WO2008030858A2

WO2008030858A2 - Use of esterase expressed in plants for the control of gram-negative bacteria

Info

Publication number: WO2008030858A2
Application number: PCT/US2007/077614
Authority: WO
Inventors: Dean W. Gabriel; Joseph D. Reddy
Original assignee: Integrated Plant Genetics, Inc.
Priority date: 2006-09-05
Filing date: 2007-09-05
Publication date: 2008-03-13
Also published as: WO2008030858A3

Abstract

The present invention provides various methods of using esterase to control gram-negative bacteria. The present invention also provides transgenic plants expressing esterase and methods of their production and use. The present invention finds applications in many fields, including plant husbandry, water purification, food safety, bioterrorism prevention, and cut flower maintenance.

Description

USE OF ESTERASE EXPRESSED IN PLANTS FOR THE CONTROL OF GRAM-NEGATIVE BACTERIA

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims priority from U.S. Provisional Patent Application No. 60/824,480, filed September 5, 2006, the entire disclosure of which is hereby expressly incorporated herein by reference in its entirety for all purposes. The entire disclosure includes the specification, claims, figures and sequence listings.

FIELD OF THE INVENTION

[0002] The present invention relates to methods for killing or suppressing growth of Gram- negative bacteria that infect, infest or cause disease in plants, including pathogenic, saprophytic and opportunistic microbes that cause disease in plants and food borne illness in people or in animal feed.

BACKGROUND OF THE INVENTION

[0003] All publications and patent applications discussed and/or cited herein are incorporated by reference to the same extent as if each individual publication or patent application was specifically and individually indicated to be incorporated by reference.

[0004] The following description includes information that may be useful in understanding the present invention. It is not an admission that any of the information provided herein is prior art or relevant to the presently claimed inventions, or that any publication specifically or implicitly referenced is prior art.

[0005] Plants grown for commercial agricultural purposes are nearly always planted as uniform monocultures; that is, single varieties of a given crop are mass-produced by vegetative propagation or by seed and are planted on a very large scale. When a pathogen or pest arrives that can overcome the natural disease or pest resistance of a given variety, severe economic losses can occur because of the practice of monoculture, sometimes involving loss of the entire crop in a given area. Control of diseases and pests using massive applications of agricultural chemicals is expensive, environmentally unsound and often impossible. For example, citrus canker disease, caused by a quarantined Gram-negative bacterial pathogen, Xanthomonas citri, has spread uncontrollably throughout Florida. As a second example, the Gram-negative bacterial pathogen Ca. Liberibacter asiaticus is a USDA Select Agent (potential bioterrorist agent; http://www.aphis.usda.gov/programs/ag selectagent/ag bioterr toxinslist.html that was introduced into Florida in 2005 and has also spread uncontrollably throughout Florida. This pathogen threatens world citrus production. As a third example, the Gram negative bacterial pathogen Ralstonia solanacearum Race 3 Biovar 2 has been introduced into the U.S. numerous times and is such a serious threat to U.S. potato production that it is also a listed USDA Select Agent. This pathogen has been introduced into the U.S. by infected geranium plants, but asymptomatically, so that detection of the pathogen is delayed. As a final example, numerous human deaths have been reported due to the Gram-negative bacterium Escherichia coli , which is capable of internally infecting certain crop plants such as spinach, alfalfa sprouts and mung bean sprouts. Conventional plant breeding to control such diseases of plants or food-borne contamination has proven to be impossible. There is therefore an urgent and pressing need for gene engineering techniques to provide plants, including carrier plants such as geraniums, with disease and pest resistance against diseases and pests that they naturally are susceptible to, or tolerant of.

[0006] A wide variety of antibacterial and antifungal proteins have been identified and their genes isolated from both animals and plants. Because of the major differences in the structures of fungal. Gram-positive bacterial and Gram-negative bacterial cell walls, many of these proteins attack only fungi or Gram positive bacteria, which have cell walls that are exposed directly to the environment. Gram negative bacteria do not have cell walls that are exposed directly to the environment. Instead, their cell walls are enveloped and protected by a unique outer membrane structure, the lipopolysaccharide (LPS) barrier, which provides a very effective additional barrier to protect their cell walls against most eukaryotic defenses, particularly plant defenses. The majority of plant pathogenic bacteria are Gram negative. The great majority of the pathogens listed by the USDA as Select Agents are bacterial pathogens, and all of these are Gram negative. [0007] The LPS provides an effective defense to Gram negative bacteria against externally produced enzymes that can effectively degrade the bacterial cell wall (also called the murein layer), including the relatively thick but exposed cell walls of Gram-positive bacteria and fungi. For example, lysozymes are antimicrobial enzymes that can directly lyse and kill bacteria. Lysozymes are found in mammalian cells, insects, plants, bacteria and viruses that break bacterial and fungal cell walls, specifically cleaving bonds between the amino sugars of the recurring muropeptides (e.g., C-I of N-acetylmuramic acid and C-4 of N- acetylglucosamine) of microbial cell walls, but lysozymes are unable to reach the relatively thin cell walls of Gram negative bacteria because of the LPS (Ibrahim et al. 2001 and references therein). Some lysozymes also are pleiotropically lytic proteins, meaning they are active in killing Gram-negative and Gram-positive bacteria, but this additional lytic activity is not due to the enzymatic action of lysozyme, but specifically due to a short, linear peptide fragment that is a degradation product of some lysozymes; it is the linear degradation product of the lysozyme that breaches the LPS barrier and the cell wall, reaching the inner membrane and permeabilizing the inner membrane, resulting in lysis (During et al, 1999; Ibrahim et al. 2001). However, this linear peptide activity does not work well in plants (see below).

[0008] Many antimicrobial proteins demonstrated to directly kill Gram-negative bacteria are small peptides (proteins of less than 50 amino acids in length) that are amphipathic and positively charged, so that they are attracted to the negatively charged Gram negative outer membrane, are small enough to penetrate the LPS, and are also small enough to penetrate the relatively thin Gram negative cell wall. Following penetration of both the LPS and cell wall barriers, these peptides usually act to permeabilize the inner membrane, directly causing cell death.

[0009] The largest described group by far of these antimicrobial peptides are linear (eg., cccropins, attacins and magainins). However, linear peptides are not found naturally in plants and most linear peptides are rapidly degraded by plant proteases. For example, cecropin B is rapidly degraded when incubated with intercellular plant fluid, with a half-life ranging from about three minutes in potato to about 25 hours in rice (Owens & Heutte, 1997). Transgenic tobacco plants expressing cecropins have only slightly increased resistance to (Gram- negative) Pseudomanas syringae pv. tabaci, the cause of tobacco wildfire (Huang et al 1997). Synthetic cecropin analogs Shiva- 1 and SB-37, expressed from transgenes in potato plants, only slightly reduced bacterial infection caused by (Gram-negative) Erwinia carotovora (Λrce et al 1999). Transgenic apple expressing the SB-37 peptide showed only slightly increased resistance to (Gram-negative) E. amylovora in field tests (Norelli et al 1998). Similarly, transgenic potatoes expressing attacin showed resistance to bacterial infection by E. carotovora (Arce et al 1999) and transgenic pear and apple expressing attacin genes have also shown slightly enhanced resistance to E. amylovora (Norelli et al 1994; Reynoird et al 1999). Attacin E was also found to be rapidly degraded by plants (Ko et al 2000). Transgenic tobacco plants expressing a synthetic magainin analog that had been modified to be less sensitive to extracellular plant proteases were only slightly resistant to the bacterial pathogen /: carotovora (Li et al 2001).

[0010] The disulfide-linked peptides (e.g. defensins, prophenins and thaumatins) show more promise of stability when expressed in plants, but resistance has either been weak, not demonstrated, or cytotoxicity issues have emerged. Hen egg-white lysozyme genes (with lytic ability) have been used to confer weak Gram-negative bacterial disease resistance to transgenic tobacco plants (Trudel et al 1995; Kato et al 1998). Bacteriophage T4 lysozyme has also been reported to slightly enhance resistance in transgenic potato against E. carotovora (During et al 1993; Ahrenholz et al., 2000) and in transgenic apple plants against E. amylovora (Ko 1999). However, as mentioned previously, the action of lysozyme against Gram-negative bacteria is specifically due to a short lytic peptide fragment (Ibrahim et al. 2001) that is presumably sensitive to protease. Thaumatins exhibit the widest range of antimicrobial activity so far characterized, but also exhibit potent cytotoxic effects on eukaryotic cells (Taguchi et al 2000).

[0011 ] Plants produce a diverse array of low molecular weight, antimicrobial compounds, including phytoanticipins, which are pre-formed, and phytoalexins, which are synthesized in response to pathogen attack (Grayer and Harborne 1994; Osbourne 1996; Harborne 1999; Hamnierschmidt 1999; Dixon 2001). The importance of these compounds in general plant defense against microbial attack has been demonstrated by the increased susceptibility of mutant plants impaired in production of phytoanticipins or phytoalexins (Frey et al. 1997; Papadopoulou et al. 1999; Glazebrook and Ausbel 1994). In addition, several studies have demonstrated that phytoalexins and phytoanticipins can be present in locally sufficient concentrations to inhibit growth of certain pathogenic fungi and bacteria (Del Sorbo et al. 2000; Pierce el al. 1996; Schoonbek et al. 2001; McNally et al. 2003). [0012] The phytoalexin and phytoanticipin antibiotics are readily capable of penetrating bacterial cell walls and inner membrane of either Gram negative or Gram positive bacteria, but have a difficult time penetrating the LPS barrier that is found only in Gram negative bacteria and completely surrounds the bacterial cell wall and inner membrane. Indeed, and by contrast with bacterial pathogens of animals, almost all bacterial pathogens of plants are Gram negative, and this protective barrier is probably critical to the ability of bacteria to attack most plants. Mutations affecting the structure of the LPS of a (Gram-negative) bacterial plant pathogen of citrus caused the pathogen to die out very quickly on citrus (Kingsley et al., 1993), indicating the importance of the LPS structure in evading specific plant phytochemical defenses. In addition, mutations affecting multidrug efflux in Gram- negative bacteria cause the bacteria to die out rapidly in plants, highlighting the role of low molecular weight plant defense compounds (phytoalexins) in plant defense, and further indicating the importance of the intact LPS of Gram-negative in resisting plant defense compounds (Reddy et ah, 2007). Multidrug efflux requires an intact LPS for function.

[0013] Very recently, certain recombinant "lipase/esterase enzymes" were discovered that could efficiently destroy the soluble Lipid A found in the supernatants of Escherichia coli cultures following the removal of living E. coli cells by centrifugation (Ahn et al. 2004, incorporated in its entirety by reference). Lipid A is a major component of LPS, which is also called "endotoxin'^" because of its powerful effects in provoking the animal immune response. Ahn et al. 2004 describe their discovery as a method useful in degrading lipidA portion of the LPS that is found as a contaminant in cell free protein extracts of E. coli cell cultures that are intended for injection into humans or animals, thereby inactivating the endotoxin effect of the LPS. Such E. coli cultures are often used in biotechnology to manufacture recombinant proteins, and when the protein is to be injected into animals, all traces of the endotoxin activity in eliciting an immune response must be removed or degraded; otherwise, the contaminating endotoxin can provoke life threatening anaphylactic shock or sepsis. Nowhere is it demonstrated or suggested that "lipase/esterase enzymes" can be used to inhibit growth of, or to kill, living Gram negative bacteria, such as E. coli. Indeed, Gram negative bacteria such as E. coli are often used to express or over express lipases to the point where such expressed lipases confer a selective advantage to the bacteria and allow the bacteria to grow on lipids as sole carbon source (for example, refer Jakab et al. 2003). Lipases were unknown, until the present discovery, to penetrate the thick polysaccharide barrier of the LPS that protects the Lipid A portion of the LPS in living cells. Furthermore, lipases were unknown and have not been used, until the present discovery, to detrimentally affect, degrade or compromise the intact LPS of living Gram negative bacteria in order to facilitate antibiotic or other protein entry into the cell in order to kill Gram negative bacteria.

[0014] It is likely that lipases/esterases will have an additional effect of degrading certain bacterial cell to cell signaling molecules (ie., "quorum sensing" molecules) that help regulate pathogenicity and contain ester bonds, such as 12-methyl-tetradecanoic acid produced by Xylella (Simionato et al., 2007), the acyl homoserine lactones produced by Pseudomonas, Vibrio and Agrobacterium and the 3-hydroxylpalmitic acid methyl ester produced by Ralstonia solanacearum (Zhang, 2003; Shinohara et al., 2007) and references therein. Not all quorum sensing molecules that help regulate pathogenicity contain ester bonds, however, and therefore a lipase/esterase would not be expected to affect pathogenicity of Xanlhomonas: instead, the Xanihomonas quorum sensing molecule is a fatty acid, cis-11- methyl-2-dodecenoic acid (Wang et al., 2004). In any case, nowhere in the literature is the effect of lipases/esterases taught or suggested to compromise the LPS barrier, resulting in bacterial cell death as a result of the combined action of esterases and natural plant defense compounds, or additional enzymes or proteins, as provided by the present invention.

[0015] Nonenzymatic, antimicrobial peptides are abundant in nature but of limited value in transgenic plants, primarily due to degradation by plant proteases. Many are also highly toxic substances that can lyse or kill eukaryotic cells. In addition, some Gram-negative bacteria are resistant to antimicrobial peptides even in culture media, (Gutsmann et al., 2005). This may help explain why plant pathogenic bacteria can overcome host plant defensins. Safer, more efficacious and particularly, nontoxic methods are needed that are capable of enhancing a plant's natural defenses.

