WO2008086858A1 - Production et utilisation de variantes non naturelles du domaine 2 de la bikunine du placenta humain conçues par évolution moléculaire dirigée - Google Patents

Production et utilisation de variantes non naturelles du domaine 2 de la bikunine du placenta humain conçues par évolution moléculaire dirigée Download PDF

Info

Publication number
WO2008086858A1
WO2008086858A1 PCT/EP2007/010797 EP2007010797W WO2008086858A1 WO 2008086858 A1 WO2008086858 A1 WO 2008086858A1 EP 2007010797 W EP2007010797 W EP 2007010797W WO 2008086858 A1 WO2008086858 A1 WO 2008086858A1
Authority
WO
WIPO (PCT)
Prior art keywords
hbikd2
seq
variants
native
chimera
Prior art date
Application number
PCT/EP2007/010797
Other languages
English (en)
Inventor
Frank Dittmer
Heiner Apeler
Juergen Franz
Axel Harrenga
Felix Oehme
Original Assignee
Bayer Schering Pharma Aktiengesellschaft
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Family has litigation
First worldwide family litigation filed litigation Critical https://patents.darts-ip.com/?family=39167588&utm_source=google_patent&utm_medium=platform_link&utm_campaign=public_patent_search&patent=WO2008086858(A1) "Global patent litigation dataset” by Darts-ip is licensed under a Creative Commons Attribution 4.0 International License.
Application filed by Bayer Schering Pharma Aktiengesellschaft filed Critical Bayer Schering Pharma Aktiengesellschaft
Publication of WO2008086858A1 publication Critical patent/WO2008086858A1/fr

Links

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/81—Protease inhibitors
    • C07K14/8107—Endopeptidase (E.C. 3.4.21-99) inhibitors
    • C07K14/811—Serine protease (E.C. 3.4.21) inhibitors
    • C07K14/8114—Kunitz type inhibitors
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/04—Antihaemorrhagics; Procoagulants; Haemostatic agents; Antifibrinolytic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides

