WO2008098145A1 - Procédés de modulation des réponses des lymphocytes b spécifiques des antigènes - Google Patents

Procédés de modulation des réponses des lymphocytes b spécifiques des antigènes Download PDF

Info

Publication number
WO2008098145A1
WO2008098145A1 PCT/US2008/053350 US2008053350W WO2008098145A1 WO 2008098145 A1 WO2008098145 A1 WO 2008098145A1 US 2008053350 W US2008053350 W US 2008053350W WO 2008098145 A1 WO2008098145 A1 WO 2008098145A1
Authority
WO
WIPO (PCT)
Prior art keywords
cells
antigen
cell
immune response
binding
Prior art date
Application number
PCT/US2008/053350
Other languages
English (en)
Inventor
Edward A. Clark
Martha Hayden-Ledbetter
Lorna Santos
Original Assignee
University Of Washington
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University Of Washington filed Critical University Of Washington
Publication of WO2008098145A1 publication Critical patent/WO2008098145A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2878—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the NGF-receptor/TNF-receptor superfamily, e.g. CD27, CD30, CD40, CD95
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/705—Receptors; Cell surface antigens; Cell surface determinants
    • C07K14/70503—Immunoglobulin superfamily
    • C07K14/70521—CD28, CD152
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2803—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against the immunoglobulin superfamily
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/2887—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants against CD20
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/20—Immunoglobulins specific features characterized by taxonomic origin
    • C07K2317/24—Immunoglobulins specific features characterized by taxonomic origin containing regions, domains or residues from different species, e.g. chimeric, humanized or veneered
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2317/00—Immunoglobulins specific features
    • C07K2317/60—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments
    • C07K2317/62—Immunoglobulins specific features characterized by non-natural combinations of immunoglobulin fragments comprising only variable region components
    • C07K2317/622—Single chain antibody (scFv)
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/33—Fusion polypeptide fusions for targeting to specific cell types, e.g. tissue specific targeting, targeting of a bacterial subspecies
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/40—Fusion polypeptide containing a tag for immunodetection, or an epitope for immunisation
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/70—Fusion polypeptide containing domain for protein-protein interaction
    • C07K2319/74—Fusion polypeptide containing domain for protein-protein interaction containing a fusion for binding to a cell surface receptor