SUMMARY OF THE INVENTION

[0016] It has now been found by the present inventors that commercially available lipases/esterases can compromise the integrity of the LPS barriers of certain Gram-negative bacteria in culture, and that when coupled with certain detergents, lytic proteins such as certain lysozymes or natural plant defense compounds such as berberine chloride, can allow these other enzymes or chemicals to kill or strongly inhibit the growth of Gram-negative bacteria in culture. Thus it has been discovered that lipases/esterases can promote an inhibitory or lethal effect on Gram-negative bacteria in culture medium, and the effect is shown in the examples provided in this invention to be dependent on other lytic or toxic compounds in the surrounding medium, indicating that the lipase is compromising the integrity of the bacterial LPS barrier in living cells.

[0017] Further, the present inventors have: 1) cloned a functional bovine (Bos taurus) pregastric esterase (PGE) gene; 2) cloned a functional nematode (Caenorhabditis elegans) lipase gene; 3) cloned a functional bacterial (Lactococcus lactis ssp. cremoris) lipase gene; 4) operably fused all three esterase genes separately to plant promoters in gene expression cassettes; 5) expressed functional, enzymatically active, bovine PGE, nematode lipase and bacterial lipase in multiple different plants, both monocot and dicot, including tomato, tobacco, geranium and rice, and 6) resulting in enhanced disease resistance of said plants, which are now able to kill or inhibited growth of many different Gram-negative bacteria infecting said transgenic plants. Thus it has been discovered that lipases, PGE, and more generally, esterases, may be functionally expressed in both monocot and dicot plants to enhance a plant^'s natural disease resistance mechanisms.

[0018] This invention therefore provides both general and specific methods for strongly enhancing disease resistance in plants against Gram-negative bacteria, whether said bacteria are plant pathogens or not, comprising introducing into the plant a gene expression cassette operably fusing: 1) a promoter that functions in plants; 2) an esterase, whether a lipase, PGE or another esterase gene or gene fragment that functions to express active lipase, PGE or another esterase enzyme in plants; 3) a transcriptional terminator region that functions in plants; and 4) obtaining expression of said gene for lipase, PGE or production of another esterase in said plants.

[0019] In one example, the above expression cassette containing a lipase, PGE or another esterase gene or gene fragment that functions to express active lipase, PGE or another esterase in plants has a plant secretion signal sequence that functions in plants, operably fused to the amino terminus of the esterase gene or gene fragment.

[0020] The present invention further provides nucleic acid molecules, operably linked to one or more expression control elements, including vectors comprising the isolated nucleic acid molecules. The invention further includes host cells transformed to contain the nucleic acid molecules of the invention and methods for producing a peptide, polypeptide or protein comprising the step of culturing a host cell transformed with a nucleic acid molecule of the invention under conditions in which the protein is expressed.

[0021] This invention further provides vectors comprising the nucleic acid constructs of the present invention, as well as host cells, recombinant cells and transgenic tissues and organisms comprising the vectors of the present invention. For example, this invention provides such cells and transgenic tissues and organisms that are hemizygotic, heterozygotic or homozygotic for the nucleic acid constructs, wherein if the organism is a plant it can be monoploid, diploid or polyploid. It is an object of the present invention to provide such cells and transgenic tissues and organisms wherein they express a single copy or multiple copies of one or more esterase proteins, or esterase-like ortholog protein products of the present invention. Cells or transgenic tissues and organisms which express multiple copies of one of the esterase proteins, or esterase-like proteins, mutant esterase or esterase-like proteins, or esterase or esterase-like ortholog proteins, or which express more than one of the esterase or esterase-like proteins, mutant esterase or esterase-like proteins, or esterase or esterase-like ortholog proteins, or which express a translational or transcriptional gene fusion carrying an esterase or esterase-like protein may be desirable, for example, to produce broad-spectrum resistance or tolerance to a variety of different Gram negative bacteria, whether pathogens, opportunistic or saprophytic.

[0022] Gram-negative bacteria are in particular bacteria with an LPS, including but not limited to the following genera: Agrobacterium, Burkholderia, Candidatus Liberibacter, Erwinia, Escherichia, Pseudomonas, Ralstonia, Salmonella, Shigella, Xanlhomonas and Xylella.

[0023] According to the present invention it is possible to impart into plants resistance, or increased resistance, to Gram-negative bacteria using nontoxic esterase enzymes, including lipases, that are not in themselves bactericidal, including, but not limited to, the above named pathogenic genera. There is a particular demand for the generation of such nontoxic resistance in crop plants, both agronomic as well as horticultural, both for food crop use as well as ornamental. There is also a particular demand for nontoxic methods to eliminate of Gram-negative bacteria that are pathogenic to humans and animals that may be carried asymptomatically in some plants, such as fresh alfalfa and bean sprouts, lettuce and spinach. There is also a particular demand for the elimination of Gram-negative bacteria that may be carried asymptomatically in some plants, such as ornamental plants, including geraniums, but that can cause disease on other plants, such as crop plants, including potatoes. There is also particular demand for the elimination of USDA Select Agents that may be carried in crop plants such as citrus or geranium. There is also a particular demand for nontoxic methods to eliminate Gram-negative bacteria that can cause human and animal diseases and that may be carried asymptomatically in some plants, such as fresh vegetables, including alfalfa sprouts, bean sprouts, lettuce, spinach and carrots. There is also particular demand for the extension of shelf life of cut flowers, due to attack by Gram-negative bacteria that are saprophytic.

[0024] The present invention therefore also relates to a method for preparing transformed plant cells and plants, including seeds and all parts of plants, having increased resistance or immunity to Gram-negative bacterial infection or infestation, whether plant pathogenic or not. This method provides one or more esterase genes, esterase gene fusions, and the introduction of these genes and fusions into the genome of plant cells, followed by introduction of said genes into plant cells, regeneration of whole transformed plants from said cells, providing transgenic plants with resistance or immunity to disease, infection or infestation by Gram-negative bacteria. This invention describes the use of esterase genes to control disease, infection and infestation in transgenic plants to: 1) control diseases otherwise affecting said transgenic plants, 2) to eliminate said transgenic plants from being carriers of diseases that affect other plants or animals (eg., nosocomial infestations or in animal feed), and 3) to prolong the shelf life of said transgenic plants if said plants are detached from roots (eg., cut flowers, grafting).

[0025] Multiple methods are used by those skilled in the art for introducing esterase genes into plants or plant cells of dicots or monocots, including, but not limited to, use of Agrobacterium tumefaciens and various Ti-plasmid variations, use of Rhizobium spp, Sinorhizobium spp or Mesorhizobium spp. (Broothaerts et ah, 2005) and various Ti-plasmid variations, use of electroporation, particle bombardment, fibrous silicon carbide whiskers or nonfibrous silicon carbide powder. Multiple methods are available to those skilled in the art for the regeneration of fully transgenic plants, including both dicots and monocots.

[0026] The invention further provides nucleic acid probes for the detection of expression of the esterase or esterase-like proteins of the present invention, or mutants, or homologs, or orthologs thereof, in for example, plants which either have been genetically altered to express at least one of said proteins or which may naturally express esterase or esterase-like proteins, or mutants, or homologs, or orthologs thereof.

[0027] The present invention provides for the treatment of Gram negative bacteria with a \ ariety of lipases results in reducing the protective effectiveness of the lipopolysaccharide outer membrane.

[0028] The present invention also provides for the expression of bovine pregastric esterase in plants resulting in the production of enzymatically active esterase that effectively inhibits the growth of all tested Gram negative pathogens.

[0029] The present invention also provides for the expression of esterase in plants as an excellent method to enhance the disease resistance of plants, either alone or in combination with additional lytic peptides, proteins or antimicrobial enzymes, including suppressing growth of Gram negative bacteria that may be carried by plants without symptoms but which are important pathogens of animals, other plant species, or which may contaminate food and feed.

BRIEF DESCRIPTION OF THE FIGURES

[0030] Figure 1 shows a "snapshot" of the optical densities after 16 hrs. of growth of liquid cultures of Λ^' pelargonii grown in the presence of porcine pancreatic lipase (PL), berberine chloride (Berb), both PL and Berb together, and in the same nutrient broth without the PL or Berb additives (Control). The cultures in the tubes containing PL or Berb, but not both, continue to grow slowly, while the culture in the tube containing both PL and Berb remains static. These cells are dead due to the combined action of lipase and the phytoalexin berberine chloride.

[0031 ] Figure 2 shows the phenol red lipase/esterase assay using either Commercial porcine pancreatic lipase (SL) or plant expressed bovine pregastric esterase (768WI). In this Figure, the first tube on the left (Buffer) contains phenol red buffer and Tween 20 (the dark red color appears dark in this black and white figure); the second tube to the right (SL) has 4 Units of Sigma porcine pancreatic lipase added (the bright yellow color appears light); the third tube to the right (731) has a twenty microliter droplet of a crude tomato plant leaf extract from leaves inoculated 4 days earlier with GV2260 carrying "empty" expression vector pIPG731 (the dark red color appears dark), and the fourth tube to the right (labeled 768) has a twenty microliter droplet of crude tomato plant leaf extract from leaves inoculated four days earlier with GV2260 carrying cloned bovine pregastric esterase expressed in the pIPG768 (the bright yellow color appears light). Tomato leaf tissue particles may be seen floating in the third and fourth tubes to the right. In these assays, only the porcine lipase positive control and plant tissue inoculated with pIPG746 (cloned bovine PGE) exhibited the color change from red (dark in this black and white figure) to bright yellow (light in this black and white figure) in the indicator tubes. The photo was taken 16 hrs. after start of the assay.

[0032] Figure 3 shows X. pelargonii inoculated on both sides of the mid-vein of a pepper leaf and the effect of bovine PGE with the P 12 plant secretion signal on the bottom half of the leaf (labeled GV2260/BL746). Inoculated within the solid white lines were A. tumefaciens GV2260 carrying either pIPG746 (bottom half) or empty vector (top half). Inoculated within the broken white lines 48 hrs later (to give time for transient gene expression) was X. pelargonii strain CHSC. The photo was taken 48 hrs. after inoculation with X. pelargonii

[0033] Figure 4 shows 0.8% agarose gel loaded with amplified PCR products from representative nontransgenic and transgenic plants of three indicated dicots and one monocot carrying the bovine PGE gene. The PCR primers used to amplify the bovine PGE gene were: IPG952 5'-CTCAGCTGCATACGCCTTCC (SEQ ID NO.: 1) and IPG953 5'- ACAGGTCATTGTCAGCACTCC (SEQ ID NO.: 2). From left to right: M, 1 kb ladder; 1, NT tomato var. Micro-Tom; 2 and 3, pIPG768 in tomato var. Micro-Tom; 4, NT tobacco var. Xanthi; 5 and 6, pIPG852 in tobacco var. Xanthi; 7, NT geranium var. Avenida; 8 and 9, pIPG774 in geranium var. Avenida; 10, rice var. TP-309; 1 1 and 12, pIPG774 in rice var. TP- 309.

[0034] Figure 5 shows typical symptoms of bacterial blight on a nontransgenic Florist's geranium {Pelargonium X hortorum) cultivar "Avenida" leaf inoculated with X. pelargonii cells sprayed on the leaves at a concentration of 10⁷ colony forming units per milliliter (cfu/ml) and also inoculated using scissors dipped in 10⁹ cfu/ml of X. pelargonii cells to clip the leaves in several places. Following inoculation, plants were held at 32° C. The circled region contains ca. I O³ cfu/cm² live X. pelargonii cells (for details, refer Example 27 below). Photo taken four weeks after inoculation.

[0035] Figure 6 shows a transgenic Florist's geranium {Pelargonium X hortorum) cultivar "Avenida" leaf expressing enzymatically active bovine PGE and inoculated at the same time and in the same manner as that described in the legend of Figure 5. Following inoculation, plants were held at 32° C. The circled region contains ca. 100 cfu/cm² live X. pelargonii cells (for details, refer Example 27 below). Photo taken four weeks after inoculation.

DETAILED DESCRIPTION

[0036] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present invention, the preferred methods and materials are described. The DNA cloning techniques used in the present invention are conventional and can be performed by anyone skilled in the art, using methods taught by, for example, Sambrook et al (1989).

[0037] The present invention is based on our discovery that the combination of Commercial lipase, and a lytic enzyme such as lysozyme or a phytoalexin such as berberine chloride, strongly inhibits growth of some bacteria in culture, including both Xanthomonas and Xylella. The effect of the lipase is evidently to degrade or compromise the structure of the LPS barrier of living bacteria. Furthermore, we discovered that: 1) surfactants, 2) enzymes that attack the peptidoglycan or cell wall, and 3) plant defense compounds can be made highly efficacious against culture grown Gram-negative bacteria by the addition of lipase to the culture medium. Furthermore, we discovered that bovine PGE could be used to enhance the natural resistance of plants when the bovine PGE is expressed in transgenic plants, evidently by degrading or compromising the structure of the LPS barrier and allowing the plant's natural defense compounds to more readily penetrate the living bacterial cells, thereby killing them. We also discovered that not only can at least some esterases, such as bovine PGE and nematode lipase, be stably produced by plant cells without toxic effects to plants, but that said expression of esterase genes in plants provides a novel and safe means of protecting plants against infection or infestation by Gram-negative bacteria.

[0038] The present invention is also based, in part, on our discovery that at least some plant leader peptides, particularly those found on proteins secreted through the plant cell wall and accumulating in plant xylem tissue, potentiate the anti-LPS effect of esterases.