Definitions

  • HAI-2 hepatocyte growth factor activator inhibitor type 2
  • SPINT2 hepatocyte growth factor activator inhibitor type 2
  • Kunitz domains are polypeptides of about 56-60 amino acids length that inhibit a broad spectrum of serine proteases with different potency. Most of the family members contain three intramolecular disulfide bonds in a conserved spacing.
  • Mature placental bikunin contains of 2 Kunitz domains and a single putative transmembrane domain indicating that bikunin is synthesized as a membrane- associated form and might be shedded as a proteolytically truncated form. It has a broad inhibitory spectrum against various serine proteases showing potent inhibitory activities not only to plasmin, trypsin and kallikreins but also to the HGA-activating proteases hepatocyte growth factor activator (HGFA) and hepsin (Delaria et al., J Biol. Chem. 272:12209-12214, 1997; Kawaguchi et al., J. Biol. Chem.
  • HGFA hepatocyte growth factor activator
  • aprotinin which is a 58-amino acid bovine protein (Dembowsky et al., Chapter 10, In: Novel Therapeutic Proteins - Selected Case Studies, Dembowsky et al. (eds.), WILEY-VCH, Weinheim, 2001 , pp. 225-41).
  • Aprotinin is the active substance in the medicament Trasylol, which is approved for the reduction of perioperative blood loss in CABG patients. Its blood saving properties have been mainly assigned to the antifibrinolytic but anticoagulative activities of aprotinin mediated by the potent inhibition of key serine proteases like plasmin, plasmakallikrein and factor XIa.
  • SIRS systemic inflammatory response
  • Aprotinin might have further potential for blood saving in major surgery (hip replacement, spinal surgery, liver transplantation) and further indications like trauma (Samama et al., Anesth. Analg. 95:287-293, 2002; Porte et al., Lancet 355:1303- 1309, 2000; Coats et al., Cochrane Database Syst. Rev. 4:CD004896, 2004).
  • Placental bikunin due to its human origin is supposed to be non-immunogenic.
  • functional characterization of a soluble fragment of recombinant bikunin and both of its synthetically prepared Kunitz domains 1 and 2 revealed that all three proteins are potent inhibitors of kallikreins, plasmin and factor XIa (Delaria et al., J Biol. Chem. 272:12209-12214).
  • a bikunin variant with a mutation in KD2 had almost wt-activity against HGFA, whereas a point mutation in KD1 markedly reduced the activity.
  • KD1 is mainly responsible for the HGFA inhibitory activity of bikunin (Qin et al., FEBS 436:111-114, 1998). Together these findings led to the conclusion that bikunin or its isolated KDs may be considered as a therapeutic protein for those indications for which aprotinin has shown to be beneficial.
  • an objective of the present invention is to identify derivatives of hBikD2 with improved expression levels and with functional activities at least similar to aprotinin.
  • Non-native variants of natural Kunitz-type domains with putative protease inhibitor activity have also been described in US5863893 by Dennis et al. and US5914315 by Sprecher et al..
  • Variant polypeptides according to the present invention may be designed by directed molecular evolution approaches which in general allow the random generation of a large number of mutants followed by selection for the desired property.
  • Strategies for this type of in vitro protein engineering are based on various techniques of mutagenesis and/or recombination of DNA as has been reviewed in Bloom et al., Curr. Opin. Struct. Biol. 15:447-452, 2005; Kaur and Sharma, Crit. Rev. Biotechnology 26:165-199, 2006.
  • Protein function can be modified and improved in vitro by a variety of methods, including site directed mutagenesis (Alber et al., Nature, 5; 330:41-46, 1987) combinatorial cloning (Huse et al., Science, 246:1275-1281 , 1989; Marks et al., Biotechnology, 10:779-783, 1992) and random mutagenesis combined with appropriate selection systems (Barbas et al., PNAS. USA, 89:4457-4461 , 1992).
  • site directed mutagenesis Alber et al., Nature, 5; 330:41-46, 1987
  • combinatorial cloning Hause et al., Science, 246:1275-1281 , 1989; Marks et al., Biotechnology, 10:779-783, 1992
  • random mutagenesis combined with appropriate selection systems (Barbas et al., PNAS. USA, 89:4457-4461 , 1992).
  • the method of random mutagenesis together with selection has been used in a number of cases to improve protein function and two different strategies exist. Firstly, randomisation of the entire gene sequence in combination with the selection of a variant (mutant) protein with desired characteristics, followed by a new round of random mutagenesis and selection. This method can then be repeated until a protein variant is found which is considered optimal (Schier R. et al., J. MoI. Biol. 1996 263:551-567).
  • the traditional route to introduce mutations is by error prone PCR (Leung et al., Technique, 1 :11-15, 1989) with a mutation rate of approximately 0.7%.
  • defined regions of the gene can be mutagenised with degenerate primers, which allows for mutation rates of up to 100% (Griffiths et al., EMBO. J, 13:3245-3260, 1994; Yang et al., J. MoI. Biol. 254:392-403, 1995).
  • Random mutation has been used extensively in the field of antibody engineering.
  • Antibody genes formed in vivo can be cloned in vitro (Larrick et al., Biochem. Biophys. Res. Commun. 160:1250-1256, 1989) and random combinations of the genes encoding the variable heavy and light genes can be subjected to selection (Marks et al., Biotechnology, 10:779-783, 1992). Functional antibody fragments selected by these methods can be further improved using random mutagenesis and additional rounds of selections (Schier R. et al., J. MoI. Biol. 1996 263:551-567).
