referred to herein as "constructs", "plasmids” or “vectors.”
  • Representative examples of the nucleic acids of the present invention include bacterial plasmid vectors including expression, cloning, cosmid and transformation vectors such as, but not limited to, pBR322, pSJF2, animal viral vectors such as, but not limited to, modified adenovirus, influenza virus, polio virus, pox virus, retrovirus, and the like, vectors derived from bacteriophage nucleic acid, and synthetic oligonucleotides like chemically synthesized DNA or RNA.
  • the term “nucleic acid” further includes modified or derived nucleotides and nucleosides.
  • protein As used herein, “protein”, “peptide” and “polypeptide” are used interchangeably to denote an amino acid polymer/residues or a set of two or more interacting or bound amino acid polymers/residues.
  • Identity or “identical” means that an amino acid or nucleotide at a particular position in a first polypeptide or polynucleotide is identical to a corresponding amino acid or nucleotide in a second polypeptide or polynucleotide that is in an optimal global alignment with the first polypeptide or polynucleotide.
  • a sequence which "encodes" a selected polypeptide is a nucleic acid molecule which is transcribed (in the case of DNA) and translated (in the case of mRNA) into a polypeptide, for example, in vivo when placed under the control of appropriate regulatory sequences (or “control elements").
  • the boundaries of the coding sequence are typically determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to, cDNA from viral, prokaryotic or eukaryotic mRNA, genomic DNA sequences from viral or prokaryotic DNA, and even synthetic DNA sequences.
  • a transcription termination sequence may be located 3' to the coding sequence.
  • control elements may also be associated with a coding sequence.
  • a DNA sequence encoding a polypeptide can be optimized for expression in a selected cell by using the codons preferred by the selected cell to represent the DNA copy of the desired polypeptide coding sequence.
  • isolation means altered “by the hand of man” from its natural state, i.e., if it occurs in nature, it has been changed or removed from its original environment, or both.
  • a polynucleotide naturally present in a living organism is not “isolated", the same polynucleotide separated from the coexisting materials of its natural state, obtained by cloning, amplification and/or chemical synthesis is “isolated” as the term is employed herein.
  • a polynucleotide that is introduced into an organism by transformation, genetic manipulation or by any other recombinant method is "isolated” even if it is still present in said organism.
  • sdAbs are all equivalent terms identifying the variable region of the HCAbs of the present invention. Other terms may also be used to identify the variable region of the HCAbs, and should not modify the scope of the present invention.
  • sample encompasses a variety of sample types obtained from an individual and can be used in a targeting assay of the invention.
  • the definition encompasses blood and other liquid samples of biological origin, solid tissue samples such as a biopsy specimen or tissue cultures or cells derived therefrom, and the progeny thereof.
  • the definition also includes samples that have been manipulated in any way after their procurement, such as by treatment with reagents, solubilization, or enrichment for certain components.
  • a "disease or disorder associated with cells over-expressing EGFR” means a disease or a disorder for which its progression is associated with high levels of EGFR.
  • a disease or disorder may be a cancer or a tumour.
  • a non- exhaustive list of such diseases or disorders may be, but not limited to, cancers of breast cancer, bladder tumor, colon cancer, glioma and glioblastoma, non-small cell lung carcinoma, pancreatic cancer, ovarian cancer, gastric cancer, lung cancer, salivary cancer and head and neck cancer.
  • treating refers to a process by which the symptoms of a disorder or a disease associated with cells over-expressing EGFR are alleviated or completely eliminated.
  • preventing refers to a process by which symptoms of a disorder or a disease associated with cells over-expressing EGFR are obstructed or delayed.
  • an acceptable carrier means a vehicle for containing the anti-
  • EGFR polypeptides and/or polynucleotides encoding same of the invention that can be administered to a subject without adverse effects.
  • Suitable carriers known in the art include, but are not limited to, gold particles, sterile water, saline, glucose, dextrose, or buffered solutions.
  • Carriers may include auxiliary agents including, but not limited to, diluents, stabilizers (i.e., sugars and amino acids), preservatives, wetting agents, emulsifying agents, pH buffering agents, viscosity enhancing additives, colors and the like.
  • Anti-EGFR polypeptides of the invention and polynucleotides encoding same
  • a polypeptide that specifically binds to Epidermal Growth Factor Receptor comprising at least one of the following Complementarity Determining Regions (CDRs):
  • CDR1 region comprising an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NOs: 1 , 2, 3 or 4;
  • CDR2 region comprising an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NOs: 5, 6, 7, 8 or 9;
  • CDR3 region comprising an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NOs: 10, 1 1 , 12 or 13.
  • anti-EGFR polypeptide of the invention may comprise different combinations of CDRs including but not limited to a single CDR or combinations of two or more CDR in various proportion.
  • the anti-EGFR polypeptide of the invention may further comprise flanking regions. Indeed, such flanking regions may be inserted upstream or downstream of a selected CDR. According to a preferred but non-limiting embodiment, at least one of said flanking regions is located upstream of the CDR1 region, or between the CDR1 and CDR2 regions, or between the CDR2 and CDR3 regions or downstream of the CDR3 region, or any combination thereof.
  • flanking regions in accordance with the present invention may comprise an amino acid sequence selected from the group consisting of the flanking region 1 (FR1) as set forth in SEQ ID NO:40, the flanking region 2 (FR2) as set forth in SEQ ID NO: 41 , the flanking region 3 (FR3) as set forth in SEQ ID NO:42 and the flanking region 4 (FR4) as set forth in SEQ ID NO: 43.
  • the anti-EGFR polypeptides of the invention may comprise for instance, but non-limited to, an amino acid sequence substantially identical to SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 , SEQ ID NO:23, SEQ ID NO:25, SEQ ID NO:27, SEQ ID NO:29, SEQ ID NO:31 , SEQ ID NO:33 or SEQ ID NO:35.
  • anti-EGFR polypeptide may be encoded for instance, but non-limited to, by a polynucleotide comprising a nucleic acid sequence substantially identical to
  • SEQ ID NO:14 SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22, SEQ ID NO:24, SEQ ID NO:26, SEQ ID NO:28, SEQ ID NO:30, SEQ ID NO:32 or SEQ ID NO:
  • nucleic acid sequence As used herein, the term "substantially identical", when referring to a nucleic acid sequence, is to be understood that the sequence of interest has a nucleic acid sequence which is at least 70% identical, or at least 80% identical, or at least 95% identical, or at least 98% identical to the nucleotide sequences contemplated by the present invention.