[0039] The present invention is also based on our discovery that these same plant leader peptides provide a means for targeting the anti-LPS effect of esterases to the plant apoplast and xylem, where they accumulate, providing a novel means of protecting plants against a wide variety of gram negative bacteria. Furthermore, we have discovered that transgenic plants expressing lipase may be used to produce crude or purified extracts of antimicrobial compounds.

[0040] The following exemplary steps and embodiments are intended to illustrate the present inv ention in greater detail:

[0041] 1. A prokaryotic DNA or eukaryotic cDNA clone of an active esterase is obtained. A variety of methods may be used, including without limitation: 1) directly synthesizing the gene based on a known sequence; 2) synthesizing DNA primers based on a known sequence and using PCR to amplify a cDNA clone from RNA extracted from appropriate eukaryotic tissue, and 3) identifying a esterase clone from a library that is expressed in an appropriate bacteria or fungus, based on production of esterase by one of the clones on an agar indicator plate. One example of such DNA is a cloned pregastric esterase (PGE).

[0042] 2. Said esterase clone is operably fused within a plant gene expression cassette, minimally comprising a promoter that is functional in plants, followed by the esterase clone and followed by a plant terminator in a plant expression vector that may be used for transient gene expression in plants. Several plant promoters and promoters from plant viruses that are functional in plants are widely available for use to functionally express a foreign gene in plants in transient expression assays, for example, the CaMV promoter found in the pCAMBIA series of plant expression vectors (Cambia, Canberra, Australia). Several plant terminators are also available, including the widely available NOS terminator, also found in the pCAMBIA plant expression vector series. For transfer into plant cells, the plant expression vectors may optionally also contain T-DNA borders and ability to replicate in Agrobacterium tumefaciens, Rhizobium spp., Sinorhizobium spp. or Mesorhizobium spp., which are subsequently used to transfer the DNA region between the T-DNA borders into plants.

[0043] 3. In one example, an intron may be optionally used to increase gene expression. Introns are known to be required for abundant expression of many genes in plants, including both dicots and ornamental plants and especially monocots, possibly by enhancing transcript stability or facilitating mRNA maturation (Callis et al., 1987; Mun, J. H. et al. 2002; Rose & Beliakoff, 2000; Rose, 2002, Simpson & Filipowicz, 1996, each of which is specifically incorporated by reference herein).

[0044] 4. In one example, a plant secretion signal is added to the esterase coding region, replacing the native secretion signal, if any. Some plant stress-associated and/or disease- associated proteins have been found to accumulate preferentially and most abundantly in the xylem of plants, presumably requiring a specific secretion signal sequence. Only a very few proteins are found in the xylem; it is unclear how they are secreted through the plant cell wall to reach the xylem. Such proteins have secretion signal peptides that are useful for targeting antimicrobial compounds to the plant apoplast and xylem; we call these "xylem secretion signal peptides". The xylem secretion signal peptide sequence is amplified from an appropriate plant source by PCR and cloned upstream of the esterase sequence. One example of such a peptide is a 24 amino acid plant signal peptide derived from one such protein, P12 (GenBank Accession # AFOl 5782; Ceccardi et al., 1998, each of which is specifically incorporated by reference herein)

[0045] 5. Plant expression of an active, correctly folded esterase is verified in any one of several plant species using transient gene expression (Wroblewski et al. 2005). The plant expression vector carrying the esterase gene cloned in the gene expression cassette is transformed into A. lumefaciens, and the resulting transformed cells are inoculated into plants by flooding a sizeable area of leaf tissue with diluted cell cultures. An empty vector control, consisting of the plant expression vector but without the esterase gene cloned in the expression cassette, is also inoculated, preferably on the same leaf. After 3-4 days, the plant tissue that has been inoculated is ground in 200 mM NaCl, clarified by centrifugation, and assayed using rhodamine (Jette and Ziomek, 1994), tributyrin (Singh et al., 2006) or other appropriate esterase assay (for example, Gupta et al., 2003). Esterase levels in the tissues inoculated with the esterase clone are compared with esterase levels in the tissues inoculated with the empty vector control.

[0046] 6. The most enzymatically active DNA constructs are then tested in host plant challenge assays using transient gene expression, in order to determine if the esterase will be efficacious in killing or inhibiting pathogenic bacteria, whether plant pathogenic or not. Appropriate pathogenic species of target pathogenic Gram negative bacteria are chosen for example, the plant pathogens Xanthomonas pelargonii inoculated into geranium or Ralstonia sυlanaceanan inoculated into tobacco, tomato or pepper, the animal pathogen Escherichia coli or Salmonella typhimurium on spinach or sprouts. Nonhost challenge assays may also be used for efficacy testing against plant pathogens, provided the nonhost plant produces a visible hypersensitive response (HR) against the plant pathogen. In all cases, plant leaf tissues are inoculated by flooding with diluted cultures of A. fumefaciens carrying the esterase gene expression vector exactly as illustrated in embodiment 5, above, and the extent of the inoculated areas is marked. After 3-4 days, the plant tissue that has been inoculated is again super-inoculated or "challenge inoculated" in the same tissue zone, this time with a plant pathogen or target Gram-negative bacterium that has an antibiotic resistance marker different from that of the A. tumefaciens strain used. In the case of a plant pathogen, the visible pathogenic symptoms on a host or the HR response that is observed on a nonhost on the empty vector control tissues is compared with the symptoms or response that is observed on the plant tissues pre-inoculated with the esterase expressing vector. Any reduction in symptoms or the HR response is indicative of efficacy of the esterase clone used. In all cases, and whether plant pathogen, animal pathogen or nonpathogen, 1 cm leaf disks are removed from within the super-inoculated zones, ground in liquid growth medium and cell count assays are performed using serial dilutions, comparing cell counts taken from zones inoculated within the empty vector control tissues with those taken from zones inoculated with the esterase expression clone.

[0047] Any reduction in cell counts taken from tissues pre-inoculated with an esterase expression clone as compared with those taken from tissues pre-inoculated with the empty vector control is evidence of efficacy of the esterase in killing the bacterium used for the challenge inoculation, whether plant pathogen, animal pathogen, or nonpathogen. Since permanent plant transformations are a slow and expensive process, this combination of transient expression assay and challenge inoculation is generally very useful as a pre-screen for anti-microbial genes of any type that may be useful in permanent transformations.

[0048] 7. Permanent transformation of plant cells, both monocots and dicots, followed by regeneration and propagation of transformed plants of the desired dicot and monocot species are then undertaken.

[0049] It is also an object of the invention to prevent diseases of both monocot and dicot plants prophylactically by killing any Gram-negative bacterium that infects or feeds on the plant and causes plant disease. In one embodiment of the invention, the prophylactic and therapeutic treatment of a variety of diseases caused by various species and pathovars of Xanthomonos, Pseudomonas, Erwinia, Agrobacterium, Ca. Liberibacter, XyUlIa, Ralstonia and Bitrkholderia is achieved. Transgenic plants are created using plants that are hosts of the indicated pathogen genus, said host plants carrying one or more genes encoding one or more lipase, PGE or esterase enzymes or enzymatically active peptide derivatives, fused with a xylem secretion signal peptide, operably linked with a plant promoter such that the lipase(s), PGE and/or esterase enzymes or enzymatically active peptide fragments are made by the plants.

[0050] It is also an object of the invention to prevent food-borne diseases of humans and animals in both monocot and dicot plants by prophylactically killing any Gram-negative bacterium that infects or feeds on the plant and causes a food-borne disease of humans and/or animals. In one embodiment of the invention, the prophylactic and therapeutic elimination of fecal bacteria that can contaminate fresh vegetables and cause a variety of intestinal diseases, including Escherichia, Shigella and Salmonella is achieved. Several outbreaks of Salmonella and E. coli O157:H7 associated with organically grown sprouts and mesclun lettuce have been reported (Doyle, M. P. 2000. Nutrition 16: 647-9). According to the FDA in its web report of the 2006 outbreak of E. coli in contaminated spinach (http://www.cfsan.fda.gov/~dms/spinacqa.html): "To date, 204 cases of illness due to E. coli O157:H7 infection have been reported to the CDC including 31 cases involving a type of kidney failure called Hemolytic Uremic Syndrome (HUS), 104 hospitalizations, and three deaths. The first death was an elderly woman in Wisconsin; the second death, a two-year-old in Idaho; and the third death, an elderly woman in Nebraska." Transgenic plants are created using plants that are hosts of the indicated pathogen genus, said host plants carrying one or more lipase, esterase, or lipase-like or esterase-like peptides fused with a xylem secretion signal peptide, operably linked with a plant promoter such that the lipase(s) and/or lipase-like peptides are made by the plants.

[0051] In another embodiment of the invention, transgenic plants are created that are hosts of the indicated genus, said host plants carrying one or more esterase or esterase-like peptides fused with a xylem secretions signal peptide together with a lytic peptide or lytic enzyme, all operably linked with plant promoters such that the esterase and/or esterase-like peptides and lytic enzymes are made by the plant hosts. Lytic peptides or enzymes may be linear or compact and globular, and include but are not limited to lysozymes, cecropins, attacins, magainins, holins, permeability increasing proteins, etc. [0052] It is a further object of the invention to prevent or to dampen epidemics or plagues by planting these transgenic plants as "trap" plants in an environment such that populations of infectious bacteria, fungi, nematodes or insects are reduced by feeding upon the transgenic plants. Such an environment may include commercial crops, including nontransgenic crops of the same or different plant species as the transgenic trap plants, gardens and inside buildings.

[0053] It is also an object of the invention to prophylactically prevent contamination of livestock feed and human foods by killing any Gram negative bacterium that might contaminate the feed or foods. In another embodiment of the invention, livestock feeds may incorporate or consist of transgenic whole plants, transgenic plant parts or a crude, semi-pure or pure extract of transgenic plants expressing esterase and/or esterase-like enzymes or peptide fragments. In another embodiment of the invention, human foods such as eggs or sprouts may be treated with a spray preparation of esterases and or esterase-like enzymes or peptide fragments made from transgenic plants.

DEFINITIONS

[0054] As used herein, the term ''esterase" refers inclusively to any enzyme categorized as IiC 3.1 .1.x. particularly including carboxylic-ester hydrolases (EC 3.1.1.1 and triacylglycerol acylhydrolases (EC 3.1.1.3).

[0055] As used herein, the term "esterase-like" protein or peptide refers to any amino acid sequence that is predicted by sequence analysis of a protein or peptide coding region to encode an esterase.

[0056] As used herein, the term "carboxylic-ester hydrolase" (EC 3.1.1.1), refers to a "carboxylesterase" and catalyzes the reaction of a carboxylic ester + H₂O to an alcohol plus a carboxylate, with a preference for water soluble substrates Other common names for carboxylic-ester hydrolases are: ali-esterase; B-esterase; monobutyrase; cocaine esterase; procaine esterase; methylbutyrase; vitamin A esterase; butyryl esterase; carboxyesterase; carboxylate esterase; carboxylic esterase; methylbutyrate esterase; triacetin esterase; carboxyl ester hydrolase; butyrate esterase; methylbutyrase; carboxylesterase; propionyl esterase; nonspecific carboxylesterase: esterase D; esterase B; esterase A; serine esterase; carboxylic acid esterase: and cocaine esterase. [0057] As used herein, the term "lipase" refers to any triacylglycerol acylhydrolase (EC 3.1.1.3), commonly called "triacylglycerol lipase" and catalyzing the reaction of triacylglycerol plus H₂O to diacylglycerol plus a carboxylate, and prefer water insoluble substrates Other common names for lipases are: tributyrase; butyrinase; glycerol ester hydrolase; tributyrinase; Tween hydrolase; steapsin; triacetinase; tributyrin esterase; Tweenase; amno N-AP; Takedo 1969-4-9; Meito MY 30; Tween esterase; GA 56; capalase L; triglyceride hydrolase; triolein hydrolase; tween-hydrolyzing esterase; amano CE; cacordase; triglyceridase; triacylglycerol ester hydrolase; amano P; amano AP; PPL; glycerol-ester hydrolase; GEH; meito Sangyo OF lipase; hepatic lipase; lipazin; post-heparin plasma protamine-resistant lipase; salt-resistant post-heparin lipase; heparin releasable hepatic lipase; amano CES; amano B; tributyrase; triglyceride lipase; liver lipase; and hepatic monoacylglycerol acyltransferase.

[0058] As used herein, the term "lipase-like" protein or peptide refers to any amino acid sequence that is predicted by sequence analysis of a protein or peptide coding region to encode a lipase.

[0059] As used herein, the term "Gram-negative bacterium" refers to any bacterium producing lipopolysaccharide (LPS).

[0060] As used herein, the term "disease resistance" refers to any reduction in disease symptoms or pathogen numbers in the plant or material tested caused by the treatment, as compared with the most susceptible plant phenotype or pathogen numbers known in comparable tests of untreated plants or materials. The term "disease tolerance" or "tolerance" is sometimes used in the literature to refer to a comparative reduction in disease symptoms in relation to the most susceptible plant reaction known, and so is included in the term "disease resistance" as used herein

[0061] As used herein, the term "resistance" to bacteria refers to any reduction in bacterial numbers in the plant or material tested caused by the treatment, as compared with untreated plants or materials.

[0062] As used herein, the term "immunity" to bacteria refers to elimination of detectable bacterial cell counts in the plant or material tested caused by the treatment, as compared with untreated plants or materials. [0063] As used herein, the term "allele" refers to any of several alternative forms of a gene.