  • Combinatorial pairing of genes has also been used to improve protein function, e.g. antibody affinity (Marks et al., Biotechnology, 10:779-783, 1992).
  • DNA shuffling Another known process for in vitro mutation of protein function, which is often referred to as "DNA shuffling", utilises random fragmentation of DNA and assembly of fragments into a functional coding sequence (Stemmer, Nature 370:389-391 , 1994).
  • the DNA shuffling process generates diversity by recombination, combining useful mutations from individual genes. It has been used successfully for artificial evolution of different proteins, e.g. enzymes and cytokines (Chang et al., Nature Biotech. 17:793-797, 1999; Zhang et al. Proc. Natl. Acad. Sci. USA 94:4504-4509, 1997; Christians et al., Nature Biotech. 17:259-264, 1999).
  • the genes are randomly fragmented using DNase I and then reassembled by recombination with each other.
  • the starting material can be either a single gene (first randomly mutated using error- prone PCR) or naturally occurring homologous sequences (so-called family shuffling).
  • FINDTM Fragment-
  • hBikD2 which can be produced as a functional protein at a high level in a recombinant expression system, for example the yeast secretion system, and which show a favorable inhibition profile against serine proteases.
  • the invention is based on the surprising discovery that by methods of directed molecular evolution chimeras of Kunitz-type proteins like hBikD2 and aprotinin can be generated that exhibit the desired properties.
  • the expression level of the protein defined by SEQ ID NO: 1 can be further improved by generating novel variants of SEQ ID NO: 1 through random mutagenesis using error prone PCR (Example 8).
  • the mutated proteins (SEQ ID NO: 2 to 37 in Tab.1) are characterized by having at least one additional amino acid exchange and/or amino acid insertion per molecule leading to a further increased expression level in the yeast secretion system while retaining the favorable inhibition profile.
  • SEQ ID NO: 1 SEQ ID NO: 38 to 40
  • the said characteristics bearing combinations of the above mentioned mutations Example 5 and 6).
  • Table 2 Expressionlevels of novel hBikD2 variants in yeast secretion system. Range in 2-3 different experiments, values referring to trypsin inhibitory activity of an aprotinin standard
  • Table 3 Activity of aprotinin and novel hBikD2 variants in various serine protease assays. Mean values of at least 2 experiments.
  • non-native variant of hBikD2 is defined as a non- naturally Kunitz domain having disulfide bonds at Cys5-Cys55, Cys14-Cys38, and Cys30-Cys51 and more than 50% amino acid sequence identity to the second domain of human placental bikunin (hBikD2, Y129 to Q186 of NM_021102) but bearing at least one amino acid exchange.
  • the term "improved expression level" is defined as having trypsin inhibitory activities accumulating in the secretions of transformed cells of >10 ⁇ g/ml (referring to an aprotinin standard).
  • vorable inhibition profile is defined as having IC50 values for the inhibition of plasmin, plasmakallikrein and trypsin of below 50 nM.
  • hBikD2 human bikunin
  • Kunitz-type inhibitor domain 2 of human bikunin exhibit similar or improved protease specificities as found for aprotinin, especially with respect to the potency of plasmin and plasmakallikrein inhibition.
  • its human origin should allow the repeated use of an hBikD2-based drug in human patients with reduced risk of adverse immune responses.
  • the accessibility of the material remains unsatisfactory.
  • hBikD2 using various expression systems, for example the yeast secretion system, do not exceed background levels when assessed by the analysis of the trypsin inhibitory activity accumulating in the secretions of transformed cells (Tab. 2).
  • FIND ® recombination of hBikD2 and aprotinin sequences was employed to create novel non-native hBikD2 variants (Example 7). Due to the limited homology of hBikD2 and aprotinin (50%) recombination was performed with 3 hBikD2/aprotinin chimeras: In the first chimera (chimera # 3) amino acids 1 to 10 and 56 to 58 relate to aprotinin whereas the core sequence from amino acid 11 to 55 is derived from hBikD2.
  • the second chimera (chimera # 5) comprises the N-terminal and core amino acid 1 to 39 from hBikD2 and the C-terminal amino acids 40 to 58 from aprotinin.
  • the third chimera (chimera # 6) consists of amino acids 1 to 39 from aprotinin and amino acid 40 to 58 from hBikD2.
  • the instant invention provides for non-native variants of hBikD2 generated by directed molecular evolution with more than 50% aminoacid sequence identity to the second domain of human placental bikunin (hBikD2, Y129 to Q186 of NM_021102) but bearing at least one aminoacid exchange.
  • hBikD2 human placental bikunin
  • NM_021102 human placental bikunin
  • an example of a polypeptide useful in the invention has the amino acid sequence defined by SEQ ID NO: 1.
  • hBikD2 variant defined by SEQ ID NO: 1 should be further optimized, by generating randomly mutated libraries using error prone PCR (Example 8).
  • Screen of the resulting about 10,000 clones led to the identification of additional non-native hBikD2 variants with further improved expression in the yeast secretion system (Examples 9 and 10).
  • Sequence analysis revealed that these mutated variants are characterized by having at least one amino acid exchange and/or amino acid insertion per molecule (SEQ ID NO: 2 - 37 in Tab. 1).