  • the present invention provides a chimeric protein which has a binding specificity to EGFR.
  • the anti-EGFR polypeptide of the invention may further comprise an Fc portion of a heavy chain peptide linked to the CDRs of the present invention. It is within the scope of the present invention to provide an anti-EGFR molecule that comprises more than one copy of the contemplated chimeric protein. It will be understood that the copies of the chimeric protein may be identical or different.
  • the Fc portion of a heavy chain peptide may be an Fc portion of a mammalian heavy chain peptide, such as, but non-limited to, an Fc portion of a human heavy chain peptide.
  • the Fc portion may be derived from or encoded by, but non-limited to, a human IgGI immunoglobulin molecule (e.g. IgG gene).
  • a human IgGI immunoglobulin molecule e.g. IgG gene
  • the Fc portion may also be derived from or encoded by another IgG subclass such as lgG2a, lgG2b, lgG3 or lgG4 or other immunoglobulin isotypes such as IgA, IgD, IgE and IgM.
  • the sources of the mammalian immunoglobulin molecules includes human or another source that need not be human.
  • the Fc portion of a heavy chain peptide contemplated by the present invention may comprise a nucleic acid sequence substantially identical to a sequence as set forth in SEQ ID NO:36, or an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NO:37.
  • the chimeric polypeptide of the invention may comprises an amino acid sequence substantially identical to a sequence as set forth in SEQ ID NO:38. Such a polypeptide may be encoded for instance but non-limited to by a polynucleotide comprising a nucleic acid sequence substantially identical to a sequence as set forth in SEQ ID NO:39. As one skilled in the art may appreciate, the chimeric protein of the invention may further comprise a linker so as to link the Fc portion of the heavy chain peptide to the CDRs (Ae. the single variable domain peptide). In this connection, the contemplated linker may be, but not limited to, a peptide linker moiety.
  • the contemplated linker should be long enough and flexible enough to allow the single variable domain peptide to freely interact with a EFGR molecule.
  • the linker if required, may be for instance a peptide of at least two amino acid residues, or at least 5 amino acid residues, or at least 10 amino acids residues, or at least 15 amino acid residues.
  • the linker contemplated by the present invention should link the carboxy-terminal of the sdAb of the invention with the amino-terminal of the Fc portion of the heavy chain peptide.
  • a contemplated linker or hinge peptide may have an amino acid sequence substantially identical to AEPKSCDKTHTCPPCP (i.e. Ala-Glu-Pro-Lys- Ser-Cys-Asp-Lys-Thr-His-Thr-Cys-Pro-Pro-Cys-Pro; referred to SEQ ID NO:60).
  • the anti-EGFR polypeptide of the invention may be advantageously glycosylated.
  • glycosylation or “glycosylated” refers to the addition of a carbohydrate moiety to a protein.
  • the carbohydrate moiety may be, but not limited to, a glucose, a galactose, a mannose, or a fucose residue. It also may be an N-acetyl-galactosamine or an N-acety!glucosamine residue.
  • the glycans may be, but non-limited to, of type GO (Hex 3 FuciHexNAc 4 ), of type G1 (HeX 4 FuC 1 HeXNAc 4 ) and of type G2 (Hex 5 (Fuci)HexNAc 4 ). Further addition of residues such as GIcNAc or Neu ⁇ Ac to a protein may be done by any method suitable to one skilled in the art.
  • anti-EGFR polypeptides and polynucleotides encoding same of the invention may be used in the targeting of cells over-expressing EGFR.
  • the anti-EGFR polypeptides of the invention may be used as targeting agents for targeting cells that over-express EGFR.
  • the polynucleotides encoding the anti-EGFR polypeptides of the invention may be used in a so called "genetic therapy method" to also target cells that over-express EGFR.
  • the polynucleotides of the invention may be incorporated into a vector which is replicable and expressible upon injection to a subject in need thereof thereby producing the anti-EGFR polypeptide in vivo.
  • the anti-EGFR encoding polynucleotides may be incorporated into a plasmid vector under the control of the CMV promoter which is functional in eukaryotic cells.
  • the use of the polynucleotides of the invention in genetic therapy may employ a suitable delivery method or system such as direct injection of plasmid DNA into muscles [Wolf et al. H M G (1992) 1 : 363, Turnes et al., Vaccine (1999), 17 : 2089, Le et al. , Vaccine (2000) 18 : 1893, Alves et al. , Vaccine (2001 )19 : 788], injection of plasmid DNA with or without adjuvants [Ulmer et al. , Vaccine (1999) 18: 18, MacLaughlin et al. , J. Control Release (1998) 56: 259, Hartikka et al. , Gene Ther.
  • a suitable delivery method or system such as direct injection of plasmid DNA into muscles [Wolf et al. H M G (1992) 1 : 363, Turnes et al., Vaccine (1999), 17 : 2089,
  • compositions for targeting EGFR-over- expressing cells advantageously comprises an acceptable carrier and an anti-EGFR polypeptide(s) of the invention, or a polynucleotide encoding the anti-EGFR polypeptide of the invention.
  • compositions of the invention may thus be used, according to yet another embodiment of the invention, in a method for targeting an EGFR-overexpressing cell in a subject.
  • the in vivo targeting method of the invention comprises the steps of:
  • step (b) detecting the presence or absence of the anti-EGFR: EGFR-overexpressing cell complex of step (a).
  • compositions of the invention may also be used, in accordance with a further embodiment of the invention, in an in vitro method for targeting an EGFR- overexpressing cell.
  • the in vitro targeting method of the invention comprises the steps of:
  • step (b) detecting the presence or absence of the anti-EGFR:EGFR-overexpressing cell complex of step (a).
  • the detecting step of the in vivo method of the invention may be achieved by any suitable processes known to one skilled in the art. For instance, one may consider of coupling the anti-EGFR polypeptide of the invention with a labelling agent, such as a contrast agent or any suitable marker.
  • a labelling agent such as a contrast agent or any suitable marker.
  • the contrast agent may be, but not limited to, a radionuclide, a fluorescent dye, a fluorescent nanoparticle, a magnetic contrast agent or a supermagnetic contrast agent.
  • the marker may be of the fluorescent, chemical or radioactive type.
  • a contrast agent e.g. a radionuclide such as 64 Cu
  • such a detection may be achieved for instance by a positron emission tomography (PET) scanner or micro-PET scanner.
  • the step of detecting generated by such a contrast agent may be achieved for instance by an optical imaging scanner.
  • the step of detecting generated by such a contrast agent may be achieved for instance by a magnetic resonance tomography scanner.
  • the detecting step of the in vitro method of the invention may be achieved by any suitable processes known to one skilled in the art.