Definitions

  • the invention generally relates to methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors CD22 and CD72.
  • the invention further relates to methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors preferentially expressed on B lymphocytes and containing an immunoreceptor tyrosine inhibitory motif (ITIM).
  • ITIM immunoreceptor tyrosine inhibitory motif
  • DCs Dendritic cells
  • Ags foreign antigens
  • T lymphocytes T lymphocytes
  • both B cells and DCs have been implicated in immune responses to autoantigens (e.g., see Yan et al, 2006).
  • Yan et al (2006) showed that recognition of auto-Ag by Ag-specific B cells was required to initiate a T cell autoimmune response.
  • MAbs to a range of different surface molecules have been used to deliver Ags to DCs in vivo and/or in vitro including MHC class II, CDl Ic, DEC205/CD205, DC-SIGN/CD209, F4/80-like receptor (FIRE), CIRE, Dectin-1, Dectin-2, 33D1/DCIR2, and the mannose receptor (Finkelman et al, 1996, Bonifaz et al, 2002, 2004, Engering et al, 2002, Chieppa et al, 2003, Ramakrishna et al, 2004, Debal et al, 2005, Tacken et al, 2005, Corbett et al, 2005, Boscardin et al, 2006, Trumpfheller et al, 2006, Carter et al, 2006a,b, Dudziak et al, 2006).
  • the mAb-based Ag delivery system can be two orders of magnitude more effective than non-targeted Ags in activating protective immunity.
  • Simultaneous injection of Ag- anti-DC conjugates with a anti-CD40 mAb significantly enhanced host immune responses more than the classic Alum + Ag vaccine (Bonifaz et al, 2004, Boscardin et al, 2006).
  • This important finding is highly pertinent to the field of DNA vaccination, where many studies have found that DNA alone can induce Ab responses comparable with unadjuvanted protein immunogens, but 'for sheer magnitude of Ab titers DNA alone could not equal a potent protein plus adjuvant' (Donnelly et al, 2005).
  • Ag delivered via anti-FIRE, anti-CIRE or anti-Dectin-1 mAbs triggers specific antibody responses without an adjuvant, while Ag with anti-DEC205 does not (Corbett et al, 2005, Carter et al, 2006b).
  • Ag with anti-DEC205 does not (Corbett et al, 2005, Carter et al, 2006b).
  • several recent studies suggest that different immune responses are induced depending on which DC subset is targeted to receive the antigen.
  • Targeting Ags to 33Dl or Dectin-1 using mAbs promotes CD4 T cell and antibody responses better than CD8 responses while targeting Ags to DEC205 promotes better CD8 than CD4/antibody responses (Boscardin et al, 2006, Dudziak et al, 2006, Carter et al, 2006).
  • the invention generally relates to methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors CD22 and CD72.
  • the antigen can be from an infectious agent, is a tumor-associated antigen, or an autoantigen.
  • modulating the immune response generates protective immunity to a pathogen.
  • modulating an immune response suppresses autoantibody production.
  • the invention further relates to methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors preferentially expressed on B lymphocytes and containing an immunoreceptor tyrosine inhibitory motif (ITIM).
  • the antigen can be from an infectious agent, is a tumor-associated antigen, or an autoantigen.
  • modulating an immune response suppresses autoantibody production.
  • a method for modulating an immune response in a subject which comprises targeting antigens to B cell surface receptors using an scFvIg derived from an antibody which binds to the receptor, and which genetically fuses the antigen to the carboxyl end of the scFvIg moiety.
  • a method for creating an scFvIg-Ag fusion protein comprises genetically fusing the scFvIg directly to the antigen specificity of interest, without any intervening sequence.
  • a method for creating an scFv Ig-Ag fusion protein is provided which comprises genetically fusing the scFvIg to the antigen through use of a spacer linker to physically separate functional domains.
  • a method for creating an scFvIg-Ag fusion protein is provided which comprises genetically fusing the scFvIg to the antigen by a hydrophilic linker to improve solubility and decrease steric hindrance between protein domains.
  • a composition is provided which comprises a CD22 binding molecule that does not fix complement, or mediate ADCC, or lead to destruction of the cells to which it binds.
  • a method for modulating an immune response in a subject comprises targeting antigens into the immune system through surface receptors on dendritic cells together with an inhibitor of CD22 function or binding.
  • the antigen can be from an infectious agent, a tumor-associated antigen, or an autoantigen.
  • modulating the immune response can generate protective immunity to a pathogen
  • modulating the immune response can suppress autoantibody production.
  • a method for modulating an immune response in a subject comprises targeting antigens into the immune system through surface receptors on dendritic cells together with an inhibitor of CD22 function or binding.
  • the antigen can be from an infectious agent, a tumor-associated antigen, or an autoantigen.
  • modulating the immune response can generate protective immunity to a pathogen
  • modulating the immune response can suppress autoantibody production.
  • a method for modulating an immune response in a subject comprises targeting antigens into the immune system through CD22 receptors on B lymphocytes whereby CD22 binding to dendritic cells is inhibited.
  • the immune system is altered or suppressed.
  • FIG. 1 Immature DCs, but not mature DCs, inhibit BCR- induced proliferation of B cells.
  • Purified CFSE-labeled B cells from WT mice were co-cultured with either WT bone marrow-derived iDCs (A) or mDCs (B) and the indicated graded doses of anti-IgM.
  • CFSE dilution of the B cells was examined 72 hours post-incubation by flow cytometry. Two different B cell:DC ratios were examined (4: 1 and 16: 1). The histograms shown are from cultures where the B cell:DC ratio was 4: 1. Results from both ratios are shown in graph format. These results are representative of at least 8 independent experiments.
  • FIG. 1 iDC-mediated inhibition of WT B cells is contact dependent.
  • Purified CFSE-labeled B cells from WT mice were co-cultured with either WT bone marrow-derived iDCs (A) or mDCs (B) and the indicated concentrations of anti-IgM ("contact").
  • the DCs and B cells were physically separated using transwells with a pore size of 0.4 ⁇ m ("transwell").
  • transwell a pore size of 0.4 ⁇ m
  • FIG. 3 (A) WT iDCs do not inhibit BCR-induced proliferation of CD22-deficient B cells. (B) ST6GalI-deficient iDCs inhibit BCR-induced proliferation of WT B cells in a contact-dependent manner. (A) Purified CFSE- labeled B cells from CD22-def ⁇ cient mice were co-cultured together ("contact") or in transwells ("transwell”) with WT bone marrow-derived iDCs and graded doses of anti-IgM ("contact”). (B) Purified CFSE-labeled B cells from WT mice were co- cultured with ST6Gal-I-deficient bone marrow-derived iDCs and graded doses of anti-IgM. The same method described in Figure 2 was used. These results are representative of at least 3 independent experiments.
  • FIG. 4 Soluble CD22 binds to WT and SToGaII KO DCs.
  • FIG. 5 Cleavage of sialic acids does not disrupt CD22 binding on DCs.
  • the binding of the purified chimeric CD22 fusion proteins to the surface of WT DCs and B cells following cleavage of sialic acids was quantified by flow cytometry.
  • Arthrobacter ureafaciens neuraminidase treated cells (A) and cells treated by mild sodium metaperiodate oxidation for 30 minutes (B) were stained with the indicated fusion proteins or control human IgG (Fc fragment) along with anti-human IgG-PE secondary and CD19-FITC (for the splenocytes) or CDl Ic-FITC (for the iDCs).
  • the cells were gated on CD 19+ (B cells) or CDl lc+ (iDCs).
  • the neuraminidase and sodium metaperiodate-treated human IgG control was similar to the untreated sample shown.
  • the results shown are representative of 3 experiments.
  • FIG. 6 CD22 and ST ⁇ Gal-I KO mice have fewer MZ B cells and T2 B cell precursors compared to WT.
  • A Development of splenic B cell subsets and expression of various surface markers.
  • B Total splenocytes were isolated from WT and ST ⁇ Gal-I KO mice. The splenocytes were analyzed for surface expression of IgM, IgD and CD21 by flow cytometric analysis. The percent of each B cell subset is shown in the table. Data represent mean ⁇ standard deviation. MZ, marginal zone; FO, follicular mature; *, P ⁇ 0.05; and **, P ⁇ 0.01. n>3 mice per genotype.
  • FIG. 7 Absolute numbers of B cell subsets in spleen.
  • Total splenocytes were isolated from WT and CD22 KO mice. The splenocytes were analyzed for surface expression of IgM, IgD and CD21 by flow cytometric analysis. The absolute number of each B cell subset is shown in the table. Data represent mean ⁇ standard deviation. MZ, marginal zone; FO, follicular mature; *, P ⁇ 0.05; and **, P ⁇ 0.01. n>10 mice.
  • FIG. 8 CD22-deficient iDCs do not inhibit BCR-induced proliferation of CD22-deficient B cells.
  • Purified CFSE-labeled B cells from CD22- deficient mice were co-cultured with CD22-deficient bone marrow-derived iDCs and the indicated concentrations of anti-IgM.
  • CFSE dilution of the B cells was examined 72 hours post-incubation by flow cytometry. Two different ratios of B cell: DC were examined (4: 1 and 16:1).
  • FIG. 9 ST ⁇ Gall-deficient DCs do not express ⁇ 2-6-linked sialic acids.
  • FIG. 10 Schematic structure of planned scFvIg-Ag targeting fusion genes.
  • the scFv domain of the desired monoclonal antibody is cloned from the expressing hybridoma.
  • the VL and VH domains are linked by one of several linker domains, including (gly4ser)3, (gly4ser)4, and a hydrophilic linker containing gly and ser residues.
  • the scFv is expressed as part of a fusion gene that contains the mouse, human, or macaque IgG2a or IgGl domains, mutated at a series of residues implicated in mediation of effector function.
  • the fusion gene also contains an antigen fragment or the intact antigen which is to be targeted to the lymphocyte subset of interest.
  • Figure 11 Alignment of murine IgG2a, human IgGl, and macaque IgGl- [hinge-CH2-CH3]- amino acid sequences. Sequence matches between all three sequences are highlighted in yellow, homology matches between two sequences are highlighted in light blue, and conservative sequence changes are highlighted in green. The consensus sequence is listed at the bottom. Residues enclosed in boxes are a subset of the residues identified as important in ADCC, CDC, or FcR binding. These residues are P238 (ADCC), N297 (FcR binding, ADCC, CDC, and glycosylation), K322 (CIq binding, CDC), and P331 (CIq binding, CDC).
  • FIG. 12 Structure of a prototype scFv-Ag fusion protein.
  • cDNA cassettes encoding anti CD22 V L and V H segments were cloned from the hybridoma, fused by one of three potential (glyser) based linkers, and attached to a mutated murine IgG2a (hlgGl or macaque IgGl) Fc domain, including an SCC hinge and (P238S/K322S/P331S) Fc.
  • the single chain cDNA is expressed from a DNA vaccine or mammalian expression vector designed to express soluble protein.
  • the single chain fusion protein also encodes a linker-Ag domain attached to the carboxyl end of the CH3.
  • FIG. 13 niDCAL-2 expression.
  • mDCAL-2 (red) is expressed on mouse CD8- & CD8+ DCs,PDCAl+ pDCs and B cells in spleen but not on NK cells or CD4+ or CD8+ T cells.
  • Mouse spleen cells were isolated from 6 week old wild type mice and fractionated into different subsets using magnetic beads (Miltenyi). Cell subsets were stained with various diagnostic marker antibodies and cells gated based on their expression pattern. Staining is shown with rat P4G2 anti- mDCAL-2 mAb,with rat isotype control staining in purple.
  • FIG. 14 mDCAL-2 is internalized upon crosslinking by P4G2 + anti-rIgG2a.
  • JAWS-II cells immunodeficiency-derived cell line
  • P4G2 anti-mDCAL-2
  • P4G2a-Biotin anti-ratIgG2a-Biotin
  • FIG. 15 Table of scFv Targeting Constructs. Each fusion protein is indicated by the target receptor and the hybridoma used as the source of V regions. The Fc domain to which the constructs are fused are indicated. Each of these constructs includes an open reading frame at the end of the Fc domain in order to attach the desired antigen domains for targeting. [0028] Figure 16. CD22 KO mice, unlike WT mice, do not produce IgG antibodies to antigen targeted to dendritic cells.
  • mice Groups of three wildtype (WT) or CD22 deficient (CD22 KO) mice were inoculated by the intravenous (i.v.) route with different doses of a rat IgG2b monoclonal antibody (mAb) 33Dl, which binds to mouse 33Dl (DCIR2) moelcules on the surface of mouse DCs (Dudziak et al., Science, 5:315, 2007).
  • Sera were obtained from one group of WT (black circles) or CD22 KO (open circles) mice 10 days after immunization.
  • ELISA was performed to measure serum levels of mouse IgGl anti-rat IgG2b.
  • WT mice unlike CD22 KO mice produced high levels of IgGl anti-rat IgG2b antibodies, but at 1 ⁇ g inoculation, both WT and CD22 KO mice produced only low levels of IgGl antibodies.
  • WT mice made more IgGl when inoculated with even higher levels of antigen (10-100 ⁇ g, i.v.), but CD22 KO mice did not. Both WT and CD22 KO mice could produce IgGl antibodies to rat IgG2b antigen not targeted to DCs (Ml/70).
  • FIG. 1 P4G2scFvIg, P4G2scFvIg-OVA, and P4G2scFvIg- HEL fusion proteins bind specifically to A20 murine B cell lymphoma cells.
  • Culture supernatants from COS transient transfections or from CHO master wells were incubated with 10E6 A20 murine B cell lymphoma cells in PBS/2%FBS (staining media) for 45 minutes on ice. Cells were washed and incubated with either biotinylated anti-mouse IgG2a antibody or with biotinylated anti-HEL antibody at 1: 100, 45 minutes on ice.
  • Figure 18 Serial dilutions of culture supernatants from CHO cells transfected with P4G2 scFvIg, P4G2 scFvIg-OVA and P4G2 scFv ⁇ g-HEL2X demonstrate dose dependent binding to A20 B cell lymphoma cells.
  • Culture supernatants from individual master wells transfected with the anti-mouse DCAL2 scFvIg and scFvIg-Ag fusion genes were harvested from 96 well plates and incubated at varying dilutions with A20 B cell lymphoma cells (10 E6).
  • FIG. 19 Nucleotide and predicted amino acid sequence of P4G2 scFvIg-OVA fusion gene.
  • the P4G2 scFvIg-OVA fusion gene was constructed as described in the examples. Each cassette or functional segment is indicated in the boxed regions, with the single letter amino acid sequence indicated above each codon.
  • CD22 is required for DC dependent inhibition of antigen-receptor induced B cell proliferation. This has led us to propose in this invention that CD22 is a special target for delivering antigen to B cells and into the immune system. Further, we propose that receptors on B cells with immunoreceptor tyrosine inhibitory motifs (ITIMs) are especially well suited for delivering antigens into the immune system.
  • ITIMs immunoreceptor tyrosine inhibitory motifs
  • the B cell restricted receptors with ITIMs include CD22 and CD72, but any ITIM-bearing receptor, which is relatively restricted to B cells would also fall under this invention.
  • "Patient”, “subject” or “mammal” are used interchangeably and refer to mammals such as human patients and non-human primates, as well as experimental animals such as rabbits, rats, and mice, and other animals. Animals include all vertebrates, e.g., mammals and non-mammals, such as sheep, dogs, cows, chickens, amphibians, and reptiles.
  • Treating includes the administration of the compositions, compounds or agents of the present invention to prevent or delay the onset of the symptoms, complications, or biochemical indicia of a disease, alleviating or ameliorating the symptoms or arresting or inhibiting further development of the disease, condition, or disorder.
  • Treating further refers to any indicia of success in the treatment or amelioration or prevention of the disease, condition, or disorder, including any objective or subjective parameter such as abatement; remission; diminishing of symptoms or making the disease condition more tolerable to the patient; slowing in the rate of degeneration or decline; or making the final point of degeneration less debilitating.
  • the treatment or amelioration of symptoms can be based on objective or subjective parameters; including the results of an examination by a physician.
  • treating includes the administration of the compounds or agents of the present invention to prevent or delay, to alleviate, or to arrest or inhibit development of the symptoms or conditions associated with adisease or disorder.
  • therapeutic effect refers to the reduction, elimination, or prevention of the disease or disorder, symptoms of the disease or disorder, or side effects of the disease or disorder in the subject.
  • Treating” or “treatment” using the methods of the present invention includes preventing the onset of symptoms in a subject that can be at increased risk of a disease or disorder or but does not yet experience or exhibit symptoms, inhibiting the symptoms of a isease or disorder (slowing or arresting its development), providing relief from the symptoms or side- effects of a disease or disorder (including palliative treatment), and relieving the symptoms of a disease or disorder (causing regression).
  • Treatment can be prophylactic (to prevent or delay the onset of the disease, or to prevent the manifestation of clinical or subclinical symptoms thereof) or therapeutic suppression or alleviation of symptoms after the manifestation of the disease or condition.
  • a chronic disease or condition is a disease or condition that is long- lasting or recurrent.
  • the term chronic describes the course of the disease, or its rate of onset and development.
  • a chronic course is distinguished from a recurrent course; recurrent diseases or conditions relapse repeatedly, with periods of remission in between.
  • Treatment of recurrent diseases and conditions with the proteins dislosed herein are also contemplated.
  • a chronic disease or condition can have one or more of the following characteristics: a chronic disease or condition is permanent, leaves residual disability, can be caused by nonreversible pathological alteration, requires special training of the patient for rehabilitation, or can be expected to require a long period of supervision, observation, or care.
  • Tumor associated antigen denotes a protein or peptide or other molecule capable of inducing an immune response to a tumor.
  • an "autoantigen” denotes an endogenous antigen that stimulates the production of autoantibodies, as in an autoimmune reaction.
  • an “autoantibody” is an antibody that reacts with the cells, tissues, or native proteins of the individual in which it is produced.
  • An intact "antibody” comprises at least two heavy (H) chains and two light (L) chains inter-connected by disulfide bonds.
  • Each heavy chain is comprised of a heavy chain variable region (abbreviated herein as HCVR or VH) and a heavy chain constant region.
  • the heavy chain constant region is comprised of three domains, CHi, CH 2 and CH3.
  • Each light chain is comprised of a light chain variable region (abbreviated herein as LCVR or V L ) and a light chain constant region.
  • the light chain constant region is comprised of one domain, C L -
  • the V H and V L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR).
  • CDR complementarity determining regions
  • FR framework regions
  • Each V H and V L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FRl, CDRl, FR2, CDR2, FR3, CDR3, FR4.
  • the variable regions of the heavy and light chains contain a binding domain that interacts with an antigen.
  • the constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (CIq) of the classical complement system.
  • the term antibody includes antigen-binding portions of an intact antibody that retain capacity to bind.
  • binding examples include (i) a Fab fragment, a monovalent fragment consisting of the V L , V H , C L and CHl domains; (ii) a F(ab') 2 fragment, a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region; (iii) a Fd fragment consisting of the VH and CHl domains; (iv) a Fv fragment consisting of the V L and V H domains of a single arm of an antibody, (v) a dAb fragment (Ward et al, Nature 341: 544-546, 1989), which consists of a VH domain; and (vi) an isolated complementarity determining region (CDR).
  • a Fab fragment a monovalent fragment consisting of the V L , V H , C L and CHl domains
  • F(ab') 2 fragment a bivalent fragment comprising two Fab fragments linked by a disulfide bridge at the hinge region
  • Single chain antibodies or “single chain Fv (scFv)” refers to an antibody fusion molecule of the two domains of the Fv fragment, V L and V H .
  • the two domains of the Fv fragment, V L and V H are coded for by separate genes, they can be joined, using recombinant methods, by a synthetic linker that enables them to be made as a single protein chain in which the V L and V H regions pair to form monovalent molecules (known as single chain Fv (scFv); see, e.g., Bird et al., Science 242: 423-426, 1988; and Huston et al, Proc. Natl. Acad. Sci. USA, 85: 5879- 5883, 1988).