  • the instant invention provides for the non-native variants of hBikD2 having the amino acid sequence of SEQ ID NO: 2 to 37. In a preferred embodiment the instant invention provides for the non-native variant of hBikD2 having the amino acid sequence of SEQ ID NO: 6.
  • the instant invention provides for the non-native variants of hBikD2 having all kinds of combinations of mutations described by SEQ ID NO: 2 to 37.
  • the instant invention provides for the non- native variants of hBikD2 having the amino acid sequence of SEQ ID NO: 38 to 40.
  • non-native variants of hBik-D2 described here can be made synthetically using any standard polypeptide synthesis protocol and equipment.
  • the described variants can be produced by recombinant methods using expression systems based on bacterial, yeast, baculovirus or mammalian expression vectors and the like.
  • a preferred recombinant expression system producing the described variants is the yeast S. cerevisiae.
  • the agents described herein are useful in the treatment of the following diseases: blood loss during operations with increased risk of bleeding; therapeutic intervention into thromboembolism (e.g. after operations, accidents); bleeding from postoperative surgery; shock; polytrauma; sepsis; disseminated intravascular coagulation (DIC); multiorgan failure (MOF); unstabile angina; myocardial infarction; stroke; embolism; deep venous thrombosis (DVT); inflammatory diseases (e.g.
  • asthma, rheumatism invasive tumor growth and metastasis; therapeutic intervention into pain or edema (edema of brain of spinal marrow); prevention of activation of hemostasis during dialysis; treatment of symptoms of skin aging (elastosis, atrophy, wrinkling, vascularly changes, pigmentary changes, actinic keratoderma, blackheads, cysts); wound healing; melanoma; treatment of symptoms of melanoma (actinic keratoderma, basal cell carcinoma, invasive squamous-cell carcinoma, malignant melanoma); multiple sclerosis; fibrosis; cerebral haemorrhage; inflammation of brain or spinal cord; infections of brain; tendinopathy.
  • the 58 amino acids coding sequence comprising Kunitz-type domain 2 (Y129 - Q186) from the human placental bikunin gene (hBikD2, NM_021102) was purchased as synthetic gene from Geneart (optimized for S.cerevisiae codon-usage). Additional oligonucleotides 5' and 3' to the coding sequence include restriction enzyme recognition sites, which were used for in-frame subcloning of hBikD2 into the yeast secretion vector plU10.10.W (Apeler, Chapter 12, In: J. Knablein (ed.), Wiley-VCH, Modern Biopharmaceuticals, 1021-1032, 2005). The synthetic gene coding for hBikD2 was cloned into vector pPCR-Script, also purchased from Geneart.
  • the DNA sequence of the synthetic gene coding for hBikD2 is as following:
  • the deduced amino acid sequence of hBikD2 is as following :
  • Chimera # 5 comprises 58 amino acids (aa), consisting of 39 aa of the human placental bikunin gene (hBikD2, aa 1 - 39 ) and of 19 aa of the bovine aprotinin gene (BPTI, bovine pancreatic trypsin inhibitor, aa 40 - 58, NM_001001554 ).
  • Chimera # 5 was purchased as synthetic gene from Geneart (optimized for S.cerevisiae codon- usage). Additional oligonucleotides 5' and 3' to the coding sequence include restriction enzyme recognition sites, which were used for in-frame subcloning of chimera # 5 into the yeast secretion vector pi U 10.10. W (Apeler, 2005). The synthetic gene coding for chimera # 5 was cloned into vector pPCR-Script, also purchased from Geneart.
  • the synthetic gene coding for chimera # 5 had the following sequence : GGGCGAATTGGGTACCGATTCCCATCTATTTTTACTGCTGTTTTGTTTGCTGCTTCTTCT GCTTTGGCTTATGAAGAATATTGTACTGCTAATGCTGTTACTGGTCCTTGTAGAGCTTCT TTTCCAAGATGGTATTTTGATGTTGAAAGAAATTCTTGTAATAACTTCATATATGGTGGT TGTAGAGCTAAAAGAAATAACTTCAAATCTGCTGAAGATTGTATGAGAACTTGTGGTGGT GCTTAATGACTCGAGGGAGCTCCAGCTTTTGTTCCCTT
  • the deduced amino acid sequence of chimera # 5 (aa from BPTI are uderlined) is as following :
  • Chimera # 6 comprises 58 amino acids (aa), consisting of 39 aa the bovine aprotinin gene (BPTI, bovine pancreatic trypsin inhibitor, aa 1 - 39, NM 001001554) and of 19 aa of the human placental bikunin gene (hBikD2, aa 40 - 58).
  • Chimera # 6 was purchased as synthetic gene from Geneart (optimized for S.cerevisiae codon-usage). Additional oligonucleotides 5' and 3' to the coding sequence include restriction enzyme recognition sites, which were used for in-frame subcloning of chimera # 6 into the yeast secretion vector plU10.10.W (Apeler, Chapter 12, In: J. Knablein (ed.), Wiley-VCH, Modern Biopharmaceuticals, 1021-1032, 2005). The synthetic gene coding for chimera # 6 was cloned into vector pPCR-Script, also purchased from Geneart.
  • the synthetic gene coding for chimera # 6 had the following sequence :
  • N- and C-terminal amino acids of the synthetic gene mentioned in example 1 were exchanged to the corresponding amino acids in the
  • PCR-primers used in the PCR-reaction were deduced from BPTI, corresponding to aa 1-17 (primer A) and aa 56-58 (primer B).
  • primer A at the 5' end exhibits a recognition site for the restriction enzyme BsaBI, primer B a recognition site for Xhol.
  • primers A and B used had the following sequences: Primer A:
  • BPTI-specific nucleotides are printed in capital letters, lower case letters are for flanking sequences, restriction enzyme recognition sites (BsaBI: gatnnnnatc; Xhoi: ctcgag) are underlined.
  • the PCR mixture contained 10ng hBikD2 Plasmid-DNA, 10 pMol Primer A, 10 pMol Primer B, 1 mM dNTPs, IxPCR reaction buffer (Novagen), 1 mM MgSO 4 , 1 U KOD Hot Start DNA Polymerase (Novagen) in a total volume of 50 ⁇ l.
