WO2008033776A1 - Sondes et procédés permettant de détecter des mutations bcr-abl résistant au gleevec - Google Patents

Sondes et procédés permettant de détecter des mutations bcr-abl résistant au gleevec Download PDF

Info

Publication number
WO2008033776A1
WO2008033776A1 PCT/US2007/078059 US2007078059W WO2008033776A1 WO 2008033776 A1 WO2008033776 A1 WO 2008033776A1 US 2007078059 W US2007078059 W US 2007078059W WO 2008033776 A1 WO2008033776 A1 WO 2008033776A1
Authority
WO
WIPO (PCT)
Prior art keywords
nucleic acid
seq
abl
bcr
acid molecule
Prior art date
Application number
PCT/US2007/078059
Other languages
English (en)
Other versions
WO2008033776B1 (fr
Inventor
Michael C. Heinrich
Emmanuel J. Beillard
Julie Toplin
Original Assignee
Oregon Health & Science University
Molecularmd Corporation
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Oregon Health & Science University, Molecularmd Corporation filed Critical Oregon Health & Science University
Publication of WO2008033776A1 publication Critical patent/WO2008033776A1/fr
Publication of WO2008033776B1 publication Critical patent/WO2008033776B1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/536—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase
    • G01N33/542—Immunoassay; Biospecific binding assay; Materials therefor with immune complex formed in liquid phase with steric inhibition or signal modification, e.g. fluorescent quenching
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/106—Pharmacogenomics, i.e. genetic variability in individual responses to drugs and drug metabolism