[0064] As used herein, the term "amino acid" refers to the aminocarboxylic acids that are components of proteins and peptides. The amino acid abbreviations are as follows: A (Ala); C (Cys); D (Asp); E (GIu); F (Phe); G (GIy); H (His); I (Iso); K (Lys); L (Leu); M (Met); N (Asn); P (Pro); Q (GIn); R (Arg); S (Ser); T (Thr); V (VaI); W (Tip), and Y (Tyr).

[0065] As used herein, the term "crop plant" refers to any plant grown for any commercial purpose, including, but not limited to the following purposes: seed production, hay production, ornamental use, fruit production, berry production, vegetable production, oil production, protein production, forage production, animal grazing, golf courses, lawns, flower production, landscaping, erosion control, green manure, improving soil tilth/health, producing pharmaceutical products/drugs, producing food or food additives, smoking products, pulp production and wood production.

[0066] As used herein, the term "cross pollination" or "cross-breeding" refer to the process by which the pollen of one flower on one plant is applied (artificially or naturally) to the ovule (stigma) of a flower on another plant.

[0067] As used herein, the term "cultivar" refers to a variety, strain or race of plant that has been produced by horticultural or agronomic techniques and is not normally found in wild populations.

[0068] As used herein, the terms "dicotyledon" and "dicot" refer to a flowering plant having an embryo containing two seed halves or cotyledons. Examples include citrus; geranium; tobacco; tomato; the legumes, including peas, alfalfa, clover and soybeans; oaks; maples; roses: mints; squashes; daisies; walnuts; cacti; violets and buttercups.

[0069] As used herein, the term "ER retention signal" refers to an amino acid sequence (the ER retention signal peptide) attached to a polypeptide which causes the polypeptide to be retained and accumulated in the endoplasmic reticulum (ER).

[0070] As used herein, esterases, including carboxylesterases, pregastric esterases and lipases are enzymes that cleave triglycerides (fats, lipids, triacylglycerols or carboxylic acid esters) into carboxylic acids (fatty acids) and mono- and di-glycerides. Esterases (EC 3.1.1.x) are classified into different groups including carboxylesterases (EC 3.1.1.1) and lipases (EC 3.1.1.3), based on the acyl chain length of the ester substrate and/or activation at the oil/water interface but the classifications of EC 3.1.1.x are based on substrate preference and protein sequence homology, not absolute specificity, and the specificity of some esterases can be quite wide, covering several categories (Bornscheuer, 2002, incorporated in its entirety specifically by reference herein). For example, an esterase from Acinetobacter that most closely resembles an enol lactone hydrolase (EC 3.1.1.24) actually has much higher substrate acth ity against enol esters, such as vinyl acetate (EC 3.1.1.1) (Suzuki et ah, 2002). As another example, there is great overlap of enzymatic activity among enzymes classified as esterases (EC 3.1.1.1) and those classified as lipases (EC 3.1.1.3), with lipases exhibiting higher levels of activity at oil/water interfaces. However, "the borderline between esterases and lipases has never been drawn with absolute certainty" (Desnuelle & Savar, 1963). More recent work has shown that activation at the oil/water interface is an unsuitable criterion for distinction of lipases from esterases (Verger, 1997, which is specifically incorporated by reference herein). Probably the best distinction is that lipases are esterases with an ability to act on "long chain" acyl glycerols (Calvo & Fontecha, 2004; Gupta et al, 2003; Singh et al, 2006, each of which is specifically incorporated by reference herein).

[0071] The difficulty in classification is largely due to the fact that many esterases show a very wide range of substrate specificities and classification into a particular group is difficult due to overlapping specificities or preferences (Calero-Rueda et al., 2002, which is specifically incorporated by reference herein). Functionally, there are no differences, but there are substrate preferences. Because of the wide substrate specificity exhibited by these enzymes and a classification system based on apparent substrate preference, the term "esterase" as used in the present invention includes all enzymes classified as EC 3.1.1.x, including both carboxylesterases (EC 3.1.1.1) and lipases (EC 3.1.1.3).

[0072] Esterases as used herein also include polypeptide portions or fragments of a whole esterase protein that retain the ability to act as an esterase enzyme. Esterases are often found as modular portions of larger proteins. For example, the Arabidopsis thaliana gene locus (GenBank) AAF24544 encodes a single polypeptide of 1 ,41 1 amino acids and within this single protein are four "SGNH Plant Lipase-Like hydrolase regions"; the first of these regions (from amino acid 36 - 366) is known to encode an active lipase (Brick et al. 1995). For additional examples of esterase modules within larger proteins, refer Gordillo et al., 2006; Cepeljnik,T et al., 2006). Esterase modules may also be artificially constructed by recombinant DNA techniques to form larger, multifunctional proteins (for example, refer Levasseur et al., 2005).

[0073] Esterases are made from plant, animal, fungal and bacterial sources, and are extremely important in biotechnology, including as additives to detergents and the manufacture of foods and nutraceuticals (Jaeger & Reetz, 1998). Pregastric esterase (PGE), also called lingual lipase is a major fat-digesting enzyme in newborn and in young animals, and the purified enzyme from kids exhibits both lipase and esterase characteristics (ie., hydrolyzes both short and long chain acyl glycerols) (Calvo & Fontecha, 2004). PGE is different from pancreatic lipase in not requiring emulsifiers such as bile salts. For example, milk fat globules are resistant to the action of pancreatic lipase, but they are readily hydrolyzed by PGE.

[0074] The cDNA encoding bovine PGE was isolated, cloned and completely sequenced (Timmermans et al, 1994). This PGE sequence is nearly identical to all other PGEs found in mammals. Preparation, purification, cloning and microbial expression of recombinant kid PGF. for the therapeutic treatment of lipase deficiency in animals is disclosed by Bolen et al. (US 6,582,948). A cDNA encoding bovine PGE has been isolated, cloned and completely sequenced (Timmermans et al, 1994). This PGE sequence is nearly identical to all other PGEs found in mammals. Preparation, purification, cloning and microbial expression of recombinant kid PGE for the therapeutic treatment of lipase deficiency in animals is disclosed by Bolen et al. (US 6,582,948). Large scale production of recombinant dog gastric lipase in tobacco plants has been achieved, demonstrating that active glycosylated enzyme was produced in plants using an unmodified animal lipase coding region when operably fused with a plant promoter (Gruber et al. 2001, which is specifically incorporated in its entirety herein). It was not taught or suggested that the enzymatic action of animal lipases or esterases should directly affect microbial pathogens, rendering them sensitive to normal plant defenses.

[0075] A "lipase-like" pathogen inducible gene family was recently found by genomic DNA sequence analysis in the plant Arabidopsis (Jakab et al., 2003, which is specifically incorporated in its entirety herein. The authors speculated that the lipase-like proteins were involved as intermediaries in one or more signal transduction pathways involving plant defense responses. Similarly, a phospholipase gene family has been identified in Arabidopsis, and recently four of these genes were either over-expressed or potentially suppressed by antisense constructs in transgenic petunia plants (Zahn et al, 2005, which is specifically incorporated in its entirety herein). There is no teaching or suggestion in these papers that the lipase-like gene family or the phospholipase gene family functioned to directly cause or effect resistance against pathogens or that the genes functioned to degrade, breach, compromise or otherwise affect the LPS barrier of living Gram negative pathogens.

[0076] As used herein, the term "female plant" refers to a plant that produces ovules. Female plants generally produce seeds after fertilization. A plant designated as a "female plant" may contain both male and female sexual organs. Alternatively, the "female plant" may only contain female sexual organs either naturally {e.g., in dioecious species) or due to emasculation {e.g., by detasselling).

[0077] As used herein, the term "filial generation" refers to any of the generations of cells, tissues or organisms following a particular parental generation. The generation resulting from a mating of the parents is the first filial generation (designated as "Fl" or "Fj"), while that resulting from crossing of Fl individuals is the second filial generation (designated as ^UF2" or "F₂").

[0078] As used herein, the term "gamete" refers to a reproductive cell whose nucleus (and often cytoplasm) fuses with that of another gamete of similar origin but of opposite sex to form a zygote, which has the potential to develop into a new individual. Gametes are haploid and arc differentiated into male and female.

[0079] As used herein, the term "gene" refers to any segment of DNA associated with a biological function. Thus, genes include, but are not limited to, coding sequences and/or the regulatory sequences required for their expression. Genes can also include nonexpressed DNA segments that, for example, form recognition sequences for other proteins. Genes can be obtained from a variety of sources, including cloning from a source of interest or synthesizing from known or predicted sequence information, and may include sequences designed to have desired parameters.

[0080] As used herein, the term "genotype" refers to the genetic makeup of an individual cell, cell culture, tissue, organism (e.g., a plant), or group of organisms.

[0081] As used herein, the term "hemizygous" refers to a cell, tissue or organism in which a gene is present only once in a genotype, as a gene in a haploid cell or organism, a sex-linked gene in the heterogamctic sex, or a gene in a segment of chromosome in a diploid cell or organism where its partner segment has been deleted.

[0082] As used herein, the terms "heterologous polynucleotide" or a "heterologous nucleic acid" or an "exogenous DNA segment" refer to a polynucleotide, nucleic acid or DNA segment that originates from a source foreign to the particular host cell, or, if from the same source, is modified from its original form. Thus, a heterologous gene in a host cell includes a gene that is endogenous to the particular host cell, but has been modified. Thus, the terms refer to a DNA segment which is foreign or heterologous to the cell, or homologous to the cell but in a position within the host cell nucleic acid in which the element is not ordinarily found. Exogenous DNA segments are expressed to yield exogenous polypeptides.

[0083] As used herein, the term "heterologous trait" refers to a phenotype imparted to a transformed host cell or transgenic organism by an exogenous DNA segment, heterologous polynucleotide or heterologous nucleic acid.

[0084] As used herein, the term "heterozygote" refers to a diploid or polyploid individual cell or plant having different alleles (forms of a given gene) present at least at one locus.

[0085] As used herein, the term "heterozygous" refers to the presence of different alleles (forms of a given gene) at a particular gene locus.

[0086] As used herein, the terms "homolog" or "homologue" refer to a nucleic acid or peptide sequence which has a common origin and functions similarly to a nucleic acid or peptide sequence from another species.

[0087] As used herein, the term "homozygote" refers to an individual cell or plant having the same alleles at one or more loci.

[0088] As used herein, the term "homozygous" refers to the presence of identical alleles at one or more loci in homologous chromosomal segments.

[0089] As used herein, the term "hybrid" refers to any individual cell, tissue or plant resulting from a cross between parents that differ in one or more genes.

[0090] As used herein, the term "inbred" or "inbred line" refers to a relatively true-breeding strain. [0091] As used herein, the term "line" is used broadly to include, but is not limited to, a group of plants vegetatively propagated from a single parent plant, via tissue culture techniques or a group of inbred plants which are genetically very similar due to descent from a common parent(s). A plant is said to "belong" to a particular line if it (a) is a primary transformant (TO) plant regenerated from material of that line; (b) has a pedigree comprised of a TO plant of that line; or (c) is genetically very similar due to common ancestry (e.g., via inbreeding or selling). In this context, the term "pedigree" denotes the lineage of a plant, e.g. in terms of the sexual crosses effected such that a gene or a combination of genes, in heterozygous (hemizygous) or homozygous condition, imparts a desired trait to the plant.

[0092] As used herein, the term "locus" (plural: "loci") refers to any site that has been defined genetically. A locus may be a gene, or part of a gene, or a DNA sequence that has some regulatory role, and may be occupied by different sequences.

[0093] As used herein, the term "lytic protein" refers to any enzyme, in whole or in part, or lytic peptide that: 1) degrades or penetrates the peptidoglycan or murein layer that forms the bacterial cell wall of both Gram positive or Gram negative bacteria, and 2) has the ability to permeabilize or disrupt the bacterial inner membrane. Said proteins may be linear, partially degraded or compact and globular, and include but are not limited to lysozymes, cecropins, attacins. magainins, permeability increasing proteins, etc.

[0094] As used herein, the term "male plant" refers to a plant that produces pollen grains. The '"male plant" generally refers to the sex that produces gametes for fertilizing ova. A plant designated as a "male plant" may contain both male and female sexual organs. Alternatively, the "male plant" may only contain male sexual organs either naturally (e.g., in dioecious species) or due to emasculation (e.g., by removing the ovary).

[0095] As used herein, the term "mass selection" refers to a form of selection in which individual plants are selected and the next generation propagated from the aggregate of their seeds.

[0096] As used herein, the term "monocotyledon" or "monocot" refer to any of a subclass (Monocotyledoneae) of flowering plants having an embryo containing only one seed leaf and usually having parallel-veined leaves, flower parts in multiples of three, and no secondary growth in stems and roots. Examples include lilies; orchids; rice; corn, grasses, such as tall fescue, goat grass, and Kentucky bluegrass; grains, such as wheat, oats and barley; irises; onions and palms.

[0097] As used herein, the terms "mutant" or "mutation" refer to a gene, cell, or organism with an abnormal genetic constitution that may result in a variant phenotype.

[0098] As used herein, the terms "nucleic acid" or "polynucleotide" refer to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double- stranded form. Unless specifically limited, the terms encompass nucleic acids containing known analogues of natural nucleotides that have similar binding properties as the reference nucleic acid and are metabolized in a manner similar to naturally occurring nucleotides. Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. degenerate codon substitutions) and complementary sequences as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al. (1991) Nucleic Acid Res. 19:5081 ; Ohtsuka et al. (1985) J. Biol. Chem. 260:2605-2608; Cassol et al. (1992); Rossolini el al. (1994) MoI. Cell. Probes 8:91-98). The term nucleic acid is used interchangeably with gene, cDNA, and mRNA encoded by a gene. The term "nucleic acid" also encompasses polynucleotides synthesized in a laboratory using procedures well known to those skilled in the art.