  • the skilled person in the art may consider detecting the labelled polypeptide of the invention by conventional methods such as, but not limited to, immunohistochemistry or ELISA techniques.
  • the anti-EGFR polypeptides of the invention advantageously and successfully target EGFR over- expressing cells
  • a method for treating a disease or disorder associated with cells over-expressing EGFR which comprises the step of administering the anti- EGFR polypeptides and/or the polynucleotides encoding same to a subject suspected of containing cells over-expressing EGFR.
  • the in vivo targeting method as contemplated by the invention may find a particular advantage in the diagnostic of diseases or disorders associated with overexpression of EGFR.
  • the present invention provides a method for diagnosing diseases or disorders characterized by cells overexpressing of EGFR.
  • Such a diagnostic method comprises a step a) of labelling the polypeptide of the invention with a labelling agent such as, but not limited to, a contrast agent and a step b) of administering the labelled polypeptide to a subject suspected of containing cells overexpressing EGFR.
  • the diagnostic method of the invention further comprises a step c) of detecting cells overexpressing EGFR.
  • Such a detection step may be achieved by any processes or means suitable to one skilled in the art. Such means may be, but not limited to, positron emission tomography, optical imaging or magnetic resonance imaging.
  • an "effective amount" is an amount sufficient to effect beneficial or desired results, including clinical results.
  • An effective amount can be administered in one or more administrations.
  • an effective amount of the anti-EGFR polypeptides of the invention and the polynucleotides encoding same is an amount that is sufficient to target the EGFR over-expressing cells.
  • it is the amount that is sufficient to palliate, ameliorate, stabilize, reverse, slow or delay the progression of the disease state.
  • pentameric sdAb, or pentabody, V2C-EG2 was constructed by fusing EG2 (SEQ ID NO:15) which is the sdAb with the highest affinity, to the D17E/W34A mutant of E. coli shiga toxin B subunit (StxB).
  • cHCAb, EG2-hFc (SEQ ID NO:38) was constructed by fusing EG2 to the Fc of human IgGL E. coli expressed EG2 and V2C-EG2, and mammalian expressed EG2-hFc were tested for their tumor-targeting ability in a xenograft tumor model of human pancreatic carcinoma (MIA PaCa-2) in mice (FIG. 5A to 5C).
  • EG2 and V2C-EG2 were shown to localize mainly in the kidneys after i.v. injection, EG2-hFc exhibited excellent tumor accumulation.
  • cHCAb of the invention is demonstrated to be useful in the diagnostics and/or therapeutics for diseases or disorders associated with cells overexpressing EGFR such as cancer.
  • EGFR-ECD EGFRvIII
  • EGFRvlll-ECD EGFRvIII
  • a male llama (Lama glama) was injected subcutaneously with 100, 75, 75, 50 and 50 ⁇ g EGFRvlll-ECD on days 1 , 21 , 36, 50 and 64, respectively (Arbabi Ghahroudi, M., Desmyter, A., Wyns, L., Hamers, R., & Muyldermans, S. (1997) FEBS letters 414, 521 -526).
  • Complete Freund's Adjuvant was used for primary immunization (Sigma, St. Louis, MO), incomplete Freund's Adjuvant for immunizations 2 - 4 (Sigma, St. Louis, MO), and no adjuvant for the final immunization.
  • the llama was bled one week following each immunization and heparinized blood was collected for immediate isolation of the peripheral blood leukocytes, which were stored at -8O 0 C until further use.
  • Three different sense primers (called J' corresponding to the 5'-end of IgG) including MJ1 (GCCCAGCCGGCCATGGCCSMKGTGCAGCTGGTGGAKTCTGGGGGA; SEQ ID NO-.61), MJ2 (CAGCCGGCCATGGCCCAGGTAAAGCTGGAGGAGTCTGGGGGA; referred to SEQ ID NO:62) and MJ3
  • Amplified products of approximately 600 bp from the primer combination J'-C H 2 were extracted from a 1 % agarose gel and purified with a QIAquick Gel Extraction Kit (Qiagen) and the amplified products from primers J'-C H 2 b 3 were PCR purified.
  • the two primers of MJ7BACK were extracted from a 1 % agarose gel and purified with a QIAquick Gel Extraction Kit (Qiagen)
  • the final PCR product was digested with Sfi ⁇ and ligated into pMED1 , a derivative of pHEN4, and transformed into E. coli TG1 (NEB, Ipswich, MA) by electroporation (Arbabi Ghahroudi, M., Desmyter, A., Wyns, L., Hamers, R., & Muyldermans, S. (1997) FEBS letters 414, 521-526). Phages were rescued with helper phage M13KO7 (NEB 1 Ipswich, MA).
  • the llama immune phage display library was panned against 1 mg/ml EGFRvlll-ECD that was preadsorbed to a Reacti-BindTM maleic anhydride activated microtiter plate well. About 10 11 phages were added to the well and incubated at 37 0 C for 2 hr for antigen binding. After disposal of unattached phages, the wells were washed six times with phosphate buffered saline supplemented with 0.05% TweenTM 20 (PBST) for round one and washes were increased by one for each additional round.
  • PBST phosphate buffered saline supplemented with 0.05% TweenTM 20
  • Phages were eluted by 10 min incubation with 100 ⁇ l 100 mM triethylamine and the eluate was subsequently neutralized with 200 ⁇ l 1M Tris-HCI (pH 7.5). Phages were amplified as described above but on a smaller scale. After four rounds of panning, eluted phages were used to infect exponentially growing E. coll TG1. Individual colonies were used in phage ELISA. Positive phage clones were sequenced. Based on the sequence identity of the CDRs, the sdAb has been divided into four (4) groups.
  • sdAb EG2 was subcloned into the SspEI and ⁇ amHI sites of pVT2, generating an expression vector for pentabody V2C-EG2 (Stone, E., Hirama, T., Tanha, J., Tong-Sevinc, H., Li, S., MacKenzie, C.
  • EG2 sdAbs and V2C-EG2 pentabody were expressed periplasmically and purified by IMACTM (Zhang, J., Li, Q., Nguyen, T. D., Tremblay, T. L., Stone, E., To, R., Kelly, J., & Roger MacKenzie, C. (2004) Journal of molecular biology 341 , 161-169).
  • clones were inoculated in 25 ml LB-Ampicillin (Amp) and incubated at 37 0 C with 200 rpm shaking overnight. The next day, 20 ml of the culture was used to inoculate 1 I of M 9 (0.2% glucose, 0.6% Na 2 HPO 4 , 0.3% KH 2 PO 4 , 0.1 % NH 4 CI, 0.05% NaCI, 1 mM MgCI 2 , 0.1 mM CaCI 2 ) supplemented with 0.4% casamino acids, 5 mg/l of vitamin B1 and 200 ⁇ g/ml of Amp, and cultured for 24 hr.
  • M 9 (0.2% glucose, 0.6% Na 2 HPO 4 , 0.3% KH 2 PO 4 , 0.1 % NH 4 CI, 0.05% NaCI, 1 mM MgCI 2 , 0.1 mM CaCI 2
  • 0.4% casamino acids 5 mg/l of vitamin B1 and 200 ⁇ g/ml of Amp, and cultured
  • Human Fc (hFc) gene comprising the nucleic acid sequence of SEQ ID NO:36 was inserted into a mammalian expression vector pTT5, a derivative of the pTT vector to generate hFc fusion vector pTT5-hFc.
  • EG2 was amplified and inserted into pTT5-hFc so that the C-terminus of the sdAb was linked to the hinge region of human IgGI and then to Fc of human IgGI with no extra residues added to the entire construct.
  • the generated EG2-hFc was used in the transient transfection of human embryonic kidney cells (HEK293).