  • the 'cycle'- conditions were 2 min. at 94°C, 25 cycles of, in each case, 1 min. at 94°C, 1 min. at 5O 0 C, 1.5 min. at 72°C and a subsequent 10 min incubation at 68°C.
  • the PCR product coding for chimera # 3 had the following sequence: caccqattcccatctattttcactgctgtcttqttcqctqcttcttctgctttggctaqa ccagatttctgcttggagccaccatatactggtccatgtagagcttcttttccaagatgg tattttgatgttgagagaaattcttgtaacaacttcatctatggtggttgtagaggtaac aaaa attcttatagatctgaagaggcttgcatgttgagatgtggtggtgcttaatagct cqaqtaa
  • Restriction enzyme recognition sites (5' BsaBI: GATnnnnATC; 3' Xhol: CTCGAG) are underlined.
  • the deduced amino acid sequence of chimera # 3 (aa from BPTI are underlined) is as following:
  • variants 176E9-mut10,-mut11 , and -mut12 comprised 58 aa each (SEQ ID NO:
  • Additional oligonucleotides 5' and 3' to the coding sequences include restriction enzyme recognition sites, which were used for in-frame subcloning of the variants into the yeast secretion vector plU10.10.W (Apeler,
  • the synthetic genes had the following sequences (restriction enzyme recognition sites - 5' BsaBI: GATnnnnATC; 3' Xhol: CTCGAG, Sad: GAGCTC - are underlined):
  • variant - mut10 (coding for protein defined by SEQ ID NO: 38)
  • variant - mut12 (coding for protein defined by SEQ ID NO: 40)
  • deduced amino acid sequences of variants 176E9-mut10, -mut11 , and -mut12 are as following:
  • the PCR reaction mixture of example 4 was purified with a purification kit (Qiagen), cleaved with the restriction enzymes BsaBI and Xhol and ligated into the yeast secretion vector plU10.10.W, which was cleaved with the same restriction enzymes accordingly.
  • Chimera # 5 and # 6 and each of the variants -mut10, -mut11 , and - mut12 cloned in pPCRscript were cleaved with the restriction enzymes BsaBI and Xhol, the corresponding inserts isolated and ligated each into the yeast secretion vector plU10.10.W as described above. Plasmid DNA from each transformation event was isolated, cleaved with the restriction enzymes BsaBI and Xhol and positive clones sequenced.
  • aa sequences of chimera # 3, # 5, # 6 and variants -mut10 (SEQ ID NO: 38), -mut11 (SEQ ID NO: 39), and -mut12 (SEQ ID NO: 40) are as following (MF ⁇ -pre-sequences are italicized, aa derived from BPTI and mutated aa in variants are underlined):
  • CTCAAGCTTGACTTCAGGTTGTCTAACTCCTTCC All primers were purchased from MWG, Ebersberg, Germany.
  • the PCR reactions contained 1 ng of either chimeric construct, 0,5 ⁇ M of each primer, 200 ⁇ M of each dNTP (New England Biolabs, cat # N0440S, N0441S, N0442S, N0443S), 1x Dynazyme reaction buffer, 1 U Dynazymell DNA Polymerase (Finnzymes, cat # F-501 L ) and 0,02 U Phusion DNA polymerase (Finnzymes, cat # F-530-S) in a total volume of 50 ⁇ l.
  • the PCR program comprises 25 cycles of 94°C for 15 sec, 57°C for 30 sec min and 72°C for 30 sec and finally elongation at 72°C for 7 minutes.
  • Single-stranded DNA representing sense and antisense strands
  • ssDNA Single-stranded DNA
  • the PCR products were divided into two batches and digested separately with EcoRI or Hindlll (New England Biolabs, cat # R0101 L and R0104S, respectively), creating a 5'phosphorylated end on either the sense or the antisense strand.
  • the 5'phosphorylated strand was digested using a StrandaseTM ssDNA Preparation Kit (Novagen, Merck Biosciences, cat # 69199-3), leaving the unphosphorylated strand of DNA intact.
  • the obtained ssDNA was analyzed by agarose gel (Cambrex, cat # 50080) electrophoresis, purified using Recochip (TaKaRa, cat # 9039) according to manufacturer's recommendations, and finally ethanol precipitatated.
  • the FIND ® experiments were initiated by fragmenting sense and antisense ssDNA, respectively, with Exonuclease I (Exo I) (100 U/g DNA, (New England Biolabs, cat # 0293L)), Exonuclease V (Exo V) (50 U/g DNA (USB, cat # 70040Y)) and Exonuclease VII (Exo VII) (5 U/g DNA (USB, cat # 70082Y)) in separate tubes under conditions recommended by the manufacturers.
  • Exonuclease I Exo I
  • Exo V Exonuclease V
  • Exo VII Exonuclease VII
  • PCR 1 The ssDNA fragments resulting from the exonuclease digestions were recombined in a first PCR reaction (PCR 1) essentially as described above with the exceptions that the DNA polymerase used was Phusion (1 U) and that the PCR mix contained 1x Phusion HF reaction buffer, no added primers and 60ng ssDNA from each strand, in a total volume of 50 ⁇ l.
  • PCR 2 The material from PCR 1 was then amplified in a second PCR reaction (PCR 2) also as described above with 5 ⁇ l PCR 1 product, 0,5 ⁇ M primers (same as used for the initial amplification of DNA fragments), 1x AmpliTaq reaction buffer and 1 ,25U AmpliTaq® DNA polymerase (Applied Biosystems, cat # N8080171) in a 50 ⁇ l total volume.
  • PCR 2 PCR 2 also as described above with 5 ⁇ l PCR 1 product, 0,5 ⁇ M primers (same as used for the initial amplification of DNA fragments), 1x AmpliTaq reaction buffer and 1 ,25U AmpliTaq® DNA polymerase (Applied Biosystems, cat # N8080171) in a 50 ⁇ l total volume.
  • the reassembled full-length genes were subsequently cloned into pGEM®-T Vector System I (Promega, cat # A3610) and sequenced.
  • sense ssDNA from chimera # 5 was recombined with antisense ssDNA from chimera # 3 and this resulting library was in a second FIND ® round used to prepare sense ssDNA that was recombined with antisense ssDNA from chimera # 6.
  • a pYES2-vector containing MF pre-pro-leader sequence and hBikD2 was modified to remove a Nhel-site after the URA-3 using Quikchange multisitedirected mutagenesis kit (Stratagene #200513) according to the manufacturer's instructions.