Definitions

  • This disclosure relates to probes and primers for detecting one or more mutations in Bcr-Abl, as well as kits including the probes and primers and methods of using the probes and primers.
  • imatinib tyrosine kinase inhibitor imatinib
  • CML chronic myelogenous leukemia
  • Ph+ Philadelphia acute lymphoblastic leukemia
  • ALL relapse after an initial response is common in patients with advanced disease.
  • the T315I point mutation is one of the most common imatinib-resistant mutations and patients with this mutation are also resistant to two second generation tyrosine kinase inhibitors, dasatinib (SPR YCEL®) and nilotinib.
  • SPR YCEL® second generation tyrosine kinase inhibitors
  • nilotinib second generation tyrosine kinase inhibitors
  • appropriate detection of this mutation is important for optimal management of patients with imatinib resistance and may be useful for clinical trials of agents that target patients with the T315I mutation.
  • Current methods for mutation detection such as direct DNA sequencing, are not sensitive enough for detection of point mutations at low levels of Bcr-Abl transcript.
  • ultrasensitive detection methods such as allele specific PCR (AS-PCR) may be too sensitive and can display a propensity for false positives.
  • AS-PCR allele specific PCR
  • the present disclosure provides nucleic acid probes that can be used to detect one or more mutations in a AbI kinase domain, such as a mutation in the AbI kinase domain of Bcr- AbI, such as a mutation that decreases sensitivity to a Bcr-Abl/ AbI kinase inhibitor (such as imatinib, dasatinib, and/or nilotinib).
  • Bcr-Abl mutations include the AbI kinase domain mutations T315I, T315A, and F317L.
  • methods of using the disclosed probes to detect a Bcr-Abl mutation in the AbI kinase domain such as the T315I mutation.
  • Such methods can be suitable for high-throughput detection of a Bcr-Abl mutation in a biological sample, and can be used for clinical management of CML or Ph+ ALL patients, for screening of patients to determine eligibility for clinical studies (for example to determine if the subject is likely to benefit from treatment with a Bcr-Abl/ AbI kinase inhibitor such as imatinib), or combinations thereof.
  • isolated nucleic acid probes that include at least one fluorophore, such as an acceptor fluorophore or a donor fluorophore, and in some examples can hybridize to a Bcr-Abl nucleic acid molecule under high stringency conditions.
  • the probes consist of a sequence having at least 90%, at least 95%, or at least 98% sequence identity to the nucleotide sequence shown in any of SEQ ID NOS: 5-9 and 17.
  • the fluorescently labeled probes consist of the nucleic acid sequence shown in any of SEQ ID NOS: 5-9 and 17.
  • compositions that include two or more of the probes disclosed herein, such as at least one mutation-specific probe and at least one anchor probe, wherein the mutation-specific probes and the anchor probes are labeled with a different fluorophore (for example a FRET pair).
  • a different fluorophore for example a FRET pair
  • a composition can include a first and a second nucleic acid probe, wherein the first nucleic acid probe is a fluorescently labeled mutation-specific probe consisting of a sequence having at least 90% or at least 95% sequence identity to the nucleotide sequence shown in SEQ ID NO: 5, 7, 9 or 17, and the second nucleic acid probe is a fluorescently labeled anchor probe consisting of a sequence having at least 90% or at least 95% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6 or 8.
  • Particular combinations include SEQ ID NO: 5 and 6, SEQ ID NO: 17 and 6, SEQ ID NO: 7 and 8, and SEQ ID NO: 9 and 8. Additional variants of SEQ ID NOS: 5-9 and 17 are also provided herein.
  • Kits are provided that include one or more of the probes or compositions provided herein.
  • such as kit can include at least one, at least two, at least three, or more probes disclosed herein, such as a probe that consists of a sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 5-9 and 17.
  • the kits further include at least one other component, such as a component that can be used in the amplification of a Bcr-Abl nucleic acid molecule and/or an AbI kinase domain nucleic acid molecule.
  • Exemplary components include at least one pair of nucleic acid amplification primers (such as any sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 1 and 2, 1 and 16, or 3 and 4), a polymerizing agent, deoxynucleoside triphosphates, deoxynucleotide triphosphates, a buffer suitable for use in a nucleic acid amplification reaction, or combinations thereof.
  • nucleic acid amplification primers such as any sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 1 and 2, 1 and 16, or 3 and 4
  • a polymerizing agent such as any sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 1 and 2, 1 and 16, or 3 and 4
  • deoxynucleoside triphosphates such as any sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 1 and 2, 1 and 16, or 3 and 4
  • a polymerizing agent such as any sequence having at least 95% or 100% sequence
  • the present disclosure also provides methods that can be used to detect a Bcr-Abl mutation in a nucleic acid, which results in the substitution of one or more target amino acids of Bcr-Abl, such as a mutation in the AbI kinase domain at amino acid 315 or 317.
  • the method includes contacting an amplified AbI kinase domain nucleic acid molecule that includes the region encoding amino acid 315 (such as the region encoding at least amino acids 315-317) with the disclosed compositions, under conditions that permit hybridization between the amplified nucleic acid molecule and the first and second nucleic acid probes in the composition.
  • the method includes contacting an amplified Bcr-Abl nucleic acid molecule that includes the AbI kinase domain region encoding amino acid 315 (such as the region encoding at least amino acids 315-317) with the disclosed compositions, under conditions that permit hybridization between the amplified nucleic acid molecule and the first and second nucleic acid probes in the composition.
  • the resulting hybridization complex is heated to increase the temperature and permit melting of the hybridization complex.
  • the resulting melting curve is detected, for example by detecting a fluorescent signal from a donor or acceptor fluorophore on the probes, wherein a melting point temperature shift compared to a melting curve expected for the wild-type AbI kinase domain (for example, the AbI kinase domain of Bcr-Abl) indicates the presence of a mutation at the target amino acid in the AbI kinase domain, such as the AbI kinase domain of Bcr-Abl.
  • the test melting curve is compared to a melting curve for a control, such as a wild-type or mutant AbI kinase domain or Bcr-Abl sequence.
  • the disclosed methods further include amplifying the Bcr-Abl sequence, for example from a nucleic acid molecule isolated from a biological sample (such as peripheral blood or bone marrow).
  • the resulting first Bcr-Abl amplicon which includes the Bcr-Abl junction and the region at least encoding amino acid 315, can be further amplified (for example using nested PCR), wherein the resulting second amplicon, includes at least the region encoding amino acid 315 of the AbI kinase domain of Bcr-Abl.
  • the disclosed methods can be used to determine a treatment protocol for a subject having CML or Ph+ ALL. For example, if it is determined that the subject has a mutation which decreases the sensitivity to a Bcr-Abl/ AbI kinase inhibitor (such as imatinib), for example a T315I mutation, such a subject would not be selected to receive the Bcr-Abl/ AbI kinase inhibitor.
  • the disclosed methods are at least 95% sensitive and specific, such as at least 98%, at least 99% or even at least 100% sensitive and specific.
  • FIG. 1 is a schematic drawing showing a particular example of the assay that can be used to detect mutations in Bcr-Abl at amino acid 315 or 317 (or both).
  • FIG. 2 is a schematic drawing showing a particular example of FRET-based detection using probes that can be used to detect mutations in Bcr-Abl at amino acid 315 or 317 (or both).
  • FIG. 3 is an exemplary melting curve graph showing the analysis of T315I, F317L and wild- type Bcr-Abl amplicons.
  • FIG. 4 is an exemplary melting curve graph showing the disclosed methods can reliably detect samples containing > 5% of the T315I mutant Bcr-Abl allele.
  • FIG. 5 is an exemplary melting curve graph showing that the disclosed methods can detect the wild-type and T315I mutant Bcr-Abl allele in clinical samples.
  • FIG. 6 is an exemplary melting curve graph showing that the disclosed methods can detect the wild-type and T315I mutant Bcr-Abl allele in clinical samples.
  • FIG. 7 is an exemplary melting curve graph showing the disclosed methods can reliably detect samples containing > 5% of the T315I mutant Bcr-Abl allele.
  • nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.
  • SEQ ID NOS: 1 and 2 are exemplary forward and reverse primers, respectively, used to amplify a Bcr-Abl transcript that includes the Bcr-Abl junction as well as the region encoding amino acids 315-317.
  • SEQ ID NOS: 3 and 4 are exemplary forward and reverse primers, respectively, used to amplify a Bcr-Abl amplicon using nested PCR and/or a portion of an AbI kinase domain.
  • SEQ ID NOS: 5 and 6 are exemplary FRET mutation-specific and anchor probes, respectively, that can hybridize to a sense Bcr-Abl amplicon and/or a portion of an AbI kinase domain.
  • SEQ ID NOS: 7 and 8 are exemplary FRET mutation-specific and anchor probes, respectively, that can hybridize to an anti-sense Bcr-Abl amplicon and/or a portion of an AbI kinase domain amplicon.
  • SEQ ID NO: 9 is an exemplary FRET mutation-specific probe that includes an intentional mismatch and can hybridize to an anti-sense Bcr-Abl amplicon and/or a portion of an AbI kinase domain. This probe can be used in combination with SEQ ID NO: 8.
  • SEQ ID NOS: 10 and 11 are exemplary Bcr-Abl wild-type cDNA and Bcr-Abl protein sequences, respectively.
  • SEQ ID NOS: 12 and 13 are exemplary AbI wild-type cDNA and AbI protein sequences, respectively.
  • SEQ ID NOS: 14 and 15 are exemplary target and identified DNA sequences.
  • SEQ ID NO: 16 is an exemplary reverse primer, used to amplify a Bcr-Abl transcript that includes the Bcr-Abl junction as well as the region encoding amino acids 315- 317.
  • SEQ ID NO: 17 is an exemplary FRET mutation-specific probe that can hybridize to a sense Bcr-Abl amplicon and/or a portion of an AbI kinase domain amplicon.
  • the term "or" refers to a single element of stated alternative elements or a combination of two or more elements, unless the context clearly indicates otherwise.
  • the phrase “the AbI kinase domain T315I or F317L mutation” refers to the AbI kinase domain T315I mutation, the AbI kinase domain F317L mutation, or a combination of both the AbI kinase domain T315I mutation and the AbI kinase domain F317L mutation.
  • an AbI kinase domain can refer to the AbI kinase domain of Bcr-Abl.
  • AbI kinase Includes any AbI kinase gene, cDNA, RNA, or protein from any organism, such as a mammal.
  • AbI kinase nucleic acid and protein sequences are known in the art, and exemplary wild-type AbI kinase cDNA and protein sequences are shown as SEQ ID NO: 12 (GENBANK® ACCESSION NO. M14752 as available September 11, 2006)and SEQ ID NO: 13 (GENBANK® ACCESSION NO. AAA51561 September 11, 2006) respectively.
  • the AbI kinase domain spans about amino acids 220-498 of AbI.
  • Acceptor fluorophore Compounds which absorb energy from a donor fluorophore, for example in the range of about 400 to 900 nm (such as in the range of about 500 to 800 nm). Acceptor fluorophores generally absorb light at a wavelength which is usually at least 10 nm higher (such as at least 20 nm higher), than the maximum absorbance wavelength of the donor fluorophore, and have a fluorescence emission maximum at a wavelength ranging from about 400 to 900 nm. Acceptor fluorophores have an excitation spectrum which overlaps with the emission of the donor fluorophore, such that energy emitted by the donor can excite the acceptor. Ideally, an acceptor fluorophore is capable of being attached to a nucleic acid molecule, such as an isolated probe or primer of the present disclosure.
  • acceptor fluorophores include, but are not limited to, rhodamine and its derivatives (such as N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-X- rhodamine (ROX)), fluorescein derivatives (such as 5-carboxyfluorescein (FAM) and 2'7'- dimethoxy-4'5'-dichloro-6-carboxyfluorescein (JOE)), green fluorescent protein (GFP), BODIPY (4,4-difluoro-4-bora-3a,4a-diaza-s-indacene), LightCycler Red (LC-Red) 640, LC- Red 705, and cyanine dyes (such as Cy5 and Cy5.5).
  • rhodamine and its derivatives such as N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA), 6-carboxy-
  • an acceptor fluorophore is capable of being attached to a nucleotide, such as the base, sugar, or phosphate ( ⁇ , ⁇ , or ⁇ ) of the nucleotide.
  • a nucleotide such as the base, sugar, or phosphate ( ⁇ , ⁇ , or ⁇ ) of the nucleotide.
  • an acceptor fluorophore can be attached to a nucleotide that is part of a probe disclosed herein, such as the 3' or 5' nucleotide of the probe.
  • an acceptor fluorophore is a dark quencher, such as, Dabcyl, QSY7 (Molecular Probes), QSY33 (Molecular Probes), BLACK HOLE QUENCHERSTM (Glen Research), ECLIPSETM Dark Quencher (Epoch Biosciences), IOWA BLACKTM (Integrated DNA Technologies).
  • a quencher can reduce or quench the emission of a donor fluorophore.
  • an increase in the emission signal from the donor fluorophore can be detected when the quencher is a significant distance from the donor fluorophore (or a decrease in emission signal from the donor fluorophore when in sufficient proximity to the quencher acceptor fluorophore).
  • Amplifying a nucleic acid molecule To increase the number of copies of a nucleic acid molecule, such as a gene or fragment of a gene, for example a region of a Bcr- AbI gene (such as a region that includes the portion encoding amino acids 315-317 of the AbI kinase domain).
  • the resulting amplification products are called amplicons.
  • in vitro amplification is the polymerase chain reaction (PCR), in which a nucleic acid molecule (such as those isolated from a biological sample) is contacted with a pair of oligonucleotide primers, under conditions that allow for hybridization of the primers to the nucleic acid molecule.
  • the primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid molecule.
  • the cycle can be repeated as many times as desired.
  • Other examples of in vitro amplification techniques include quantitative real-time
  • PCR nested PCR, strand displacement amplification
  • USPN 5,744,311 transcription- free isothermal amplification
  • USPN 6,033,881 repair chain reaction amplification
  • ligase chain reaction amplification see EP-A-320 308
  • gap filling ligase chain reaction amplification see USPN 5,427,930