  • Such single chain antibodies are included by reference to the term “antibody” fragments can be prepared by recombinant techniques or enzymatic or chemical cleavage of intact antibodies.
  • Human sequence antibody includes antibodies having variable and constant regions (if present) derived from human germline immunoglobulin sequences.
  • the human sequence antibodies of the invention can include amino acid residues not encoded by human germline immunoglobulin sequences (e.g., mutations introduced by random or site-specific mutagenesis in vitro or by somatic mutation in vivo).
  • Such antibodies can be generated in non-human transgenic animals, e.g., as described in PCT Publication Nos. WO 01/14424 and WO 00/37504.
  • human sequence antibody is not intended to include antibodies in which CDR sequences derived from the germline of another mammalian species, such as a mouse, have been grafted onto human framework sequences (e.g., humanized antibodies).
  • recombinant immunoglobulins can be produced. See, Cabilly, U.S. Pat. No. 4,816,567, incorporated herein by reference in its entirety and for all purposes; and Queen et al, Proc. Nat'l Acad. Sci. USA 86: 10029-10033, 1989.
  • “Monoclonal antibody” refer to a preparation of antibody molecules of single molecular composition.
  • a monoclonal antibody composition displays a single binding specificity and affinity for a particular epitope.
  • the term “human monoclonal antibody” refers to antibodies displaying a single binding specificity which have variable and constant regions (if present) derived from human germline immunoglobulin sequences.
  • the human monoclonal antibodies are produced by a hybridoma which includes a B cell obtained from a transgenic non- human animal, e.g., a transgenic mouse, having a genome comprising a human heavy chain transgene and a light chain transgene fused to an immortalized cell.
  • Immuno cell response refers to the response of immune system cells to external or internal stimuli (e.g., antigen, cell surface receptors, cytokines, chemokines, and other cells) producing biochemical changes in the immune cells that result in immune cell migration, killing of target cells, phagocytosis, production of antibodies, other soluble effectors of the immune response, and the like.
  • external or internal stimuli e.g., antigen, cell surface receptors, cytokines, chemokines, and other cells
  • a "conservative amino acid substitution” is one in which the amino acid residue is replaced with an amino acid residue having a similar side chain.
  • Families of amino acid residues having similar side chains have been defined in the art. These families include amino acids with basic side chains (e.g., lysine, arginine, histidine), acidic side chains (e.g., aspartic acid, glutamic acid), uncharged polar side chains (e.g., glycine, asparagine, glutamine, serine, threonine, tyrosine, cysteine), nonpolar side chains (e.g., alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan), beta-branched side chains (e.g., threonine, valine, isoleucine) and aromatic side chains (e.g., tyrosine, phenylalanine, tryptophan, histidine).
  • a predicted nonessential amino acid residue in a protein is preferably replaced with another amino acid residue from the same side chain family.
  • mutations can be introduced randomly along all or part of a coding sequence, such as by saturation mutagenesis, and the resultant mutants can be screened for biological activity to identify mutants that retain activity. Following mutagenesis of the protein sequences, the encoded protein can be expressed recombinantly and the activity of the protein can be determined.
  • Geneetic fusion refers to the creation of a single gene construct that results in production of a single fusion protein with multiple functional domains, one of which is target antigen binding (the scFv) and the another is the antigen being targeted, for example, OVA, HEL, HA(flu), CSP (malaria) or some other antigen or antigen fragment and the like.
  • target antigen binding the scFv
  • the antigen being targeted for example, OVA, HEL, HA(flu), CSP (malaria) or some other antigen or antigen fragment and the like.
  • a "biologically active portion" of a protein includes a fragment of a protein which participates in an interaction between a molecule and an effector molecule.
  • Biologically active portions of a protein include peptides comprising amino acid sequences sufficiently identical to or derived from the amino acid sequence of the protein.
  • biologically active portions comprise a domain or motif with at least one activity of the protein of interest.
  • a biologically active portion of a protein can be a polypeptide which is, for example, 10, 25, 50, 100, 200, or more, amino acids in length.
  • Biologically active portions of a protein can be used as targets for developing agents which modulate a various activities as described herein.
  • sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second amino acid or nucleic acid sequence for optimal alignment and non-homologous sequences can be disregarded for comparison purposes).
  • the length of a reference sequence aligned for comparison purposes is at least 30%, preferably at least 40%, more preferably at least 50%, even more preferably at least 60%, and even more preferably at least 70%, 80%, 90%, 100% of the length of the reference sequence.
  • amino acid residues or nucleotides at corresponding amino acid positions or nucleotide positions are then compared.
  • a position in the first sequence is occupied by the same amino acid residue or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position (as used herein amino acid or nucleic acid "identity” is equivalent to amino acid or nucleic acid "homology”).
  • the percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which need to be introduced for optimal alignment of the two sequences.
  • the comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm.
  • the percent identity between two amino acid sequences is determined using the (Needleman and Wunsch, J. MoI. Biol 48: 444-453, 1970) algorithm which has been incorporated into the GAP program in the GCG software package (available at http://www.gcg.com), using either a Blossum 62 matrix or a PAM250 matrix, and a gap weight of 16, 14, 12, 10, 8, 6, or 4 and a length weight of 1, 2, 3, 4, 5, or 6.
  • the percent identity between two nucleotide sequences is determined using the GAP program in the GCG software package (available at http://www.gcg.com), using a NWSgapdna.CMP matrix and a gap weight of 40, 50, 60, 70, or 80 and a length weight of 1, 2, 3, 4, 5, or 6.
  • a particularly preferred set of parameters are a Blossum 62 scoring matrix with a gap penalty of 12, a gap extend penalty of 4, and a frameshift gap penalty of 5.
  • the percent identity between two amino acid or nucleotide sequences can be determined using the algorithm of (Meyers and Miller, CABIOS 4: 11-17, 1989) which has been incorporated into the ALIGN program (version 2.0), using a PAM 120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.
  • nucleic acid and protein sequences described herein can be used as a "query sequence" to perform a search against public databases to, for example, identify other family members or related sequences.
  • Such searches can be performed using the NBLAST and XBLAST programs (version 2.0) of (Altschul et ai, J. MoI. Biol 215: 403-10, 1990).
  • Gapped BLAST can be utilized as described in (Altschul et al, Nucleic Acids Res 25: 3389-3402, 1997).
  • BLAST and Gapped BLAST programs the default parameters of the respective programs ⁇ e.g., XBLAST and NBLAST) can be used. See http://www.ncbi.nlm.nih.gov.
  • polypeptides of the present invention have an amino acid sequence sufficiently identical or substantially identical to the amino acid sequence of the protein sequences.
  • “Sufficiently identical” or “substantially identical” is used herein to refer to a first amino acid or nucleotide sequence that contains a sufficient or minimum number of identical or equivalent ⁇ e.g., with a similar side chain) amino acid residues or nucleotides to a second amino acid or nucleotide sequence such that the first and second amino acid or nucleotide sequences have a common structural domain or common functional activity.
  • amino acid or nucleotide sequences that contain a common structural domain having at least about 60%, or 65% identity, likely 75% identity, more likely 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identity are defined herein as sufficiently or substantially identical.
  • a primary immune response which is also described as a "protective” immune response, refers to an immune response produced in an individual as a result of some initial exposure ⁇ e.g. the initial "immunization" to a particular antigen.
  • Such an immunization can occur, for example, as the result of some natural exposure to the antigen (for example, from initial infection by some pathogen that exhibits or presents the antigen) or from antigen presented by cancer cells of some tumor in the individual.
  • the immunization can occur as a result of vaccinating the individual with a vaccine containing the antigen.
  • a primary immune response can become weakened or attenuated over time and can even disappear or at least become so attenuated that it cannot be detected. Accordingly, the present invention also relates to a "secondary" immune response, which is also described here as a "memory immune response.”
  • the term secondary immune response refers to an immune response elicited in an individual after a primary immune response has already been produced. Thus, a secondary or immune response can be elicited, e.g., to enhance an existing immune response that has become weakened or attenuated, or to recreate a previous immune response that has either disappeared or can no longer be detected.
  • An agent that can be administrated to elicit a secondary immune response is after referred to as a "booster” since the agent can be said to "boost" the primary immune response.
  • Immunologically cross-reactive or “immunologically reactive” refers to an antigen which is specifically reactive with an antibody which was generated using the same (“immunologically reactive") or different (“immunologically cross-reactive") antigen.
  • Immunologically reactive conditions refers to conditions which allow an antibody, generated to a particular epitope of an antigen, to bind to that epitope to a detectably greater degree than the antibody binds to substantially all other epitopes, generally at least two times above background binding, preferably at least five times above background. Immunologically reactive conditions are dependent upon the format of the antibody binding reaction and typically are those utilized in immunoassay protocols. See, Harlow and Lane, Antibodies, A Laboratory Manual, Cold Spring Harbor Publications, New York, 1988 for a description of immunoassay formats and conditions.
  • Inhibitors of B-lymphocyte receptors in cells are used to refer to inhibitory, activating, or modulating molecules, respectively, identified using in vitro and in vivo assays for receptor binding or signaling on B-lymphocyte through surface receptors CD22 and CD72, e.g., ligands, agonists, antagonists, and their homologs and mimetics.
  • Module includes inhibitors and activators.
  • Inhibitors are agents that, e.g., bind to, partially or totally block stimulation, decrease, prevent, delay activation, inactivate, desensitize, or down regulate the activity of B-lymphocytes through surface receptors CD22 and CD72, e.g., antagonists.
  • Activators are agents that, e.g., bind to, stimulate, increase, open, activate, facilitate, enhance activation, sensitize or up regulate the activity of B-lymphocytes through surface receptors CD22 and CD72, e.g., agonists.
  • Modulators include agents that, e.g., alter the interaction of B-lymphocyte receptor with: proteins that bind activators or inhibitors, receptors, including proteins, peptides, lipids, carbohydrates, polysaccharides, or combinations of the above, e.g., lipoproteins, glycoproteins, and the like.
  • Modulators include genetically modified versions of naturally-occurring B-lymphocyte receptor ligands, e.g., with altered activity, as well as naturally occurring and synthetic ligands, antagonists, agonists, small chemical molecules and the like.
  • Cell-based assays for inhibitors and activators include, e.g., applying putative modulator compounds to a cell expressing a B-lymphocyte receptor, e.g., surface receptors CD22 and CD72, and then determining the functional effects on B-lymphocyte receptor signaling, as described herein.
  • Cell based assays include, but are not limited to, in vivo tissue or cell samples from a mammalian subject or in vitro cell-based assays comprising B- lymphocyte receptor that are treated with a potential activator, inhibitor, or modulator are compared to control samples without the inhibitor, activator, or modulator to examine the extent of inhibition.
  • Control samples can be assigned a relative B-lymphocyte receptor activity value of 100%. Inhibition of B- lymphocyte receptor is achieved when the B-lymphocyte receptor activity value relative to the control is about 80%, optionally 50% or 25-0%. Activation of B- lymphocyte receptor is achieved when the B-lymphocyte receptor activity value relative to the control is 110%, optionally 150%, optionally 200-500%, or 1000- 3000% higher.
  • the ability of a molecule to bind to B-lymphocyte receptor can be determined, for example, by the ability of the putative ligand to bind to B-lymphocyte receptor immunoadhesin coated on an assay plate. Specificity of binding can be determined by comparing binding to non- B-lymphocyte receptors.
  • Test compound refers to any compound tested as a modulator of an immune response via B-lymphocyte receptor, e.g., surface receptors CD22 and CD72.
  • the test compound can be a biological entity, such as a protein, e.g., an antibody or peptide, or scFv fusion to an antigen to B -lymphocytes through surface receptors CD22 and CD72 surface receptor.
  • test compound can be modulators that are genetically altered versions of scFv fusion to an antigen to B cell surface receptor or scFv fusion to the antigen.
  • test compounds will be s peptides or peptidemimetics.
  • antibody binding to B-lymphocyte receptor can be assayed by either immobilizing the ligand or the receptor.
  • the assay can include immobilizing B-lymphocyte receptor fused to a His tag onto Ni-activated NTA resin beads.
  • Antibody can be added in an appropriate buffer and the beads incubated for a period of time at a given temperature. After washes to remove unbound material, the bound protein can be released with, for example, SDS, buffers with a high pH, and the like and analyzed.
  • Signaling responsiveness refers to signaling via a B-lymphocyte receptor, e.g., surface receptors CD22 and CD72.
  • Signaling responsiveness can refer to, for example, an B-lymphocyte receptor, e.g., surface receptors CD22 and CD72, response dependent on the binding of a scFvIG-antigen fusion, through which a signal is propagated.
  • the B-lymphocyte receptor signaling can occur, for example, in B cells or dendritic cells.
  • Signal generating compounds for measurement in cell-based assays can be generated, e.g., by conjugation with an enzyme or fluorophore.
  • Enzymes of interest as labels will primarily be hydrolases, particularly phosphatases, esterases and glycosidases, or oxidotases, particularly peroxidases.
  • Fluorescent compounds include fluorescein and its derivatives, rhodamine and its derivatives, dansyl, umbelliferone, etc.
  • Chemiluminescent compounds include luciferin, and 2,3- dihydrophthalazinediones, e.g., luminol.
  • Detecting an effect of a test compound on B-lymphocyte receptor signaling can refer to a therapeutic or prophylactic effect in a mammalian subject, such as the reduction, elimination, or prevention of the disease, symptoms of the disease, or side effects of the disease in the subject.
  • Detecting an effect of a test compound on B-lymphocyte receptor signaling can refer to a compound having an effect in a cell-based assay, e.g., a diagnostic assay, as measured by scFv antigen fusion protein binding to a B-lymphocyte through surface receptors CD22 or CD72.
  • This invention relies on routine techniques in the field of recombinant genetics, cellular biology and immunology.
  • Basic texts disclosing the general methods of use in this invention include Sambrook et al, Molecular Cloning, A Laboratory Manual, 2 nd ed., 1989; Kriegler, Gene Transfer and Expression: A Laboratory Manual, 1990; and Ausubel et al, eds., Current Protocols in Molecular Biology, 2006; Coligan et al, eds., Current Protocols in Immunology, 2006, all of which are herein incorporated by reference for all purposes.
  • B cells clearly can acquire Ags from DCs and other target cells and recognize membrane-associated Ags (Batista et al., 2001, Bergtold et al, 2005, Carrasco and Batista, 2006).
  • the fact that DCs can activate Ag-specific B cells suggests that DCs have a means of retaining Ags in an intact form, a process we term 'Ag preservation' in contrast to the 'Ag processing' of Ag for T cells.
  • DCs can internalize and sequester soluble ovalbumin (OA) intracellularly, until they receive a second signal via e.g., CD40, which induces cross presentation (Delamarre et al, 2003).
  • OA sequester soluble ovalbumin
  • the Ag- scFv technology will make it possible to compare the efficacy of targeting antigens to DCs vs. B cells with DNA vaccination. Because as with DCs, activation signals to B cells enhance their capacity as APCs (Heit et al, 2004), we will compare the following prime-boost protocols with anti-CD40 scFv: 1) prime HA-anti-33Dl (DCs), boost with either a) HA-anti-33Dl (DCs) or b) HA-anti- CD22 (B cells); and 2) prime with HA-anti-CD22 (B cells), boost with either a) HA- anti-33Dl (DCs) or b) HA-anti-CD22 (B cells).
  • prime-boost protocols with anti-CD40 scFv: 1) prime HA-anti-33Dl (DCs), boost with either a) HA-anti-33Dl (DCs) or b) HA-anti-CD22 (B cells).
  • DCs dendritic cells
  • BM bone marrow(BM)-derived immature DCs
  • mDCs mature DCs
  • ⁇ 2-6 sialic acids on iDCs is not required for this inhibition as iDCs from ST ⁇ Gal-I KO mice also inhibited BCR-induced proliferation of WT B cells.
  • a ligand for CD22 is expressed on the surface of iDCs.
  • This ligand does not contain ⁇ 2-6 sialic acids and is distinct from the ligand expressed on the surface of B cells.
  • CD22 and ST ⁇ Gal-I KO mice had deficiencies in marginal zone and transitional 2 precursor B cells, suggesting that the development of these splenic B cells is dependent on both CD22 and ⁇ 2-6 sialic acid- containing glycoproteins.
  • the numbers of long-lived mature B cells in the BM were lower in the CD22 KO, but normal in the ST ⁇ Gal-I KO mice, indicating that the maintenance of these cells is dependent only on CD22.
  • the ⁇ 2-6 sialic acid-containing glycoprotein can be important for the development of splenic B cell subsets while the ligand that does not contain oc2-6 sialic acids, perhaps on iDCs, is required for the maintenance of long-lived mature B cells in the BM.
  • DCs regulate B cells are through the production of soluble factors including cytokines.
  • DCs can stimulate CD40-activated B cells to proliferate and produce Ab by secreting soluble factors (Dubois et al, 1997).
  • the differentiation of naive B cells into IgM-secreting plasma cells is dependent on IL- 12 production by DCs (Dubois et al, 1998).
  • B cell activating factor B cell activating factor
  • BAFF B cell activating factor
  • APRIL B cell activating factor
  • BAFF and APRIL produced by DCs greatly enhance B cell Ag receptor (BCR)-induced proliferation of B cells (Craxton et al, 2003, Hanada et al, 2003).
  • Balazs et al (2002) also found that BAFF and APRIL play a role in the differentiation of naive marginal zone (MZ) B cells into plasmablasts. These TNF family members also induce IgGi secretion in B cells (Hanada et al, 2003). Furthermore, CD40-independent class switching is also affected by DC-generated BAFF and APRIL (Litinsky et al, 2002). Type I IFNs and IL-6 produced by a subset of DCs also influence B cells to differentiate into Ig- secreting plasmablasts (Jego et al, 2003).
  • DCs can also exert their effects on B cells by direct cell-to-cell interactions.
  • CD40L expressed on DCs can induce CD40 positive B cells to secrete IgG and IgA (Pinchuk et al, 1996).
  • DC-mediated CD40 triggering can also provide B cells with a survival signal (Wykes and MacPherson, 2000).
  • Ag-specific B cells can physically interact with DCs in vitro that have been pulsed with the cognate Ag (Huang et al, 2005). This direct interaction induces the release of intracellular Ca 2+ by the B cells.
  • DCs and B cells can form clusters in vitro, resulting in the induction of B cell proliferation, differentiation and isotype class switching (Dubois et al, 1999).