  • Clone 6E of 293-EBNA1 was maintained as suspension culture in shaker flasks in serum-free F17 medium (Invitrogen, Burlington, ON). Cells were inoculated at a density of 0.25 x 10 6 cells/ml in a 2.5 I shake flask (500 ml working volume) two days prior to transfection. Cells (usually at a concentration of around 1.0-1.5 x 10 6 cells/ml) were transfected with 1 ⁇ g/ml plasmid DNA and 2 ⁇ g/ml linear 25 kDa polyethyleneimine, as previously described (Pham, P. L., Perret, S., Doan, H.
  • EG2-hFc secreted into the medium was purified by affinity chromatography on a Protein A column (MabSelect SuRe, GE Healthcare, Uppsala, Sweden). Purified material was desalted on a HiPrepTM 26/10 desalting column (GE Healthcare, Uppsala, Sweden) equilibrated with phosphate buffered saline (PBS). Protein concentration was determined by absorbance at 280 using a molar extinction coefficient of 58830 calculated from EG2-hFc amino acid sequence (Gill, S. C. and von Hippel, P. H. (1989) Calculation of protein extinction coefficients from amino acid sequence data. Anal. Biochem. 182:319-326(1989). [PubMed: 26103491.
  • the amount of analyte bound after subtraction from the blank control surface is shown as relative resonance units (RU).
  • RU relative resonance units
  • the double referenced sensorgrams from each injection series were analyzed for binding kinetics using BIAevaluationTM software (GE Healthcare, Uppsala, Sweden).
  • Dissociation constants (K 0 ) were calculated from the on- and off-rates ⁇ k ou and k off , respectively), as determined by global fitting of the experimental data to a 1 : 1 Langmuir binding model (Chi 2 ⁇ 1). The final reported K 0 was from at least three independent experiments.
  • High MW markers catalase 232 kDa
  • ferritin 440 kDa
  • thyroglobulin 669 kDa
  • blue dextran 2000 kDa
  • Non-small cell lung carcinoma cells A549 and breast cancer cells MDA-MB- 468 were purchased from ATCC (Manassas, VA) and maintained in DMEM (Gibco, Rockville, MA) supplemented with 5% fetal bovine serum (FBS, Gibco) and 1 % Antibiotic-Antimycotic (Gibco) or RPMI supplemented with 10% FBS and 1% Antibiotic-Antimycotic, respectively, in 5% CO 2 incubator.
  • FBS fetal bovine serum
  • Gibco 1 % Antibiotic-Antimycotic
  • RPMI Supplemented with 10% FBS and 1% Antibiotic-Antimycotic, respectively, in 5% CO 2 incubator.
  • An isolation of HEK293 cells, 293-6E is maintained in the laboratory of Dr. Yves Durocher. Protein A column was obtained from GE Healthcare.
  • Genomic DNA of Fc of human IgGI was obtained from Dr. M. Neuberger. Standard PCR procedure was used to remove the intron regions from the genomic DNA.
  • the generated cDNA of human IgGI Fc was amplified using primers HFC-F1 (TTTACAGAATTCGCCACCATGGAGTTTGGGCTGAGCTGGGTTTTCCTTGTTGCT)
  • HFC- F2 (AAAGGTGTCCAGTGTGAGACGTCTAGCCCAGCTGAGCCCAAATCTTGTGACAA AACTCACACATGCCCACCGTGCCCAACATGCCCACCGTGCCCAGCA; SEQ ID NO:70) and HFC-R to add Kosac sequence and signal peptide of human IgGI heavy chain.
  • the final product was cloned into pTT5 using restriction sites EcoR ⁇ and Apa ⁇ , generating a Fc fusion vector pTT5-hFc.
  • hFc3 gcacctgaactcctgggggga; SEQ ID NO:73
  • hFc4 actgctcctcccgcggctttg; SEQ ID NO:74
  • the mixture of the two gel purified PCR products were used as the template of the final PCR reaction using hFC5 and hFc4 as primers, the product of which was digested with EcoRI and Sacll and ligated into pTT5-hFc digested with the same enzymes to generate cHCAb expression plasmids which are fusions of sdAbs to human IgGI Fc.
  • One mg of each cHCAb expression plasmid was used to transiently transfect
  • HEK293E cells were inoculated at a density of 0.25 x 10 6 cells/ml in a 2.5 liters Erlenmeyer culture flask (500 ml working volume) two days prior to transfection.
  • Cells (usually around 1.0-1 .5 x 10 6 cells/ml) were transfected with 1 ⁇ g/ml plasmid DNA and 2 ⁇ g/ml linear 25 kDa polyethylenimine, as previously described (Pham, P. L., Perret, S., Doan, H. C, Cass, B., St-Laurent, G., Kamen, A., & Durocher, Y.
  • cHCAbs were digested using trypsin and the resulted peptides were then purified using C-is Sep-Pak cartridges. The peptides were redissolved in 0.1 M sodium phosphate buffer (pH 7.5) and incubated with PNGase F (10 unit) for 24 h at 37°C. The released oligosaccharides were purified with graphitic carbon cartridges and lyophilized. Dried oligosaccharide samples were dissolved in a glass tube using 50 ⁇ l_ of
  • DMSO DMSO-NaOH slurry and 50 ⁇ l of methyl iodide were then added. Tubes were capped tightly and stirred for about 10 min at room temperature. The reaction was stopped by the addition of water (2 ml). The permethylated oligosaccharides were extracted into chloroform (1 ml) by vortex mixing. The lower organic layer containing the permethylated oligosaccharides was washed with water (3 ⁇ 2 mL) and dried with a stream of nitrogen at room temperature. The permethylated products were dissolved in 75% methanol and purified with C 18 Sep- Pak cartridge.
  • the spectrometer was operated in the positive reflectron mode. The spectra were accumulated by 1000 laser shots.
  • the matrix used was 1 mg/mL dihydroxybenzoic acid in 75% acetonitrile.
  • 1 ,4,7,10-tetraazacyclododecane-N,N',N",N'"-tetraacetic acid was activated by N-hydroxysulfosuccinimide (sulfo-NHS) and 1 -ethyl-3-[3- (dimethylamino)propyi] carbodiimide (EDC) in a mixture solution (pH 5.5) at 4 0 C for 30 min.
  • Purified antibody was reacted with a 1 ,000: 1 ,000: 100:1 molar ratio of 1 ,4,7, 10-tetraazacyclododecane-N,N',N",N'"-tetraacetic acid (DOTA)DOTA:su ⁇ fo- NHS:EDC:antibody in 0.1 M Na 2 HPO 4 (pH 7.5) at 4 0 C for 12-16 hr.
  • the reaction mixture was centrifuged repeatedly through a YM-30 centricon with 30 mM ammonium citrate buffer (pH 6.5) to remove unconjugated small molecules.
  • the purified conjugate was concentrated to 1 mg/ml in 30 mM ammonium citrate buffer and stored at -2O 0 C for further use.
  • 64 Cu 64 CuCI 2 in 0.1 M HCI; radionuclide purity > 99% was purchased from Washington University (St. Louis, MO).
  • DOTA-conjugated antibody 150 ⁇ g of DOTA-conjugated antibody and 1 mCi of 64 Cu were incubated in 30 mM ammonium citrate (pH 6.5) at 43 0 C for 45 min. The reaction was terminated by addition of 5 ⁇ l 10 mM diethylenetriaminepentaacetic acid solution. Labeled antibody was separated by a size exclusion Bio-SpinTM 6 column (Biorad, Mississauga, ON). Radiolabeling efficiency was determined by integrating peak areas on Fast Protein Liquid Chromatography (FPLC) chromatograms and determining the percentage of radioactivity associated with the antibody peaks.
  • FPLC Fast Protein Liquid Chromatography
  • the human pancreatic carcinoma cell line MIA PaCa-2 was maintained in DMEMTM (Gibco, Gaithersburg, MD) supplemented with 10% fetal bovine serum (FBS; Gibco, Gaithersburg, MD).
  • FBS fetal bovine serum
  • MIA PaCa-2 pancreatic cancer cells (3 x 10 6 in sterile saline) were injected subcutaneously into the right flank of the animals.
  • the animal models were imaged when tumors reached the size of 300-500 mm 3 .
  • About 400 ⁇ Ci/120 ⁇ g of 64 Cu-DOTA-antibody was administered via tail vain injection to mice under Metofane anesthesia. The animals were allowed free access to food and water.
  • mice were re-anesthetized and imaged using microPET/CT scanner at the time points indicated.
  • MicroPET/CT imaging of mice was performed using a tri-modality microPET/CT/SPECT imager (Gamma Medica FLEX Inc., CA) for functional and anatomical imaging.