  • coupled ligase detection and PCR see USPN 6,027,889
  • NASBATM RNA transcription-free amplification see USPN 6,025,134
  • Binding An association between two or more molecules, such as the formation of a nucleic acid molecule hybridization complex. Generally, the stronger the binding of the molecules in a complex, the slower their rate of dissociation. Particular examples of specific binding include, but are not limited to, hybridization of one nucleic acid molecule to a complementary nucleic acid molecule, and the association of a protein (such as a polymerase) with a target protein or nucleic acid molecule.
  • a protein such as a polymerase
  • an oligonucleotide molecule (such as a probe or primer) is observed to bind to a target nucleic acid molecule (such as a coding region of an AbI kinase domain, for example the AbI kinase domain of Bcr-Abl, that includes at least amino acids 315-317) if a sufficient amount of the oligonucleotide molecule forms base pairs or is hybridized to its target nucleic acid molecule to permit detection of that binding.
  • the binding between an oligonucleotide and its target nucleic acid molecule is frequently characterized by the temperature (T m ) at which 50% of the oligonucleotide is melted from its target.
  • T m the temperature at which 50% of the oligonucleotide is melted from its target.
  • binding is assessed by detecting a fluorophore present on a probe hybridized to the target nucleic acid molecule.
  • the fluorescent signal detected following the interaction of donor and acceptor fluorophores on probes hybridized to the target nucleic acid molecule (thereby forming a hybridization complex) and the subsequent melting of the hybridization complex can be measured as an indication of the presence of one or more mutations in the target nucleic acid molecule (such as a mutation in amino acids 315 or 317 of an AbI kinase domain, for example the AbI kinase domain of Bcr-Abl).
  • Bcr-Abl A fusion gene that is the result of a reciprocal translocation between chromosomes 9 and 22 [t(9;22)], cytogenetically evident as the Philadelphia chromosome (Ph), and encoding a constitutively active tyrosine kinase.
  • the Bcr-Abl gene is derived from relocation of the portion of c-ABL gene from chromosome 9 to the portion of BCR gene locus on chromosome 22.
  • Bcr-Abl hybrid genes produce p230, p210, and pi 85 fusion proteins (where p refers to the approximate molecular weight in kilodaltons, with the size depending on the breakpoint in BCR locus).
  • Bcr-Abl is an oncogene that is responsible for the transformation of hematopoietic stem cells and the symptoms of chronic myeloid leukemia (CML) and Philadelphia (Ph+) acute lymphoblastic leukemia (ALL), and includes any Bcr-Abl gene, cDNA, RNA, or protein from any organism, such as a mammal.
  • Bcr-Abl nucleic acid and protein sequences are known in the art, and exemplary wild- type Bcr-Abl cDNA and protein sequences are shown below as SEQ ID NO: 10 and SEQ ID NO: 11 respectively.
  • variant Bcr-Abl sequences are known.
  • mutations that reduce the effectiveness of one or more Bcr-Abl/ AbI kinase inhibitors are known, such as mutations in the AbI kinase domain (for example T315I, T315A, and F317L mutations).
  • Bcr-Abl contains the kinase domain derived from the cellular AbI protein.
  • residue number 315 refers the 315 residue in AbI kinase such as the AbI kinase set forth as SEQ ID NO: 13.
  • Bcr-Abl inhibitor or AbI kinase inhibitor An agent that can significantly reduce the biological activity of Bcr-Abl and/or AbI kinase alone or in the presence of another molecule, such as a reduction of Bcr-Abl and/or AbI kinase activity at least 20%, at least 80%, or at least 99%.
  • inhibitors include imatinib, AMN107 (nilotinib), dasatinib, NS-187, ON012380, Bosutinib (SKI-606), INNO-406 (NS-187), and MK-0457 (VX-680).
  • Bcr-Abl mutation Substitution of one or more amino acids in a wild-type Bcr-Abl sequence (such as the sequence shown in SEQ ID NO: 10), which in some examples decrease the sensitivity of Bcr-Abl to a Bcr-Abl/ AbI kinase inhibitor, such as imatinib.
  • Exemplary mutations include those in the Bcr-Abl kinase domain (amino acids 220-498 of the AbI kinase domain, Abl-la numbering), such as mutations in amino acids 255, 315, and 317, for example E255K, E255V, T315I, T315A, and F317L.
  • CML Chronic myeloid leukemia
  • cDNA complementary DNA: A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences which determine transcription.
  • cDNA is complementary to an mRNA and can be synthesized using reverse transcriptase.
  • a detectable change is one that can be detected, such as a change in the intensity, frequency or presence of an electromagnetic signal, such as fluorescence, for example a change in fluorescence of a probe, such as a probe specific for an T315I mutation in a Bcr-Abl nucleic acid.
  • the detectable change is a reduction in fluorescence intensity.
  • the detectable change is an increase in fluorescence intensity.
  • a double-stranded DNA or RNA strand consists of two complementary strands of base pairs. Since there is one complementary base for each base found in DNA/RNA (such as A/T, and C/G), the complementary strand for any single strand can be determined.
  • Detect To determine if an agent (such as a signal or particular nucleotide or amino acid) is present or absent. In some examples, this can further include quantitation.
  • use of the disclosed probes in particular examples permits detection of a fluorophore, for example detection of a signal from an acceptor fluorophore, which can be used to determine if an AbI kinase domain mutation is present (such as mutations in nucleotides coding for amino acid 315 or 317).
  • Donor Fluorophore Fluorophores or luminescent molecules capable of transferring energy to an acceptor fluorophore, thereby generating a detectable fluorescent signal from the acceptor.
  • Donor fluorophores are generally compounds that absorb in the range of about 300 to 900 nm, for example about 350 to 800 nm. Donor fluorophores have a strong molar absorbance coefficient at the desired excitation wavelength, for example greater than about 10 3 M "1 cm "1 .
  • a variety of compounds can be employed as donor fluorescent components, for example in conjunction with the disclosed probes and primers, including fluorescein (and derivatives thereof), rhodamine (and derivatives thereof), GFP, phycoerythrin, BODIPY, DAPI (4',6-diamidino-2-phenylindole), Indo-1, coumarin, dansyl, and cyanine dyes.
  • a donor fiuorophore is a chemiluminescent molecule, such as aequorin.
  • Electromagnetic radiation A series of electromagnetic waves that are propagated by simultaneous periodic variations of electric and magnetic field intensity, and that includes radio waves, infrared, visible light, ultraviolet light, X-rays and gamma rays. In particular examples, electromagnetic radiation is emitted by a laser, which can possess properties of monochromaticity, directionality, coherence, polarization, and intensity.
  • Lasers are capable of emitting light at a particular wavelength (or across a relatively narrow range of wavelengths), for example such that energy from the laser can excite a donor but not an acceptor fiuorophore.
  • Emission or emission signal The light of a particular wavelength generated from a source.
  • an emission signal is emitted from a fiuorophore after the fiuorophore absorbs light at its excitation wavelength(s).
  • Excitation or excitation signal The light of a particular wavelength necessary and/or sufficient to excite an electron transition to a higher energy level.
  • an excitation is the light of a particular wavelength necessary and/or sufficient to excite a fiuorophore to a state such that the fiuorophore will emit a different (such as a longer) wavelength of light then the wavelength of light from the excitation signal.
  • Fiuorophore A chemical compound, which when excited by exposure to a particular stimulus such as a defined wavelength of light, emits light (fluoresces), for example at a different wavelength (such as a longer wavelength of light). Fluorophores are part of the larger class of luminescent compounds. Luminescent compounds include chemiluminescent molecules, which do not require a particular wavelength of light to luminesce, but rather use a chemical source of energy. Therefore, the use of chemiluminescent molecules (such as aequorin) eliminates the need for an external source of electromagnetic radiation, such as a laser. Examples of particular fluorophores that can be used in the probes disclosed herein are provided in U.S. Patent No.
  • rhodamine and derivatives such as 6-carboxy-X-rhodamine (ROX), 6- carboxyrhodamine (R6G), lissamine rhodamine B sulfonyl chloride, rhodamine (Rhod), rhodamine B, rhodamine 123, rhodamine X isothiocyanate, sulforhodamine B, sulforhodamine 101 and sulfonyl chloride derivative of sulforhodamine 101 (Texas Red); N,N,N',N'-tetramethyl-6-carboxyrhodamine (TAMRA); tetramethyl rhodamine; tetramethyl rhodamine isothiocyanate (TRITC); riboflavin; rosolic acid and terbium chelate derivatives; LightCycler Red 640; Cy5.5;
  • fluorophores include those known to those skilled in the art, for example those available from Molecular Probes (Eugene, OR).
  • a fluorophore is used as a donor fluorophore or as an acceptor fluorophore.
  • fluorophores have the ability to be attached to a nucleic acid probe without sufficiently interfering with the ability of the probe to interact with the target nucleic acid molecule, are stable against photobleaching, and have high quantum efficiency.
  • FRET efficiency drops off according to l/(l+(R/R0) ⁇ 6) where RO is the distance at which the FRET efficiency is 50%.
  • FRET pairs Sets of fluorophores that can engage in fluorescence resonance energy transfer (FRET). Examples of FRET pairs that can be used are listed below. However, one skilled in the art will recognize that numerous other combinations of fluorophores can be used.
  • the probes disclosed herein include a FRET pair, wherein one probe of the pair includes a donor fluorophore and the other probe of the pair includes an acceptor fluorophore that can be excited by the wavelength of light emitted from the donor fluorophore.
  • an anchor probe can include a donor fluorophore and the mutation-specific probe can include the appropriate acceptor fluorophore (or vice versa).
  • FAM is most efficiently excited by light with a wavelength of 488 nm, emits light with a spectrum of 500 to 650 nm, and has an emission maximum of 525 nm.
  • FAM is a suitable donor fluorophore for use with JOE, TAMRA, and ROX (all of which have their excitation maxima at 514 nm, and will not be significantly stimulated by the light that stimulates FAM), as well as Cy5, Cy5.5, and LC -Red 640.
  • CYA is maximally excited at 488 nm and can therefore serve as a donor fluorophore for rhodamine derivatives (such as R6G, TAMRA, and ROX) which can be used as acceptor fluorophores (see Hung et al., Analytical Biochemistry, 243:15-27, 1996).
  • CYA and FAM are not examples of a good FRET pair, because both are excited maximally at the same wavelength (488 nm).
  • FRET pairs are (donor/acceptor): fluorescein/rhodamine, phycoerythrin/Cy7; fluorescein/Cy5; fluorescein/Cy5.5; fluorescein/LC-Red 640; fluorescein LC -Red 705; and fluorescein/J A286.
  • Hybridization The ability of complementary single-stranded DNA or RNA to form a duplex molecule (also referred to as a hybridization complex).
  • Nucleic acid hybridization techniques can be used to form hybridization complexes between a probe or primer and a nucleic acid molecule, such as a Bcr-Abl nucleic acid molecule.
  • a probe or primer such as any of SEQ ID NOS: 1-9 and 16
  • a Bcr-Abl nucleic acid molecule will form a hybridization complex with a Bcr-Abl nucleic acid molecule (such as SEQ ID NO: 10).
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (such as the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization. Calculations regarding hybridization conditions for attaining particular degrees of stringency are discussed in Sambrook et al., (1989) Molecular Cloning, second edition, Cold Spring Harbor Laboratory, Plain view, NY (chapters 9 and 11). The following is an exemplary set of hybridization conditions and is not limiting: Very High Stringency (detects sequences that share at least 90% identity) Hybridization: 5x SSC at 65 0 C for 16 hours
  • Hybridization 5x-6x SSC at 65°C-70°C for 16-20 hours
  • Hybridization 6x SSC at RT to 55 0 C for 16-20 hours
  • the probes and primers disclosed herein can hybridize to Bcr-Abl nucleic acid molecules, under low stringency, high stringency, and very high stringency conditions.
  • Imatinib A specific small molecule inhibitor of Bcr-Abl and/or AbI kinase, STI- 571, STI571, GLIVEC® and GLEEVECTM. Mutations in Bcr-Abl, such as amino acids 315 and 317, can reduce the effectiveness of imatinib.
  • Isolated An "isolated" biological component (such as a nucleic acid molecule, protein, or cell) has been substantially separated or purified away from other biological components in which the component naturally occurs, such as other chromosomal and extrachromosomal DNA and RNA, and proteins.
  • Nucleic acid molecules and proteins that have been “isolated” include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acid molecules and proteins, such as probes and primers. Isolated does not require absolute purity, and can include nucleic acid molecules that are at least 50% isolated, such as at least 75%, 80%, 90%, 95%, 98%, 99%, or even 100% isolated.
  • Label An agent capable of detection, for example by spectrophotometry, flow cytometry, or microscopy.
  • a label can be attached to a nucleotide, thereby permitting detection of the nucleotide, such as detection of the nucleic acid molecule of which the nucleotide is a part, such as a Bcr-Abl T315I specific probe and/or primer.
  • labels include, but are not limited to, radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent agents, fluorophores, haptens, enzymes, and combinations thereof. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed for example in Sambrook et al. (Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989) and Ausubel et al. (In Current Protocols in Molecular Biology, John Wiley & Sons, New York, 1998).
  • Luminescence Resonance Energy Transfer A process similar to FRET, in which the donor molecule is a luminescent molecule, or is excited by a luminescent molecule, instead of for example by a laser. Using LRET can decrease the background fluorescence.
  • a chemiluminescent molecule can be used to excite a donor fluorophore (such as GFP), without the need for an external source of electromagnetic radiation.
  • the luminescent molecule is the donor, wherein the excited resonance of the luminescent molecule excites one or more acceptor fluorophores.
  • An example of luminescent molecule that can be used includes, but is not limited to, aequorin.
  • Nucleic acid molecule A deoxyribonucleotide or ribonucleotide polymer including without limitation, cDNA, mRNA, genomic DNA, and synthetic (such as chemically synthesized) DNA or RNA.