  • B cells and DCs interact in a few distinct locations. DCs can cluster with B cells in the lymph in an LFA-I -dependent manner (Kushnir et al, 1998). Both VLA -4 and LFA-I play important roles in enabling B cells to recognize membrane-bound Ags expressed on target cells (Carrasco et al, 2004; Carrasco et al, 2006).
  • LFA-I and VLA-4 on B cells bind to their ligands (CD54/ICAM-1 and VCAM-I, respectively) on the surface of target cells also expressing membrane-bound Ag, the threshold for A-specific BCR signaling required for activation is lowered.
  • the binding of both the integrin and BCR facilitates synapse formation between the B cell and target cell and allows the B cell to effectively spread over the membrane expressing the Ag. This subsequently results in B cell activation and allows the B cell to acquire Ag from the target cell (Batista et al, 2001; Fleire et al, 2006).
  • DCs and B cell also interact in the red pulp of the spleen (Garcia de Vinuesa et al, 1999). This interaction is thought to support plasmablast survival and their differentiation into Ab-secreting plasma cells. Balazs et al (2002) demonstrated that association between DC and B cells can occur at T cell-B cell borders in the spleen. Blood DCs capture bacteria and deliver them to MZ B cells, after which, the DC-B cell-Ag complexes moves to T cell-B cell borders and the bridging channel connecting the white and red pulp, where plasmablast production subsequently takes place (Balazs et al, 2002).
  • B cells and DCs associate in follicles (Berney et al, 1999, Lindquist et al, 2004). B cells can also interact with DCs once they have exited the high endothelial venule, but before they enter LN follicles (Qi et al, 2006). This interaction results in the activation of the Ag-specific B cells by the DCs expressing cognate Ag, and in the transfer of Ag on the surface of DCs to the Ag- specific B cells (Wykes et al, 1998; Qi et al, 2006).
  • iDCs bone marrow-derived immature DCs
  • mDCs mature DCs
  • ITIM immunreceptor tyrosine-based inhibitory motif
  • CD22 ligand on iDCs is distinct from the ligands expressed on the surface of B cells, implicating differential roles for cis versus trans interactions between CD22 and its ligand.
  • a method for identifying candidate or test bispecific compounds which reduce the concentration of an agent in the serum and/or circulation of a non-human animal.
  • Compounds selected or optimized using the instant methods can be used to treat subjects that would benefit from administration of such a compound, e.g., human subjects.
  • bispecific compounds that can be tested in an aspect of the methods of the present invention are bispecific compounds.
  • the term "bispecific compound” includes compounds having two different binding specificities.
  • Exemplary bispecific compounds include, e.g., bispecific antibodies, heteropolymers, and antigen-based heteropolymers.
  • Bispecific molecules that can be tested in an aspect of the invention preferably include a binding moiety that is specific for B-lymphocyte receptors, e.g., surface receptors CD22 and CD72,.
  • novel B-lymphocyte receptor binding molecules can be identified based on their ability to bind to surface receptors CD22 and CD72.
  • any number of test compounds e.g., scFv-antigen fusion proteins or peptidomimetics or other drugs can be used for testing and can be obtained using any of the numerous approaches in combinatorial library methods known in the art, including: biological libraries; spatially addressable parallel solid phase or solution phase libraries; synthetic library methods requiring deconvolution; the v one-bead one- compound” library method; and synthetic library methods using affinity chromatography selection.
  • the biological library approach is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small chemical molecule libraries of compounds (Lam, Anticancer Drug Des. 12: 145, 1997).
  • test modulating agent can be generally ignored in the in vitro system, the assay instead being focused primarily on the effect of the drug on the molecular target as can be manifest in an alteration of binding affinity with upstream or downstream elements.
  • phage display techniques known in the art can be used to identify novel binding molecules of B -lymphocyte receptor, e.g., surface receptors CD22 and CD72.
  • the invention provides assays for screening candidate or test compounds which bind to surface receptors CD22 and CD72 or biologically active portion thereof.
  • Cell-based assays for identifying molecules that bind to B- lymphocyte receptor can be used to identify additional agents for use in bispecific compounds of the invention.
  • cells expressing surface receptors CD22 and CD72 can be used in a screening assay.
  • compounds which produce a statistically significant change in binding to surface receptors CD22 and CD72 can be identified.
  • the assay is a cell-free assay in which a B-lymphocyte receptor binding molecule is identified based on its ability to bind to surface receptors CD22 and CD72 in vitro.
  • the surface receptors CD22 and CD72 protein binding molecule can be provided and the ability of the protein to bind B-lymphocyte receptor can be tested using art recognized methods for determining direct binding. Determining the ability of the protein to bind to a target molecule can be accomplished, e.g., using a technology such as real-time Biomolecular Interaction Analysis (BIA). Sjolander et al, Anal. Chem. 63: 2338-2345, 1991, and Szabo et al., Curr. Opin. Struct.
  • BIOSjolander et al Anal. Chem. 63: 2338-2345, 1991
  • Szabo et al. Curr. Opin. Struct.
  • BIOA is a technology for studying biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore). Changes in the optical phenomenon of surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • the cell-free assays of the present invention are amenable to use of both soluble and/or membrane-bound forms of proteins.
  • a solubilizing agent such that the membrane-bound form of the protein is maintained in solution.
  • non-ionic detergents such as n-
  • Suitable assays are known in the art that allow for the detection of protein-protein interactions (e.g., immunoprecipitations, two-hybrid assays and the like). By performing such assays in the presence and absence of test compounds, these assays can be used to identify compounds that modulate (e.g., inhibit or enhance) the interaction of a protein of the invention with a target molecule(s).
  • Determining the ability of the protein to bind to or interact with a target molecule can be accomplished, e.g., by direct binding.
  • the protein could be coupled with a radioisotope or enzymatic label such that binding of the protein to a target molecule can be determined by detecting the labeled protein in a complex.
  • proteins can be labeled with 125 1, 35 S, 14 C, or 3 H, either directly or indirectly, and the radioisotope detected by direct counting of radioemmission or by scintillation counting.
  • molecules can be enzymatically labeled with, for example, horseradish peroxidase, alkaline phosphatase, or luciferase, and the enzymatic label detected by determination of conversion of an appropriate substrate to product.
  • binding to an upstream or downstream binding element in the presence and absence of a candidate agent, can be accomplished in any vessel suitable for containing the reactants. Examples include microtitre plates, test tubes, and micro-centrifuge tubes.
  • a fusion protein can be provided which adds a domain that allows the protein to be bound to a matrix.
  • glutathione-S-transferase/ B-lymphocyte receptor (GST/ B cell receptor) fusion proteins can be adsorbed onto glutathione sepharose beads (Sigma Chemical, St. Louis, Mo.) or glutathione derivatized microtitre plates, which are then combined with the cell lysates, e.g. 35 S-labeled, and the test modulating agent, and the mixture incubated under conditions conducive to complex formation, e.g., at physiological conditions for salt and pH, though slightly more stringent conditions can be used. Following incubation, the beads are washed to remove any unbound label, and the matrix immobilized and radiolabel determined directly (e.g.
  • the complexes can be dissociated from the matrix, separated by SDS- PAGE, and the level of B-lymphocyte receptor -binding protein found in the bead fraction quantitated from the gel using standard electrophoretic techniques.
  • biotinylated molecules can be prepared from biotin-NHS (N-hydroxy-succinimide) using techniques well known in the art (e.g., biotinylation kit, Pierce Chemicals, Rockford, 111.), and immobilized in the wells of streptavidin-coated 96 well plates (Pierce Chemical).
  • a microphysiometer can be used to detect the interaction of a protein of the invention with its target molecule without the labeling of either the protein or the target molecule. McConnell et al, Science 257: 1906-1912, 1992.
  • a "microphysiometer” e.g., Cytosensor
  • LAPS light-addressable potentiometric sensor
  • Exemplary heteropolymers and antigen-based heteropolymers for testing in the instant invention and methods of making them are known in the art.
  • exemplary heteropolymers are taught in WO 0300797 IAl; U.S. 20020103343A1; U.S. Pat. No. 5,879,679; U.S. Pat. No. 5,487,890; U.S. Pat. No. 5,470,570; WO 9522977A1 ; WO/02075275 A3, WO/0246208A2 or A3, WO/0180883A1, WO/0145669A1, WO 9205801A1, Lindorfer et al, J. Immunol. Methods.
  • Exemplary reagents that can be used to cross-link the components of a bispecific molecule include: polyethelyene glycol, SATA, SMCC, as well others known in the art, and available, e.g., from Pierce Biotechnology. Exemplary forms of bispecific molecules that can be tested are described in U.S. Ser. No. 60/411,731, filed on Sep. 16, 2002, the contents of which are incorporated herein by reference.
  • bispecific molecules can be made (e.g., dimer, trimer, tetramer, pentamer, or higher multimer forms).
  • purified forms of bispecific molecules can be tested, e.g., as described in U.S. Ser. No. 60/380,211, filed on Can 13, 2002, the contents of which are incorporated herein by reference.
  • one of the binding moieties of the heteropolymer is an antibody
  • antibodies of different isotypes e.g., IgA, IgD, IgE, IgGl, IgG 2 (e.g., IgG 2 a), IgG 3 , IgG 4 , or IgM
  • portions of an antibody molecule e.g., Fab fragments
  • at least one of the binding moieties is an antibody comprising an Fc domain.
  • the antibody is a mouse antibody.
  • the effect of modifications to antibodies can be tested, e.g., the effect of deimmunization of the antibody, e.g., as described in U.S. Ser. No. 60/458,869, filed on Mar. 28, 2003 can be tested.
  • the concentration of an agent, e.g. pathogenic agent, in the serum, circulation and/or tissue of the non-human animal can be reduced by at least e.g. about 20%, about 30%, about 40%, about 50%, about 60%, about 70%, about 80%, about 90% or about 100%.
  • the concentration of an agent in the serum, circulation and/or tissue of a subject can be measured indirectly.
  • pathology resulting from the presence of the agent in the serum and/or circulation can be measured, e.g., by examining tissue samples from the animal.
  • Another indirect measurement of the concentration of an agent in the serum, circulation and/or tissue of the non-human animal is measurement of the ability of the agent to cause infection in the non-human animal.
  • the effect of the bispecific compound on clinical signs and symptoms of infection can be measured.
  • the ability of the bispecific compound to inhibit the spread of infection e.g., from one organ system to another or from one individual to another can also be tested.
  • the ability of the bispecific compound to bind to cells bearing scFv-antigen fusion proteins in the non-human animal is measured.
  • determining the ability of the bispecific compound to bind to a B-lymphocyte receptor target molecule can also be accomplished using a technology such as real-time Biomolecular Interaction Analysis (BIA) (Sjolander et al., Anal. Chem. 63: 2338-2345, 1991 and Szabo et al, Curr. Opin. Struct. Biol. 5: 699-705, 1995).
  • BIOA Biomolecular Interaction Analysis
  • BIOA is a technology for studying biospecific interactions in real time, without labeling any of the interactants ⁇ e.g., BIAcore). Changes in the optical phenomenon of surface plasmon resonance (SPR) can be used as an indication of real-time reactions between biological molecules.
  • SPR surface plasmon resonance
  • the destruction of the agent by cells in the non- human animal ⁇ e.g., killing by macrophage
  • the destruction of the agent by cells in the non- human animal ⁇ e.g., killing by macrophage
  • Compounds that reduce the concentration of the agent in the serum and/or circulation of the non-human animal (as compared with concentrations observed in non-human animals that do not receive the bispecific compound) can be selected.
  • Compounds for testing in the subject assays can be selected from among a plurality of compounds tested.
  • bispecific compounds for testing in the instant assays can have already been identified as being capable of binding B-lymphocyte receptor, e.g., surface receptors CD22 and CD72, e.g., in an in vitro assay and can be further evaluated or optimized using the instant assays.
  • the ability of a bispecific compound to reduce the concentration of an agent in the serum and/or circulation can be compared to another bispecific compound or a non-optimized version of the same compound to determine its ability reduce the concentration of the agent in the serum and/or circulation.
  • the bispecific compounds of the instant invention are administered at concentrations in the range of approximately 1 ⁇ g compound/kg of body weight to approximately 100 ⁇ g compound/kg of body weight.
  • a therapeutically effective amount of a bispecific compound ⁇ i.e., an effective dosage ranges from about 0.01 to 5000 ⁇ g/kg body weight, preferably about 0.1 to 500 ⁇ g/kg body weight, more preferably about 2 to 80 ⁇ g/kg body weight, and even more preferably about 5 to 70 ⁇ g/kg, 10 to 60 ⁇ g/kg, 20 to 50 ⁇ g/kg, 24 to 41 ⁇ g/kg, 25 to 40 ⁇ g/kg, 26 to 39 ⁇ g/kg, 27 to 38 ⁇ g/kg, 28 to 37 ⁇ g/kg, 29 to 36 ⁇ g/kg, 30 to 35 ⁇ g/kg, 31 to 34 ⁇ g/kg or 32 to 33 ⁇ g/kg body weight.
  • treatment of a subject with a therapeutically effective amount of a protein, polypeptide, or antibody can include a single treatment or, preferably, can include a series of treatments.
  • the animal is treated with bispecific compound in the range of between about 1 to 500 ⁇ g/kg body weight following intravenous (iv) injection of an agent.
  • iv intravenous
  • the effective dosage of a bispecific compound used for treatment can increase or decrease over the course of a particular treatment. Changes in dosage can result and become apparent from the results of diagnostic assays as described herein.
  • the route of administration of test compounds and/or agents can be intravenous (iv) injection into the circulation of the animal.
  • Other administration routes include, but are not limited to, topical, parenteral, subcutaneous, or by inhalation.
  • parenteral includes injection, e.g. by subcutaneous, intravenous, or intramuscular routes, also including localized administration, e.g., at a site of disease or injury. Sustained release of compounds from implants is also known in the art.
  • suitable dosages will vary, depending upon such factors as the nature of the disorder to be treated, the patient's body weight, age, and general condition, and the route of administration. Preliminary doses can be determined according to animal tests, and the scaling of dosages for human administration are performed according to art-accepted practices.
  • the candidate compounds and agents can be administered over a range of doses to the animal.
  • the agent can be also administered to the animal, the candidate compound can be administered either before, at the same time, or after, administration of the agent.
  • Surface receptors CD22 and CD72 in B-lymphocytes expressed in transgenic animals, e.g. mice, of the present invention can be used to screen or evaluate candidate compounds useful for treating disorders or diseases in humans that are associated with the presence of unwanted agents in the serum and/or circulation of a subject, such as autoantibodies, infectious agents, or toxins.
  • Exemplary targeted agents that can be bound by the bispecific compounds of the present invention include blood-borne agents, including, but not limited to, any of the following: viruses, viral particles, toxins, bacteria, polynucleotides, antibodies, e.g., autoantibodies associated with an autoimmune disorder.
  • exemplary targeted viral agents include, but are not limited to, any one of the following: cytomegalovirus, influenza, Newcastle disease virus, vesicular stomatitis virus, rabies virus, herpes simplex virus, hepatitis, adenovirus-2, bovine viral diarrhea virus, human immunodeficiency virus (HIV), dengue virus, Marburg virus, Epstein-Barr virus.
  • Exemplary Gram-positive bacterial targets Streptococcus pyogenes, Staphylococcus aureus, Mycobacterium tuberculosis, Streptococcus pneumoniae, or Bacillus subtilis are useful for the treatment of skin infections, community-acquired pneumonia, upper and lower respiratory tract infections, skin and soft tissue infections, hospital-acquired lung infections, bone and joint infections, respiratory tract infections, acute bacterial otitis media, bacterial pneumonia, urinary tract infections, complicated infections, noncomplicated infections, pyelonephritis, intra-abdominal infections, deep-seated abcesses, bacterial sepsis, central nervous system infections, bacteremia, wound infections, peritonitis, meningitis, infections after burn, urogenital tract infections, gastro-intestinal tract infections, pelvic inflammatory disease, endocarditis, and other intravascular infections.
  • the infections to be treated can be caused by Gram-positive bacteria. These include, without limitation, infections by, Staphylococcus aureus, Staphylococcus epidermidis, Enterococcus faecalis, Enterococcus faecium, Clostridium perfringens, Clostridium difficile, Streptococcus pyogenes, Streptococcus pneumoniae, other Streptococcus spp., and other Clostridium spp. More specifically, the infections can be caused by a Gram-positive coccus, or by a drug-resistant Gram- positive coccus. Exemplary Gram-positive cocci are, without limitation, S. aureus, S. epidermidis, S. pneumoniae, S. pyogenes, M. catarrhalis, C. difficile, H. pylori, Chlamydia spp., and Enterococcus spp.
  • Bacteremia can be caused by gram-negative or gram-positive bacteria.
  • Gram-negative bacteria have thin walled cell membranes consisting of a single layer of peptidoglycan and an outer layer of lipopolysacchacide, lipoprotein, and phospholipid.
  • Exemplary gram-negative organisms include, but are not limited to, Enterobacteriacea consisting of Escherichia, Shigella, Edwardsiella, Salmonella, Citrobacter, Klebsiella, Enterobacter, Hafnia, Serratia, Proteus, Morganella, Providencia, Yersinia, Erwinia, Buttlauxella, Cedecea, Ewingella, Kluyvera, Tatumella and Rahnella.
  • exemplary gram-negative organisms not in the family Enterobacteriacea include, but are not limited to, Pseudomonas aeruginosa, Stenotrophomonas maltophilia, Burkholderia, Cepacia, Gardenerella, Vaginalis, and Acinetobacter species.
  • Gram-positive bacteria have a thick cell membrane consisting of multiple layers of peptidoglycan and an outside layer of teichoic acid.
  • Exemplary gram-positive organisms include, but are not limited to, Staphylococcus aureus, coagulase-negative staphylococci, streptococci, enterococci, corynebacteria, and Bacillus species.
  • the targeted agent is resistant to traditional therapies, e.g., is resistant to antibiotics.
  • the agent in performing an assay of the invention, is administered to the transgenic animal, e.g., prior to, simultaneously with, or after administration of a bispecific compound.
  • the bispecific compounds of the present invention can be modified to enhance their half life.
  • Peptide analogs are commonly used in the pharmaceutical industry as non-peptide drugs with properties analogous to those of the template peptide. These types of non-peptide compounds are termed "peptide mimetics” or “peptidomimetics” (Fauchere, Adv. Drug Res. 15: 29, 1986; Veber et al, TINS p.392, 1985; and Evans et al, J. Med. Chem 30: 1229, 1987, which are incorporated herein by reference) and are usually developed with the aid of computerized molecular modeling.
  • Peptide mimetics that are structurally similar to therapeutically useful peptides can be used to produce an equivalent therapeutic or prophylactic effect.
  • a particularly preferred non-peptide linkage is -CH 2 NH-.
  • Such peptide mimetics can have significant advantages over polypeptide aspects, including, for example: more economical production, greater chemical stability, enhanced pharmacological properties (half-life, absorption, potency, efficacy, etc.), altered specificity (e.g., a broad-spectrum of biological activities), reduced antigenicity, and others.
  • Labeling of peptidomimetics usually involves covalent attachment of one or more labels, directly or through a spacer (e.g., an amide group), to non-interfering position(s) on the peptidomimetic that are predicted by quantitative structure-activity data and/or molecular modeling.