  • the primer used in the reaction was 5 ' -
  • the resulting vector was further modified to introduce an Nhel-site in the leader sequence using Quikchange Il mutagenesis kit (Stratagene, #200524) according to the manufacturer's instructions using the primers 5 ' -
  • the hBikD2-sequence was removed using Nhel (New England Biolabs #R0131) and Sphl (New England Biolabs #R0182) and replaced by a stuffer- fragment encoding a stop-codon created by annealing of the two phosphorylated oligos forward: 5'P-CTAGCTCTGCTTTGGCTTAACTCGAGCATG and reverse 5 1 P- CTCGAGTTAAGCCAAAGCAGAG.
  • the libraries ware cloned into the modified pYES2 expression vector, generated as described above, using Nhel (New England Biolabs #R0131) and Sphl (New England Biolabs #R0182) and transformed into the E. coli strain ElectroTen Blue (Stratagene #200159) using electroporation according to the manufacturer's instructions.
  • the transformation was plated out on Q-trays (Genetix #X6023) with LB agar (Miller) (Merck Cat# 1.10283.0500) with 50 ⁇ g/ml Ampicillin (Calbiochem) and incubated over night in 37°C. The resulting colonies were scraped off the plate and used for extracting the plasmid DNA using HiSpeed Plasmid Midi Kit (Qiagen #12643).
  • This o/n-culture was used to inoculate 50ml 2xYPD with 25 ⁇ g/ml Chloramphenicol at a starting titer of 5-10 x 10 6 cells/ml. This culture was grown at 30 0 C, 200rpm until the titer was at least 2x10 7 cells/ml. To 10 8 of these cells, a transformation mix consisting of 240 ⁇ l 50% PEG 3500 (Sigma, #P-3640), 36 ⁇ l 1.0M Litium Acetate (Sigma #L-4185), 50 ⁇ l 2mg/ml salmon sperm DNA (Sigma, #D1626) and 1 ⁇ g of DNA to be transformed was added.
  • Example 10 Trypsin screening assay hBikD2/aprotinin clones with enhanced expression levels were identified using a trypsin assay in which the enzyme trypsin catalyses the cleavage of the substrate N ⁇ - Benzoyl-L-arginine 4-nitroanilide hydrochloride (L-BAPA), which can be measured as absorbance at 405 nm.
  • the trypsin assay was performed in clear, flat-bottom 384- well plates (Greiner, cat # 781186) in a Beckman Coulter robot system consisting of Beckman Multimek 96, Multidrop 384 Titertek, BMG FluoStar reader and Cytomat Incubator as follows.
  • Trypsin from bovine pancreas (Sigma, cat. # T4665, 10200 U/ml) at a concentration of 1 mg/ml in 50 mM Tris, pH 8.4, was diluted in buffer (0.2 M Triethanolamine hydrochloride, 0.02 M NaCI, 10 ml 5% Tween-80, pH to 7.8) to a final concentration of 50 U/ml. Trypsin solution was added to each well, followed by the addition of sample supernatants, at a final dilution of 7.5 or 15 times, and the plate was preincubated at 23 or 28 0 C for 10 minutes.
  • the substrate L-BAPA (Sigma, cat #.
  • Stock cultures of yeast transformants were prepared by mixing of 1-ml aliquots of a seed culture with 1 ml of a glycerol-solution (80%) in polypropylene vials and storage at -140 0 C.
  • Yeast fermentation was performed either in medium scale (100 ml) or large scale (10,000 to 25,000 ml) format.
  • medium scale fermentation a 50-ml shake flask filled with 10 ml of SD2 medium was inoculated with a stock culture and incubated on a shaker (240 rpm) for 2-3 days at 28-30 0 C. 3 ml of seed culture were used to inoculate 100 ml of SC5 medium in a 1-L shake flask. Subsequent incubation was perfomed for 4 day at 240 rpm and 28-30 0 C. pH- values of the cultures were adjusted to 5-6 once a day with 5 N NaOH and cultures were fed on day 1 to 3 with 1 ml of 50%-yeast extract solution and 4 ml of a 4 M glucose-solution.
  • Bioreactor system (Wave Biotech, Tagelswangen, CH) was employed. Bioreactor bags were inoculated with 300 (for 10,000 ml SD5 medium) to 750 ml (for 25,000 ml SD5 medium) seed culture and incubation was performed for 4 days at 30 0 C and a wave frequency of 32/min (angel: 10°, aeration: 0.25 l/min) in a fed batch mode continuously adding a 100- to 250-fold volume of the above mentioned feeding solutions per day. pH-adjustment to 5-6 was done with 5 N NaOH once a day.
  • Recombinant protein defined by SEQ ID NO:1 produced in the fermentation process was purified from 10 liter yeast medium.
  • the pH of the medium was adjusted to pH 7.8 with IM NaOH.
  • the medium was cleared by centrifugation at 2,000 rpm (4 0 C; 15 min; Beckmann-Allegra 6KR centrifuge).
  • the supernatant was applied to a 10 ml Trypsin agarose column (Sigma-T173) at 1 ml/min. The column was washed with 70 ml 50 mM Tris pH 7.8, 250 mM NaCl and with 50 ml 50 mM Tris pH 7.8, 600 mM NaCl.
  • the protein was eluted with 100 ml 50 mM KCl/ 10 mM HCl pH 2.0. The samples were collected in 2 ml fractions which contained 500 ⁇ l 200 mM Tris/Cl pH 7.6, 2 M NaCl each to neutralize the eluate. The protein was detected by its Trypsin-inhibiting activity.
  • Fractions containing Trypsin-inhibiting activity were pooled and applied to a Source 15 RPC column (GE Healthcare). The column was washed with 6 ml 0.1% TFA (buffer HPLC-A), and the protein was subsequently eluted with a 25 ml gradient from 0% to 50% buffer HPLC-B (0.1% TFA, 60% acetonitril) and a 5 ml gradient from 50% to 100% buffer HPLC-B. Samples containing the protein were lyophilized, dissolved in 50 mM Tris pH 7.5 and stored at -20 0 C.
  • TFA buffer HPLC-A
  • IC50 values of non-native hBikD2 variants against trypsin, plasmin and plasmakallikrein were determined in biochemical assays perfomed in white 384-well microtiterplates employing defined fluorogenic substrates.
  • the assay buffer was composed of 50 mM Tris /Cl, pH 7.4, 100 mM NaCI, 5 mM CaCI 2 , 0,08 % (w/v) BSA.