  • the nucleic acid molecule can be double stranded (ds) or single stranded (ss).
  • nucleic acid molecule can be the sense strand or the antisense strand.
  • Nucleic acid molecules can include natural nucleotides (such as A, T/U, C, and G), and can also include analogs of natural nucleotides.
  • Nucleotide The fundamental unit of nucleic acid molecules.
  • a nucleotide includes a nitrogen-containing base attached to a pentose monosaccharide with one, two, or three phosphate groups attached by ester linkages to the saccharide moiety.
  • the major nucleotides of DNA are deoxyadenosine 5'-triphosphate (dATP or A), deoxyguanosine 5'-triphosphate (dGTP or G), deoxycytidine 5'-triphosphate (dCTP or C) and deoxythymidine 5'-triphosphate (dTTP or T).
  • the major nucleotides of RNA are adenosine 5'-triphosphate (ATP or A), guanosine 5'-triphosphate (GTP or G), cytidine 5'- triphosphate (CTP or C) and uridine 5'-triphosphate (UTP or U).
  • Nucleotides include those nucleotides containing modified bases, modified sugar moieties and modified phosphate backbones, for example as described in U.S. Patent No. 5,866,336 to Nazarenko et al.
  • modified base moieties which can be used to modify nucleotides at any position on its structure include, but are not limited to: 5-fluorouracil, 5-bromouracil, 5- chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N ⁇ 6- sopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2- methyladenine, 2-methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7- methylguanine, 5-methylaminomethyluracil, methoxyarninomethyl-2-thiouracil, beta-D- mannosylqueo
  • modified sugar moieties which may be used to modify nucleotides at any position on its structure, include, but are not limited to arabinose, 2-fluoroarabinose, xylose, and hexose, or a modified component of the phosphate backbone, such as phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphor amidate, a phosphordiamidate, a methylphosphonate, or an alkyl phosphotriester or analog thereof.
  • a target nucleic acid molecule is a nucleic acid molecule, at least a portion of the sequence of which is to be determined.
  • a target nucleic molecule is a Bcr- AbI nucleic acid sequence, wherein the sequence of codons 315, 317, or both, is determined.
  • the determination of a nucleic acid sequence can be made indirectly, for example by measuring the melting temperature of probes hybridized to the target nucleic acid sequence, wherein the melting temperature indicates the nucleotide sequence present.
  • PNA Peptide nucleic acid
  • PNA Peptide nucleic acid
  • Ph+ ALL A BCR-ABL- positive leukemia associated with a chromosomal translocation called the Philadelphia chromosome.
  • Ph+ ALL is associated with the pi 85 Bcr-Abl fusion protein.
  • Polymerizing agent A compound capable of reacting monomer molecules (such as nucleotides) together in a chemical reaction to form linear chains or a three-dimensional network of polymer chains.
  • a particular example of a polymerizing agent is polymerase, an enzyme which catalyzes the 5' to 3' elongation of a primer strand complementary to a nucleic acid template.
  • Examples of polymerases that can be used to amplify a nucleic acid molecule include, but are not limited to the E. coli DNA polymerase I, specifically the Klenow fragment which has 3' to 5' exonuclease activity, Taq polymerase, reverse transcriptase (such as HIV-I RT), E. coli RNA polymerase, and wheat germ RNA polymerase II.
  • polymerase The choice of polymerase is dependent on the nucleic acid to be amplified. If the template is a single-stranded DNA molecule, a DNA-directed DNA or RNA polymerase can be used; if the template is a single-stranded RNA molecule, then a reverse transcriptase (such as an RNA-directed DNA polymerase) can be used.
  • a DNA-directed DNA or RNA polymerase can be used; if the template is a single-stranded RNA molecule, then a reverse transcriptase (such as an RNA-directed DNA polymerase) can be used.
  • Primers Short nucleic acid molecules, such as a DNA oligonucleotide, for example sequences of at least 15 nucleotides, which can be annealed to a complementary target nucleic acid molecule by nucleic acid hybridization to form a hybrid between the primer and the target nucleic acid strand.
  • a primer can be extended along the target nucleic acid molecule by a polymerase enzyme.
  • primers can be used to amplify a target nucleic acid molecule (such as a portion of a Bcr-Abl nucleic acid molecule, for example a portion of a Bcr-Abl molecule containing the Bcr-Abl junction and/or a region including the nucleotides encoding amino acid 315 of the AbI kinase domain), wherein the sequence of the primer is specific for the target nucleic acid molecule, for example so that the primer will hybridize to the target nucleic acid molecule under very high stringency hybridization conditions.
  • a target nucleic acid molecule such as a portion of a Bcr-Abl nucleic acid molecule, for example a portion of a Bcr-Abl molecule containing the Bcr-Abl junction and/or a region including the nucleotides encoding amino acid 315 of the AbI kinase domain
  • probes and primers can be selected that include at least 15, 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides.
  • a primer is at least 15 nucleotides in length, such as at least 15 contiguous nucleotides complementary to a target nucleic acid molecule.
  • Particular lengths of primers that can be used to practice the methods of the present disclosure include primers having at least 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 45, at least 50, or more contiguous nucleot
  • An "upstream” or “forward” primer is a primer 5' to a reference point on a nucleic acid sequence.
  • a “downstream” or “reverse” primer is a primer 3' to a reference point on a nucleic acid sequence. In general, at least one forward and one reverse primer are included in an amplification reaction.
  • PCR primer pairs can be derived from a known sequence (such as the Bcr-Abl nucleic acid sequence set forth as SEQ ID NO: 12), for example, by using computer programs intended for that purpose such as Primer (Version 0.5, ⁇ 1991, Whitehead Institute for Biomedical Research, Cambridge, MA) or PRIMER EXPRESS® Software (Applied Biosystems, AB, Foster City, CA). Methods for preparing and using primers are described in, for example, Sambrook et al. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York; Ausubel et al. (1987) Current Protocols in Molecular Biology, Greene Publ. Assoc. & Wiley- Intersciences.
  • a primer includes a label.
  • Probe An isolated nucleic acid molecule that includes a detectable label or reporter molecule, such as a primer that includes a label.
  • Typical labels include radioactive isotopes, ligands, chemiluminescent agents, fluorophores, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e.g., in Sambrook et al., Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989) and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences (1987).
  • a probe includes at least one fluorophore, such as an acceptor fluorophore or donor fluorophore.
  • a fluorophore can be attached at the 5'- or 3'-end of the probe.
  • the fluorophore is attached to the base at the 5'-end of the probe, the base at its 3'-end, or the phosphate group at its 5'-end.
  • Probes are generally at least 12 nucleotides in length, such as at least 15 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides, or at least 25 nucleotides, such as 12-50 nucleotides, 12-40 nucleotides, or 12-30 nucleotides .
  • Quantifying a nucleic acid molecule Determining or measuring a quantity (such as a relative quantity) of nucleic acid molecules present, such as the number of amplicons or the number of nucleic acid molecules present in a sample. In particular examples, it is determining the relative amount or actual number of nucleic acid molecules present in a sample, such as Bcr-Abl nucleic acid molecules present in a sample.
  • a quantity such as a relative quantity
  • Sample Biological specimens such as samples containing biomolecules, such as nucleic acid molecules (for example genomic DNA, cDNA, RNA, or inRNA).
  • biomolecules such as genomic DNA, cDNA, RNA, or inRNA
  • Exemplary samples are those containing cells or cell lysates from a subject, such as those present in peripheral blood (or a fraction thereof such as white blood cells or serum), urine, saliva, tissue biopsy (such as a bone marrow biopsy), cheek swabs, surgical specimen, fine needle aspirates, amniocentesis samples and autopsy material.
  • a sample is one obtained from a subject having, suspected of having, or who has had, CML or Ph+ ALL.
  • Sequence identity/similarity The identity/similarity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity or similarity between the sequences. Sequence identity can be measured in terms of percentage identity; the higher the percentage, the more identical the sequences are.
  • homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity/similarity when aligned using standard methods.
  • NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. MoI. Biol. 215:403-10, 1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn, and tblastx. Additional information can be found at the NCBI web site.
  • NCBI National Center for Biological Information
  • BLASTN is used to compare nucleic acid sequences
  • BLASTP is used to compare amino acid sequences.
  • the options can be set as follows: -i is set to a file containing the first nucleic acid sequence to be compared (such as C: ⁇ seql.txt); -j is set to a file containing the second nucleic acid sequence to be compared (such as C: ⁇ seq2.txt); -p is set to blastn; -o is set to any desired file name (such as C: ⁇ output.txt); -q is set to -1; -r is set to 2; and all other options are left at their default setting.
  • the following command can be used to generate an output file containing a comparison between two sequences: C: ⁇ B12seq -i c: ⁇ seql.txt -j c: ⁇ seq2.txt -p blastn -o c: ⁇ output.txt -q -1 -r 2.
  • the number of matches is determined by counting the number of positions where an identical nucleotide or amino acid residue is presented in both sequences.
  • 75.11, 75.12, 75.13, and 75.14 are rounded down to 75.1, while 75.15, 75.16, 75.17, 75.18, and 75.19 are rounded up to 75.2.
  • the length value will always be an integer.
  • nucleic acid molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and are different under different environmental parameters. Nucleic acid molecules that hybridize under stringent conditions to a Bcr-Abl gene sequence typically hybridize to a probe based on either an entire Bcr-Abl gene or selected portions of the gene, respectively, under conditions described above.
  • the nucleic acid probes and primers disclosed herein are not limited to the exact sequences shown, as those skilled in the art will appreciate that changes can be made to a sequence, and not substantially affect the ability of the probe or primer to function as desired.
  • sequences having at least 80%, at least 90%, at least 95%, at least 98%, or at least 99% sequence identity to any of SEQ ID NOS: 1-9, 16, and 17 are provided herein.
  • sequence identity ranges are provided for guidance only; it is possible that probes and primer can be used that fall outside these ranges.
  • examples include electromagnetic signals such as light, for example light of a particular quantity or wavelength.
  • the signal is the disappearance of a physical event, such as quenching of light.
  • a characteristic signal is the particular signal expected when a particular nucleotide sequence is present, such the melting curve generated when a wild-type or a mutant Bcr-Abl sequence is present (such as a sequence encoding a mutation at amino acid 315 or 317 of the AbI kinase domain of Bcr-Abl).
  • a characteristic signal can be the melting curve resulting from the signal emitted from an acceptor or donor fluorophore present on a probe.
  • Subject Living multi-cellular vertebrate organisms, including human and veterinary subjects.
  • a subject is one having or suspected of having CML.
  • a phrase that is used to describe any environment that permits the desired activity includes incubating a target nucleic acid molecule (such as a Bcr-Abl sequence) with reagents that permit amplification of the target, detection of a particular sequence within the target, or combinations thereof.
  • a target nucleic acid molecule such as a Bcr-Abl sequence
  • the present disclosure provides isolated nucleic acid probes that can be used to detect one or more Bcr-Abl mutations.
  • mutations include those in the AbI kinase domain of Bcr-Abl (amino acids 220-498, for example of SEQ ID NO: 13), such as those that reduce the sensitivity of a Bcr-Abl/ AbI kinase inhibitor (for example imatinib).
  • AbI kinase domain mutations or substitutions include those at amino acids 315 and 317, such as T315I, T315A, and F317L.
  • the mutation in the Bcr-Abl coding sequence is a single nucleotide replacement.
  • an isolated probe of the present application includes a fluorophore and a nucleic acid molecule consisting of a nucleotide sequence shown in any of SEQ ID NOS: 5-9 and 17.
  • the fluorophore is an acceptor fluorophore or a donor fluorophore.
  • SEQ ID NOS: 5-9 and 17 with particular fluorophores are described herein, one skilled in the art will appreciate that different fluorophores can be used.
  • SEQ ID NOS: 5 and 6 include an acceptor fluorophore and donor fluorophore (e.g. the FRET pair LC-Red 640 and fluorescein), respectively.
  • acceptor fluorophore and donor fluorophore e.g. the FRET pair LC-Red 640 and fluorescein
  • FRET pair LC-Red 640 and fluorescein e.g. the FRET pair LC-Red 640 and fluorescein
  • the nucleic acid sequence shown in SEQ ID NO: 5 could include a donor fluorophore (such as fluorescein), and the nucleic acid sequence shown in SEQ ID NO: 6 could include an acceptor fluorophore (such as LC-Red 640 or Cy5).
  • a donor fluorophore such as fluorescein
  • an acceptor fluorophore such as LC-Red 640 or Cy5
  • probes that include variations to the nucleotide sequences shown in any of SEQ ID NOS: 5-9 and 17, as long as such variations permit detection of the desired AbI kinase domain mutation, such as a mutation in the AbI kinase domain of Bcr-Abl.
  • a probe can have at least 90%, at least 95%, or at least 98% sequence identity to a nucleic acid consisting of the sequence shown in any of SEQ ID NOS: 5-9 and 17.
  • the number of nucleotides does not change, but the nucleic acid sequence shown in any of SEQ ID NOS: 5-9 and 17 can vary at a few nucleotides, such as changes at 1, 2, 3, or 4 nucleotides.
  • a mutation specific probe (such as SEQ ID NOS: 5, 7, 9, and 17) does not include a change in the region that hybridizes to the nucleotides of codon 315 (such as nucleotides 6-8 of SEQ ID NO: 7 and 9 and nucleotides 16-18 of SEQ ID NO: 5), codon 317 (such as nucleotides 12- 14 of SEQ ID NO: 7 and 9 and nucleotides 10-12 of SEQ ID NO: 5), or both.
  • codon 315 such as nucleotides 6-8 of SEQ ID NO: 7 and 9 and nucleotides 16-18 of SEQ ID NO: 5