  • a spacer e.g., an amide group
  • non-interfering positions generally are positions that do not form direct contacts with the macromolecules(s) to which the peptidomimetic binds to produce the therapeutic effect.
  • Derivatization (e.g., labeling) of peptidomimetics should not substantially interfere with the desired biological or pharmacological activity of the peptidomimetic.
  • Such modified polypeptides can be produced in prokaryotic or eukaryotic host cells. Alternatively, such peptides can be synthesized by chemical methods. Methods for expression of heterologous polypeptides in recombinant hosts, chemical synthesis of polypeptides, and in vitro translation are well known in the art and are described further in Maniatis et al , Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor, N.Y., 1989; Berger et al, Methods in Enzymology, Volume 152, Guide to Molecular Cloning Techniques, 1987, Academic Press, Inc., San Diego, Calif.; Merrifield, J. Am. Chem. Soc.
  • Polypeptides can be produced, typically by direct chemical synthesis, and used as a binding moiety of a heteropolymer.
  • Peptides can be produced as modified peptides, with nonpeptide moieties attached by covalent linkage to the N- terminus and/or C-terminus.
  • either the carboxy-terminus or the amino-terminus, or both are chemically modified. The most common modifications of the terminal amino and carboxyl groups are acetylation and amidation, respectively.
  • Amino-terminal modifications such as acylation (e.g., acetylation) or alkylation (e.g., methylation) and carboxy-terminal modifications such as amidation, as well as other terminal modifications, including cyclization, can be incorporated into various aspects of the test compounds.
  • Certain amino-terminal and/or carboxy-terminal modifications and/or peptide extensions to the core sequence can provide advantageous physical, chemical, biochemical, and pharmacological properties, such as: enhanced stability, increased potency and/or efficacy, resistance to serum proteases, desirable pharmacokinetic properties, and others.
  • the invention relates to methods for modulating an immune response in a subject, the method comprising targeting antigens to B cell surface receptors using an scFvIg derived from an antibody which binds to the receptor, and which genetically fuses the antigen to the carboxyl end of the scFvIg moiety.
  • Therapeutic antibodies and scFv-antigen fusion proteins can be identified by, for example, any of a combination of diagnostic or prognostic assays as described herein or are known in the art. In general, such disorders involve treatment for infectious disease, e.g., bacterial, viral, or parasite disease, or cancer.
  • Another aspect of the invention pertains to methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors CD22 and CD72.
  • the agent can be a compound that specifically binds to B-lymphocyte receptor, e.g., surface receptors CD22 and CD72.
  • the agent can be an antibody or a protein, e.g., scFv-antigen fusion proteins.
  • the present invention provides methods for methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors CD22 and CD72 and for treatment for infectious disease, e.g., bacterial, viral, or parasite disease, or cancer.
  • infectious disease e.g., bacterial, viral, or parasite disease, or cancer.
  • Successful treatment of disorders related to infectious disease or cancer can be brought about by techniques that serve to activate binding of antigen to B-lymphocyte receptor, e.g., surface receptors CD22 and CD72.
  • B-lymphocyte receptor e.g., surface receptors CD22 and CD72.
  • compounds e.g., an agent identified using an assay described herein, such as an antibody, that prove to exhibit negative modulatory activity, can be used to prevent and/or ameliorate symptoms of disorders.
  • Such molecules can include, but are not limited to peptides, phosphopeptides, small organic or inorganic molecules, or antibodies (including, for example, polyclonal, monoclonal, humanized, anti- idiotypic, chimeric or single chain antibodies, and F a b, F( a b') 2 and F a b expression library fragments, scFV molecules, and epitope-binding fragments thereof)-
  • antibodies and derivatives thereof e.g. , antigen-binding fragments thereof
  • B-lymphocyte receptor e.g., surface receptors CD22 and CD72 can modulate or activate immune response to infectious disease, e.g., bacterial, viral, or parasite disease, or cancer
  • kits comprising the compositions, e.g., nucleic acids, expression cassettes, vectors, cells, polypeptides (e.g., B-lymphocyte receptor, e.g., surface receptors CD22 and CD72,) and/or scFv-antigen fusion antibodies of the invention.
  • the kits also can contain instructional material teaching the methodologies and uses of the invention, as described herein.
  • compositions and methods for treating an infectious disease e.g., bacterial, viral, or parasite disease, or cancer
  • infectious disease include but are not limited to, viral or bacterial diseases.
  • the polypeptide or polynucleotide of the present invention can be used to treat or detect infectious agents. For example, by increasing the immune response, particularly increasing the proliferation and differentiation of B and/or T cells, infectious diseases can be treated.
  • the immune response can be increased by either enhancing an existing immune response, or by initiating a new immune response.
  • the polypeptide or polynucleotide of the present invention can also directly inhibit the infectious agent, without necessarily eliciting an immune response.
  • bacterial or fungal families can cause the following diseases or symptoms, including, but not limited to: bacteremia, endocarditis, eye infections (conjunctivitis, tuberculosis, uveitis), gingivitis, opportunistic infections (e.g., AIDS related infections), paronychia, prosthesis-related infections, Reiter's Disease, respiratory tract infections, such as Whooping Cough or Empyema, sepsis, Lyme Disease, Cat-Scratch Disease, Dysentery, Paratyphoid Fever, food poisoning, Typhoid, pneumonia, Gonorrhea, meningitis, Chlamydia, Syphilis, Diphtheria, Leprosy, Paratuberculosis, Tuberculosis, Lupus, Botulism, gangrene, tetanus, impetigo, Rheumatic Fever, Scarlet Fever, sexually transmitted diseases, skin diseases (e.g., cellu
  • a polypeptide or polynucleotide of the present invention can be used to treat or detect any of these symptoms or diseases.
  • parasitic agents causing disease or symptoms that can be treated or detected by a polynucleotide or polypeptide of the present invention include, but not limited to, the following families: Amebiasis, Babesiosis, Coccidiosis, Cryptosporidiosis, Dientamoebiasis, Dourine, Ectoparasitic, Giardiasis, Helminthiasis, Leishmaniasis, Theileriasis, Toxoplasmosis, Trypanosomiasis, and Trichomonas.
  • These parasites can cause a variety of diseases or symptoms, including, but not limited to: Scabies, Trombiculiasis, eye infections, intestinal disease (e.g., dysentery, giardiasis), liver disease, lung disease, opportunistic infections (e.g., AIDS related), Malaria, pregnancy complications, and toxoplasmosis.
  • a polypeptide or polynucleotide of the present invention can be used to treat or detect any of these symptoms or diseases.
  • treatment using a polypeptide or polynucleotide of the present invention could either be by administering an effective amount of a polypeptide to the patient, or by removing cells from the patient, supplying the cells with a polynucleotide of the present invention, and returning the engineered cells to the patient (ex vivo therapy).
  • the polypeptide or polynucleotide of the present invention can be used as an antigen in a vaccine to raise an immune response against infectious disease.
  • the invention provides pharmaceutical compositions comprising polypeptides or scFv-antigen fusion proteins of the invention.
  • the polypeptides or scFv-antigen fusion proteins of the invention can be used methods for modulating an immune response in a subject by targeting antigens into the immune system through the surface receptors CD22 and CD72 to treat infectious disease, e.g., bacterial, viral, or parasite disease, or cancer.
  • infectious disease e.g., bacterial, viral, or parasite disease, or cancer.
  • Such modulation in a cell or a non- human animal can generate a screening modality for identifying compounds to treat or ameliorate infectious disease, e.g., bacterial, viral, or parasite disease, or cancer.
  • Administration of a pharmaceutical composition of the invention to a subject is used to generate a immune response in the subject.
  • the polypeptides or scFv-antigen fusion proteins of the invention can be combined with a pharmaceutically acceptable carrier (excipient) to form a pharmacological composition.
  • Pharmaceutically acceptable carriers can contain a physiologically acceptable compound that acts to, e.g., stabilize, or increase or decrease the absorption or clearance rates of the pharmaceutical compositions of the invention.
  • Physiologically acceptable compounds can include, e.g., carbohydrates, such as glucose, sucrose, or dextrans, antioxidants, such as ascorbic acid or glutathione, chelating agents, low molecular weight proteins, compositions that reduce the clearance or hydrolysis of the peptides or polypeptides, or excipients or other stabilizers and/or buffers.
  • Detergents can also used to stabilize or to increase or decrease the absorption of the pharmaceutical composition, including liposomal carriers.
  • Pharmaceutically acceptable carriers and formulations for peptides and polypeptide are known to the skilled artisan and are described in detail in the scientific and patent literature, see e.g., the latest edition of Remington's Pharmaceutical Science, Mack Publishing Company, Easton, Pa. ("Remington's").
  • physiologically acceptable compounds include wetting agents, emulsifying agents, dispersing agents or preservatives which are particularly useful for preventing the growth or action of microorganisms.
  • Various preservatives are well known and include, e.g., phenol and ascorbic acid.
  • a pharmaceutically acceptable carrier including a physiologically acceptable compound depends, for example, on the route of administration of the peptide or polypeptide of the invention and on its particular physio-chemical characteristics.
  • a solution of polypeptides or scFv-antigen fusion proteins of the invention are dissolved in a pharmaceutically acceptable carrier, e.g., an aqueous carrier if the composition is water-soluble.
  • a pharmaceutically acceptable carrier e.g., an aqueous carrier if the composition is water-soluble.
  • aqueous solutions that can be used in formulations for enteral, parenteral or transmucosal drug delivery include, e.g., water, saline, phosphate buffered saline, Hank's solution, Ringer's solution, dextrose/saline, glucose solutions and the like.
  • the formulations can contain pharmaceutically acceptable auxiliary substances as required to approximate physiological conditions, such as buffering agents, tonicity adjusting agents, wetting agents, detergents and the like.
  • Additives can also include additional active ingredients such as bactericidal agents, or stabilizers.
  • the solution can contain sodium acetate, sodium lactate, sodium chloride, potassium chloride, calcium chloride, sorbitan monolaurate or triethanolamine oleate.
  • These compositions can be sterilized by conventional, well-known sterilization techniques, or can be sterile filtered.
  • the resulting aqueous solutions can be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous solution prior to administration.
  • concentration of peptide in these formulations can vary widely, and will be selected primarily based on fluid volumes, viscosities, body weight and the like in accordance with the particular mode of administration selected and the patient's needs.
  • Solid formulations can be used for enteral (oral) administration. They can be formulated as, e.g., pills, tablets, powders or capsules.
  • conventional nontoxic solid carriers can be used which include, e.g., pharmaceutical grades of mannitol, lactose, starch, magnesium stearate, sodium saccharin, talcum, cellulose, glucose, sucrose, magnesium carbonate, and the like.
  • a pharmaceutically acceptable nontoxic composition is formed by incorporating any of the normally employed excipients, such as those carriers previously listed, and generally 10% to 95% of active ingredient (e.g., peptide).
  • a non-solid formulation can also be used for enteral administration.
  • the carrier can be selected from various oils including those of petroleum, animal, vegetable or synthetic origin, e.g., peanut oil, soybean oil, mineral oil, sesame oil, and the like.
  • suitable pharmaceutical excipients include e.g., starch, cellulose, talc, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, magnesium stearate, sodium stearate, glycerol monostearate, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol.
  • Polypeptides or scFv-antigen fusion proteins of the invention when administered orally, can be protected from digestion. This can be accomplished either by complexing the polypeptides or scFv-antigen fusion proteins with a composition to render it resistant to acidic and enzymatic hydrolysis or by packaging the polypeptides or scFv-antigen fusion proteins in an appropriately resistant carrier such as a liposome.
  • Means of protecting compounds from digestion are well known in the art, see, e.g., Fix, Pharm Res. 13: 1760-1764, 1996; Samanen, J. Pharm. Pharmacol. 48: 119-135, 1996; U.S. Pat. No. 5,391,377, describing lipid compositions for oral delivery of therapeutic agents (liposomal delivery is discussed in further detail, infra).
  • Systemic administration can also be by transmucosal or transdermal means.
  • penetrants appropriate to the barrier to be permeated can be used in the formulation.
  • penetrants are generally known in the art, and include, e.g., for transmucosal administration, bile salts and fusidic acid derivatives.
  • detergents can be used to facilitate permeation.
  • Transmucosal administration can be through nasal sprays or using suppositories. See, e.g., Sayani, Crit. Rev. Ther. Drug Carrier Sy st. 13: 85-184, 1996.
  • the agents are formulated into ointments, creams, salves, powders and gels.
  • Transdermal delivery systems can also include, e.g., patches.
  • polypeptides or scFv-antigen fusion proteins of the invention can also be administered in sustained delivery or sustained release mechanisms, which can deliver the formulation internally.
  • sustained delivery or sustained release mechanisms which can deliver the formulation internally.
  • biodegradeable microspheres or capsules or other biodegradeable polymer configurations capable of sustained delivery of a peptide can be included in the formulations of the invention (see, e.g., Putney, Nat. Biotechnol. 16: 153-157, 1998).
  • the polypeptides or scFv-antigen fusion proteins of the invention can be delivered using any system known in the art, including dry powder aerosols, liquids delivery systems, air jet nebulizers, propellant systems, and the like. See, e.g., Patton, Biotechniques 16: 141-143, 1998; product and inhalation delivery systems for polypeptide macromolecules by, e.g., Dura Pharmaceuticals (San Diego, Calif.), Aradigrn (Hayward, Calif.), Aerogen (Santa Clara, Calif.), Inhale Therapeutic Systems (San Carlos, Calif.), and the like.
  • the pharmaceutical formulation can be administered in the form of an aerosol or mist.
  • the formulation can be supplied in finely divided form along with a surfactant and propellant.
  • the device for delivering the formulation to respiratory tissue is an inhaler in which the formulation vaporizes.
  • Other liquid delivery systems include, e.g., air jet nebulizers.
  • compositions of the invention in vesicles composed of substances such as proteins, lipids (for example, liposomes, see below), carbohydrates, or synthetic polymers (discussed above).
  • lipids for example, liposomes, see below
  • carbohydrates for example, liposomes, see below
  • synthetic polymers discussed above.
  • polypeptides or scFv-antigen fusion proteins of the invention can be delivered alone or as pharmaceutical compositions by any means known in the art, e.g., systemically, regionally, or locally ⁇ e.g., directly into, or directed to, a tumor); by intraarterial, intrathecal (IT), intravenous (IV), parenteral, intra-pleural cavity, topical, oral, or local administration, as subcutaneous, intra-tracheal (e.g., by aerosol) or transmucosal (e.g., buccal, bladder, vaginal, uterine, rectal, nasal mucosa).
  • one mode of administration includes intra-arterial or intrathecal (IT) injections, e.g., to focus on a specific organ, e.g., brain and CNS (see e.g., Gurun, Anesth Analg. 85: 317-323, 1997).
  • I intra-arterial or intrathecal
  • a specific organ e.g., brain and CNS
  • intra-carotid artery injection if preferred where it is desired to deliver a polypeptide or scFv-antigen fusion protein of the invention directly to the brain.
  • Parenteral administration is a preferred route of delivery if a high systemic dosage is needed.
  • Actual methods for preparing parenterally administrable compositions will be known or apparent to those skilled in the art and are described in detail, in e.g., Remington's, See also, Bai, J. Neuroimmunol. 80: 65-75, 1997; Warren, J. Neurol. ScL 152: 31-38, 1997; Tonegawa, /. Exp. Med. 186: 507-515, 1997.
  • the pharmaceutical formulations comprising polypeptides or scFv-antigen fusion proteins of the invention are incorporated in lipid monolayers or bilayers, e.g., liposomes, see, e.g., U.S. Pat. Nos. 6,110,490; 6,096,716; 5,283,185; 5,279,833.
  • the invention also provides formulations in which water soluble polypeptides or scFv-antigen fusion proteinsof the invention have been attached to the surface of the monolayer or bilayer.
  • peptides can be attached to hydrazide-PEG-(distearoylphosphatidyl) ethanolamine-containing liposomes (see, e.g., Zalipsky, Bioconjug. Chem. 6: 705-708, 1995).
  • Liposomes or any form of lipid membrane such as planar lipid membranes or the cell membrane of an intact cell, e.g., a red blood cell, can be used.
  • Liposomal formulations can be by any means, including administration intravenously, transdermally (see, e.g., Vutla, J. Pharm. Sci. 85: 5-8, 1996), transmucosally, or orally.
  • the invention also provides pharmaceutical preparations in which the polypeptides or scFv-antigen fusion proteins of the invention are incorporated within micelles and/or liposomes (see, e.g., Suntres, J. Pharm. Pharmacol. 46: 23-28, 1994; Woodle, Pharm. Res. 9: 260-265, 1992).
  • Liposomes and liposomal formulations can be prepared according to standard methods and are also well known in the art, see, e.g., Remington's; Akimaru, Cytokines MoI. Ther. 1: 197-210, 1995; Alving, Immunol. Rev. 145: 5-31, 1995; Szoka, Ann. Rev. Biophys. Bioeng. 9: 467, 1980, U.S. Pat. Nos. 4, 235,871, 4,501,728 and 4,837,028.
  • the active peptide compounds are prepared with carriers that will protect the compound against rapid elimination from the body, such as a controlled release formulation, including implants and microencapsulated delivery systems.
  • a controlled release formulation including implants and microencapsulated delivery systems.
  • Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art. The materials can also be obtained commercially from Alza Corporation and Nova Pharmaceuticals, Inc.
  • Liposomal suspensions (including liposomes targeted to infected cells with monoclonal antibodies to viral antigens) can also be used as pharmaceutically acceptable carriers. These can be prepared according to methods known to those skilled in the art, for example, as described in U.S. Pat. No. 4,522,811.
  • Dosage unit form refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active compound calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier.
  • Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g., for determining the LD 50 (the dose lethal to 50% of the population) and the ED 50 (the dose therapeutically effective in 50% of the population).
  • the dose ratio between toxic and therapeutic effects is the therapeutic index and it can be expressed as the ratio LD 50 /ED 50 .
  • Compounds that exhibit high therapeutic indices are preferred. While compounds that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue in order to minimize potential damage to uninfected cells and, thereby, reduce side effects.
  • the data obtained from the cell culture assays and animal studies can be used in formulating a range of dosage for use in humans.
  • the dosage of such compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity.
  • the dosage can vary within this range depending upon the dosage form employed and the route of administration utilized.
  • the therapeutically effective dose can be estimated initially from cell culture assays.