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Hematology (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Diabetes (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Engineering & Computer Science (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • General Chemical & Material Sciences (AREA)
  • Biochemistry (AREA)
  • Biophysics (AREA)
  • Genetics & Genomics (AREA)
  • Molecular Biology (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Peptides Or Proteins (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Preparation Of Compounds By Using Micro-Organisms (AREA)

Abstract

La présente invention concerne de nouvelles variantes du domaine 2 de la bikunine du placenta humain, lesdites variantes présentant des niveaux d'expression améliorés et des propriétés favorables d'inhibition de la sérine protéase, ainsi que leur production et leur utilisation.
PCT/EP2007/010797 2006-12-22 2007-12-11 Production et utilisation de variantes non naturelles du domaine 2 de la bikunine du placenta humain conçues par évolution moléculaire dirigée WO2008086858A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
EP06026812 2006-12-22
EP06026812.5 2006-12-22

Publications (1)

Publication Number Publication Date
WO2008086858A1 true WO2008086858A1 (fr) 2008-07-24

Family

ID=39167588

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/EP2007/010797 WO2008086858A1 (fr) 2006-12-22 2007-12-11 Production et utilisation de variantes non naturelles du domaine 2 de la bikunine du placenta humain conçues par évolution moléculaire dirigée

Country Status (6)

Country Link
AR (1) AR064615A1 (fr)
CL (1) CL2007003810A1 (fr)
PE (1) PE20081847A1 (fr)
TW (1) TW200848425A (fr)
UY (1) UY30817A1 (fr)
WO (1) WO2008086858A1 (fr)

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19725014A1 (de) * 1997-06-13 1998-12-17 Bayer Ag Aprotininvarianten mit verbesserten Eigenschaften und Bikunine von Aprotininvarianten