[0099] As used herein, a DNA segment is referred to as "operably linked" when it is placed into a functional relationship with another DNA segment. For example, DNA for a signal sequence is operably linked to DNA encoding a polypeptide if it is expressed as a preprotein that participates in the secretion of the polypeptide; a promoter or enhancer is operably linked to a coding sequence if it stimulates the transcription of the sequence. Generally, DNA sequences that are operably linked are contiguous, and in the case of a signal sequence both contiguous and in reading phase. However, enhancers need not be contiguous with the coding sequences whose transcription they control. Linking is accomplished by ligation at convenient restriction sites or at adapters or linkers inserted in lieu thereof.

[00100] As used herein, the term "open pollination" refers to a plant population that is freely exposed to some gene flow, as opposed to a closed one in which there is an effective barrier to gene flow. [00101] As used herein, the terms "open-pollinated population" or "open-pollinated variety" refer to plants normally capable of at least some cross-fertilization, selected to a standard, that may show variation but that also have one or more genotypic or phenotypic characteristics by which the population or the variety can be differentiated from others. A hybrid, which has no barriers to cross-pollination, is an open-pollinated population or an open-pollinated variety.

[00102] As used herein, the terms "ortholog" and "orthologue" refer to a nucleic acid or peptide sequence which functions similarly to a nucleic acid or peptide sequence from another species. For example, where one gene from one plant species has a high nucleic acid sequence similarity and codes for a protein with a similar function to another gene from another plant species, such genes would be orthologs.

[00103] As used herein when discussing plants, the term "ovule" refers to the female gametophyte, whereas the term "pollen" means the male gametophyte.

[00104] As used herein, the term "phenotype" refers to the observable characters of an individual cell, cell culture, organism (e.g., a plant), or group of organisms which results from the interaction between that individual's genetic makeup (i.e., genotype) and the environment.

[00105] As used herein, the term "phytoalexin" refers to any antimicrobial chemical compound made by a plant, whether preformed or made in response to presence of a microbe.

[00106] The term "plants" as used herein denotes complete plants and also parts of plants, including seeds, tubers, cuttings, etc.

[00107] As used herein, the term "plant line" is used broadly to include, but is not limited to, a group of plants vegetatively propagated from a single parent plant, via tissue culture techniques or a group of inbred plants which are genetically very similar due to descent from a common parent(s). A plant is said to "belong" to a particular line if it (a) is a primary transformant (TO) plant regenerated from material of that line; (b) has a pedigree comprised of a TO plant of that line; or (c) is genetically very similar due to common ancestry (e.g., via inbreeding or selfing). In this context, the term "pedigree" denotes the lineage of a plant, e.g. in terms of the sexual crosses effected such that a gene or a combination of genes, in heterozygous (hemizygous) or homozygous condition, imparts a desired trait to the plant. [00108] As used herein, the term "plant tissue" or "plant part" refers to any part of a plant. Examples of plant organs include, but are not limited to the leaf, stem, root, tuber, seed, branch, pubescence, nodule, leaf axil, flower, pollen, stamen, pistil, petal, peduncle, stalk, stigma, style, bract, fruit, trunk, carpel, sepal, anther, ovule, pedicel, needle, cone, rhizome, stolon, shoot, pericarp, endosperm, placenta, berry, stamen, and leaf sheath.

[00109] As used herein, the term "promoter" refers to a region of DNA involved in binding RNA polymerase to initiate transcription.

[00110] As used herein, the terms "protein," "peptide" or polypeptide" refer to amino acid residues and polymers thereof. Unless specifically limited, the terms encompass amino acids containing known analogues of natural amino acid residues that have similar binding properties as the reference amino acid and are metabolized in a manner similar to naturally occurring amino acid residues. Unless otherwise indicated, a particular amino acid sequence also implicitly encompasses conservatively modified variants thereof (e.g. conservative substitutions) as well as the sequence explicitly indicated. The term "polypeptide" also encompasses polypeptides synthesized in a laboratory using procedures well known to those skilled in the art.

[00111] As used herein, the term "recombinant" refers to a cell, tissue or organism that has undergone transformation with recombinant DNA. The original recombinant is designated as "RO" or "Ro-" Selfing the RO produces a first transformed generation designated as "Rl" or ^"Ri .^"

[00112] As used herein, the term "secretion signal" refers to an amino acid sequence (the secretion signal peptide) attached to a N-terminus of a polypeptide, which is needed for secretion of the mature polypeptide from the cell.

[00113] As used herein, the term "self pollinated" or "self-pollination" means the pollen of one flower on one plant is applied (artificially or naturally) to the ovule (stigma) of the same or a different flower on the same plant.

[00114] As used herein, the term "transcript" refers to a product of a transcription process. [00115] As used herein, the term "transformation" refers to the transfer of nucleic acid (i.e., a nucleotide polymer) into a cell. As used herein, the term "genetic transformation" refers to the transfer and incorporation of DNA, especially recombinant DNA, into a cell.

[00116] As used herein, the term "transformant" refers to a cell, tissue or organism that has undergone transformation. The original transformant is designated as "TO" or "To." Selfing the TO produces a first transformed generation designated as "Tl" or "T₁."

[00117] As used herein, the term "transgene" refers to a nucleic acid that is inserted into an organism, host cell or vector in a manner that ensures its function.

[00118] As used herein, the term "'transgenic" refers to cells, cell cultures, organisms (e.g., plants), and progeny which have received a foreign or modified gene by one of the various methods of transformation, wherein the foreign or modified gene is from the same or different species than the species of the organism receiving the foreign or modified gene.

[00119] As used herein, the term "transposition event" refers to the movement of a transposon from a donor site to a target site.

[00120] As used herein, the term "variety'^" refers to a subdivision of a species, consisting of a group of individuals within the species that are distinct in form or function from other similar arrays of individuals.

[00121] As used herein, the terms "untranslated region" or "UTR" refer to any part of a mRNA molecule not coding for a protein (e.g., in eukaryotes the poly(A) tail).

[00122] As used herein, the term "vector" refers broadly to any plasmid or virus encoding an exogenous nucleic acid. The term should also be construed to include non-plasmid and non-viral compounds which facilitate transfer of nucleic acid into virions or cells, such as, for example, polylysine compounds and the like. The vector may be a viral vector that is suitable as a delivery vehicle for delivery of the nucleic acid, or mutant thereof, to a cell, or the vector may be a non-viral vector which is suitable for the same purpose. Examples of viral and non- viral vectors for delivery of DNA to cells and tissues are well known in the art and are described, for example, in Ma et al. (1997, Proc. Natl. Acad. Sci. U.S.A. 94:12744-12746). Examples of viral vectors include, but are not limited to, a recombinant vaccinia virus, a recombinant adenovirus, a recombinant retrovirus, a recombinant adeno-associated virus, a recombinant avian pox virus, and the like (Cranage et al, 1986, EMBO J. 5:3057-3063; International Patent Application No. WO94/17810, published August 18, 1994; International Patent Application No. WO94/23744, published October 27, 1994). Examples of non-viral vectors include, but are not limited to, liposomes, polyamine derivatives of DNA, and the like.

[00123] Λs used herein, a "whole plant" means a plant with a shoot and a root.

PLANT TRANSFORMATION

[00124] As discussed herein, several embodiments of the present invention employ expression units (or expression vectors or systems) to express an exogenously supplied nucleic acid sequence in a plant. Methods for generating expression units/systems/vectors for use in plants are well known in the art and can readily be adapted for use in the instant invention. A skilled artisan can readily use any appropriate plant/vector/expression system in the present methods following the outline provided herein.

[00125] The expression control elements used to regulate the expression of the protein can either be the expression control element that is normally found associated with the coding sequence (homologous expression element) or can be a heterologous expression control clement. A variety of homologous and heterologous expression control elements are known in the art and can readily be used to make expression units for use in the present invention. Transcription initiation regions, for example, can include any of the various opine initiation regions, such as octopine, mannopine, nopaline and the like that are found in the Ti plasmids of Agrobaclerium tumefacians. Alternatively, plant viral promoters can also be used, such as the cauliflower mosaic virus 19S and 35S promoters (CaMV 19S and CaMV 35S promoters, respectively) to control gene expression in a plant (U.S. Patent Nos. 5,352,605; 5,530,196 and 5,858,742 for example). Enhancer sequences derived from the CaMV can also be utilized (U.S. Patent Nos. 5,164,316; 5,196,525; 5,322,938; 5,530,196; 5,352,605; 5,359,142; and 5,858,742 for example). Lastly, plant promoters such as RUBISCO small and large subunit promoters, prolifera promoter, fruit-specific promoters, Ap3 promoter, heat shock promoters, seed-specific promoters, etc. can also be used.

[00126] Either a gamete-specific promoter, a constitutive promoter (such as the CaMV or Nos promoter), an organ-specific promoter (such as the E8 promoter from tomato) or an inducible promoter is typically ligated to the protein or antisense encoding region using standard techniques known in the art. The expression unit may be further optimized by employing supplemental elements such as transcription terminators and/or enhancer elements.

[00127] Thus, for expression in plants, the expression units will typically contain, in addition to the protein sequence, a plant promoter region, a transcription initiation site and a transcription termination sequence. Unique restriction enzyme sites at the 5' and 3' ends of the expression unit are typically included to allow for easy insertion into a preexisting vector.

[00128] In the construction of heterologous promoter/structural gene or antisense combinations, the promoter is preferably positioned about the same distance from the heterologous transcription start site as it is from the transcription start site in its natural setting. As is known in the art, however, some variation in this distance can be accommodated without loss of promoter function.

[00129] In addition to a promoter sequence, the expression cassette can also contain a transcription termination region downstream of the structural gene to provide for efficient termination. The termination region may be obtained from the same gene as the promoter sequence or may be obtained from different genes. If the mRNA encoded by the structural gene is to be efficiently processed, DNA sequences which direct polyadenylation of the RNA are also commonly added to the vector construct. Polyadenylation sequences include, but are not limited to the Agrobaclerium octopine synthase signal (Gielen et ah, EMBO J 3:835-846 (1984)) or the nopaline synthase signal (Depicker et al, MoI. and Appl. Genet. 1 :561-573 (1982)).

[00130] The resulting expression unit is ligated into or otherwise constructed to be included in a vector that is appropriate for higher plant transformation. The vector may also contain a selectable marker gene by which transformed plant cells can be identified in culture. Replication sequences, of bacterial or viral origin, are generally also included to allow the vector to be cloned in a bacterial or phage host, preferably a broad host range prokaryotic origin of replication is included. A selectable marker for bacteria should also be included to allow selection of bacterial cells bearing the desired construct. Suitable prokaryotic selectable markers also include resistance to antibiotics such as ampicillin, kanamycin or tetracycline. [00131] Other DNA sequences encoding additional functions may also be present in the vector, as is known in the art. For instance, in the case of Agrobaclerium, Rhizobium, Mesorhizobium and Sinorhizobium transformations, T-DNA sequences will also be included for subsequent transfer to plant chromosomes.

[00132] The sequences of the present invention can also be fused to various other nucleic acid molecules such as Expressed Sequence Tags (ESTs), epitopes or fluorescent protein markers.

[00133] ESTs are gene fragments, typically 300 to 400 nucleotides in length, sequenced from the 3' or 5' end of complementary-DNA (cDNA) clones. Nearly 30,000 Arabidopsis thaliana ESTs have been produced by a French and an American consortium (Delseny et al., FHBS Lett. 405(2): 129-132 (1997); Arabidopsis thaliana Database, http://genome.www.stanford.edu/Arabidopsis). For a discussion of the analysis of gene- expression patterns derived from large EST databases, see, e.g., M. R. Fannon, TIBTECH 14:294-298 (1996).

[00134] To introduce a desired gene or set of genes by conventional methods requires a sexual cross between two lines, and then repeated back-crossing between hybrid offspring and one of the parents until a plant with the desired characteristics is obtained. This process, however, is restricted to plants that can sexually hybridize, and genes in addition to the desired gene will be transferred.

[00135] Recombinant DNA techniques allow plant researchers to circumvent these limitations by enabling plant geneticists to identify and clone specific genes for desirable traits, such as resistance to an insect pest, and to introduce these genes into already useful varieties of plants. Once the foreign genes have been introduced into a plant, that plant can then be used in conventional plant breeding schemes {e.g., pedigree breeding, single-seed- dcscent breeding schemes, reciprocal recurrent selection) to produce progeny which also contain the gene of interest.

[00136] Genes can be introduced in a site directed fashion using homologous recombination. Homologous recombination permits site-specific modifications in endogenous genes and thus inherited or acquired mutations may be corrected, and/or novel alterations may be engineered into the genome. Homologous recombination and site-directed integration in plants are discussed in, for example, U.S. Patent Nos. 5,451 ,513; 5,501,967 and 5,527,695.