  • a dose can be formulated in animal models, e.g., of inflammation or disorders involving undesirable inflammation, to achieve a circulating plasma concentration range that includes the IC 5 0 (i.e., the concentration of the test compound which achieves a half-maximal inhibition of symptoms) as determined in cell culture.
  • Levels in plasma can be measured, for example, by high performance liquid chromatography, generally of a labeled agent.
  • Animal models useful in studies, e.g., preclinical protocols, are known in the art, for example, animal models for inflammatory disorders such as those described in Sonderstrup (Springer, Sem. Immunopathol. 25: 35-45, 2003) and Nikula et ai, Inhal. Toxicol.
  • a therapeutically effective amount of protein or polypeptide such as an antibody ranges from about 0.001 to 30 mg/kg body weight, for example, about 0.01 to 25 mg/kg body weight, about 0.1 to 20 mg/kg body weight, or about 1 to 10 mg/kg, 2 to 9 mg/kg, 3 to 8 mg/kg, 4 to 7 mg/kg, or 5 to 6 mg/kg body weight.
  • the protein or polypeptide can be administered one or several times per day or per week for between about 1 to 10 weeks, for example, between 2 to 8 weeks, between about 3 to 7 weeks, or about 4, 5, or 6 weeks. In some instances the dosage can be required over several months or more.
  • treatment of a subject with a therapeutically effective amount of an agent such as a protein or polypeptide (including an antibody) can include a single treatment or, preferably, can include a series of treatments.
  • the dosage is generally 0.1 mg/kg of body weight (for example, 10 mg/kg to 20 mg/kg).
  • Partially human antibodies and fully human antibodies generally have a longer half-life within the human body than other antibodies. Accordingly, lower dosages and less frequent administration is often possible.
  • Modifications such as lipidation can be used to stabilize antibodies and to enhance uptake and tissue penetration (e.g., into the brain).
  • a method for lipidation of antibodies is described by Cruikshank et al. , J. Acquired Immune Deficiency Syndromes and Human Retrovirology, 14: 193, 1997).
  • the present invention encompasses agents or compounds that modulate an immune response in a subject by targeting antigens into the immune system through the surface receptors CD22 and CD72.
  • An agent can, for example, be a polypeptide or scFv-antigen fusion proteins.
  • Such compounds include, but are not limited to, peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, small non-nucleic acid organic compounds or inorganic compounds (i.e., including heteroorganic and organometallic compounds) having a molecular weight less than about 10,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 5,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 1 ,000 grams per mole, organic or inorganic compounds having a molecular weight less than about 500 grams per mole, and salts, esters, and other pharmaceutically acceptable forms of such compounds.
  • peptides e.g., peptoids
  • amino acids amino acid analogs
  • small non-nucleic acid organic compounds or inorganic compounds i.e., including heteroorganic and organometallic compounds
  • small non-nucleic acid organic compounds or inorganic compounds i.e.
  • Exemplary doses include milligram or microgram amounts of the small chemical molecule per kilogram of subject or sample weight (e.g., about 1 microgram per kilogram to about 500 milligrams per kilogram, about 100 micrograms per kilogram to about 5 milligrams per kilogram, or about 1 microgram per kilogram to about 50 micrograms per kilogram. It is furthermore understood that appropriate doses of a small chemical molecule depend upon the potency of the small chemical molecule with respect to the expression or activity to be modulated.
  • an animal e.g., a human
  • a physician, veterinarian, or researcher can, for example, prescribe a relatively low dose at first, subsequently increasing the dose until an appropriate response is obtained.
  • the specific dose level for any particular animal subject will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, gender, and diet of the subject, the time of administration, the route of administration, the rate of excretion, any drug combination, and the degree of expression or activity to be modulated.
  • An antibody or fragment thereof can be linked, e.g.
  • Therapeutic agents include, but are not limited to, antibiotics (e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)).
  • antibiotics e.g., dactinomycin (formerly actinomycin), bleomycin, mithramycin, and anthramycin (AMC)
  • the conjugates described herein can be used for modifying a given biological response.
  • the moiety bound to the antibody can be a protein or polypeptide possessing a desired biological activity.
  • proteins can include, for example, a toxin such as abrin, ricin A, Pseudomonas exotoxin, or diphtheria toxin; a protein such as tumor necrosis factor, .alpha.-interferon, .beta. -interferon, nerve growth factor, platelet derived growth factor, tissue plasminogen activator; or, biological response modifiers.
  • an antibody can be conjugated to a second antibody to form an antibody heteroconjugate as described by Segal in U.S. Pat. No. 4,676,980.
  • compositions can be included in a container, pack, or dispenser together with instructions for administration.
  • compositions are generally formulated as sterile, substantially isotonic and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.
  • GMP Good Manufacturing Practice
  • compositions of the invention can be administered in a variety of unit dosage forms depending upon the method of administration. Dosages for typical polypeptides or scFv-antigen fusion protein as pharmaceutical compositions are well known to those of skill in the art. Such dosages are typically advisorial in nature and are adjusted depending on the particular therapeutic context or patient tolerance.
  • the amount of polypeptide or scFv-antigen fusion protein adequate to accomplish this is defined as a "therapeutically effective dose.”
  • dose schedule and amounts effective for this use i.e., the "dosing regimen” will depend upon a variety of factors, including the stage of the disease or condition, the severity of the disease or condition, the general state of the patient's health, the patient's physical status, age, pharmaceutical formulation and concentration of active agent, and the like.
  • the mode of administration also is taken into consideration.
  • the dosage regimen must also take into consideration the pharmacokinetics, i.e., the pharmaceutical composition's rate of absorption, bioavailability, metabolism, clearance, and the like. See, e.g., the latest Remington's; Egleton, Peptides 18: 1431- 1439, 1997; Langer, Science 249: 1527-1533, 1990.
  • polypeptide or scFv-antigen fusion protein compositions are administered to a patient suffering from infectious disease, e.g., bacterial, viral, or parasite disease, or cancer, in an amount sufficient to at least partially arrest the condition or a disease and/or its complications.
  • infectious disease e.g., bacterial, viral, or parasite disease, or cancer
  • a soluble peptide pharmaceutical composition dosage for intravenous (IV) administration would be about 0.01 mg/hr to about 1.0 mg/hr administered over several hours (typically 1, 3, or 6 hours), which can be repeated for weeks with intermittent cycles.
  • CSF cerebrospinal fluid
  • Reagents Recombinant mouse GM-CSF was purchased from Fitzgerald. LPS was obtained from Sigma-Aldrich. Goat anti-mouse IgM F(ab')2 fragments and PE-conjugated goat anti-human IgG were purchased from Jackson ImmunoResearch Laboratories. COS cells used for generation of CD22 fusion proteins were obtained from the American Type Culture Collection. All flow cytometry reagents were purchased from BD Biosciences. Arthobacter ureafaciens (Au) neuraminidase was purchased from Roche Diagnostics and the PE-conjugated Sambucus nigra lectin was obtained from Vector Labs.
  • mice were housed under specific pathogen-free conditions, and all experiments were performed in compliance with the University of Washington Institutional Animal Care and Use Committee.
  • ST ⁇ Gal-I KO mice (Hennet et al, 1998) were housed under specific pathogen-free conditions at the University of California, San Diego facility.
  • the BM and splenocytes were collected at UCSD and shipped overnight to UW as single cell suspensions in complete RPMI medium.
  • DC cell culture BM cells from the femurs and tibias of mice were collected under sterile conditions and cultured in complete RPMI media supplemented with 20 ng/ml recombinant mouse GM-CSF. The cells were fed every other day for 8 days to generate iDCs. To obtain mDCs, day 7 cultured iDCs were stimulated with 1 ⁇ g/ml LPS for 24 hs. Prior to co-culturing with the CFSE-labeled B cells, the DCs were extensively washed with complete RPMI.
  • B cell purification B cells from mouse spleens were purified using the EasySep Negative Selection kit for mouse B cells (StemCell Corporation) according to the manufacturer's protocol. Following the purification, the B cells were labeled by incubation with 10 ⁇ M CFSE for 10 minutes at 37°C, followed by quenching. For the B cell-DC co-cultures, washed DCs and CFSE-labeled B cells were cultured in 24 well tissue culture dishes or 0.4 ⁇ m transwells (Corning) at 37 0 C. Following 72 hs of incubation, the cells were collected and CFSE dilution was measured by flow cytometry. Data were analyzed using FlowJo software.
  • Neuraminidase and metaperiodate treatments were washed twice with PBS containing 2 mg/ml BSA and resuspended at a concentration of 5xlO 6 cells/ml.
  • Au neuraminidase was added to the cells at a final concentration of 400 mU/ml. The cells were then incubated at 37°c for 2 hs, after which they were washed and stained.
  • Two well-known inhibitory receptors expressed on B cells are CD22 and CD72 (Nitschke and Tsubata, 2004). Both receptors are know to activate inhibitory pathways within B cells since they both contain ITIMs within their cytoplasmic domains.
  • CD22 was an attractive candidate because it as an adhesion molecule with ligands expressed on hematopoietic cells and also because it modulates BCR signaling and associates with the BCR complex (Cornall et al, 1999).
  • CD22 appears to be required for DCs to inhibit BCR- induced cell division.
  • CD22 can mediate interactions with erythrocytes, neutrophils, T cells, B cells and monocytes (Stamenkovic and Seed, 1990; En gel et al, 1993; Law et al, 1995); thus it is possible that CD22 on B cells binds to ligands on iDCs. This binding might be required for iDCs to inhibit B cell proliferation in response to BCR crosslinking.
  • WT iDCs to iDCs derived from mice deficient for the sialyltransferase ST ⁇ Gal-I, which generates ⁇ 2-6 sialic acid ligands for CD22 (Hennet et al, 1998).
  • ST ⁇ Gal-I KO iDCs like WT iDCs, inhibited BCR-induced proliferation of WT B cells (Fig. 3B).
  • transwells To determine if the inhibition mediated by the ST ⁇ Gal-I KO iDCs is contact-dependent, we used transwells to provide a barrier between the iDCs and B cells.
  • BCR-induced cell division was not inhibited (Fig. 3B), as was the case with WT iDCs (Fig. 2).
  • physical interaction between WT B cells and ST6Gal-I-deficient iDCs is required for iDCs to inhibit BCR-induced B cell proliferation.
  • CD22 interacts with molecule(s) on iDCs
  • CD22 fusion proteins To determine if CD22 binds to molecules on the surface of iDCs, we used chimeric CD22 fusion proteins to stain bone marrow-derived DCs (Law et al., 1995).
  • One of the chimeric fusion proteins contains all seven extracellular immunoglobulin (Ig) domains fused to the Fc region of human IgG (CD22 RgI -7).
  • the other fusion protein contained deletions of Ig domains 1 and 2 (CD22 Rg3-7), the regions previously shown to be required for CD22 ligand binding (Law et al., 1995).
  • CD22 binds to a ligand(s) on iDCs that does not contain oc2-6 sialic acids.
  • This ligand on iDCs is distinct from the major CD22 ligand on B cells, which is comprised mostly of ⁇ 2-6 sialic acid-containing glycoproteins.
  • CD22 binding to iDCs is not disrupted by cleavage of ⁇ 2-6 sialic acids
  • CD22 interacts with ligands distinct from those expressing oc2-6 sialic acids on iDCs
  • a neuraminidase from Arthrobacter ureafaciens (Au) to specifically cleave ⁇ 2-6 sialic acids
  • Au Arthrobacter ureafaciens
  • the cells were stained with the CD22 Rg fusion proteins, SNA or human IgG control and analyzed by flow cytometry. Binding of CD22 RgI -7 and CD22 Rg3-7 were largely unaffected by neuraminidase treatment of the iDCs (Fig. 5A, top panels).
  • CD22 Rgl-7 binding was significantly reduced following neuraminidase treatment (Fig. 5A bottom panels) as previously reported (Hennet et al., 1998).
  • Fig. 5A bottom panels the requirements for CD22 to bind to B cells are different than the requirements for binding to iDCs.
  • CD22 ligand on iDCs is not an cc2-6 sialic acid-containing glycoprotein, but can contain some other sialic acids.
  • the CD22 ligand on B cells is comprised mostly oc2-6 sialic acid-containing glycoproteins.
  • CD22 Rg3-7 binding of CD22 to B cells requires Ig domains 1 and 2 of CD22 since binding of the deletion mutant (CD22 Rg3-7) was unaltered by both neuraminidase treatment and mild sodium metaperiodate oxidation.
  • B cells and iDCs clearly express distinct sets of CD22 ligands.
  • CD22 ligand interactions can play a role in the development of transitional T2 B cell precursors
  • CD22 and ST6Gal-I KO mice similar defects in the splenic B cell development.
  • Cells were stained for surface IgM, IgD and CD21 and analyzed by flow cytometry.
  • CD22 KO mice had normal of numbers follicular mature B cells (FO) and slightly more transitional 1 (Tl) B cells (Fig. 7).
  • the MZ B cell population was reduced by one-half in the CD22 KO mice, as previously reported (Samardzic et al., 2002).
  • CD22 KO mice had dramatic deficiencies in the two T2 subsets. There were 65% fewer T2 follicular precursor cells (T2-FOP) and 87% less T2 marginal zone precursor cells (T2-MZP) compared to WT mice.
  • T2-FOP T2 follicular precursor cells
  • T2-MZP T2 marginal zone precursor cells
  • the ST6Gal-I KO showed similar deficiencies in MZ and T2 precursor B cell populations (Fig. 6B).
  • DCs to control the initiation of an immune response requires that iDCs undergo maturation by toll-like receptor (TLR) or CD40 stimulation (Hawiger et al., 2001; Bonifaz et al., 2002; Lui et al, 2002).
  • TLR toll-like receptor
  • An inhibitory role for DCs is more likely to occur in a steady state during induction of tolerance or anergy. Indeed, DCs can induce peripheral T cell anergy in vivo they are stimulated by Ag in the absence of CD40 or TLR co-stimulation (Hawiger et al, 2001; Lui er a/., 2002).
  • iDC-mediated inhibition of B cell proliferation required CD22 (Fig. 3A).
  • ST6Gal-I KO iDCs which lack cc2-6 sialic acid ligands for CD22, inhibited WT B cell proliferation (Fig. 3B).
  • CD22 bound equally well to WT and ST ⁇ Gal-I KO iDCs (Fig. 4A) suggesting that a ligand for CD22 is expressed on both of these iDCs.
  • CD22 binding to ST ⁇ Gal-I KO B cells was lower compared to WT B cells (Fig. 4B).
  • iDCs do not express ⁇ 2-6 sialic acid- containing glycoprotein ligands for CD22 and that there is differential expression of CD22 ligands on B cells and iDCs.
  • B cells express both oc2-6 sialic acid and non-oc2-6 sialic acid glycoprotein ligands since some CD22 binding was evident in both ST ⁇ Gal-I KO B cells (Fig. 4B) and Au treated WT B cells (Fig. 5A).
  • CD22 ligand binding on iDCs might be important for regulating B cell development
  • CD22 KO mice had fewer MZ and T2 B cell precursors compared to WT animals.
  • the T2 subset that was most deficient in the CD22 KO mice was also the very same subset of B cells from WT mice that has the highest expression of CD22 (Fig. 6C and Fig. 7). Therefore, it is possible that CD22 ligand interactions play a role in the development of T2 B cells as they differentiate into either MZ or FO B cells.
  • CD22 can bind to its ligands in cis (on the same cellular surface) or in (on a different cell) (Cyster and Goodnow, 1997).
  • the distinct CD22 ligands on different cell types can have functional significance.
  • CD22 binding to ligands expressed on the B cell surface in cis can induce different signaling pathways and cellular responses compared to binding ligands expressed on other cells types ⁇ i.e. iDCs) in trans.
  • CD22 ligand binding in cis is thought to be important for the regulation of BCR signaling (Cyster and Goodnow, 1997; Jin et al, 2002; KeIm et al, 2002). Trans binding of CD22 to its ligand has not been as extensively studied as cis interactions.
  • CD22 KO mice have reduced numbers of recirculating B cells in the bone marrow while ST ⁇ Gal-I KO mice have normal numbers compared to WT animals (Hennet et al, 1998; Collins et al, 2006). Binding of CD22 in trans to ligands not containing ⁇ -2-6 sialic acid linkages, perhaps on iDCs, can regulate the development, survival or maintenance of recirculating B cells in the bone marrow.
  • CD22 ligand interaction with oc2-6 sialic acid-containing glycoproteins in cis or trans can be responsible for regulating the development of different B cell subsets (i.e. MZ B cells which are deficient in both CD22 and ST6Gal-I KO mice).
  • CD22 ligand trans interactions could also potentially regulate MHC class II levels on B cells. MHC class II expression is elevated on CD22 KO B cells, but normal on ST ⁇ Gal-I KO B cells (Otipoby et al, 1996; Hennet et al, 1998; Ghosh et al, 2006). This CD22 trans ligand interaction can act to down-regulate MHC class II expression, thereby reducing B cell activation.
  • CD22 siglec domain is normally "masked” by its binding to sialyated glycans ligands in cis, such as CD45, IgM or CD22 itself.
  • sialyated glycans ligands in cis such as CD45, IgM or CD22 itself.
  • CD22 interactions would be eliminated but CD22 could still function through its interactions with ligands on iDCs.
  • the trans interactions would inhibit BCR signaling that could oppose the activation signals produced by the lack of CD22 cis interactions and thus result in normal BCR signaling levels.
  • CD22 ligand interactions in cis and in trans can work in concert to regulate BCR signaling threshold levels and development of B cell subsets in the spleen and bone marrow.
  • B cells and production of neutralizing antibodies Pre-existing antibodies in the circulation or at the mucosa provide a first line of defense against viral re-infection. For instance, injection of FLU-infected, susceptible mice with an HA-specific neutralizing mAb prevented death (Gerhard, 2001). In other studies, long long-lasting smallpox vaccine-induced antibodies are sufficient to protect macaques against lethal monkeypox virus (Edghill-Smith et al, 2005). Memory B cells which can replenish high affinity antibody producing plasma cells at sites of viral entry are important for providing sterilizing protective immunity. Neutralizing antibodies are necessary and sufficient to protect mice against infection with vesicular stomatitis virus (VSV).
  • VSV vesicular stomatitis virus
  • DCs not only process and present Ags to T cells but also present Ags to B cells. While much is known about how DCs process and present Ags to T cells (Trombetta and Mellman, 2005), less is known about how Ag-specific responses of B cells occur and are regulated. Others and we reported that human DCs activated through CD40 could drive B cells to proliferate and mature (Pinchuk et al, 1996, Clark, 1997, Dubois et al, 1997, 1998, Fayette et al, 1998, Wykes et al, 1998). Since then a number of studies have suggested that DCs can play an important role in 'antigen preservation and presentation' to B cells (Carrasco and Batista, 2006). Balazs et al.
  • B cells clearly can acquire Ags from DCs and other target cells and recognize membrane-associated Ags (Batista et al, 2001, Bergtold et al, 2005, Carrasco and Batista, 2006).
  • the fact that DCs can activate Ag-specific B cells suggests that DCs have a means of retaining Ags in an intact form, a process we term 'Ag preservation' in contrast to the 'Ag processing' required for recognition of Ag by T cells (Clark and Santos, in preparation).
  • DCs can internalize and sequester soluble ovalbumin (OA) intracellularly, until they receive a second signal via e.g., CD40, which induces cross presentation (Delamarre et al, 2003).
  • OA sequester soluble ovalbumin
  • MAbs to a range of different surface molecules have been used to deliver Ags to DCs in vivo and/or in vitro including MHC class II, CDl Ic, DEC205/CD205, DC-SIGN/CD209, F4/80-like receptor (FIRE), CIRE, Dectin-1, Dectin-2, 33D1/DCIR2, and the mannose receptor (Finkelman et al, 1996, Bonifaz et al., 2002, 2004, Engering et al., 2002, Chieppa et al., 2003, Ramakrishna et al., 2004, Debal et al, 2005, Tacken et al., 2005, Corbett et al, 2005, Boscardin et al, 2006, Trumpfheller et al, 2006, Carter et al, 2006a,b, Dudziak et al, 2006).
  • the mAb-based Ag delivery system can be two orders of magnitude more effective than non-targeted Ags in activating protective immunity.