  • codon 317 such as nucleotides 12- 14 of SEQ ID NO: 7 and 9 and nucleotides 10-12 of SEQ ID NO: 5
  • SEQ ID NO: 7 can include a A2C, G9C, G17T, or C20G substitution (or combinations thereof), but in some examples nucleotides 6-8 (ATT; codon 315), nucleotides 12-14 (TTC; codon 317), or both, are not substituted (wherein the number refers to the nucleotide number in SEQ ID NO: 7). Similar substitutions can be made to the other probe sequences provided herein.
  • the present application also provides probes that are slightly longer or shorter than the nucleotide sequences shown in any of SEQ ID NOS: 5-9 and 17, as long as such deletions or additions permit detection of the desired AbI kinase domain mutation, such as a mutation in the AbI kinase domain of Bcr-Abl.
  • a probe can include a few nucleotide deletions or additions at the 5'- or 3'-end of the probe shown in any of SEQ ID NOS: 5-9 and 17, such as addition or deletion of 1, 2, 3, or 4 nucleotides from the 5'- or 3'- end, or combinations thereof (such as a deletion from one end and an addition to the other end).
  • the number of nucleotides changes.
  • SEQ ID NO: 8 deletion of the 5' "G” (nucleotide 1 of SEQ ID NO: 8), addition of a "G” or "GC” to the 3'-end", or combinations thereof. Similar changes can be made to the other sequences provided herein.
  • a mutation-specific probe such as a probe consisting of a nucleic acid sequence shown in any of 5, 7, 9 and 17, includes an acceptor fluorophore quencher at one end of the probe and a donor fluorophore at the other end of the probe.
  • the probe does not emit significant donor emission when hybridized to the AbI kinase domain target nucleic acid molecule (because the quencher is in sufficient proximity to the donor to reduce fluorescence emission by the donor), and the donor emission increases when the hybridization complex is disrupted during melting.
  • target AbI kinase domain mutation such as a mutation in the AbI kinase domain of Bcr-Abl
  • a mutation-specific probe containing both a quencher and a donor fluorophore
  • an anchor probe is not needed to practice the methods disclosed herein.
  • compositions include at least two nucleic acid probes, wherein the probes can be used to detect an AbI kinase domain mutation, such as a mutation in the AbI kinase domain of Bcr-Abl.
  • the composition includes a first nucleic acid probe and a second nucleic acid probe, wherein each probe includes a different fluorophore, such as a FRET pair (for example when one of the probes includes a FRET donor and the other includes a FRET acceptor).
  • the end of the probe not including the fluorophore can be blocked to significantly decrease extension (for example if the probes are included in an amplification reaction).
  • One of the probes is referred to as a mutation-specific probe, the other an anchor probe (which is generally longer than the mutation-specific probe).
  • the probes recognize adjacent AbI kinase domain sequences, such as sequences in AbI kinase domain of Bcr-Abl, with the shorter mutation-specific probe lying over the mutation site.
  • the mutation-specific probe can hybridize to a region of the AbI kinase domain, such as the AbI kinase domain of Bcr-Abl, that includes the one or more codons of interest (such as codons 315, 317, or both), and the anchor probe hybridizes to the AbI kinase domain sequence downstream from the mutation-specific probe.
  • the probes can be separated by at least 1 nucleotide, such as 1-2 nucleotides.
  • the mutation-specific probe can be designed so that a single base mismatch (such as a nucleotide substitution encoding for a mutation at amino acid 315 or 317 of an AbI kinase domain, such as an AbI kinase domain of Bcr-Abl) will result in a melting temperature (T m ) shift of at least 3°C, such as at least 4°C, at least 6°C, or at least 8°C, such as 4-10 0 C.
  • T m melting temperature
  • mutation-specific probes include those having at least 90%, at least 95%, or at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 5, 7, 9, or 17 and in some examples consist of the nucleotide sequence shown in SEQ ID NO: 5, 7, 9, or 17.
  • a mutation-specific probe can include a donor fluorophore (thereby permitting detection of the change in acceptor fluorophore emission on the anchor probe during melting, wherein a decrease in acceptor fluorophore emission indicates that the mutation-specific probe is no longer hybridized to the AbI kinase domain nucleic acid amplicon).
  • anchor probes include those at least 90%, at least 95%, or at least 98% sequence identity to the nucleotide sequence shown in SEQ ID NO: 6 or 8, and in some examples consist of the nucleotide sequence shown in SEQ ID NO: 6 or 8.
  • an anchor probe can include an acceptor fluorophore (thereby permitting detection of the change in acceptor fluorophore emission on the anchor probe during melting, wherein a decrease in acceptor fluorophore emission indicates that the mutation-specific probe is no longer hybridized to the AbI kinase domain nucleic acid amplicon).
  • the composition includes fluorescently labeled probes having at least 95% or at least 100% sequence identity to the nucleotide sequence shown in SEQ ID NO: 5 and 6, SEQ ID NO: 5 and 17, SEQ ID NO: 7 and 8, or SEQ ID NO: 9 and 8.
  • exemplary probes are provided in SEQ ID NOS: 5-9 and 17, one skilled in the art will appreciate that the probe sequence can be varied slightly by moving the probes a few nucleotides upstream or downstream from the nucleotide positions that they hybridize to on the AbI kinase domain nucleic acids.
  • the mutation specific probe will include the nucleotide position including the codon of interest, such as codon 315, 317, or both.
  • mutation-specific probe SEQ ID NO: 7 recognizes nucleotides 1302- 1324 of an AbI cDNA
  • the corresponding anchor probe in SEQ ID NO: 8 recognizes nucleotides 1326-1352 of an AbI cDNA. Therefore, there is one nucleotide separating the two probes.
  • SEQ ID NOS: 7 and 8 can be made, by "sliding" the probes a few nucleotides 5' or 3' from their positions.
  • Table 1 shows exemplary combinations of mutation specific probes and anchor probes that can be used to detect an AbI kinase domain mutation, such as a mutation in the AbI kinase domain of Bcr-Abl. Based on this disclosure, one skilled in the art will appreciate that similar changes can be made to SEQ ID NOS: 9 and 8, as well as SEQ ID NOS: 5 and 6 and SEQ ID NOS: 17 and 6.
  • Nucleotides refer to SEQ ID NO: 12 (either strand)
  • the acceptor fluorophore is attached to the 3' end of the mutation-specific probe and the donor fluorophore is attached to a 5' end of the anchor probe (for example for SEQ ID NOS: 7 and 8).
  • the acceptor fluorophore is attached to a 5' end of the mutation-specific probe molecule and the donor fluorophore is attached to a 3' end of the anchor probe (for example for SEQ ID NOS: 5 and 6).
  • Appropriate donor/acceptor fluorophore pairs can be selected using routine methods.
  • the donor emission wavelength is one that can significantly excite the acceptor, thereby generating a detectable emission from the acceptor.
  • Non-limiting examples of donor/acceptor FRET pairs include fluorescein as the donor and LightCycler Red 640 (LC-Red 640), LC-Red 705, JA286, Cy5, or Cy5.5 as the acceptor.
  • the acceptor fluorophore is a dark quencher that significantly decreases the detectable donor emission when in sufficient proximity to the donor fluorophore.
  • the mutation-specific probe and the anchor probe are hybridized to an AbI kinase domain amplicon (that is, when there is a hybridization complex)
  • no significant donor emission signal is detected.
  • the probes are released from the AbI kinase domain amplicon (that is, the hybridization complex comes apart)
  • the emission signal from the donor increases, because it is no longer quenched by the dark quencher.
  • Exemplary dark quenchers include Dabcyl, QSY7, QSY33, BLACK HOLE QUENCHERSTM, ECLIPSETM Dark Quencher, and IOWA BLACKTM.
  • kits that can be used to analyze a biological sample containing nucleic acid molecules for the presence of one or more AbI kinase domain mutations, such as a mutation at amino acid 315 or 317, for example in the AbI kinase domain of Bcr-Abl.
  • the kits include one or more of the probes or compositions provided herein.
  • such as kit can include at least one, at least two, at least three, at least four, or more probes disclosed herein, such as probes that consist of a sequence having at least 90, at least 95, at least 98% or even 100% sequence identity to any of SEQ ID NOS: 5-9 and 17.
  • the kit includes a pair of oligonucleotide probes disclosed herein, such as a first donor oligonucleotide probe and a first acceptor oligonucleotide probe, wherein the probes hybridize to adjacent regions of a AbI kinase domain nucleic acid sequence that includes codon 315 (and in some examples also codon 317).
  • the probes are in separate vessels. Examples of exemplary pairs of oligonucleotide probes include SEQ ID NOS: 5 and 6, SEQ ID NOS: 17 and 6, SEQ ID NOS: 7 and 8, and SEQ ID NOS: 8 and 9.
  • kits further include at least one other component, such as a component that can be used to amplify a Bcr-Abl nucleic acid molecule and/ or an AbI kinase domain nucleic acid molecule.
  • exemplary components include a pair of nucleic acid amplification primers, a polymerizing agent; (such as a thermostable DNA polymerase), deoxynucleoside triphosphates, deoxynucleotide triphosphates, a buffer suitable for use in a nucleic acid amplification reaction, or combinations thereof.
  • oligonucleotide primers that can be included in the kit are those that can amplify a segment of Bcr-Abl that includes the Bcr-Abl junction and the region encoding amino acids 315-317 (such as any sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 1, 2 and 16); one or more oligonucleotide primers that can amplify a segment of Bcr- Abl that encodes at least the region encoding amino acids 315-317 of the AbI kinase domain of Bcr-Abl (such as any sequence having at least 95% or 100% sequence identity to any of SEQ ID NOS: 3-4); or combinations thereof.
  • Bcr-Abl mutations that can be detected include those in the AbI kinase domain, such as at amino acids 315, 317, or both (for example T315I, T315A, and F317L).
  • the disclosed methods have at least 90% sensitivity and specificity, such as at least 95%, at least 99%, or even 100% sensitivity and specificity.
  • the disclosed methods can detect about 4 copies or greater of a Bcr-Abl mutation present in the sample.
  • the disclosed methods can be used to determine a treatment protocol for a subject having CML or PH+ ALL.
  • the subject is not selected to receive to treatment with a Bcr-Abl/ AbI kinase inhibitor whose sensitivity decreases in the presence of such mutations (such as imatinib, dasatinib, or nilotinib).
  • a Bcr-Abl/ AbI kinase inhibitor whose sensitivity decreases in the presence of such mutations (such as imatinib, dasatinib, or nilotinib).
  • the method includes contacting at least one of the probes disclosed herein, such as at least two probes (for example the compositions disclosed herein), with an amplified AbI kinase domain nucleic acid molecule (such as a AbI kinase domain from Bcr-Abl) under conditions that permit hybridization between the amplified Bcr-Abl nucleic acid molecule and the one or more probes, thereby generating a hybridization complex.
  • the conditions can permit a mutation-specific probe and an anchor probe to bind to their respective complementary AbI kinase domain sequence, thereby placing the fluorophores on the probes in a resonance energy transfer relationship.
  • the hybridization complex is heated to a temperature that permits melting of the hybridization complex, such as a temperature of at least 55°C, such as at least 60 0 C, at least 65°C at least 70 0 C, at least 75°C, at least 80 0 C, or at least 85°C.
  • a temperature that permits melting of the hybridization complex such as a temperature of at least 55°C, such as at least 60 0 C, at least 65°C at least 70 0 C, at least 75°C, at least 80 0 C, or at least 85°C.
  • the fluorescent signal emitted from at least one of the fluorophores on the probe such as the acceptor or donor fluorophore
  • the presence of a melting point temperature shift relative to wild-type AbI kinase domain indicates the presence of a mutation in the AbI kinase domain, such as at amino acid 315, 317, or both.
  • the method includes contacting at least one of the probes disclosed herein, such as at least two probes (for example the compositions disclosed herein), with an amplified AbI kinase domain nucleic acid molecule (such as a AbI kinase domain from Bcr-Abl) under conditions that permit hybridization between the amplified nucleic acid molecule and the one or more probes, thereby generating a hybridization complex in which the hybridization complex is formed in the absence of a peptide nucleic acid (PNA) molecule.
  • PNA peptide nucleic acid
  • the amplified AbI kinase domain nucleic acid molecule includes the region encoding amino acid 315, such as at least the region encoding amino acids 315-317.
  • the amplified AbI kinase domain nucleic acid is at least 75 consecutive nucleotides, such as at least 100 consecutive nucleotides, or at least 150 consecutive nucleotides, such as 75-500 nucleotides (e.g. of SEQ ID NO: 10).
  • the amplified AbI kinase domain nucleic acid molecule in some examples is obtained from a clinical sample, such as blood or a fraction thereof.
  • Bcr-Abl and or the AbI kinase domain of Bcr-Abl can be amplified directly from the sample, or nucleic acid molecules from the sample can be isolated and amplified. If RNA is isolated, it can be reverse transcribed before amplification.
  • the method can also include exciting a donor fluorophore present on one of the probes, thereby permitting the donor fluorophore to emit a signal which excites the acceptor fluorophore to emit a fluorescent signal.
  • the donor is excited with a laser.
  • the donor can also be excited by a chemiluminescent molecule.
  • Melting of the hybridization duplex formed between one or more probes disclosed herein and an amplified AbI kinase domain sequence can be performed by increasing the temperature of the hybridization duplex to at least the lowest temperature that will disrupt the hybridization of at least one probe.
  • the hybridization complex includes a mutation-specific probe (such as SEQ ID NO: 5, 7, 9, or 17) and an anchor probe (such as SEQ ID NO: 6 or 8) hybridized to a AbI kinase domain sequence
  • melting can be performed by heating the complex to at least the lowest temperature that will disrupt the hybridization of the mutation-specific probe, the anchor probe, or both.
  • the temperature of the hybridization complex is increased to at least 70 0 C, such as at least 80 0 C.
  • the melting curve is generated by increasing the temperature of hybridization complex to at least 80 0 C with a ramp rate of at least 0.1 °C/second, such as at least 0.2°C/second, at least 0.5°C/second, such as O.rC/second to 1.0°C/second.