[00137] Methods of producing transgenic plants are well known to those of ordinary skill in the art. Transgenic plants can now be produced by a variety of different transformation methods including, but not limited to, electroporation; microinjection; microprojectile bombardment, also known as particle acceleration or biolistic bombardment; viral-mediated transformation; Agrobacterium-, Rhizobium-, Mesorhizobium- and Sinorhizobium-mediated transformation. See. for example, U.S. Patent Nos. 5,405,765; 5,472,869; 5,538,877; 5,538,880; 5,550,318; 5,641 ,664; 5,736,369 ; 5,736369; US 2005/0289672; US 2005/0289667, PCT Publication WO 2006/004914; Watson et al, Recombinant DNA, Scientific American Books (1992); Hinchee et al, Bio/Tech. 6:915-922 (1988); McCabe et al, Bio/Tech. 6:923-926 (1988); Toriyama et al, Bio/Tech. 6:1072-1074 (1988); Fromm et al, Bio/Tech. 8:833-839 (1990); Mullins et al, Bio/Tech. 8:833-839 (1990); Hiei et al, Plant Molecular Biology 35:205-218 (1997); Ishida et al, Nature Biotechnology 14:745-750 ( 1996); Zhang et al , Molecular Biotechnology 8:223-231 (1997); Ku et al, Nature Biotechnology 17:76-80 (1999); Raineri et al , Bio/Tech. 8:33-38 (1990), and Broothaerts et al., Nature 433:629-633 (2005), each of which is expressly incorporated herein by reference in their entirety.

[00138] Agrobacterium tumefaciens is a naturally occurring bacterium that is capable of inserting its DNA (genetic information) into plants, resulting in a type of injury to the plant known as crown gall. It can also insert foreign DNA into plants through the use of its modified or "disarmed" natural DNA insertion system, but without forming crown gall disease. Most species of plants can now be transformed using this method. See, for example, Wang et al, Australian Journal of Plant Physiology 23(3): 265-270 (1996); Hoffman et al, Molecular Plant-Microbe Interactions 10(3): 307-315 (1997); and, Trieu et al, Plant Cell Reports 16:6-11 (1996).

[00139] Rhizobium spp., Mesorhizobium spp. and Sinorhizobium spp. are naturally occurring bacteria that are also capable of inserting foreign DNA (genetic information) into plants. Many species of plants can now be transformed using this method. See, for example, Broothaerts et al.. Nature 433:629-633 (2005). [00140] Microprojectile bombardment is also known as particle acceleration, biolistic bombardment, and the gene gun (Biolistic® Gene Gun). The gene gun is used to shoot pellets that are coated with genes (e.g., for desired traits) into plant seeds or plant tissues in order to get the plant cells to then express the new genes. The gene gun uses an actual explosive (.22 caliber blank) to propel the material. Compressed air or steam may also be used as the propellant. The Biolistic® Gene Gun was invented in 1983-1984 at Cornell University by John Sanford, Edward Wolf, and Nelson Allen. It and its registered trademark are now owned by E. I. du Pont de Nemours and Company. Most species of plants have been transformed using this method, including alfalfa (U.S. Patent No. 5,324,646) and clover (Voisey et al, Biocontrol Science and Technology 4(4): 475-481 (1994); Quesbenberry et al, Crop Science 36(4): 1045-1048 (1996); Khan et al, Plant Physiology 105(1): 81-88 ( 1994); and, Voisey et al, Plant Cell Reports 13(6): 309-314 (1994)).

[00141] Developed by ICI Seeds Inc. (Garst Seed Company) in 1993, WHISKERS™ is an alternative to other methods of inserting DNA into plant cells (e.g., the Biolistic® Gene Gun, Agrobaclerium tumefaciens, the "Shotgun" Method, etc.); and it consists of needle-like crystals ("whiskers") of silicon carbide. The fibers are placed into a container along with the plant cells, then mixed at high speed, which causes the crystals to pierce the plant cell walls with microscopic "holes" (passages). Then the new DNA (gene) is added, which causes the DNA to flow into the plant cells. The plant cells then incorporate the new gene(s); and thus they have been genetically engineered.

[00142] The essence of the WHISKERS™ technology is the small needle-like silicon carbide "whisker" (0.6 microns in diameter and 5-80 microns in length) which is used in the following manner. A container holding a "transformation cocktail" composed of DNA (e.g., agronomic gene plus a selectable marker gene), embryogenic corn tissue, and silicon carbide "whiskers" is mixed or shaken in a robust fashion on either a dental amalgam mixer or a paint shaker. The subsequent collisions between embryogenic corn cells and the sharp silicon carbide "whiskers" result in the creation of small holes in the plant cell wall through which DNA (the agronomic gene) is presumed to enter the cell. Those cells receiving and incorporating a new gene are then induced to grow and ultimately develop into fertile transgenic plants.

[00143] Not surprisingly, the fibrous, needle-like "whiskers" form of silicon carbide is a pulmonary health hazard and therefore must be handled much differently from non-fibrous silicon carbide powders that contain no whiskers. The two silicon carbide forms, powder and fibrous whiskers, are regulated much differently, with the British Columbian (Canadian) Occupational Health and Safety (OHS) regulating the fibrous form the same as asbestos at 0.1 fiber per cc (f/cc) exposure limit, whereas the ordinary, non-fibrous form has an exposure limit of 3-10 mg/ cubic meter. Silicon carbide whiskers were shown to generate mutagenic reactive hydroxyl radicals in a manner similar to asbestos and to cause DNA strand breakage; silicon carbide powder did not cause such effects (Svensson et al, 1997).

[00144] Breaching the plant cell wall using silicon carbide powder does not direct any DNA associated with the powder to the plant nucleus, although this will happen at a low frequency. This problem can be overcome if the DNA is directed to the nucleus, as occurs in natural infections of A. tumefaciens or by certain viruses. Nuclear localization signal sequences (NLSs) guide the protein and any associated nucleic acid to the plant nucleus.

[00145] Silicon carbide powder may be used for plant transformation (see, for example, PCT/US2006/041702), when combined with a carrier medium or nucleic acid delivery system comprising a transformation agent, such as RNA or DNA, and incorporated into nanoparticles in the carrier medium. The bulk of the carrier medium is typically an aqueous or oil-based viscous solution, or mixture thereof, which may also include bulking agents, dispersing agents, surface modifiers, and/or permeation enhancers. The carrier medium may also contain DNA binding proteins with NLSs.

[00146] Genes successfully introduced into plants using recombinant DNA methodologies include, but are not limited to, those coding for the following traits: seed storage proteins, including modified 7S legume seed storage proteins (see, for example, U.S. Patent Nos. 5,508,468, 5,559,223 and 5,576,203); herbicide tolerance or resistance (see, for example, De Greef et al, Bio/Technology 7:61 (1989); U.S. Pat. No. 4,940,835; U.S. Pat. No. 4,769,061 ; U.S. Pat. No. 4,975,374; Marshall et α/.(1992) Theor. Appl. Genet. 83, 435; U.S. Pat. No. 5,489,520; U.S. Patent No. 5,498.544; U.S. Patent No. 5,554,798; Powell et al, Science 232:738-743 (1986); Kaniewski et al,. Bio/Tech. 8:750-754 (1990)); Day et al, Proc. Natl. Acad. Sci. USA 88:6721-6725 (1991)); phytase (see, for example, U.S. Patent No. 5,593,963); resistance to bacterial, fungal, nematode and insect pests, including resistance to the lepidoptera insects conferred by the Bt gene (see, for example, U.S. Patent Nos. 5,597,945 and 5,597,946; Johnson et al, Proc. Natl. Acad. Sci. USA, 86:9871-9875 (1989); Perlak et al, Bio/Tech. 8:939-943 (1990)); lectins (U.S. Patent No. 5,276,269); flower color (Meyer et α/., Nature 330:677-678 (1987); Napoli et al, Plant Cell 2:279-289 (1990); van der Krol et al. Plant Cell 2:291 -299 (1990)); Bt genes (Voisey et al, supra); neomycin phosphotransferase II (Quesbenberry et al, supra); the pea lectin gene (Diaz et al, Plant Physiology 109(4): 1167-1 177 (1995); Eijsden et al, Plant Molecular Biology 29(3):431-439 (1995)); the auxin-responsive promoter GH3 (Larkin et al, Transgenic Research 5(5):325- 335 (1996)); seed albumin gene from sunflowers (Khan et al, Transgenic Research 5(3): 179- 185 (1996)); and genes encoding the enzymes phosphinothricin acetyl transferase, beta- glucuronidase (GUS) coding for resistance to the Basta® herbicide, neomycin phosphotransferase, and an alpha-amylase inhibitor (Khan et al, supra), each of which is expressly incorporated herein by reference in their entirety.

[00147] For certain purposes, different antibiotic or herbicide selection markers may be preferred. Selection markers used routinely in transformation include the nptll gene which confers resistance to kanamycin and related antibiotics (see, for example, Messing & Vierra, Gene 19: 259-268 (1982); Bevan et al, Nature 304:184-187 (1983)), the bar gene which confers resistance to the herbicide phosphinothricin (White et al, Nucl Acids Res 18: 1062 (1990), Spencer et al, Theor Appl Genet 79: 625-631(1990)), and the dhfr gene, which coniers resistance to methotrexate (Bourouis et al, EMBO J. 2(7): 1099-1 104 (1983)).

[00148] A transgenic plant formed using Agrobacterium, Rhizobium, Mesorhizobium or Sinorhizobium transformation methods typically contains a single gene on one chromosome, although multiple copies are possible. Such transgenic plants can be referred to as being hemizygous for the added gene. A more accurate name for such a plant is an independent segregant, because each transformed plant represents a unique T-DNA integration event (U.S. Patent No. 6,156,953). A transgene locus is generally characterized by the presence and/or absence of the transgene. A heterozygous genotype in which one allele corresponds to the absence of the transgene is also designated hemizygous (U.S. Patent No. 6,008,437).

[00149] Assuming normal hemizygosity, selfing will result in maximum genotypic segregation in the first selfed recombinant generation, also known as the Rl or Ri generation. The Rl generation is produced by selfing the original recombinant line, also known as the RO or Ro generation. Because each insert acts as a dominant allele, in the absence of linkage and assuming only one hemizygous insert is required for tolerance expression, one insert would segregate 3: 1 , two inserts, 15: 1 , three inserts, 63 : 1 , etc. Therefore, relatively few Rl plants need to be grown to find at least one resistance phenotype (U.S. Patent Nos. 5,436,175 and 5,776,760).

[00150] As mentioned above, self-pollination of a hemizygous transgenic regenerated plant should produce progeny equivalent to an F2 in which approximately 25% should be homozygous transgenic plants. Self-pollination and testcrossing of the F2 progeny to non- transformed control plants can be used to identify homozygous transgenic plants and to maintain the line. If the progeny initially obtained for a regenerated plant were from cross- pollination, then identification of homozygous transgenic plants will require an additional generation of self-pollination (U.S. Patent 5,545,545). BREEDING METHODS

[00151] Open-Pollinated Populations. The improvement of open-pollinated populations of such crops as rye, many maizes and sugar beets, herbage grasses, legumes such as alfalfa and clover, and tropical tree crops such as cacao, coconuts, oil palm and some rubber, depends essentially upon changing gene-frequencies towards fixation of favorable alleles while maintaining a high (but far from maximal) degree of heterozygosity. Uniformity in such populations is impossible and trueness-to-type in an open-pollinated variety is a statistical feature of the population as a whole, not a characteristic of individual plants. Thus, the heterogeneity of open-pollinated populations contrasts with the homogeneity (or virtually so) of inbred lines, clones and hybrids.

[00152] Population improvement methods fall naturally into two groups, those based on purely phenotypic selection, normally called mass selection, and those based on selection with progeny testing. Interpopulation improvement utilizes the concept of open breeding populations; allowing genes for flow from one population to another. Plants in one population (cultivar, strain, ecotype, or any germplasm source) are crossed either naturally (e.g., by wind) or by hand or by bees (commonly Apis mellifera L. or Megachile rotundata F.) with plants from other populations. Selection is applied to improve one (or sometimes both) population(s) by isolating plants with desirable traits from both sources.

[00153] There are basically two primary methods of open-pollinated population improvement. First, there is the situation in which a population is changed en masse by a chosen selection procedure. The outcome is an improved population that is indefinitely propagable by random-mating within itself in isolation. Second, the synthetic variety attains the same end result as population improvement but is not itself propagable as such; it has to be reconstructed from parental lines or clones. These plant breeding procedures for improving open-pollinated populations are well known to those skilled in the art and comprehensive reviews of breeding procedures routinely used for improving cross-pollinated plants are provided in numerous texts and articles, including: Allard, Principles of Plant Breeding, John Wiley & Sons, Inc. (1960); Simmonds, Principles of Crop Improvement, Longman Group Limited (1979); Hallauer and Miranda, Quantitative Genetics in Maize Breeding, Iowa State University Press (1981); and, Jensen, Plant Breeding Methodology, John Wiley & Sons, Inc. (1988).

[00154] Mass Selection. In mass selection, desirable individual plants are chosen, harvested, and the seed composited without progeny testing to produce the following generation. Since selection is based on the maternal parent only, and there is no control over pollination, mass selection amounts to a form of random mating with selection. As stated above, the purpose of mass selection is to increase the proportion of superior genotypes in the population.

[00155] Synthetics. A synthetic variety is produced by crossing inter se a number of genotypes selected for good combining ability in all possible hybrid combinations, with subsequent maintenance of the variety by open pollination. Whether parents are (more or less inbred) seed-propagated lines, as in some sugar beet and beans (Vicia) or clones, as in herbage grasses, clovers and alfalfa, makes no difference in principle. Parents are selected on general combining ability, sometimes by test crosses or topcrosses, more generally by polycrosses. Parental seed lines may be deliberately inbred (e.g. by selfing or sib crossing). However, even if the parents are not deliberately inbred, selection within lines during line maintenance will ensure that some inbreeding occurs. Clonal parents will, of course, remain unchanged and highly heterozygous.