  • MicroCT has an X-ray tube of 80 kVp, 0.5 mA fixed anode with tungsten target to provide anatomical imaging with spatial resolution of ⁇ 100 ⁇ m.
  • X- ray CT has a 4.72" bore suitable for imaging small animals. Images were acquired at a fast scan time of 1 min and reconstructed using cone beam filtered back-projection (modified Feldkamp) reconstruction algorithm with streak artifact reduction.
  • Live animal images were acquired at low radiation doses (1.2 cGy) for 1 min fly mode scan.
  • the microPET scanner has a solid ring design of bismuth germanate (BGO) detector blocks and continuous automatic photomultiplier gain stabilization technology.
  • the 16.5 cm diameter ring is located in the same gantry.
  • the scanner provides a 10 cm transaxial and 11.6 cm axial field of view.
  • the scanner is capable of an axial and transaxial resolution of 2 mm. Images were reconstructed using 2D filtered back-projection (2D OSEM) and 3D filtered back-projection (3D OSEM).
  • the calibration factor to convert PET image units of counts/sec/voxel to ⁇ Ci/cc was calculated from a mouse-sized cylinder with a known concentration of 18 F in water assuming a tissue density of 1 g/cc. No additional attenuation correction was applied.
  • the conversion of positron activity of 18 F to that of 64 Cu was carried out by the ratio of the branching ratios of the positron decay of the isotopes.
  • the calculated concentrations of radioactivity were multiplied by the volume of each region of interest (ROI) to determine total radioactivity present within regions. ROI was analyzed using Analyzer AVW 3.0 software (Biomedical Imaging Resource, Mayo
  • EGFRvlll-ECD construction of immune phage display library and subsequent panning.
  • peripheral leukocytes were isolated from llama blood, total RNA was isolated and cDNA synthesized.
  • DNA encoding the variable regions of HCAbs was amplified and flanked with Sfi ⁇ restriction sites using nested PCR.
  • the amplified DNA was digested with Sfi ⁇ restriction enzyme and ligated into pMED1.
  • the ligation products were transformed into E. coli TG 1 cells, generating an immune sdAb phagemid library with a size of 5.5x10 7 , which is rescued by helper phage M13KO7.
  • Phage ELISA demonstrated 44 of the 45 clones were positive for EGFRvlll-ECD binding. Phage ELISA on EGFR-ECD indicated that these phages bound to wild type EGFR as well.
  • Analysis of encoding sequences of the sdAbs displayed on the phage clones revealed 11 different sdAb genes. These sdAbs can be divided into four groups based on CDR sequence identity (see Figure 2).
  • the four anti-EGFR sdAbs were analyzed for their binding to EGFR-ECD by surface plasmon resonance.
  • the on-rates of the sdAbs were quite similar, but their off-rates have significant differences.
  • the dissociation constants (K D s) of the sdAbs range from 55 nM (EG2) to 440 nM (EG31) (Fig. 4A and Table 1 ).
  • pTT5 is a derivative of an E. coli -mammalian shuttle vector pTT ( Bruggemann, M., Williams, G. T., Bindon, C. I., Clark, M. R., Walker, M. R., Jefferis, R., Waldmann, H., & Neuberger, M. S. (1987) The Journal of experimental medicine 166, 1351 -1361). which has both bacterial origin of replication (pMB1 ) and Epstein Barr Virus origin of replication (OriP).
  • pMB1 bacterial origin of replication
  • OriP Epstein Barr Virus origin of replication
  • the expression unit includes CMV promoter (pCMV), adenovirus tripartite leader (TPL), adenovirus major late promoter enhancer (Enh MLP) and polyA (pA).
  • DNA encoding Fc of human IgGI was flanked by DNA encoding signal peptide sequence of V H and hinge region of human IgGI at the 5'-end and inserted into EcoR ⁇ and Apa ⁇ restriction sites of pTT5. This generated pTT5-hFc (Fig. 6A).
  • Example 3 Construction and characterization of EG2 pentabody and of EG2 cHCAb.
  • EG2 the sdAb with the highest affinity for EGFR-ECD, was used to construct pentabody and cHCAb.
  • DNA encoding EG2 was amplified by PCR and flanked with restriction sites BspEI and BamHI.
  • the amplified DNA was digested and ligated into the pentamerization vector pVT2 (Stone, E., Hirama, T., Tanha, J., Tong-Sevinc, H., Li, S., MacKenzie, C. R., & Zhang, J. (2007) Journal of immunological methods 318, 88-94) digested with the same enzymes.
  • the generated clone expresses pentameric EG2, V2C-EG2 (Fig. 3A), which was purified by IMAC.
  • the yield of V2C-EG2 was 43.9 mg per liter of culture.
  • sdAb was amplified and cloned into HCAb vector pTT5-hFc (see Example 1 ), which is designed to fuse a protein to the Fc of human IgGL No extra residue was introduced due to cloning procedure and the final protein contained only sdAb-hinge-C H 2-C H 3 domains.
  • An overlap extension PCR was employed to make the fusion (Fig. 1 B). The product of the final PCR product was digested by EcoRI and Sacll and ligated into pTT5-hFc digested with the same enzymes.
  • the generated clone EG2-hFc (Fig. 3A, 6B) was used to transiently transfect
  • EG2-hFc produced by the cells was purified by Protein A affinity chromatography. The yield of EG2-hFc was in the range of 20 to 30 mg per liter of HEK293 culture. Sequence analysis of EG2-hFc indicated that a GIu to VaI mutation at position 5 of EG2 occurred during PCR amplification of EG2 but this did not affect the binding of EG2-hFc to EGFR (Fig. 4).
  • EG2, V2C-EG2 and EG2-hFc were subjected by SDS-PAGE and size exclusion chromatography to analyze their subunits and molecular masses.
  • Denatured EG2 sdAb, V2C-EG2 pentabody and EG2-hFc cHCAb migrated at 13 kDa, 21 kDa and 37 kDa, respectively (Fig. 3B).
  • Size exclusion chromatography results indicate that EG2, V2C-EG2 and EG2-hFc have molecular weights of 14 kDa, 108 kDa and 90 kDa, respectively (Fig. 3C).
  • V2C-EG2 exists as a monomer
  • EG2-hFc EG2-hFc
  • the measured size of V2C-EG2 (108 kDa) is slightly smaller than the predicted size (126 kDa). Nevertheless, it is still considered to be a pentamer based on the approximation of the two data and our previous results of other pentabodies.
  • Example 4 lmmunochemistry with cHCAbs.
  • sdAbs in the cHCAbs retained their antigen-binding ability and are comparable to conventional IgG
  • immunocytochemical staining of target cells were performed with the cHCAb.
  • EG2-hFC was used to stain breast cancer cells MDA-MB-468 for the universal expression of EGFR on MDA-MB-468. Strong staining of the cells was observed and the staining pattern match the antigen expression pattern: practically every MDA-MB-468 cell was stained positive by EG2-hFC (Fig. 7). This result suggested that cHCAbs were as functional as conventional IgGs in terms of antigen binding.
  • Example 5 Glycan profiling.
  • the glycosylation patterns can influence the physicochemical properties of glycoproteins, stability, and solubility.
  • the efficacy of recombinant/monoclonal antibodies may also depend on the specific glycoforms present.
  • N- glycans of the cHCAbs were released with PNGase F, purified using graphitic carbon cartridges, permethylated with methyl iodide and then analyzed using mass spectrometry.
  • the MALDI-TOF/TOF mass spectra for the permethylated ⁇ /-glycans from EG2-hFc is presented in Fig. 8.