  • Simultaneous injection of Ag- anti-DC conjugates with a anti-CD40 mAb significantly enhanced host immune responses more than the classic Alum + Ag vaccine (Bonifaz et al, 2004, Boscardin et al, 2006).
  • This important finding is highly pertinent to the field of DNA vaccination, where many studies have found that DNA alone can induce Ab responses comparable with unadjuvanted protein immunogens, but 'for sheer magnitude of Ab titers DNA alone could not equal a potent protein plus adjuvant' (Donnelly et al, 2005).
  • CLRs are especially attractive targets for Ag delivery to DCs since: 1) they have very restricted tissue distribution, e.g.,BDCA-2 is only expressed on pDCs (Dzionek et al, 2001), and langerin, only on Langerhans cells (LCs, Valladeau et al, 2000); 2) many CLRs internalize after crosslinking and can deliver Ags to proteosomes (Engering et al, 2002, Pulendran, 2005, Brown, 2006); 3) CLRs differ in how they signal DCs (Kanazawa et al, 2004), and thus, can be useful not only for delivering Ags to a restricted set of DCs, but also for inducing tailor made protective immune responses; and 4) human CLRs when expressed in mice retain their restricted expression on mouse DC subset counterparts ⁇ e.g., Kaplan et al, 2005), and many anti-human CLR mAbs bind to macaque DC homo
  • receptors with associated ITAM domains like FcDRIIA and the B cell receptor (BCR) complex target Ags to lysosomes for efficient degradation and presentation to T cells via a process requiring protein tyrosine kinases like Syk (Bergtold et al, 2005, Clark et al, 2004).
  • receptors with ITIM domains like Fc D RIIB can be able to deliver Ags to a nondegradative intracellular compartment, where they can be retained in a native state for subsequent presentation to B cells.
  • cDNA cassettes encoding rat anti mCD40 V L and V H segments were cloned from the IClO hybridoma, fused by a (glyiser) x linker, and attached to a mutated murine IgG2a Fc domain, including an SCC hinge and (P238S/K322S/P331S) Fc.
  • the single chain fusion gene also encodes a linker- Ag domain attached to the carboxyl end of the CH3.
  • Figure 11 shows the alignment of murine IgG2a, human IgGl, and macaquelgGl- [hinge-CH2-CH3]- amino acid sequences. Sequence matches between all 3 sequences are highlighted in red; matches between two sequences are highlighted in light blue; conservative sequence changes are in green. The consensus sequence is listed at the bottom. Residues enclosed in boxes are a subset of conserved residues identified as important in ADCC, CDC, or FcR binding. These residues are P238 (ADCC), N297 (FcR binding, ADCC, CDC, and glycosylation), K322 (CIq binding, CDC), and P331 (CIq binding, CDC). The preferred aspect can contain one or more of these mutations or be the wild type residue depending on whether depletion of the target cell subset is desired as part of the outcome.
  • DC-specific scFv engineered not to mediate either ADCC or CDC is very unlikely to deplete DCs in vivo.
  • bispecific molecules which fuse an scFvIg domain to an antigen such as viral antigens including HIV gpl20 (Hayden- Ledbetter, unpublished data). Development of viral antigen-scFvIg fusion constructs which target to selected DC markers should be straightforward.
  • This approach requires optimization of the scFv delivery system including adapting it for use as a DNA vaccine or a soluble fusion protein ; optimization of antigen expression so that neutralizing epitopes are expressed on the back end of the scFv and preserved during delivery to B cells; and testing fusion protein candidates for their ability to induce neutralizing antibodies and protective immunity using pre-clinical mouse and macaque models.
  • antigen Ag
  • scFv constructs B cells at different stages of maturation and DC subsets express particular patterns of surface receptors that mediate specific patterns of activation of other lymphocyte subsets. Targeting Ags to these specialized B cells and DC subsets with similar scFv-Ig-Ag molecules will allow us to determine which receptors mediate optimal neutralizing Ab reponses in vivo or might be used to dampen autoimmune responses and promote a more tolerogenic program. In order to be able to compare targeting to different DC subsets and B cell surface molecules we will prepare the set of scFv we will prepare are listed in Fig. 15.
  • V L -V H -hinge CH2-CH3 scFv constructs We will construct V L -V H -hinge CH2-CH3 scFv constructs, and mutate the CH2 and CH3 domain at homologous residues identified as being important for mediation of ADCC and CDC (Fig.l 1, Idusogie et al, 2001, Presta, 2002).
  • CD22 binding molecule would bind to an epitope on CD22 which modulates B cell interactions with other cells such as dendritic cells and would not fix complement or mediate antibody- dependent cell-mediated cytotoxicity (ADCC).
  • a preferred aspect of a CD22 inhibitor would be comprised of molecule that has humanized VH and VL domains that bind to CD22 and a hinge and human CH2 and CH3 domains that have been mutated so that they do not mediate ADCC or fix complement.
  • mice can recognize epitopes on the rat IgG2b mAb antibody, this form of administration targets the rat epitopes to mouse DCs.
  • sera from the immunized mice were isolated and levels of mouse IgGl anti-rat IgG2b were measured by ELISA.
  • WT mice make a strong Ag-specific IgGl antibody response to 100 ng of inoculated antigen, but CD22 KO mice did not.
  • CD22 KO mice did not.
  • the absence of CD22 prevented an antigen-specific IgG 1 antibody response to an antigen targeted to dendritic cells.
  • RNA will be isolated from hybridoma cells growing in log phase using QIAGEN RNeasy kits, including QIA shredder column purification to homogenize cell lysates, and purification over RNeasy mini-columns. Then cDNA will be synthesized and anchor tailed, and PCR will be performed using an anchor-tail (CCCCCC)-complementary primer and a primer, which anneals specifically to the antisense strand of the constant region of either mouse (or rat) CK or mouse CHl (or rat) for the appropriate isotype.
  • CCCCCC anchor-tail
  • variable region fragments are then TOPO cloned (Invitrogen), and clones with inserts of the correct size sequenced.
  • Consensus sequence for each variable domain will be determined from sequences of at least 4 independent clones.
  • the scFv is constructed by insertion of a variable length (gly4ser) linker (10-20 amino acids) or by sewing PCR using overlapping primers containing a synthetic (gly4ser)3 , a (gly4ser)4 or a hydrophilic linker containing a (glyser) motif at each end, linker domain inserted between the V L and V H regions.
  • Constructs are fused to a synthetic V 0 light chain signal peptide derived from the sequences of several different leaders, with a Kozak signal sequence included to improve expression level of the expressed fusion proteins.
  • Human and macaque IgGl and mouse IgG2a Fc domains (hinge, CH2, and CH3 domains) have been isolated from blood (human and macaque) or splenic (mouse) RNA. Sequences have been altered using SOEing PCR to introduce mutations at residues implicated in mediating ADCC and CDC effector functions. [0201]
  • the scFv-Ig-Ag fusion constructs will be inserted into one of two expression vectors for creation of the DNA vaccines.
  • the first will permit strong constitutive expression of the fusion proteins under the control of the CMVintA immediate-early promoter, which is a superior promoter and still favored for inducing immune responses (Lee et al, 1997, Donnelly et al, 2005) and which has been used successfully for FLU DNA vaccination in mice (Kodihalli et al, 1999).
  • CMVintA immediate-early promoter which is a superior promoter and still favored for inducing immune responses
  • scFv expression is under the control of a tissue specific, promoter such as the species- specific muscle creatine kinase (MCK) promoter (Bojak et al., 2002).
  • MCK species-specific muscle creatine kinase
  • the scFvs have the expected activity, e.g., that the scFvs to CD40, CD22, CD72, 33Dl, DCAL-2 and CD40 internalize and that CD40 scFv- mG2a, as expected, stimulates mouse iDCs to mature and express high levels of MHC class IFCD86.
  • Most of the constructs will be designed to eliminate ADCC and C binding effector function but not Fc receptor binding, which if it occurs can deliver Ag (You et al, 2001). Retention of this function can help to maintain the half-life of the fusion protein.
  • the linker between the scFv-Ig and Ag portions of the molecule might need to be optimized to prevent problems with protease cleavage or improper folding.
  • successful linkers are usually hydrophilic, more disordered short peptide segments.
  • the linker segment might also be presented and be immunogenic.
  • the optimal linker might best be chosen from a linker like a domain from prokaryotes (bacterial or viral sequences) rather than a mammalian linker segment such as an Ig hinge domain.
  • the following examples illustrate the production of a set of scFvIg molecules targeted to a surface receptor, murine DCAL2, expressed on several lymphocyte subsets, including B cells, and CD8 ' and CD8+ dendritic cells.
  • scFvIg-antigen [scFvIg-antigen] fusion genes and proteins which can mediate delivery of the antigens to cells expressing the target receptor by high affinity binding of the scFv portion of the molecules.
  • a similar approach could be used for human, mouse, and rat V regions targeted to a variety of different lymphocyte surface receptors.
  • a variety of different antigens or antigen fragments could be fused to an scFvIg in order to target delivery of the antigen to a particular subset of cells.
  • RNA was isolated from approximately 10E7 cultured cells in logarithmic growth, with a viability greater than or equal to 90%.
  • the hybridomas include P4G2, a rat-anti-mouse DCAL2 antibody producing hybridoma, the rat anti- mouse CD22 hybridoma.
  • Cells were cultured in RPMI containing 10% fetal bovine serum, 5x10-4 M 2-mercaptoethanol, 2 mM glutamine, penicillin/streptomycin, sodium pyruvate, and DMEM non-essential amino acids for several passages prior to isolation of RNA. Cells were harvested by centrifugation at 100 RPM, washed in PBS, and resuspended in 600 microliters of RLT buffer containing 2-mercaptoethanol to lyse the cells.
  • the variable domains of the P4G2 scFvs were cloned using a family of degenerate 5' oligonucleotides able to cross-hybridize for each V region gene family and a single 3' primer specific for the constant region of either the light or heavy chain.
  • PCR amplified products were reamplified by nested PCR, using a second set of 3' primers internal to the first set. Fragments were cloned into the PCR 2.1 -TOPO vector (Invitrogen), clones screened for inserts of the proper size by EcoRI digestion, and positive clones sequenced as previously described.
  • the primers used for the VH domain are shown below:
  • Small cassettes were designed which incorporated a 5' restriction site, Kozak consensus sequence, and the leader peptide from the human VK3 germline sequence which includes an in frame Age I site at the end of the leader peptide, just upstream of the framework region for the light chain variable domain. Overlapping, partially complementary oligonucleotides were used in PCR extension reactions to create these short cassettes. PCR products of the correct size were isolated by gel electrophoresis and cloned into the pCR-2.1 TOPO (Invitrogen) vector.
  • HUVK3LP 5'- aagcttgccaccatggcctggactccacttctccttcctctctctcactgtacagtctctaccggt-3'
  • Each of these cassettes were synthesized de novo from overlapping, partially complementary oligonucleotides, which were annealed and extended by PCR extension reactions, fragments of the correct size isolated by gel electrophoresis and QIAquick (QIAGEN, Valencia, CA) isolation, followed by cloning into pCR 2.1- TOPO vectors for DNA sequence verification.
  • PCR reactions were performed on the TOPO cloned DNA using a 30 cycle program with the following profile: 94C, 30 sec; 55C, 30-60 sec; 72C, 30-60 sec, followed by a final extension at 72C for 8 minutes.
  • PCR products were gel purified and fragments recovered using a QIAQUICK gel extraction kit (QIAGEN, Valencia, CA). Fragments were subcloned into pUC derived vectors for creating fusion genes.
  • VH was subcloned into a particular vector with the leader peptide cassette as a three way ligation, positive clones identified by restriction digestion, and these clones recut with the appropriate enzymes for inserting linker and VL domains together as a second three-way ligation. Fragments were mixed together in the appropriate ratios to optimize three-way ligation reactions.
  • Fragments were diluted 1:50 and 1 microliter used for SEWING PCR reactions when linkers were attached in this manner instead of by multi-fragment ligation. Diluted overlapping PCR products were added to standard PCR reactions without additional primers and run for 2 cycles. Cycling was then paused, and the flanking VL 5 'and VH 3' primers were added. Cycling was resumed and allowed to complete the remainder of the 30 cycle program. The temperature profile was 94C, 60 sec; 55C, 60 sec; and 72C, 60 sec for 30 cycles.
  • MUIGG2ACH2 5'- cctccatgcaaatgcccagcacctaacctcttgggtggatcatccgtcttcatcttcc-3'
  • MUIgG2A5 5 ' -agatctcgagcccagaggtcccacaatcaagccctctcctccatgcaaatgcc-3 '
  • MUIgG2A3 S 5 ' -gtttctagattatcatttacccggaagtccgagagaagctcttagtcgt-3 '
  • MUIgG2ANS 5 ' -gatatctctagatttacccggagtccgagagaagctcttagtcgt-3 '
  • MIGG2A KP5 5 ' -agtggcaaggagttcaaatgctcggtcaacaacaacctcccagcgtccatc- 3'
  • This primer was used in combination with the MUIGG2A3S or NS primers above to create a short subfragment encoding the CH3 domain of the mouse IgG2a.
  • MIGG2A KP-3 5 ' -ggttctctcgatggacgctgggaggtctttgttgaccgagcatttgaactcc- 3'
  • This primer was used as an antisense primer in combination with the MUIgG2A5 sense primer to create a larger Fc subfragment encoding the hinge and CH2 domains. The two subfragments overlap with one another. Overlap extension PCR was performed to recreate a full length mutated Fc. After two rounds of PCR, the flanking primers were added to the PCR reactions to amplify the full length mutated Fc molecules. Full length PCR fragments were isolated from the subfragments and oligonucleotides by gel electrophoresis and QIAquick column purification. Fragments were TOPO cloned and clones with correct fragment sizes were sequenced to verify the incorporation of the desired mutations.
  • MUIgG2ANS 5'-gatatctctagatttacccggagtccgagagaagctcttagtcgt-3'
  • HEL hen egg lysozyme
  • three mutant derivatives were cloned from FLAG-tagged sequences inserted in pCDNA3hygro vectors, obtained as a kind gift from Robert Brink.
  • the sequence encoding only the HEL specificity without any signal peptide or the FLAG tag was PCR amplified using the following primers, and a hydrophilic linker attached by serial PCR reactions, using overlapping 5' primer sets.
  • HEL5'+LNK tctagagctagcgacatggccaagaaggagacagtctggaggctc-3' HEL5 ' : 5 ' -aaggagacagtctggaggctcgagaaagtctttggacgatgtgag
  • HEL3 ' 5 ' -tctagattactaagagccffcagcctctgatccac-3 '
  • hydrophilic linker sequence used is as follows: 5 ' -tctagagctagcgacatggccaagaaggagacagtctggaggctcgaggagttcggtaggttc-3 ' (OVA)
  • the predicted amino acid sequence encoded is: NH2-SRASDMAKKETVWRLEEFGRF-COOH (OVA) NH2-SRASDMAKKETVWRLEK-COOH (HEL)
  • the antigen for chicken ovalbumin was amplified from a construct obtained from Michel Nussenzweig, Rockefeller University.
  • the ovalbumin sequence was also amplified with an amino terminal linker sequence attached to separate the end of the murine CH3 domain from the beginning of the ovalbumin coding sequence.
  • the oligonucleotides used were as follows:
  • Constructs were transformed into competent TOPlO bacteria (Invitrogen, Carlsbad, CA) and plasmids isolated using QIAGEN (Valencia, CA) miniprep kits. DNA was then transiently transfected into COS cells Multiple independent transfections of each new molecule were performed in order to determine the average expression level for each new form. Culture supernatants from COS transfections were screened by SDS- PAGE, Western blotting, and FACS binding assays using A20 cells as targets.
  • the scFvIg, scFvIg-HEL, and scFvIg-OVA constructs were produced by construction of recombinant expression plasmids and stable transfection of Chinese hamster ovary cells (CHO DG44). Master wells producing the highest level of fusion proteins were identified by IgG sandwich ELISA and cell binding assays using serial dilutions of harvested culture supernatants. Fusion proteins were purified from spent CHO culture supernatants by Protein A affinity chromatography after adjustment of the pH to 9.0 using 0.2M sodium carbonate buffer. Protein was eluted from the columns in 0.1M citrate buffer, pH 2.5, and dialyzed into PBS, pH 7.0.
  • A20 murine B cell lymphoma cells were suspended in staining media, PBS with 2%FBS (#16140-071, Gibco/Invitrogen, Grand Island, NY)I. Culture supernatants were concentrated 10-15 fold, dialyzed in PBS, and serial dilutions added to the cells. Binding reactions were allowed to proceed on ice for 45 minutes prior to centrifugation and washing in staining media. Cells were resuspended in staining medium containing biotin conjugated monoclonal antibody anti mouse IgG2a (5.7, Becton Dickinson) at 1 : 100.
  • A20 cells were incubated with culture supernatants, washed as described above, and incubated in a second step containing directly conjugated antibodies specific for HEL or for OVA for 45 minutes on ice. Samples were washed in staining media, fixed, and analyzed as described above. The binding analysis using different second steps to detect distinct portions of the fusion protein demonstrated that a molecule with a mouse IgG2a and either OVA or HEL attached bound specifically to the A20 cells. Further blocking studies using labeled P4G2 whole antibody demonstrated that the binding to A20 cells is specific for the mDCAL2 receptor and not some other portion of the molecule.
  • TM-NS-OVA huVK3 WT (GLY 4 SER) 3 WT mlgG2a-kv, SCC P238S P331S NS-OVA
  • B cells acquire antigen from target cells after synapse formation. Natre. 41 1:489-494.
  • Carter RW Thompson C, Reid DM, Wong SY, Tough DF. Induction of CD8+ T cell responses through targeting of antigen to Dectin-2. Cell Immunol. 2006a. 239:87-91. Carter RW, Thompson C, Reid DM, Wong SY, Tough DF. Preferential Induction of CD4+ T Cell Responses through In Vivo Targeting of Antigen to Dendritic Cell-Associated C-Type Lectin- 1. J Immunol. 2006b. 177:2276-84
  • DCAL-2 Dendritic-cell-associated C-type lectin 2
  • Dendritic cells enhance growth and differentiation of CD40-activated B lymphocytes. J. Exp. Med. 185:941-951.
  • Dendritic cells induce peripheral T cell unresponsiveness under steady state conditions in vivo. J. Exp. Med. 194:769-779.
  • Hayden now Hayden-Ledbetter MS, Linsley PS, Gayle MA, Bajorath J, Brady WA, Norris NA, Fell HP, Ledbetter JA, Gilliland LK. Single-chain mono- and bispecific antibody derivatives with novel biological properties and antitumour activity from a COS cell transient expression system. Ther Immunol. 1994. 1 :3-15.
  • Hayden now Hayden-Ledbetter MS, Gilliland LK, Ledbetter JA. Antibody engineering. Curr Opin Immunol. 1997. 9:201-12.
  • Ig domains 1 and 2 of murine CD22 constitute the ligand-binding domain and bind multiple sialylated ligands expressed on B and T cells. J. Immunol. 155:3368-3376.
  • CD22 associates with protein tyrosine phosphatase 1C, Syk, and phospholipase C- gamma(l) upon B cell activation. J. Exp. Med. 183:547-560.
  • CD22 is a negative regulator of B-cell receptor signalling. Curr Biol. 1997 7: 133-43.
  • CD22 regulates B lymphocyte function in vivo through both ligand-dependent and ligand-independent mechanisms. Nat. Immunol. 5:1078-1087.
  • Notch2 is preferentially expressed in mature B cells and indispensable for marginal zone B lineage development. Immunity. 18:675-685.
  • CD22 is both a positive and negative regulator of B lymphocyte antigen receptor signal transduction: altered signaling in CD22-deficient mice. Immunity. 1996. 5:551-62.
  • CD22 a B cell-specific immunoglobulin superfamily member, is a sialic acid-binding lectin. J. Biol. Chem. 268:7011- 7018.
  • the B-cell antigen CD22 mediates monocyte and erythrocyte adhesion. Nature. 345:74-77.
  • CD22 binds to alpha-2,6-sialyltransferase-dependent epitopes on COS cells. Cell. 68:1003-1004. Stamenkovic, L, D. Sgroi, A. Aruffo, M.S. Sy, and T. Anderson. 1991.
  • the B lymphocyte adhesion molecule CD22 interacts with leukocyte common antigen CD45RO on T cells and alpha 2-6 sialyltransferase, CD75, on B cells. Cell. 66: 1133-1144.
  • Dendritic cell-B-cell interaction dendritic cells provide B cells with CD40-independent proliferation signals and CD40-dependent survival signals. Immunology. 100: 1-3.
  • Dendritic cells interact directly with naive B lymphocytes to transfer antigen and initiate class switching in a primary T- dependent response. J. Immunol. 161 :1313-1319.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Biophysics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Biochemistry (AREA)
  • Cell Biology (AREA)
  • Toxicology (AREA)
  • Zoology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)