[00156] Whether a synthetic can go straight from the parental seed production plot to the farmer or must first undergo one or two cycles of multiplication depends on seed production and the scale of demand for seed. In practice, grasses and clovers are generally multiplied once or twice and are thus considerably removed from the original synthetic. [00157] While mass selection is sometimes used, progeny testing is generally preferred for polycrosses, because of their operational simplicity and obvious relevance to the objective, namely exploitation of general combining ability in a synthetic.

[00158] The number of parental lines or clones that enter a synthetic vary widely. In practice, numbers of parental lines range from 10 to several hundred, with 100-200 being the average. Broad based synthetics formed from 100 or more clones would be expected to be more stable during seed multiplication than narrow based synthetics.

[00159] Hybrids. A hybrid is an individual plant resulting from a cross between parents of differing genotypes. Commercial hybrids are now used extensively in many crops, including corn (maize), sorghum, sugarbeet, sunflower and broccoli. Hybrids can be formed in a number of different ways, including by crossing two parents directly (single cross hybrids), by crossing a single cross hybrid with another parent (three-way or triple cross hybrids), or by crossing two different hybrids (four-way or double cross hybrids).

[00160] Strictly speaking, most individuals in an out breeding (i.e., open-pollinated) population are hybrids, but the term is usually reserved for cases in which the parents are individuals whose genomes are sufficiently distinct for them to be recognized as different species or subspecies. Hybrids may be fertile or sterile depending on qualitative and/or quantitative differences in the genomes of the two parents. Heterosis, or hybrid vigor, is usually associated with increased heterozygosity that results in increased vigor of growth, survival, and fertility of hybrids as compared with the parental lines that were used to form the hybrid. Maximum heterosis is usually achieved by crossing two genetically different, highly inbred lines.

[00161] The production of hybrids is a well-developed industry, involving the isolated production of both the parental lines and the hybrids which result from crossing those lines. For a detailed discussion of the hybrid production process, see, e.g., Wright, Commercial Hybrid Seed Production 8:161-176, In Hybridization of Crop Plants.

ANIMAL FEED

[00162] In agriculture, animal feed or fodder is any foodstuff that is used specifically to feed domesticated livestock, including cattle, goats, sheep, horses, chickens and pigs. Most animal feed is from plants but some fodder is of animal origin. There are various types of fodder, including: hay, silage, stover and straw, oil cake and press cake, compound feed and premixes, often called "pellets" or "nuts", which may include yeast extract and sugars. Commonly grown plants used for hay are: ryegrass, Bermuda grass, timothy-grass, danthonia. Orchard grass and Brome grass. Commonly grown plants used for silage are: wheat, millet, fescue, soybeans, oats, barley, maize (corn), alfalfa (lucerne), sorghum, clovers, including red clover, white clover, and subterranean clover, brassicas, including chau moellier, kale, rapeseed, (Canola), rutabaga (swede) and turnips, and birdsfoot trefoil. High levels of bacteria can sometimes be found in fodder formulations, and potential contamination with bacteria that cause diarrhea, pulmonary inflammation, skin and organ abscesses, bacteremia, and mastitis of dairy cows has resulted in routine use of massive amounts of antibiotics in fodder as a prophylatic against these diseases (Teuber, 1999). In fact, half of the world production of antibiotics is estimated to be used in agriculture, and overuse of antibiotics is directly associated with the emergence of antibiotic resistant microbes (Levy, 1992). Alternative approaches that do not use antibiotics are urgently needed. PRESERVING CUT FLOWERS

[00163] Cut flowers are separated from their roots and therefore must have abundant water to keep them alive and from wilting. Normally, water is drawn from the root system through a network of hollow tubes called the xylem by the force of evaporative transpiration. As water evaporates from the leaves, a suction is placed on the xylem system, and water is forced upwards. The two primary enemies of cut flowers that shortens their life are bacteria and air bubbles. The nutrients that plants make naturally in the leaves flow downward to feed the roots, and these nutrients are now pumped into the water in the vase containing cut flowers. These nutrients support abundant bacterial growth within a few hours. Bacteria that normally would be kept outside the plant by an intact root system now are literally drawn into the plant through the water transpiration stream via the xylem. The bacteria eventually completely clog the xylem, shutting down transpiration, causing wilt and death of the flowers shortly thereafter. The best way to preserve cut flowers is to reduce or eliminate bacteria in the vase water. Antibiotics are typically not used, but methods that enhance a plant's natural resistance would be highly beneficial.

[00164] It should be understood that the examples and embodiments described herein are for illustrative purposes only and that various modifications or changes in light thereof will be suggested to persons skilled in the art and are to be included within the spirit and purview of this application.

EXAMPLES

[00165] Example 1 : Use of porcine pancreatic lipase in culture medium to degrade or compromise the LPS barrier of Xanthomonas pelargonii and to kill or inhibit this plant pathogen in combination with a lytic protein. Both commercially available ("Commercial") hen eggwhite lysozyme and Commercial porcine pancreatic lipase (both obtained from Sigma Chemical Co.) were evaluated in liquid culture medium for their effect on growth of Xanthomonas pelargonii, a Gram negative bacterial pathogen causing bacterial blight of geranium. A starting culture with an initial OD=O.06 was divided equally into four separate tubes. The lytic protein hen eggwhite lysozyme (10 Units/ml) and porcine pancreatic lipase (10 Units/ml) were separately added to two of the tubes, and both enzymes were added to a third. A fourth tube was kept as a control, and twelve hours later, the optical densities of all tubes were measured. The experiment was repeated three times and the results pooled. The control tubes achieved an optical density (OD) measured at 600 nm of OD=O.51. Both the lysozyme alone and the lipase alone significantly diminished growth rate. The tubes with lysozyme only grew very poorly and reached an OD=0.2. The tubes with porcine pancreatic lipase only reached a density of OD=0.44. When both enzymes were combined, there was no growth at all, but instead, death of the starter cells, resulting in a decline in optical density to OD=O.03. These results indicated that the mechanisms of action of both enzymes was quite different, and suggested that lipase removed, degraded or disabled the LPS barrier of the bacterium, allowing the lysozyme to efficiently breach the cell wall and permeabilize the inner membrane, resulting in lysis.

[00166] Example 2: Use of porcine pancreatic lipase in culture medium to degrade or compromise the LPS barrier of Xanthomonas pelargonii and to kill or disable this plant pathogen in combination with a phytoalexin. In order to confirm that lipase degraded or disabled the LPS barrier of the bacterium, porcine pancreatic lipase in combination with a Commercial, plant derived antimicrobial compound (a "phytoalexin") called berberine was used. Berberine (5,6-dihydro-9,10-dimethoxybenzo-l,3-benzodioxoloquino-lizimium, an alkaloid DNA intercalating agent; Schmeller et al., 1997), was added (5 micrograms/ml) to liquid culture medium in place of lysozyme in experiments identical to the above. Berberine is often used to assay for defects in the LPS barrier and/or efflux pumping ability of phytopathogenic bacteria (Reddy el al, 2007). Bacteria are sensitive to berberine in a concentration dependent manner. Any berberine that leaks through the LPS must be actively pumped out (effluxed) for bacterial survival; if either the LPS is breached or the efflux pumps are disabled, bacteria are unable to grow in the presence of berberine. Combined data from three experiments revealed that porcine lipase significantly affected survival of X. pelargonii in the presence of berberine, strongly indicating an effect of the lipase on the LPS barrier. Figure 1 shows optical densities of liquid cultures of X. pelargonii grown in the presence of porcine pancreatic lipase (PL), berberine chloride (Berb), both PL and Berb together, and in the same nutrient broth without the PL or Berb additives (Control).

[00167] Example 3 : Use of porcine pancreatic lipase in culture medium to degrade or compromise the LPS barrier of Xanthomonas albilineans and to kill or inhibit this plant pathogen in combination with a lytic protein. Both the Commercial lytic protein hen eggwhite lysozyme and Commercial porcine pancreatic lipase were evaluated in a manner similar to that described in Example 1 for their effect on growth of two different strains (Xa31Rl , and XaGPE) of Xanthomonas albilineans, a Gram negative bacterial pathogen causing leaf scald of sugarcane, in liquid culture medium. Two different strains were used because of significant differences in growth rates in liquid medium observed among the different strains. A starting culture of each strain with an initial OD=O.02 was divided equally into four separate tubes. Lysozyme and lipase were separately added to two of the tubes, and both enzymes were added to a third. A fourth tube was kept as a control, and twenty two hours later, the OD readings at 600 nm of all tubes were measured. Results of a typical experiment are recorded in the Table 1 below.

Table 1. Optical Density at 600 nm of culture grown X. albilineans in the presence of lipase and/or lysozyme.

Xa31Rl XaGPE

Control 0.9 0.6

Lipase 0.75 0.56

Lysozyme 0.65 0.25

Lipase + Lysozyme 0.45 0.2 [00168] As with Al pelargonii in Example 1, lysozyme alone significantly diminished growth of X. albilineans in comparison to the control, and so did the lipase alone, although to a lesser extent. When combined, there was an additive effect that diminished growth of this pathogen, but the effect was less than that observed with X. pelargonii. This result was repeated several times. This result extended the principle uncovered in Example 1 that strongly indicated that lipase removed, degraded or disabled the LPS barrier of Xanthomonas, this time using another, very different species of Xanthomonas.

[00169] Example 4: Use of porcine pancreatic lipase to degrade or compromise the LPS barrier of Xanthomonas vesicatoria and to kill or inhibit this plant pathogen in combination with a lytic protein. Both Commercial lytic protein hen eggwhite lysozyme and Commercial porcine pancreatic lipase were evaluated in a manner similar to that described in Examples 1 and 3 for their effect on growth of Xanthomonas vesicatoria, a Gram negative bacterial pathogen causing bacterial speck of tomato, in liquid culture medium. A starting culture with an initial OD=O.12 was divided equally into four separate tubes. Lysozyme and lipase were separately added to two of the tubes, and both enzymes were added to a third. A fourth tube was kept as a control, and twelve hours later, the OD readings at 600 nm of all tubes were measured. Results of a typical experiment are recorded in the Table 2 below.

Table 2. Optical Density at 600 nm of culture grown X. vesicatoria in the presence of lipase and/or lysozyme.

X. vesicatoria

Control 1.0

Lipase 1.0

Lysozvme 0.2

Lipase + Lysozyme 0.08

[00170] As with X. pelargonii and X. albilineans in Examples 1 and 3, respectively,, lysozyme significantly diminished growth of X albilineans in comparison to the control. When combined with lipase there was strong additional effect that not only stopped growth but also killed existing bacteria. This result was repeated several times and further extended the principle uncovered in Examples 1 and 3 that strongly indicated that lipase removed, degraded or disabled the LPS barrier of three different species of Xanthomonas, rendering these three bacterial species sensitive to lytic proteins and phytoalexins.

[00171] Example 5: Use of porcine pancreatic lipase to degrade or compromise the LPS barrier oϊXylella fastidiosa and to kill or disable this plant pathogen in combination with a phytoalexin. Similar experiments to those described in Example 2 were performed using the Gram negative plant pathogenic bacterium Xylella fastidiosa. This bacterium causes a variety of diseases, many of them severe, such as Pierce' s Disease of grape (the strain used in this example), and Citrus Variegated Chlorosis, a listed USDA Select Agent. Liquid cultures were started at an optical density (OD) of 0.06, and then the culture was divided into each of the four tubes. The results, expressed as OD readings after seven days of growth, clearly demonstrated a strong effect of porcine lipase on the LPS barrier of X. fastidiosa that was not obvious until combined with: 1) the plant phytoalexin, berberine, 2) a surfactant, Silwet L-77 (refer Reddy et al., 2007) or 3) the cell wall degrading enzyme lysozyme. Neither Silwet L77 (200 ppm) nor berberine chloride (5 micrograms/ml) had any significant effect on growth of the X. fastidiosa, unless procine lipase was also added. When porcine lipase (10 units/ml) plus Silwet L77 (200 ppm) were combined, there was a 35% reduction in optical density after seven days (OD=O.17), as compared with the X. fastidiosa grown in plain medium (OD=O.26) or plain medium combined with Silwet L77 at the same level (OD=O.25). When porcine lipase (10 units) plus berberine chloride (5 micrograms/ml) were combined, there was a 12% reduction in optical density after ten days (OD=O.29), as compared with the X. fastidiosa grown in plain medium or plain medium combined with berberine chloride at the same level (OD=O.33). When porcine lipase (10 Units) plus lysozyme (15 Units) were combined, there was a 31% reduction in optical density after seven days (OD=O.18), as compared with the X. fastidiosa grown in plain medium (OD=O.26) and a 22% reduction as compared with plain medium combined with lysozyme at the same level (OD=O.23). These results confirmed and extended results illustrated in Example 2 that lipase removed, degraded or disabled the LPS barrier of two different plant pathogenic genera, allowing both a surfactant and, more importantly, a phytoalexin to readily penetrate and kill X. fastidiosa cells.

[00172] Example 6: Use of porcine pancreatic lipase to degrade or compromise the LPS barrier of Ralstonia solanacearum and to kill or disable this plant pathogen in combination with a phytoalexin. Similar experiments to those described in Examples 2 and 5 were performed using the Gram negative plant pathogenic bacterium Ralstonia solanacearum. This bacterium causes severe wilt of many plants, and the severe disease, brown rot of potatoes, with world- wide losses estimated to exceed $1,000,000,000 per year; the threat posed to the U.S. potato industry by Race 3 Biovar 2 (R3B2) is considered so severe that R3B2 strains are listed USDA Select Agents (Gabriel et al, 2006). Liquid cultures of R. solanacearum were started at an optical density (OD) of 0.07, and then the culture was divided into each of the four tubes. The control tube reached an OD=O.9 after 19 hrs growth. The addition of berberine chloride (5 micrograms/ml) had little effect on growth of R. solanacearum, and the culture reached OD=O.85 after 19 hrs. Interestingly, addition of porcine pancreatic lipase (10 units/ml) had a slightly stimulatory effect on growth and caused the culture to reach OD=O.95 after 19 hrs. When porcine lipase (10 units) plus berberine chloride (5 micrograms/ml) were combined, there was a clearly synergistic effect to limit growth, with the culture reaching an OD=O.6 after 19 hrs. These results confirmed and extended results illustrated in Examples 2 and 5 that lipase removed, degraded or disabled the LPS barrier of three different plant pathogenic genera, allowing a phytoalexin to more readily penetrate the cells and limit growth and/or kill Gram negative bacterial cells.