  • the dominant sodium adducts appear at m/z 1836 and 2040, corresponding to the compositions of Hex 3 Fuci HexNAc 4 (GO type) and HeX 4 FuC 1 HeXNAc 4 (GI type), respectively.
  • Tandem mass spectrometric analysis of m/z 1836 confirmed the Hex 3 (Fuc- ⁇ )HexNAc 4 structure; whereas MS/MS experiment of ion at m/z 2040 indicated the existence of an additional hexose residue.
  • minor peaks that corresponding to G2 type structure were detected in all samples, i.e. m/z 2245. It is worth noting that a minor peak in the mass spectrum of EG2-hFC indicated an additional HexNAc in this glycoprotein.
  • EG2-hFc has three types of glycosylation, Hex 3 (Fuc- ⁇ )HexNAc 4 , Hex 4 (Fuci)HexNAc 4 and HeX 5 (FuC 1 )HeXNAc 4 .
  • Example 6 MicroPET/CT imaging of human pancreatic carcinoma model in nude mice using the constructed antibodies.
  • EG2, V2C-EG2 and EG2-hFc were labeled with 64 Cu and used for imaging of a human pancreatic carcinoma model MIA PaCa-2 established in nude mice.
  • MicroPET/CT fused images indicated that the majority of EG2 and V2C-EG2 localizes in the kidneys within 1 hr post-injection (Fig 5A and 5B). Both proteins are barely detectable in the tumor at 1 hr, 4 hr and 20 hr.
  • microPET/CT images of mice administered with EG2-hFc reveal gradual accumulation of EG2-hFc in the tumor even at 44 hr post-injection (Fig. 5C).
  • quite good tumor to muscle contrast is observed at 20 hr post-injection, and the contour of the tumor in the PET image matches the true tumor shape quite well.
  • sdAbs targeting EGFR The isolation of eleven sdAbs targeting EGFR and the construction of a pentabody (V2C-EG2) and a cHCAb (EG2-hFc) based on one of the sdAbs of the invention, EG2, is described herein.
  • the three types of antibodies were radiolabeled with 64 Cu and microPET/CT imaging was used to analyze their in vivo targeting and distribution in a MIA PaCa-2 human pancreatic carcinoma xenograft mouse model.
  • the sdAb was cleared from the circulation rapidly after injection.
  • the pentabody despite its large size (126 kDa), behaved like the sdAb.
  • the cHCAb accumulated in tumor over time and showed excellent tumor-targeting ability. This indicates that cHCAb, not sdAb and pentabody, is an appropriate sdAb-based tumor-targeting molecule.
  • tumor penetration is a more difficult parameter to measure.
  • Smaller antibody fragments have been shown to penetrate into deeper areas of tumor tissue (Buchegger, F., Haskell, C. M., Schreyer, M., Scazziga, B. R., Randin, S., Carrel, S., & Mach, J. P. (1983) The Journal of experimental medicine 158, 413-427).
  • the faster tumor penetration rate didn't result in improved tumor targeting because of accelerated clearance.
  • removal of Fc would abrogate the induction of ADCC and CDC, which are generally critical for antibody therapy.
  • sdAbs The relatively small size (-14 kDa) of sdAbs makes it possible to fulfill both requirements.
  • EG2-hFc reported here has a complete human Fc and yet is only approximately 80 kDa in size.
  • the inventors refer to this type of molecule as chimeric HCAb because of its human Fc and llama sdAb.
  • Fully human HCAb (hHCAb) can be constructed if human sdAbs are used (To, R., Hirama, T., Arbabi-Ghahroudi, M., MacKenzie, R., Wang, P., Xu, P., Ni, F., & Tanha, J.
  • thermostability of antibodies is essential for in vivo tumor targeting, a balance must be obtained between biophysical properties and immunogenicity (Willuda, J., Honegger, A., Waibel, R., Schubiger, P. A., Stahel, R., Zangemeister-Wittke, U., & Pluckthun, A. (1999) Cancer research 59, 5758-5767).
  • IgGs are glycosylated with branched oligosaccharides at position Asn297. It is now known that antibody function is greatly affected by its glycotype: Afucosylated IgGs have 10-fold increase in binding to human FcgRllla and are more potent in ADCC induction (Shinkawa, T., Nakamura, K., Yamane, N., Shoji-Hosaka, E., Kanda, Y., Sakurada, M., Uchida, K., Anazawa, H., Satoh, M., Yamasaki, M., Hanai, N., and Shitara, K. (2003).
  • Glycan types vary in antibodies obtained from different expression systems.
  • Recombinant antibodies produced in Chinese Hamster Ovary (CHO) cells are known to contain smaller number of glycans in contrast to other expression system such as mouse myeloma cell line NSO or rat hybridoma YB2/0 (Shinkawa, T., Nakamura, K., Yamane, N., Shoji-Hosaka, E., Kanda, Y., Sakurada, M., Uchida, K., Anazawa, H., Satoh, M., Yamasaki, M., Hanai, N., and Shitara, K. (2003), J Biol Chem. 278, 3466- 73).
  • HCAb profiling demonstrated that the glycosylation patterns of HCAbs are similar to IgGs from CHO expression.
  • CHO-produced antibodies have five types of glycans including four fucosylated ones (one GO, two G1 and one G2) and one afucosylaed one (G1 ) (Shinkawa, T., Nakamura, K., Yamane, N., Shoji-Hosaka, E., Kanda, Y., Sakurada, M., Uchida, K., Anazawa, H., Satoh, M., Yamasaki, M., Hanai, N., and Shitara, K. (2003, J Biol Chem. 278, 3466-73) .
  • HEK293 produced HCAb have at least three types of fucosylated glycans (one GO, one or two G1 and one G2). This suggests that HCAb will have the similar ability to induce ADCC as conventional IgG does.
  • HCAb reported here are chimeric ones because camelid sdAbs are used.
  • fully human HCAbs can be readily constructed when human sdAbs are employed (Jespers, L., Schon, O., Famm, K., and Winter, G.
  • HCAbs are expected to inherit major advantages of conventional IgGs such as strong neutralization capability, ability of inducing ADCC and CDC and long serum half life.
  • HCAb may be superior to conventional IgG in certain aspects which include: 1) It may have better targeting ability when solid tissue is regarded; 2) It may be able to target epitopes that are not readily accessible to IgGs due to their larger antigen binding surface; 3) High level expression of HCAb may be easier to reach because of its simpler structure; 4) Dose requirement may be lower because of its lower molecular weight, which is approximately half of that of IgG.
  • the yield of the cHCAb, EG2-hFc of the present invention is 21 mg per liter of culture after transient transfection and purification. A yield of over 100 mg per liter of culture was achieved from a very similar construct, indicating the potential of reaching very high expression for cHCAb.
  • HCAbs either cHCAb or hHCAb, have the potential to serve as better therapeutic antibody formats in comparison to conventional IgGs because of the following advantages: 1) potentially, better tumor penetration; 2) potentially, higher production yield due to simpler molecular structure; 3) potentially, lower dose requirement due to molecular weight that is approximately half that of IgG and 4) easier fusion to other entities such as cytokines.
  • sdAb-based antibodies their ability to target the so-called hidden epitopes that are inaccessible to conventional IgGs (Lauwereys, M., Arbabi Ghahroudi, M., Desmyter, A., Kinne, J., Holzer, W., De Genst, E., Wyns, L., & Muyldermans, S.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Immunology (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Genetics & Genomics (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Inorganic Chemistry (AREA)
  • Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Epidemiology (AREA)
  • Peptides Or Proteins (AREA)