  • the fluorescent signal detected is generated by luminescence resonance energy transfer (LRET) or Forster resonance energy transfer (FRET).
  • the mutation specific probe includes an acceptor fluorophore (and the anchor probe a donor fluorophore), or the mutation-specific probe includes a donor fluorophore (and the anchor probe an acceptor fluorophore).
  • FRET FRET no longer takes place between the acceptor and donor, thereby decreasing the acceptor fluorophore emission signal.
  • the acceptor fluorophore is a quencher.
  • the shorter mutation-specific probe melts off, quenching of the donor by the acceptor no longer takes place, thereby increasing the donor fluorophore emission signal. Therefore, either the donor or the acceptor fluorophore emission signal can be monitored to generate a melting curve, depending on the particular fluorophore used.
  • the resulting melting curve can be compared to a control or refernce, such as a melting curve for wild-type Bcr-Abl and/or wild-type AbI, wherein a shift in the test melting curve relative to the wild-type curve indicates that the test sample has a AbI kinase domain mutation, such as a mutation at amino acid 315 or 317, for example a mutation at amino acid 315 or 317 of the AbI kinase domain of Bcr-Abl.
  • a control is a melting curve for a particular AbI kinase domain mutation, such as T315I, T315A, or
  • test and control samples are run in parallel.
  • the disclosed method can further include amplifying a Bcr-Abl nucleic acid molecule isolated from a biological sample, thereby generating a first amplicon.
  • the first amplicon includes the Bcr-Abl junction and the region encoding at least amino acid 315 of AbI kinase domain of Bcr-Abl.
  • the first amplicon is at least 1000 base pairs (bp), such as at least 1500 bp, for example 1000-2000 bp.
  • the first amplicon can be amplified, thereby generating a second amplicon, wherein the second amplicon includes the region encoding at least amino acid 315 of the AbI kinase domain of Bcr-Abl.
  • the second amplicon is at least 100 bp, such as at least 200 bp, for example 100-400 bp.
  • the AbI kinase domain is amplified in the in the absence of a peptide nucleic acid (PNA) molecule.
  • PNA peptide nucleic acid
  • a PNA molecule capable of binding to wild-type AbI kinase sequence is not included in the any amplification reaction.
  • a PNA molecule capable of binding to wild-type AbI kinase sequence is not included in the any amplification reaction resulting in the amplification of Bcr-Abl sequence that includes residues 315 or 317 of Bcr-Abl.
  • the AbI kinase domain nucleic acid molecule is isolated from a biological sample amplified, thereby generating an amplicon, wherein the amplicon includes the region encoding at least amino acid 315 of the AbI kinase domain of Bcr-Abl.
  • the amplicon is at least 100 bp, such as at least 200 bp, for example 100-400 bp.
  • Methods of amplification are known in the art, and include PCR amplification, such as nested PCR amplification. Although particular primers are disclosed herein that can be used for the amplification, the primers that can be used are not so limited.
  • those skilled in the art can design primers that will generate amplicons having the properties disclosed herein using routine molecular biology methods.
  • Primers capable of hybridizing to and directing the amplification of Bcr-Abl nucleic acid molecule are disclosed.
  • the primers disclosed herein are between 15 to 40 nucleotides in length, such as 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, or even 40 nucleotides in length.
  • a primer is capable of hybridizing under very high stringency conditions to a Bcr-Abl nucleic acid sequence, such as a Bcr-Abl sequence set forth as SEQ ID NO: 13, and directing the amplification of the Bcr-Abl nucleic acid molecule, for example amplification of SEQ ID NO: 13 or a subsequence thereof.
  • a primer capable of hybridizing to and directing the amplification of a Bcr-Abl nucleic acid molecule contains a nucleic acid sequence that is at least 95% identical, such as at least 96%, at least 97%, at least 98%, at least 99%, or even 100% identical, to the nucleic acid sequence set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 16, SEQ ID NO: 3, or SEQ ID NO: 4.
  • a primer capable of hybridizing to a Bcr-Abl nucleic acid molecule consists essentially of a nucleic acid sequence set forth as SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 16, SEQ ID NO: 3, or SEQ ID NO: 4.
  • the primers are a set of primers, such as a pair of primers, capable of hybridizing to and amplifying a Bcr-Abl nucleic acid molecule.
  • a set of primers includes at least one forward primer and a least one reverse primer, where the primers are specific for the amplification of a Bcr-Abl nucleic acid molecule.
  • the set of primers includes a pair of primers that is specific for the amplification of a Bcr-Abl nucleic acid molecule that includes a portion of the nucleic acid sequence of the Bcr-Abl gene, such as the nucleic acid sequence set forth as SEQ ID NO: 13.
  • all of the steps in detecting a Bcr-Abl mutant from RT-PCR to detection of probe hybridization can be done in a single reaction vessel, such as a PCR tube, for example sequentially. It is also contemplated that the steps in detecting a Bcr-Abl mutation can be done in multiple reaction vessels.
  • primer sequence can be varied slightly by moving the probes a few nucleotides upstream or downstream from the nucleotide positions that they hybridize to on the Bcr-Abl nucleic molecule acid
  • primers that include variations to the nucleotide sequences shown in any of SEQ ID NOS: 1-4 and 16, as long as such variations permit amplification of a Bcr-Abl nucleic acid molecule.
  • a probe or primer can have at least 95% sequence identity such as at least 96%, at least 97%, at least 98%, at least 99% to a nucleic acid consisting of the sequence shown in any of SEQ ID NOs: 1-4 and 16.
  • the number of nucleotides does not change, but the nucleic acid sequence shown in any of SEQ ID NOS: 1-4 and 16 can vary at a few nucleotides, such as changes at 1, 2, 3, or 4 nucleotides.
  • a primer can include a few nucleotide deletions or additions at the 5'- or 3'-end of the probe or primers shown in any of SEQ ID NOS: 1-4 and 16, such as addition or deletion of 1, 2, 3, or 4 nucleotides from the 5'- or 3'-end, or combinations thereof (such as a deletion from one end and an addition to the other end). In such examples, the number of nucleotides changes.
  • Biological Samples Appropriate specimens for use with the current disclosure in determining whether the subject has a Bcr-Abl mutation include any conventional clinical samples, for instance blood or blood-fractions (such as such as white blood cells or serum), or tissue biopsy (such as a bone marrow biopsy). Techniques for acquisition of such samples are well known in the art, for example by collection in a vacutainer, such as a PAXgene Blood RNA Tube (QIAGEN®) (for other examples, see Schluger et al. J. Exp. Med. 176: 1327-33, 1992, for the collection of serum samples). Serum or other blood fractions can be prepared in the conventional manner.
  • a vacutainer such as a PAXgene Blood RNA Tube (QIAGEN®) (for other examples, see Schluger et al. J. Exp. Med. 176: 1327-33, 1992, for the collection of serum samples).
  • Serum or other blood fractions can be prepared in the conventional manner.
  • RNA Ribonucleic acid
  • serum about 200 ⁇ L of serum can be used for the extraction of nucleic acids for use in amplification reactions.
  • about 2.5-7.5 mis peripheral blood or 1-5 mis bone marrow is used.
  • nucleic acids are not amplified, larger amounts of blood can be collected.
  • at least 5 ⁇ g of mRNA is desired, about 5-30 mis of blood can be collected.
  • 3 ⁇ g of total RNA is obtained from 5 mis of blood.
  • the sample can be used directly, concentrated (for example by centrifugation or filtration), purified, amplified, or combinations thereof.
  • concentrated for example by centrifugation or filtration
  • purified for example by amplified
  • amplified for example by amplifying
  • RNA and/or DNA from a sample may be extracted using guanidinium isothiocyanate, such as the single-step isolation by acid guanidinium isothiocyanate-phenol-chloroform extraction of Chomczynski et al. (Anal. Biochem.
  • the sample can be used directly or can be processed, such as by adding solvents, preservatives, buffers, or other compounds or substances.
  • Nucleic acids can be extracted using standard methods. For example, DNA or RNA can be isolated from a biological sample, such as blood or a fraction thereof, using a commercially available kit.
  • rapid nucleic acid preparation can be performed using a commercially available kit (such as the QIAGEN® DNA Mini kit (QIAGEN(D)Roche MagNA Pure Compact Nucleic Acid Isolation Kit I or RNE AS Y® Mini Kit (QIAGEN®) ;
  • a commercially available kit such as the QIAGEN® DNA Mini kit (QIAGEN(D)Roche MagNA Pure Compact Nucleic Acid Isolation Kit I or RNE AS Y® Mini Kit (QIAGEN®) ;
  • This example describes methods used to generate a Bcr-Abl amplicon containing the region where T315I, T315A, and F317L mutations could occur, as well as the Bcr-Abl junction.
  • probes and PCR conditions are described, one skilled in the art will appreciate that other primers and conditions can be used.
  • the length of the resulting Bcr-Abl amplicon can vary.
  • FIG. 1 shows a specific example of the assay.
  • Bcr-Abl cDNA is selectively amplified in a first round PCR reaction using primers Forl and Revl (such as SEQ ID NOS: 1 and 2 or SEQ ID NOS: 1 and 16). This is described in Example 1.
  • the resultant product is subjected to nested PCR reaction using primers For2 and Rev2 (such as SEQ ID NOS: 3 and 4).
  • the nested PCR reaction includes mutant specific and anchor probes (such as SEQ ID NOS: 5-9).
  • a melting curve of the product is generated to identify the genotype (such as the presence or absence of ABL T315I, T315A, or F317L mutation). This is described in Example 2.
  • RNA was isolated from whole blood samples as follows. To achieve complete cell lysis, PAXgene Blood RNA tubes were incubated for at least 2 hours at room temperature prior to centrifugation. PAXgene Blood RNA tubes containing whole blood were centrifuged for 10 minutes at 3000-5000 x g using a swing-out rotor with adapters for round-bottom tubes. The supernatant was removed by decanting or pipetting, and discarded. Four milliliters of RNase-free water was added to the pellet, and the tube reclosed using a fresh secondary hemogard closure. The pellets were thoroughly resuspended by vortexing, and centrifuged for 10 minutes at 3000-5000 x g.
  • the ACK buffer was aspirated and white blood cell pellet resuspended in 30 mis cold patient wash solution (500 ml Dulbecco's Ca, Mg free PBS, 10 ml human albumin solution (4.5%), 5 ml Recombinant human Dnase (Pulmozyme), and 1 ml Mg Cl 2 (1.25 M)).
  • Cells were pelleted at -150 x g and the patient wash solution aspirated off. Cells were resuspended in 3-20 mis cold PBS for counting. Live cells were count by Trypan blue exclusion or the Guava Viacount protocol. Cells were lysed in TRIZOL solution according to the manufacturer's instructions using 0.8 ml of the reagent per 5-10 x 10 6 of cells.
  • RNA samples were centrifuged at no more than 12,000 x g for 15 minutes at 2 to 8 0 C. Following centrifugation, the mixture separated into a lower red, phenol-chloroform phase, an interphase, and a colorless upper aqueous phase. The aqueous phase (containing RNA) was transferred to a clean tube. RNA was precipitated from the aqueous phase by mixing with isopropyl alcohol, using 0.5 ml of isopropyl alcohol per 0.8 ml of TRIZOL reagent.
  • RNA pellet washed once with 75% ethanol, adding at least 1 ml of 75% ethanol per 1 ml of TRIZOL reagent.
  • the samples were mixed by vortexing and centrifuge at no more than 7,500 x g for
  • RNA pellets were briefly dried (air-dry or vacuum-dry for 5-10 minutes) and resuspended in 11 ⁇ L of DEPC -treated water.
  • RNA was reverse transcribed as described in Table 2.
  • Table 2 The optimal
  • RNA -concentration for cDNA synthesis is 150-3000 ng/ ⁇ l.
  • samples contained approximately 1 ⁇ g of total RNA.
  • cDNA product was amplified using a long range PCR (LR-PCR) protocol. Briefly, in a 25 ⁇ l reaction, 5 ⁇ L of cDNA product (equivalent to 100 ng RNA) was incubated with 0.5 mM each of the forward and reverse primers (5' - GAAGCTTCTCCCTGACATCCGT - 3'; SEQ ID NO: 1 and 5' -
  • a standard PCR reaction was run for 40 cycles as follows: each reaction was heated at 96°C for 4 minutes followed by 10 cycles of; 94°C for 15 minutes, 65°C for 30 minutes, 72°C for 1.5 minutes, 72°C for 7 minutes; 30 cycles of: 94°C for 15 minutes, 65°C for 30 minutes, 72°C for 1.5 minutes+5seconds/cycle, 72°C for 7 minutes, and held at 10 0 C.
  • the resulting Bcr-Abl amplicon (about 1.5 kB) included the Bcr- AbI junction as well as the region encoding amino acids 315-317.
  • This amplicon can be gel purified or used directly for nested PCR (see Example 3).
  • RNA-concentration for cDNA synthesis is 150-3000 ng/ ⁇ L.
  • samples contained approximately l ⁇ g of total RNA.
  • the resulting cDNA product obtained form RT-PCR was amplified using the PCR protocol described as described in Example 2. Briefly, in a 25 ⁇ L reaction, 5 ⁇ L of cDNA product (equivalent to 100 ng RNA) was incubated with 0.08 ⁇ M each of the forward and reverse primers (5' - GAAGCTTCTCCCTGACATCCGT - 3' ; SEQ ID NO: 1 (which binds to nucleotides 3205-3226 of BCR, GENB ANK® accession NM021574) and 5' - AGGCATCTCAGGCACGTCA - 3'; SEQ ID NO: 16 (which binds to nucleotides 1638-1656 of AbI, GENBANK® accession No. NM005157)).
  • the mastermix shown in Table 4 was prepared:
  • Example 2 was added and the PCR run in a Bio-Rad Thermocycler with the following parameters: 95°C for 2 minutes, 40 cycles of 94°C for 30 seconds, 65°C for 20 seconds and 72°C for 90 seconds, followed by 72° for 3 minutes and held at 10 0 C.
  • the resulting Bcr-Abl amplicon (from about 1.6 kB to about 1.8 kB) included the Bcr-Abl junction as well as the region encoding amino acids 315-317. This amplicon can be gel purified or used directly for nested PCR (see Example 3).
  • Example 3 Nested PCR and Melting Curve Analysis of Bcr-Abl Amplicons This example describes methods used in nested PCR to amplify the Bcr-Abl amplicons generated in Example 1 or 2, and then hybridize the resulting amplicon with FRET probes (an anchor probe and a probe specific for the region encoding amino acids 315-317), and then melt the hybridization complex. Although particular probes and incubation conditions are described, one skilled in the art will appreciate that other primers and conditions can be used. In addition, the length of the resulting Bcr-Abl amplicon can vary.
  • the resulting Bcr-Abl amplicons generated in Example 1 or 2 were further amplified using nested PCR. Specifically, the region encoding amino acids 277-342 of the AbI kinase domain was amplified using nested PCR with forward primer (CCATGGAGGTGGAAGAGTTC; SEQ ID NO: 3) and reverse primer (CATGTACAGCAGCACCACG; SEQ ID NO: 4).