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
DE19725014A1 (de) * 1997-06-13 1998-12-17 Bayer Ag Aprotininvarianten mit verbesserten Eigenschaften und Bikunine von Aprotininvarianten

Non-Patent Citations (2)

* Cited by examiner, † Cited by third party
Title
DELARIA K A ET AL: "CHARACTERIZATION OF PLACENTAL BIKUNIN, A NOVEL HUMAN SERINE PROTEASE INHIBITOR", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 272, no. 18, 2 May 1997 (1997-05-02), pages 12209 - 12214, XP000770013, ISSN: 0021-9258 *
MARLOR C W ET AL: "IDENTIFICATION AND CLONING OF HUMAN PLACENTAL BIKUNIN A NOVEL SERINE PROTEASE INHIBITOR CONTAINING TWO KUNITZ DOMAINS", JOURNAL OF BIOLOGICAL CHEMISTRY, AMERICAN SOCIETY OF BIOLOCHEMICAL BIOLOGISTS, BIRMINGHAM,, US, vol. 272, no. 18, 2 May 1997 (1997-05-02), pages 12202 - 12208, XP001149667, ISSN: 0021-9258 *

Also Published As

Publication number Publication date
CL2007003810A1 (es) 2008-07-18
UY30817A1 (es) 2008-07-31
TW200848425A (en) 2008-12-16
AR064615A1 (es) 2009-04-15
PE20081847A1 (es) 2009-01-11

Similar Documents

Publication Publication Date Title
EP0746611B1 (fr) Procede d'augmentation de la production de proteines recombinantes liees au bisulfure a l'aide de (saccharomyces cerevisiae)
DE60039055D1 (de) Mittel und methoden zur beeinflussung pflanzlicher blüheigenschaften
CA2207820A1 (fr) Domaines de kunitz derives de l'homme obtenus par genie genetique et inhibant l'elastase des neutrophiles chez l'homme
CZ264496A3 (en) Increase of polypeptide secretion
Pierre et al. Identification and analysis of venom gland-specific genes from the coastal taipan (Oxyuranus scutellatus) and related species
JP4892474B2 (ja) ３重螺旋構造を有するタンパク質の製造方法
FI104724B (fi) Menetelmä aprotiniinivarianttien valmistamiseksi
WO2008086858A1 (fr) Production et utilisation de variantes non naturelles du domaine 2 de la bikunine du placenta humain conçues par évolution moléculaire dirigée
JP3095183B2 (ja) 新規酵素及びそれをコードするｄｎａ
US5928877A (en) Assay for an antifreeze protein
JP2020522999A (ja) グルコースオキシダーゼＣｎＧＯＤＡ及びその遺伝子ならびに使用
HU220301B (hu) Véralvadásgátló protosztómiák (vérszívók) nyálából
US20090036647A1 (en) BITORAN WHICH IS TRYPSIN-INHIBITOR-LIKE PROTEIN DERIVED FROM BITIS ARIETANS VENOM, AND USE THEREOF AS BLOOD COAGULATION FACTOR Xa INHIBITOR
CA2163925A1 (fr) Proteines chimeriques possedant des proprietes fibrinolytiques et inhibitrices de la thrombine
KR101250604B1 (ko) 푸자리시딘 유도체 ｌｉ－ｆ０７의 생산량이 증가된 패니바실러스 폴리믹사 디비비１７０９의 변이균주와 이의 제조방법
Sarilla et al. Glycosaminoglycan-binding properties and kinetic characterization of human heparin cofactor II expressed in Escherichia coli
Kludkiewicz et al. Structurally unique recombinant Kazal-type proteinase inhibitor retains activity when terminally extended and glycosylated
NO326247B1 (no) Fremgangsmate for fremstilling av modent insulin eller et modent insulin derivat.
JP4330452B2 (ja) 選択マーカー遺伝子
JP2002034566A (ja) ミミズ由来セリンプロテアーゼの遺伝子、当該遺伝子を含むプラスミドベクター及び形質転換体
Sugihara et al. Potencies of phosphine peptide inhibitors of mammalian thimet oligopeptidase and neurolysin on two bacterial Pz peptidases
KR100781386B1 (ko) 프로테인 다이설파이드아이소머라아제1를 코딩하는 유전자및 이알오1을 코딩하는 유전자를 동시 도입시킨 히루딘생산능 재조합 사카로마이세스 세레비지애 및 이를 이용한히루딘 단백질의 생산방법
WO2009030464A2 (fr) Préparation et utilisation de variantes d'inhibiteurs de protéase du type kunitz humains (hktpi)
Hrušková-Heidingsfeldová et al. Enzymological characterization of secreted proteinases from Candida parapsilosis and Candida lusitaniae
WO2006064721A1 (fr) Forme active de la subtilisine a basse temperature

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07856548

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07856548

Country of ref document: EP

Kind code of ref document: A1