Abstract

La présente invention concerne le domaine des anticorps dirigés contre le récepteur du facteur de croissance épidermique (EGFR). La présente invention concerne plus particulièrement des polypeptides anti-EGFR (p. ex. anticorps à domaine unique : sdAb) et des séquences d'acides nucléiques qui codent pour ces polypeptides, dirigés contre EGFR et ses clones, qui ciblent EGFR. L'invention concerne également un anticorps à domaine unique qui est fusionné avec un fragment cristallisable (Fc) d'une protéine immunoglobuline afin de générer une protéine chimère. Ces protéines anti-EGFR peuvent ainsi être utilisées pour cibler des tumeurs qui présentent EGFR à leur surface, ainsi que pour diagnostiquer et traiter plusieurs types de cancer associés avec des cellules qui surexpriment EGFR à leur surface.
PCT/CA2008/000966 2007-05-18 2008-05-20 Anticorps à domaine unique et anticorps à chaîne lourde contre egfr et leurs utilisations WO2008141449A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
CA2,588,106 2007-05-18
CA002588106A CA2588106A1 (fr) 2007-05-18 2007-05-18 Anticorps a domaine unique et anticorps a chaines lourdes ciblant le recepteur du facteur de croissance epidermique et utilisations connexes

Publications (1)

Publication Number Publication Date
WO2008141449A1 true WO2008141449A1 (fr) 2008-11-27

Family

ID=40030393

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/CA2008/000966 WO2008141449A1 (fr) 2007-05-18 2008-05-20 Anticorps à domaine unique et anticorps à chaîne lourde contre egfr et leurs utilisations