  • the nested PCR reaction also included FRET probes that permit detection of a mutation at amino acid 315, 317, or both. Ideally, the FRET probes do not contribute to the generation of amplicons, but can hybridize to the amplicons.
  • the FRET probes hybridized to the sense strand mutation-specific probe (LC-Red640 - GTAGGTCATGAACTCAATGATGA - C3Blocker; SEQ ID NO: 5) and anchor probe (ACTCCCTCAGGTAGTCCAGGAGGTTCC - Fluorescein; SEQ ID NO: 6).
  • the mutation-specific probe has a T m of 59.0 0 C if the nucleic acid molecule encoding the T315I mutation is present and a T m of 52°C if the wild-type sequence is present.
  • the anchor probe has a T m of 70.81 0 C.
  • the nested PCR reaction was 25 ⁇ l and included: 1 ⁇ L of the resulting PCR reaction containing amplicons generated in Example 1 or 2, 800 ⁇ M SEQ ID NO: 3, 80 ⁇ M SEQ ID NO: 4 (for a forward: reverse primer ratio of 10:1), 200 ⁇ M SEQ ID NO: 5, 200 ⁇ M SEQ ID NO: 6, 1.5 mM MgCl 2 , 250 ⁇ M dNTPs, 0.07 units/microliter of Roche Expand High Fidelity polymerase, 1 X PCR buffer, and the nested PCR reaction conditions were as follows: 2 minute hold at 94°C; 30 cycles of 15 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C; followed by a 7 minute hold at 72°C, then a hold at 25°C.
  • the FRET probes hybridized to the sense strand mutation-specific probe (LC-Red640 - GTAGGTCATGGACTCAATGATGA - C3Blocker; SEQ ID NO: 17) and anchor probe (ACTCCCTCAGGTAGTCCAGGAGGTTCC - Fluorescein; SEQ ID NO: 6).
  • the mutation-specific probe has a T m of 59.0 0 C if the nucleic acid molecule encoding the T315I mutation is present and a T m of 52°C if the wild-type sequence is present.
  • the anchor probe has a T m of 70.81 0 C.
  • the nested PCR reaction was 25 ⁇ l and included: 1 ⁇ L of the resulting PCR reaction containing amplicons generated in Example 1 or 2, 800 ⁇ M SEQ ID NO: 3, 80 ⁇ M SEQ ID NO: 4 (for a forward: reverse primer ratio of 10:1), 200 ⁇ M SEQ ID NO: 17, 200 ⁇ M SEQ ID NO: 6, 1.5 mM MgCl 2 , 250 ⁇ M dNTPs, 0.07 units/microliter of Roche Expand High Fidelity polymerase, 1 X PCR buffer, and the nested PCR reaction conditions were as follows: 2 minute hold at 94°C; 30 cycles of 15 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C; followed by a 7 minute hold at 72°C, then a hold at 25 0 C.
  • the FRET probes hybridized to the anti-sense strand mutation- specific probe (5'- LC Red 640-TCATCATTGAGTTCATGACCTAC - C3 blocker; SEQ ID NO: 7) and anchor probe (5'- GGAACCTCCTGGACTACCTGAGGGAGT - fluorescein; SEQ ID NO: 8).
  • the mutation-specific probe has a T m of 59.21 0 C if the nucleic acid molecule encoding the T315I mutation is present and a T m of 55.3 0 C if the wild-type sequence is present.
  • the anchor probe has a T m of 70.81 0 C.
  • the nested PCR reaction was 25 ⁇ L and included: 1 ⁇ L of the PCR reaction containing amplicons generated in Example 1, 80 ⁇ M SEQ ID NO: 3, 800 ⁇ M SEQ ID NO: 4 (for a forward: reverse primer ratio of 1: 10), 200 ⁇ M SEQ ID NO: 7, 200 ⁇ M SEQ ID NO: 8, 1.5 mM MgCl 2 , 200 ⁇ M dNTPs, 0.07 units/microliter of Roche Expand High Fidelity polymerase, 1 X PCR buffer, and the PCR reaction conditions were as follows: The nested PCR reaction conditions were as follows: 2 minute hold at 94°C; 30 cycles of 15 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C; followed by a 7 minute hold at 72°C, then a hold at 25°C.
  • the FRET probes hybridized to the anti-sense strand, and the mutant-specific primer included an intentional mismatch: mutation-specific probe (5'- LC Red 640-TCATCATTCAGTTCATGACCTAC - C3 blocker; SEQ ID NO: 9) and anchor probe (SEQ ID NO: 8).
  • the mutation-specific probe has a T m of 52.3°C if the nucleic acid molecule encoding the T315I mutation is present and a T m of 41.7°C if the wild-type sequence is present.
  • the anchor probe has a T m of 70.81 0 C.
  • the nested PCR reaction was 25 ⁇ L and included: 1 ⁇ L of the PCR reaction containing amplicons generated in Example 1, 80 ⁇ M SEQ ID NO: 3, 800 ⁇ M SEQ ID NO: 4 (for a forwardxeverse primer ratio of 1 : 10), 200 ⁇ M SEQ ID NO: 7, 200 ⁇ M SEQ ID NO: 8, 1.5 mM MgCl 2 , 200 ⁇ M dNTPs, 0.07 units/microliter of Roche Expand High Fidelity polymerase, 1 X PCR buffer, and the PCR reaction conditions were as follows: The nested PCR reaction conditions were as follows: 2 minute hold at 94°C; 30 cycles of 15 seconds at 94°C, 30 seconds at 56°C, 30 seconds at 72°C; followed by a 7 minute hold at 72°C, then a hold at 25°C.
  • the nested PCR reaction was 25 ⁇ L and included: 1 ⁇ L of the PCR reaction containing amplicons generated in Example 1 or 2, 80 ⁇ M SEQ ID NO: 3, 800 ⁇ M SEQ ID NO: 4 (for a forward:reverse primer ratio of 1:10) 15 mM MgCl 2 , 250 ⁇ M dNTPs, 0.5 ⁇ L of Roche Expand High Fidelity polymerase, 1 X PCR buffer, and the PCR reaction conditions were as follows: The nested PCR reaction conditions were as follows: 2 minute hold at 95°C; 25 cycles of 15 seconds at 94°C, 30 seconds at 60 0 C, and 1 minute at 72°C.
  • the nested PCR reaction was 25 ⁇ l and included: 1 ⁇ L of the PCR reaction containing amplicons generated in Example 1 or 2, 2 ⁇ L of a 10 ⁇ M stock solution of the primer according to SEQ ID NO: 3, 0.2 2 ⁇ L of a 10 ⁇ M stock solution of the primer according to SEQ ID NO: 4 (for a forward:reverse primer ratio of 10:1), 5 ⁇ L of 1OmM dNTPs, 0.5 ⁇ L of Roche Expand High Fidelity polymerase, 1 X PCR buffer, 0.5 ⁇ L of a 10 ⁇ M stock of a primer according to the nucleic acid sequence shown in SEQ ID NO: 3, 0.5 ⁇ L of a 10 ⁇ M stock of 10 ⁇ M of a primer according to the nucleic acid sequence shown in SEQ ID NO: 4, and the nested PCR reaction conditions were as follows: 2 minute hold at 95°C; 25 cycles of 15 seconds at 94°C, 30 seconds at 60 0 C, and 1 minute at
  • the resulting nested PCR amplicon was about 0.2 kB, and included the region encoding amino acids 315-317 of the AbI kinase domain. To determine whether the resulting amplicons included a sequence encoding a
  • a FRET hybridization probe melting curve analysis was performed as follows.
  • the resulting nested PCR reaction (which includes the FRET probes described above) was incubated under conditions that permitted hybridization of the FRET probes to the amplicons, and subsequent melting of the hybridization complex.
  • the resulting nested PCR reaction containing the nested PCR amplicons was incubated at 95°C for 2 minutes, 40 0 C for 30 seconds, and then heated to 85°C at a ramp rate of 0.5°C/sec. During this heating, continuous readings at the LC-Red640 emission were obtained using a Roche 480 LightCycler.
  • a FRET hybridization probe melting curve analysis was performed as follows.
  • the resulting nested PCR reaction (which includes the FRET probes described above) was incubated under conditions that permitted hybridization of the FRET probes to the amplicons, and subsequent melting of the hybridization complex.
  • the resulting nested PCR reaction containing the nested PCR amplicons was incubated at 95°C for 2 minutes, 37°C for 30 seconds, and then heated to 65°C at a ramp rate of 0.5°C/sec. During this heating, continuous readings at the LC-Red640 emission were obtained using a Roche 480 LightCycler.
  • the resulting melting curves were analyzed using Roche genotyping software according to Roche480 guidelines.
  • the anchor probe is labeled with fluorescein and the AbI kinase domain T315I mutation-specific probe is labeled with LC-Red 640.
  • An efficient FRET process occurs when the probes are separated by only one or two bases.
  • a melting curve of the product is generated to identify the genotypes.
  • the greater stability of the anchor probe results in a loss of fluorescence when the shorter T3151 mutation-specific probe melts off the template.
  • the predicted T m of the T315I probe is 59.0 0 C for the mutant allele, compared with 52.0 0 C for the wild-type allele.
  • the method permits detection of T315I, F317L, and wild-type amplicons. Plasmids encoding cDNA for wild-type, T315I (50% or 100% mutant), or
  • F317L Bcr-Abl were used as templates in a PCR reaction that included SEQ ID NOS: 3 and 4, and the T315I mutant-specific and anchor probes shown in SEQ ID NOS: 5 and 6.
  • the assay correctly distinguished the PCR products containing the T315I mutation from those with F317L mutation or wild-type sequence.
  • the actual difference between the T m of the T315I mutant and wild-type alleles is greater than predicted.
  • the method also permits detection of the T315I mutant in clinical samples.
  • a blinded analysis of 10 human samples (peripheral blood) (genotypes included wild-type x 3, M244V x 1, Y253F x 1, F311L x 1, M351T x 2, T315I x 1, F359V x 1) was performed.
  • FIG. 5 and 7 only samples with a known Bcr-Abl T315I mutation was positive.
  • CML patient specimens containing only 25-50 total Bcr-Abl transcripts have been genotyped.
  • This example describes methods used to determine the sensitivity and specificity of the methods described in Examples 2 and 3.
  • Wild-type Bcr-Abl plasmid was diluted with varying amounts of Bcr-Abl T315I plasmid (0-100%) and used as a template in a PCR reaction that included the primers shown in SEQ ID NOS: 3 and 4, and the T315I mutant specific and anchor probes shown in SEQ ID NOS: 17 and 6.
  • PCR amplifications and melting curve generation and analysis were performed as described in Example 3.
  • the method reliably identified samples containing > 5% of the T315I mutant allele. Therefore, disclosed methods and probes can be used to reliably detect the T315I mutation when the mutant allele frequency exceeds 5-10% of total ABL transcripts.
  • the sensitivity of the of the methods described was also determined using a dilution series of known copy numbers of Bcr-Abl transcript obtained from the Bcr-Abl positive cell line K562 diluted into RNA obtained from the Bcr-Abl negative cell line HL60.
  • the number of Bcr-Abl copies tested is shown in the second column of Table 5. With reference to Table 5, 4000, 400, 40, 4, or 0 copies of the Bcr-Abl transcript were placed in individual PCR tubes. One ⁇ g of RNA was converted to cDNA via reverse transcription. The cDNA was then used as the template for amplification of the Bcr-Abl transcript using the alternate long range PCR (LR-PCR) protocol described above.
  • LR-PCR alternate long range PCR
  • the PCR products from the LR-PCR were electrophoresed on a 1 % agarose gel, stained, and visualized by UV-transillumination. In all cases (with the exception of the 0 copy number) the assay was able to amplify Bcr-Abl transcripts.
  • HL60 RNA was also tested for the amplification of wild-type AbI sequence during the nested FRET assay and no product was detected. This example demonstrates that Bcr-Abl can be amplified at least as low as 4 copies per reaction.
  • the disclosed assay was further validated for specificity in identifying the T315I mutation.
  • Genomic DNA was extracted from blood obtained from twelve healthy donors (i.e. donors without a known Bcr-Abl translocation). Fifty ng of DNA was used as the template for LR-PCR amplification of Bcr-Abl. The resulting PCR product was used in the nested FRET assay. As shown in Table 6, no positive results for the presence of Bcr-Abl, or the T315I mutation were registered. This demonstrates the specificity of the disclosed assay. Table 6: Specificity of FRET T315I assay using genomic DNA samples
  • the lower limits of detection of the disclosed assay for the identification of T315I containing transcripts was determined using a dilution series of known copy numbers of the T315I mutant Bcr-Abl transcript obtained from BaF3 cells transduced with T315I mutant Bcr-Abl diluted into known copy numbers of the wild-type Bcr-Abl transcript obtained from BaF3 cells transduced with wild-type Bcr-Abl.
  • Table 7 4000, 400, 40, 4, or 0 copies of the T315I mutant Bcr-Abl transcript were placed in individual PCR tubes. In all cases (with the exception of the 0 copy number) the assay was able to amplify Bcr-Abl transcripts.
  • This example demonstrates that T315I mutant Bcr-Abl can be amplified at least as low as 4 copies per reaction.
  • RNA obtained from BaF3 cells transduced with mutant T315I Bcr-Abl was separately diluted into RNA obtained from HL60 cells to give 200 copies of Bcr-Abl (either wild-type or T315I) per ⁇ g RNA.
  • the resulting wild-type and T315I mutant RNA samples at 200 copies were mixed together to give 50%, 20%, 10%, and 5% mutant percentages (see Table 8, column 1). This RNA was used as a template for reverse transcription and then amplified via LR-PCR.
  • the disclosed methods were further validated using two plasmids encoding T315I mutant Bcr-Abl and wild-type Bcr-Abl respectively, two RNA obtained from BAF3 cell lines encoding T315I mutant Bcr-Abl and wild-type Bcr-Abl respectively, and forty patient samples (including three T315I patients) were tested for the T315I mutation. As shown in Table 9, the disclosed assay correctly identified the presence or absence of the T315I mutation. This result was confirmed by sequencing.
  • Example 5 Kits This example describes particular kits that can be used to determine if one or more
  • Bcr-Abl mutations such as a mutation at amino acid 315 or 317, is present in a biological sample.
  • a kit includes at least one probe disclosed herein, such as a probe that includes a fluorophore and a nucleic acid sequence consisting of the nucleic acid sequence shown in any of SEQ ID NOS: 5-9.
  • a kit can include a pair of oligonucleotide probes: a first donor oligonucleotide probe and a first acceptor oligonucleotide probe, wherein the probes hybridize to adjacent regions of a Bcr-Abl nucleic acid sequence that includes codon 315 (and in some examples also codon 317).
  • a kit includes probes consisting of the nucleic acid sequence shown in SEQ ID NOS: 5 and 6, SEQ ID NOS: 17 and 6, SEQ ID NOS: 7 and 8, or SEQ ID NOS: 9 and 8 (wherein the probe includes a fluorophore).
  • the kits further include PCR primers that can amplify a segment of Bcr-Abl.
  • the kit can include SEQ ID NOS: 1-2, SEQ ID NOS: 1 and 16, SEQ ID NOS: 3-4, or SEQ ID NOS: 1-4 and 16, in addition to the probes described above.
  • kits can include one or more components for amplifying a Bcr-Abl nucleic acid molecule, such as a thermostable DNA polymerase, dNTPs, or combinations thereof.
  • a thermostable DNA polymerase such as a thermostable DNA polymerase, dNTPs, or combinations thereof.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Pathology (AREA)
  • Analytical Chemistry (AREA)
  • Molecular Biology (AREA)
  • Physics & Mathematics (AREA)
  • Wood Science & Technology (AREA)
  • Zoology (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Hematology (AREA)
  • Biochemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Genetics & Genomics (AREA)
  • Oncology (AREA)
  • Hospice & Palliative Care (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • General Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