Abstract

La présente invention concerne de manière générale des procédés de modulation d'une réponse immunitaire chez un sujet en ciblant des antigènes dans le système immunitaire par l'intermédiaire des récepteurs de surface CD22 et CD72. L'invention concerne en outre des procédés de modulation d'une réponse immunitaire chez un sujet en ciblant des antigènes dans le système immunitaire par l'intermédiaire des récepteurs de surface exprimés de manière préférentielle sur les lymphocytes B et contenant un motif d'inhibition des immunorécepteurs à base de tyrosine (ITIM).
PCT/US2008/053350 2007-02-07 2008-02-07 Procédés de modulation des réponses des lymphocytes b spécifiques des antigènes WO2008098145A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US88874607P 2007-02-07 2007-02-07
US60/888,746 2007-02-07

Publications (1)

Publication Number Publication Date
WO2008098145A1 true WO2008098145A1 (fr) 2008-08-14

Family

ID=39682118

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2008/053350 WO2008098145A1 (fr) 2007-02-07 2008-02-07 Procédés de modulation des réponses des lymphocytes b spécifiques des antigènes

Country Status (1)

Country Link
WO (1) WO2008098145A1 (fr)

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012058592A3 (fr) * 2010-10-29 2012-08-16 Immunogen, Inc. Molécules non antagonistes se liant au récepteur egf et immunoconjugués de celles-ci
WO2014043215A1 (fr) * 2012-09-11 2014-03-20 The Texas A&M University System Dianticorps bispécifiques pour le masquage et le ciblage de vaccins
US9125896B2 (en) 2010-10-29 2015-09-08 Immunogen, Inc. EGFR-binding molecules and immunoconjugates thereof
US9233171B2 (en) 2011-11-21 2016-01-12 Immunogen, Inc. Method of treatment of tumors that are resistant to EGFR antibody therapies by EGFR antibody cytotoxic agent conjugate
JP2017521046A (ja) * 2014-05-08 2017-08-03 ザ・ヘンリー・エム・ジャクソン・ファンデイション・フォー・ジ・アドヴァンスメント・オヴ・ミリタリー・メディシン、インコーポレイテッド 有害な免疫応答を処置するための寛容原性タンパク質療法としてのＢ細胞標的化抗原ＩｇＧ融合物の使用
US10961280B2 (en) * 2012-03-19 2021-03-30 Deutsches Krebsforschungszentrum B-cell receptor complex binding proteins containing T-cell epitopes
WO2022150389A1 (fr) * 2021-01-06 2022-07-14 The Regents Of The University Of California Nanocorps anti-cd72 destinés à une immunothérapie

Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7074403B1 (en) * 1999-06-09 2006-07-11 Immunomedics, Inc. Immunotherapy of autoimmune disorders using antibodies which target B-cells
WO2006073941A2 (fr) * 2004-12-31 2006-07-13 Genentech, Inc. Polypeptides de liaison a la br3 et leurs utilisations

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US7074403B1 (en) * 1999-06-09 2006-07-11 Immunomedics, Inc. Immunotherapy of autoimmune disorders using antibodies which target B-cells
WO2006073941A2 (fr) * 2004-12-31 2006-07-13 Genentech, Inc. Polypeptides de liaison a la br3 et leurs utilisations

Non-Patent Citations (6)

* Cited by examiner, † Cited by third party
Title
ARNDT M.A. ET AL.: "Generation of a highly stable, internalizing anti-CD2 single-chain Fv fragment for targeting non-Hodgkin's lymphoma", INT. J. CANCER, vol. 107, no. 5, 10 December 2003 (2003-12-10), pages 822 - 829, XP003003811 *
CARNAHAN J. ET AL.: "Epratuzumab, a CD22-targeting recombinant humanized antibody with a different mode of action from rituximab", MOL. IMMUNOL., vol. 44, no. 6, February 2007 (2007-02-01), pages 1331 - 1341, XP005664750 *
GOYAL A. ET AL.: "Inclusion of a furin-sensitive spacer enhances the cytotoxicity of ribotoxin restrictocin containing recombinant single-chain immunotoxins", BIOCHEM. J., vol. 345, no. PART 2, 15 January 2000 (2000-01-15), pages 247 - 254, XP001008585 *
MORITZ D. ET AL.: "Cytotoxic T lymphocytes with a grafted recognition specificity for ERBB2-expressing tumor cells", PROC. NATL. ACAD. SCI. U.S.A., vol. 91, no. 10, 10 May 1994 (1994-05-10), pages 4318 - 4322, XP000647482 *
TEDDER T.F. ET AL.: "CD22: A Multifunctional Receptor That Regulates B Lymphocyte Survival and Signal Transduction", ADV. IMMUNOL., vol. 88, 2005, pages 1 - 50, XP009116115, DOI: doi:10.1016/S0065-2776(05)88001-0 *
VOSE J.M.: "Antibody-targeted therapy for low-grade lymphoma", SEMIN. HEMATOL., vol. 36, no. 4, SUPPL. 6, October 1999 (1999-10-01), pages 15 - 20, XP008055767 *

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2012058592A3 (fr) * 2010-10-29 2012-08-16 Immunogen, Inc. Molécules non antagonistes se liant au récepteur egf et immunoconjugués de celles-ci
US9125896B2 (en) 2010-10-29 2015-09-08 Immunogen, Inc. EGFR-binding molecules and immunoconjugates thereof
US9238690B2 (en) 2010-10-29 2016-01-19 Immunogen, Inc. Non-antagonistic EGFR-binding molecules and immunoconjugates thereof
US9233171B2 (en) 2011-11-21 2016-01-12 Immunogen, Inc. Method of treatment of tumors that are resistant to EGFR antibody therapies by EGFR antibody cytotoxic agent conjugate
US10961280B2 (en) * 2012-03-19 2021-03-30 Deutsches Krebsforschungszentrum B-cell receptor complex binding proteins containing T-cell epitopes
WO2014043215A1 (fr) * 2012-09-11 2014-03-20 The Texas A&M University System Dianticorps bispécifiques pour le masquage et le ciblage de vaccins
US10836809B2 (en) 2012-09-11 2020-11-17 The Texas A&M University System Mosaic chimeric viral vaccine particle
US11352416B2 (en) 2012-09-11 2022-06-07 The Texas A&M University System Mosaic chimeric viral vaccine particle
JP2017521046A (ja) * 2014-05-08 2017-08-03 ザ・ヘンリー・エム・ジャクソン・ファンデイション・フォー・ジ・アドヴァンスメント・オヴ・ミリタリー・メディシン、インコーポレイテッド 有害な免疫応答を処置するための寛容原性タンパク質療法としてのＢ細胞標的化抗原ＩｇＧ融合物の使用
WO2022150389A1 (fr) * 2021-01-06 2022-07-14 The Regents Of The University Of California Nanocorps anti-cd72 destinés à une immunothérapie

Similar Documents

Publication Publication Date Title
US10604576B2 (en) Antibodies and immunocytokines
JP6496349B2 (ja) ヒト及び非ヒトｃｄ３に結合可能なｃｄ３結合分子
KR102662915B1 (ko) 항-b7-h3 항체
KR101924874B1 (ko) 인간 항-ｐｄ-１, ｐｄ-ｌ１, 및 ｐｄ-ｌ2 항체 및 그의 용도
JP6412072B2 (ja) 抗ヒト受容体型プロテインチロシンホスファターゼσ抗体
CA2884704C (fr) Modulateurs vista de diagnostic et de traitement de cancer
TWI645858B (zh) 反應b7-h3之抗體、其免疫活性片段及使用
CN113286634A (zh) 对gucy2c特异性的抗体及其用途
JP2019528038A (ja) 抗ｈｌａ−ｇ特異的抗体
KR20170128234A (ko) Ror1에 특이적인 항체 및 키메라 항원 수용체
CA2997960A1 (fr) Anticorps anti-trem2 et leurs procedes d'utilisation
WO2008098145A1 (fr) Procédés de modulation des réponses des lymphocytes b spécifiques des antigènes
AU2005339476A8 (en) Neutralizing antibodies and methods of use thereof
KR20210005639A (ko) 다중특이적 항체 및 이의 용도
JP7384835B2 (ja) Ｃｄ３に特異的な抗体及びその使用
US20220177581A1 (en) Cd22 antibodies and methods of using the same
KR20230017226A (ko) Cd40 결합 단백질
JP2022525435A (ja) Ｃｄ１９抗体およびこれを使用する方法
AU2019344524A1 (en) Anti-KLRG1 antibodies
WO2004069183A2 (fr) Regulation immunitaire basee sur le ciblage de molecules d'activation precoce
US20240174758A1 (en) Therapeutic binding molecules
WO2002066059A2 (fr) Agents bloquant la signalisation induite par cd28 de façon specifique et leurs applications
KR20190080957A (ko) Ｃｄ43의 독특한 시알로글리코실화된 암-연관 에피토프를 표적으로 하는 모노클로날 항체
CN112638949B (zh) 抗b7s1多肽及其用途
JP2024512324A (ja) 抗グリコｃｄ４４抗体およびその使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 08729325

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 08729325

Country of ref document: EP

Kind code of ref document: A1