Country Status (2)

Country Link
CA (1) CA2588106A1 (fr)
WO (1) WO2008141449A1 (fr)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8758756B2 (en) 2011-12-28 2014-06-24 Industrial Technology Research Institute Anti-human epidermal growth factor receptor antibody and uses thereof
CN105940113A (zh) * 2013-11-13 2016-09-14 酵活有限公司 靶向egfr和/或her2的单价抗原结合构建体及其用途
NO20170739A1 (en) * 2017-05-04 2018-11-05 Patogen As Novel virus in Fish and Method for detection
US10457742B2 (en) 2011-11-04 2019-10-29 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the Fc domain
CN111848793A (zh) * 2014-10-23 2020-10-30 辛格生物技术有限公司 针对细胞内抗原的单域抗体
US10875931B2 (en) 2010-11-05 2020-12-29 Zymeworks, Inc. Stable heterodimeric antibody design with mutations in the Fc domain
WO2022121928A1 (fr) * 2020-12-09 2022-06-16 江苏先声药业有限公司 Nanocorps anti-egfr et utilisation associée
US12060436B2 (en) 2012-11-28 2024-08-13 Zymeworks Bc Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005044858A1 (fr) * 2003-11-07 2005-05-19 Ablynx N.V. Polypeptide vhh de camelidae, anticorps a domaine unique diriges contre le recepteur de facteur de croissance epidermique et utilisations de ceux-ci
WO2007042289A2 (fr) * 2005-10-11 2007-04-19 Ablynx N.V. Nanobodies™ et polypeptides diriges contre l'egfr et l'igf-1r

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2005044858A1 (fr) * 2003-11-07 2005-05-19 Ablynx N.V. Polypeptide vhh de camelidae, anticorps a domaine unique diriges contre le recepteur de facteur de croissance epidermique et utilisations de ceux-ci
WO2007042289A2 (fr) * 2005-10-11 2007-04-19 Ablynx N.V. Nanobodies™ et polypeptides diriges contre l'egfr et l'igf-1r

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
OMIDFAR K. ET AL.: "Production and characterization of a new antibody specific for the mutant EGF receptor", TUMOUR BIOL., vol. 25, no. 4, July 2004 (2004-07-01) - August 2004 (2004-08-01), pages 179 - 187, XP009044126 *
OMIDFAR K. ET AL.: "Production of a novel camel single-domain antibody specific for the type II mutant EGFR", TUMOUR BIOL., vol. 25, no. 5-6, September 2004 (2004-09-01) - December 2004 (2004-12-01), pages 296 - 305, XP009147922, DOI: doi:10.1159/00081395 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10875931B2 (en) 2010-11-05 2020-12-29 Zymeworks, Inc. Stable heterodimeric antibody design with mutations in the Fc domain
US10457742B2 (en) 2011-11-04 2019-10-29 Zymeworks Inc. Stable heterodimeric antibody design with mutations in the Fc domain
US8758756B2 (en) 2011-12-28 2014-06-24 Industrial Technology Research Institute Anti-human epidermal growth factor receptor antibody and uses thereof
US12060436B2 (en) 2012-11-28 2024-08-13 Zymeworks Bc Inc. Engineered immunoglobulin heavy chain-light chain pairs and uses thereof
CN105940113A (zh) * 2013-11-13 2016-09-14 酵活有限公司 靶向egfr和/或her2的单价抗原结合构建体及其用途
CN111848793A (zh) * 2014-10-23 2020-10-30 辛格生物技术有限公司 针对细胞内抗原的单域抗体
CN111848793B (zh) * 2014-10-23 2023-08-18 辛格生物技术有限公司 针对细胞内抗原的单域抗体
NO20170739A1 (en) * 2017-05-04 2018-11-05 Patogen As Novel virus in Fish and Method for detection
NO344051B1 (en) * 2017-05-04 2019-08-26 Patogen As Novel virus in Fish and Method for detection
WO2022121928A1 (fr) * 2020-12-09 2022-06-16 江苏先声药业有限公司 Nanocorps anti-egfr et utilisation associée

Also Published As

Publication number Publication date
CA2588106A1 (fr) 2008-11-18

Similar Documents

Publication Publication Date Title
Bell et al. Differential tumor-targeting abilities of three single-domain antibody formats
Zhang et al. Transient expression and purification of chimeric heavy chain antibodies
AU2007315211B2 (en) FGFR4 antibodies
KR101782487B1 (ko) 신규 항-메소텔린 항체 및 이를 포함하는 조성물
KR102355310B1 (ko) 인슐린-유사 성장 인자 1 수용체-특이적 항체 및 그의 용도
KR102355309B1 (ko) 인슐린-유사 성장 인자 1 수용체-특이적 항체 및 그의 용도
WO2008141449A1 (fr) Anticorps à domaine unique et anticorps à chaîne lourde contre egfr et leurs utilisations
KR102406610B1 (ko) 혈액-뇌 장벽을 통과이동하는 인간화 항체 및 그의 용도
JP7419238B2 (ja) Ｐｄ１結合剤
US20220119546A1 (en) Plectin-1 binding antibodies and uses thereof
WO2022129622A1 (fr) Molécules de liaison à un antigène variant spécifique de ror1
EP4289862A1 (fr) Anticorps anti-b7-h3 humain et utilisation associée
EP3310816B1 (fr) Immunoglobulines conjuguées cys80
EP4279507A1 (fr) Protéine de liaison à cd73 et son utilisation
KR20230003067A (ko) 미스폴딩된 tdp-43에 대한 단일쇄 항체 및 인트라바디 그리고 사용 방법
US20220380485A1 (en) Single domain antibodies specifically binding globo - series glycans
US20240115720A1 (en) Antibody-pyrrolobenzodiazepine derivative conjugate
WO2024131846A1 (fr) Anticorps, fragment de liaison à l'antigène de celui-ci et utilisation pharmaceutique associée
EP3981786A1 (fr) Nouveaux anticorps dirigés contre le virus de l'hépatite b et ses utilisations
WO2024173565A2 (fr) Anticorps synthétiques humains ciblant des mutations du récepteur 2 du facteur de croissance épidermique humain (her2)
WO2024133763A2 (fr) Molécules de liaison à un antigène variant spécifique d'alpp
WO2023227644A2 (fr) Protéine de liaison
KR20240099470A (ko) 항-cldn18.2 단일클론 항체 및 이의 응용
CN114426580A (zh) 抗csf-1r抗体及其产品、方法和用途
CN118047871A (zh) 一种靶向FRα的抗体或其抗原结合片段及其应用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08757112

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08757112

Country of ref document: EP

Kind code of ref document: A1