La présente invention concerne des sondes qui peuvent être utilisées pour détecter les mutations de domaine kinase AbI, telles que les mutations des acides aminés 315 et 317. La présente invention concerne également des trousses qui incluent de telles sondes ainsi que des procédés permettant d'utiliser les sondes pour détecter les mutations Bcr-Abl. De tels procédés peuvent être utilisés pour gérer cliniquement les patients CML ou Ph+ ALL.
PCT/US2007/078059 2006-09-11 2007-09-10 Sondes et procédés permettant de détecter des mutations bcr-abl résistant au gleevec WO2008033776A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US84386406P 2006-09-11 2006-09-11
US60/843,864 2006-09-11

Publications (2)

Publication Number Publication Date
WO2008033776A1 true WO2008033776A1 (fr) 2008-03-20
WO2008033776B1 WO2008033776B1 (fr) 2008-05-22

Family

ID=38917790

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/078059 WO2008033776A1 (fr) 2006-09-11 2007-09-10 Sondes et procédés permettant de détecter des mutations bcr-abl résistant au gleevec

Country Status (1)

Country Link
WO (1) WO2008033776A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP2012034688A (ja) * 2010-07-12 2012-02-23 Arkray Inc ａｂｌ遺伝子多型の検出用プローブおよびその用途
EP2483427A1 (fr) * 2009-09-29 2012-08-08 National University of Singapore Procédé clinique de génotypage de grands gènes pour des mutations qui provoquent potentiellement une maladie
WO2016060227A1 (fr) * 2014-10-17 2016-04-21 東洋鋼鈑株式会社 Procédé de détection de mutation liées à la résistance à l'inhibiteur de bcr-abl et procédé d'acquisition de données permettant de prédire la résistance à l'inhibiteur de bcr-abl à l'aide dudit procédé

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002102976A2 (fr) * 2001-06-14 2002-12-27 The Regents Of The University Of California Mutations dans la tyrosine kinase bcr-abl associees a la resistance a sti-571

Patent Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2002102976A2 (fr) * 2001-06-14 2002-12-27 The Regents Of The University Of California Mutations dans la tyrosine kinase bcr-abl associees a la resistance a sti-571

Non-Patent Citations (5)

* Cited by examiner, † Cited by third party
Title
CHU SU ET AL: "Detection of BCR-ABL kinase mutations in CD34+ cells from chronic myelogenous leukemia patients in complete cytogenetic remission on imatinib mesylate treatment.", BLOOD 1 MAR 2005, vol. 105, no. 5, 1 March 2005 (2005-03-01), pages 2093 - 2098, XP002464828, ISSN: 0006-4971 *
HEINRICH MICHAEL C ET AL: "A novel, high-throughput assay for detection of ABL T315I mutations.", BLOOD, vol. 108, no. 11, Part 1, November 2006 (2006-11-01), & 48TH ANNUAL MEETING OF THE AMERICAN-SOCIETY-OF-HEMATOLOGY; ORLANDO, FL, USA; DECEMBER 09 -12, 2006, pages 661A, XP002464826, ISSN: 0006-4971 *
HUGHES TIMOTHY ET AL: "Monitoring CML patients responding to treatment with tyrosine kinase inhibitors: review and recommendations for harmonizing current methodology for detecting BCR-ABL transcripts and kinase domain mutations and for expressing results.", BLOOD 1 JUL 2006, vol. 108, no. 1, 1 July 2006 (2006-07-01), pages 28 - 37, XP002464831, ISSN: 0006-4971 *
KREUZER K -A ET AL: "Preexistence and evolution of imatinib mesylate-resistant clones in chronic myelogenous leukemia detected by a PNA-based PCR clamping technique.", ANNALS OF HEMATOLOGY, vol. 82, no. 5, May 2003 (2003-05-01), pages 284 - 289, XP002464825, ISSN: 0939-5555 *
SOVERINI SIMONA ET AL: "Contribution of ABL kinase domain mutations to imatinib resistance in different subsets of Philadelphia-positive patients: by the GIMEMA Working Party on Chronic Myeloid Leukemia.", CLINICAL CANCER RESEARCH : AN OFFICIAL JOURNAL OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH 15 DEC 2006, vol. 12, no. 24, 15 December 2006 (2006-12-15), pages 7374 - 7379, XP002464827, ISSN: 1078-0432 *

Cited By (7)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2483427A1 (fr) * 2009-09-29 2012-08-08 National University of Singapore Procédé clinique de génotypage de grands gènes pour des mutations qui provoquent potentiellement une maladie
EP2483427A4 (fr) * 2009-09-29 2013-03-06 Univ Singapore Procédé clinique de génotypage de grands gènes pour des mutations qui provoquent potentiellement une maladie
JP2012034688A (ja) * 2010-07-12 2012-02-23 Arkray Inc ａｂｌ遺伝子多型の検出用プローブおよびその用途
EP2407560A3 (fr) * 2010-07-12 2012-03-21 Arkray, Inc. Sonde pour la détection de polymorphisme dans le gène abl, et utilisation associée
US9085803B2 (en) 2010-07-12 2015-07-21 Arkray, Inc. Probe for detection of polymorphism in ABL gene, and use thereof
WO2016060227A1 (fr) * 2014-10-17 2016-04-21 東洋鋼鈑株式会社 Procédé de détection de mutation liées à la résistance à l'inhibiteur de bcr-abl et procédé d'acquisition de données permettant de prédire la résistance à l'inhibiteur de bcr-abl à l'aide dudit procédé
JP2016077221A (ja) * 2014-10-17 2016-05-16 東洋鋼鈑株式会社 Ｂｃｒ−ａｂｌ阻害剤耐性関連変異の検出方法及びこれを用いたｂｃｒ−ａｂｌ阻害剤耐性を予測するためのデータ取得方法

Also Published As

Publication number Publication date
WO2008033776B1 (fr) 2008-05-22

Similar Documents

Publication Publication Date Title
KR100431421B1 (ko) 형광표지된올리고뉴클레오타이드프로브의용액중에서의켄칭방법
KR102358734B1 (ko) 상이한 검출 온도를 이용한 타겟 핵산 서열의 검출
KR101376359B1 (ko) 표적 서열 강화
US20110151444A1 (en) Method for detection of an rna molecule, a kit and use related therefor
CN103459612A (zh) 用于检测野生型群体中的核酸突变体的方法和试剂盒
KR102371222B1 (ko) 표적핵산 증폭방법 및 표적핵산 증폭용 조성물
JP2003111599A (ja) 分子エネルギー輸送標識を有する核酸増幅オリゴヌクレオチドおよびそれに基づく方法
US20160076082A1 (en) A method for blocking polymerase extension of 3 prime dna ends by stem-loop structure
CN107208139B (zh) 与靶核酸序列有关的信号的分辨
US20140295422A1 (en) Quantitative Real-Time PCR Assay Using FRET Dual-labeled Primers
AU2018277210B2 (en) Multiplex PCR detection of ALK, RET, and ROS fusions
EP2459744A1 (fr) Procédé de quantification normalisée d'acides nucléiques basé sur la ligature
WO2010066407A1 (fr) Détection d'acides nucléiques en temps réel sans nucléase
CA2917920A1 (fr) Compositions et procedes d'analyse multiplex d'acides nucleiques nras et braf
WO2024012467A1 (fr) Procédé de pcr par fluorescence pour la détection d'acides nucléiques utilisant la combinaison de la polymérisation activée par amorce et sondes
WO2008033776A1 (fr) Sondes et procédés permettant de détecter des mutations bcr-abl résistant au gleevec
WO2009018225A2 (fr) Contrôle positif interne pour dosages d'acide nucléique
JP7432610B2 (ja) 水痘帯状疱疹ウイルスを増幅または検出するための組成物および方法
CN104395468A (zh) 检测hla-a*24:02的方法及检测试剂盒
WO2014158628A1 (fr) Compositions et procédés d'analyse de molécules d'acide nucléique
US20160273036A1 (en) Photoinduced electron transfer (pet) primer for nucleic acid amplification
US9267178B2 (en) Detection and differentiation of demodex mites
KR20220131709A (ko) 가이드 프로브 및 클램핑 프로브를 이용한 표적핵산 증폭방법 및 이를 포함하는 표적핵산 증폭용 조성물
WO2020221915A1 (fr) Utilisation de ditp pour une amplification préférentielle/sélective d'arn par rapport à des cibles d'adn sur la base de la température de séparation de brin
WO2020037290A1 (fr) Réactifs, mélanges, kits et procédés d'amplification d'acides nucléiques

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application

Ref document number: 07814790

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07814790

Country of ref document: EP

Kind code of ref document: A1