[00173] Example 7: Use of porcine pancreatic lipase to degrade or compromise the LPS barrier of Pseudomonas fluorescens and to kill or disable this bacterium in combination with a lytic protein. Both Commercial lytic protein hen eggwhite lysozyme and Commercial porcine pancreatic lipase were evaluated in a manner similar to that described in Examples 1, 3 and 4 for their effect on growth of Pseudomonas fluorescens , a nonpathogenic Gram negative bacterium typically isolated from soil. Lysozyme alone diminished growth in comparison to the control (by 80%), and so did the lipase (by 25%). When combined, there was an additive effect on diminishing growth (by 97%). These results confirmed and extended results illustrated in Examples 1, 2, 3, 4, 5 and 6 that lipase degraded, disabled or compromised the LPS barrier of four different Gram negative bacterial genera, allowing lytic proteins and/or phytoalexins to penetrate the cell wall and either permeabilize or bypass the inner membrane, thereby lysing or killing the cells, and that the effect is not limited to plant pathogens. These results also suggested that the destructive effect of porcine pancreatic lipase on the LPS barrier is general for all Gram negative bacteria. [00174] Example 8: Use of porcine pancreatic lipase to degrade or compromise the LPS barrier of Escherichia coli and to kill or inhibit this animal pathogen in combination with a lytic protein. Both Commercial lytic protein hen eggwhite lysozyme and Commercial porcine pancreatic lipase were evaluated in a manner similar to that described in Examples 1 , 3, 4 and 7 for their effect on growth of E. coli, a Gram negative food-borne bacterial pathogen of animals and humans, some strains of which can cause severe enteric disease. A starting culture with an initial OD=O.05 was divided equally into four separate tubes. Lysozyme and lipase were separately added to two of the tubes, and both enzymes were added to a third. A fourth tube was kept as a control, and twelve hours later, the OD readings at 600 run of all tubes were measured. Results of a typical experiment are recorded in the Table 3 below.

Table 3. Optical Density at 600 nm of culture grown E. coli in the presence of lipase and/or lysozyme.

E. coli ER2267

Control 1.0

Lipase 0.7

Lysozyme 1.0

Lipase + Lysozyme 0.1

[00175] Unlike the other bacteria examined in Examples 1, 2, 3, 4, 5, 6 and 7, lysozyme did not significantly affect growth of E. coli in comparison to the control, although the lipase did. When the two enzymes were combined, however, there was a strong synergistic effect that diminished growth of this potential food-borne pathogen. This result was repeated several times. This result extended the principle uncovered in Examples 1, 2, 3, 4, 5, 6 and 7 that strongly indicated that porcine lipase removed, degraded or disabled the LPS barrier of Gram negative bacteria generally, including food-borne bacteria with the potential for pathogenicity of animals and humans, allowing the action of lytic proteins and/or phytoalexins to kill or lyse Gram-negative bacterial cells. [00176] Example 9: Use of Candida lipase to degrade or compromise the LPS barrier of Xanthomonas pelargonii and to kill or disable this plant pathogen in combination with a lytic protein. In order to determine if the results in Examples 1, 2, 3, 4, 5, 6, 7 and 8 were due to some special property of porcine pancreatic lipase, or rather a property of lipases generally, Commercial Candida lipase (obtained from Sigma Chemical Co. from a fungal source) was evaluated in liquid culture medium in place of porcine pancreatic lipase in a manner similar to that described in Example 1 for its effect on growth of Xanthomonas pelargonii. A starting culture with an initial OD=O.05 was divided equally into four separate tubes. Lytic protein hen eggwhite lysozyme (10 Units/ml) and Candida lipase (10 Units/ml) were separately added to two of the tubes, and both enzymes were added to another. One tube was kept as a control, and twelve hours later, the optical densities of all tubes were measured. The control tube achieved an optical density (OD) measured at 600 nm of OD=O.6 after 12 hrs. growth. Both the lysozyme and the Candida lipase alone significantly diminished growth, although Candida lipase reduced growth to a lesser extent. The tubes with lysozyme only achieved an average density of OD=O.20, while the tubes with Candida lipase achieved an average density of OD=.55. When combined, there was no growth of the starter cells (OD=O.07 after 12 hrs). These results demonstrated little difference between Candida lipase and porcine pancreatic lipase in terms of effect on the LPS barrier of Xanthomonas pelargonii, and strongly indicated that at least some lipases generally, and not just porcine lipase specifically, degrade the LPS of Gram negative bacteria.

[00177] Example 10: Use of recombinant DNA techniques to obtain a bovine pregastric esterase (PGE) gene from a natural source. Salivary glands were removed from a freshly slaughtered calf within 15 minutes of death. RNA from the salivary glands was immediately extracted from three different glands using RNAeasy (Qiagen). cDNA was prepared from RNA extracts from two of the salivary glands using Thermoscript reverse transcriptase and PCR primers IPG451 (5'-atgcccatggaacatatgatgtggtggctacttgtaaca-3') (SEQ ID NO.: 3) and IPG452 (5'-gcat cccggg eta gagctc ctttttgtcttcggccatcaa-3') (SEQ ID NO.: 4). The primers were designed to amplify the complete Bos lauriis (calf) PGE gene (GenBank Accession: L26319 [gi:600756]), and to introduce Ncol and Ndel enzymatic cloning sites upstream of the ATG translational start site, and also Smal and Sad enzymatic cloning sites downstream of the gene. The latter sites also served to add two additional amino acids to the native gene, forming an endoplasmic reticulum (ER) retention signal sequence. Independent PCR amplifications were made. The resulting PCR products were cloned into E. coli vector pGemT. Nine independently amplified calf lipase cDNA clones were sequenced. All of these clones contained the native calf secretion signal leader sequence. Besides several clones that carried variations that were specific to the given clone and were discarded as PCR artifacts, there were three variations from the published clone that were common among the nine lipase clones. These three are either natural variations among different calves or the published sequence has three errors. The discrepancies are not likely themselves errors, because multiple clones from independent PCR reactions of two independent salivary glands were sequenced, and several of these were identical to the consensus sequence . One of these, pIPG442-108, carrying the bovine PGE gene encoding the native PGE, with native N- terminal secretion signal and additional two C-terminal amino acids forming an ER retention signal (SEQ ID NO. 5), was selected for plant expression and for further manipulations. These results demonstrate that recombinant DNA can be used by one skilled in the art to readily obtain the DNA coding region for an animal esterase, provided the DNA sequence is known.

[00178] Example 11 : Use of recombinant DNA techniques to obtain a nematode triglyceride lipase-cholesterol esterase gene from a natural source. RNA was extracted from the culture- grown nematode Caenorhabditis elegans obtained from Carolina Biological Supply (Burlington, NC) using RNAeasy (Qiagen). cDNA was prepared from RNA extracts using Thermoscript reverse transcriptase and PCR primers IPG915 (5'- CAGCTGCATACGCcgaaaatgtcaccactcc -3') (SEQ ID NO.: 6) and IPG894 (5'- ttacgaaatagtatctggaag -3') (SEQ ID NO.: 7). The primers were designed to amplify the C. elegans triglyceride lipase-cholesterol esterase gene (GenBank Accession: NP_504755) without a leader sequence and to introduce ih&Pvull enzymatic cloning site upstream of the coding region, and also the Spel enzymatic cloning site downstream of the gene. Independent PCR amplifications were made. The resulting PCR products were cloned into E. coli vector pGemT. Four independently amplified cDNA clones were sequenced. Besides several clones that carried variations that were specific to the given clone and were discarded as PCR artifacts, the cloned gene was 98% identical to the published sequence. One of these, pIPG818, carrying the nematode triglyceride lipase-cholesterol esterase gene encoding the native nematode esterase (SEQ ID NO. 8), was selected for plant expression and for further manipulations. These results further demonstrate that recombinant DNA can be used by one skilled in the art to readily obtain the DNA coding region for a nematode esterase, provided the DNA sequence is known. [00179] Example 12: Use of recombinant DNA techniques to obtain a bacterial tributyrin esterase gene from a natural source. DNA was extracted from the culture-grown, Gram positive bacterium Lactococcus lactis subsp. cremoris using standard methods. PCR primers IPG922 (5'- ccATGGCAGTAATCAATATCGAA -3') (SEQ ID NO.: 9) and IPG923 (5'- TATTAACTCAATCGTTCTTCTTGC -3') (SEQ ID NO.: 10) were designed and used to amplify the complete Lactococcus lactis subsp. cremoris tributyrin esterase gene (GenBank Accession: AF 157601) and to introduce the Ncol enzymatic cloning site upstream of the ATG translational start site, and also the Spel enzymatic cloning site downstream of the gene. Independent PCR amplifications were made. The resulting PCR products were cloned into E. coli vector pGemT. Four independently amplified cDNA clones were sequenced. Besides several clones that carried variations that were specific to the given clone and were discarded as PCR artifacts, the cloned gene was identical to the published sequence. One of these, pIPG849, carrying the bacterial tributyrin esterase gene encoding the native bacterial esterase (SEQ ID NO. 1 1), was selected for plant expression and for further manipulations. These results demonstrate that recombinant DNA can be used by one skilled in the art to readily obtain the DNA coding region for a bacterial esterase, provided the DNA sequence is known. Taken together with Examples 10 and 11 , these results further demonstrate that recombinant DNA can be used by one skilled in the art to readily obtain the DNA coding region for any esterase, provided the DNA sequence is known.

[00180] Example 13: Use of recombinant DNA techniques to obtain a plant carboxylesterase gene from a natural source. RNA is extracted from the plant Arabidopsis thaliana using RNAeasy (Qiagen). cDNA is prepared from RNA extracts using Thermoscript reverse transcriptase and PCR primers IPG970 (5'- TCatgagtatctccggtgctg -3') (SEQ ID NO.: 12) and IPG971 (5'- ACTAGTtcaaccttcgaggctgag -3') (SEQ ID NO.: 13). The primers were designed to amplify the complete A. thaliana carboxylesterase gene (GenBank Accession: NM_203086) and to introduce the BspHl enzymatic cloning site upstream of the ATG translational start site, and also the Spel enzymatic cloning site downstream of the gene. Independent PCR amplifications are made. The resulting PCR products are cloned into E. coli vector pGemT. Independently amplified cDNA clones are sequenced. Clones that carry variations that are specific to the given clone are discarded as PCR artifacts. A clone with the consensus sequence is selected for plant expression and for further manipulations. [00181] Example 14: Use of recombinant DNA techniques to obtain a plant lipase gene from a natural source. RNA is extracted from the plant Arabidopsis thaliana using RNAeasy (Qiagen). cDNA is prepared from RNA extracts using Thermoscript reverse transcriptase and PCR primers IPG972 (5'- cccatggcttcttcactg -3') (SEQ ID NO.: 14) and IPG973 (5'- ACTAGTccctttatgtatccactg -3') (SEQ ID NO.: 15). are then used to amplify the complete A. thaliana plant lipase gene (GenBank Accession: ATU38916) and to introduce the Ncoϊ enzymatic cloning site upstream of the ATG translational start site, and also the Spel enzymatic cloning site downstream of the gene. Independent PCR amplifications are made. The resulting PCR products are cloned into E. coli vector pGemT. Independently amplified cDNA clones are sequenced. Clones that carry variations that are specific to the given clone are discarded as PCR artifacts. A clone with he consensus sequence is selected for plant expression and for further manipulations.

[00182] Example 15: Construction of a bovine PGE expression cassette in a plant expression vector. The CaMV promoter from pBI221 (Clontech, Palo Alto, CA) was enzymatically recloned into the polylinker cloning site of pCAMBIA0390 (Cambia, Canberra, AU), which has a left T-DNA border, the polylinker site, a NOS transcriptional terminator and right T-DNA borders, creating pIPG700. The bovine PGE gene, including the native leader sequence, was enzymatically recloned into pIPG700 downstream from the CaMV promoter and upstream from the NOS terminator, creating pIPG745. A 24 amino acid plant signal peptide derived from a protein known to accumulate in the citrus xylem, P12 (GenBank Accession # AFOl 5782; Ceccardi et al., 1998) was used to replace the native PGE leader. The xylem secretion signal peptide sequence was amplified from an appropriate plant source by PCR and cloned upstream of the mature lipase sequence, replacing the native PGE leader and resulting in a translational gene fusion between P12 and PGE (SEQ ID NO. 16 and SEQ ID NO. 17) on pIPG746. In order to enhance expression of the PGE constructs a citrus PAL promoter (Harakava, 2000) was also used, replacing the CaMV promoter. This PAL promoter (SEQ ID NO. 18) was cloned from citrus (sweet orange) by PCR and used to replace the CaMV promoter on pIPG746, forming pIPG781.

[00183] Clones pIPG745, pIPG746 and/or pIPG781 were used for transient expression assays in the dicots: tobacco, pepper, tomato, citrus and geranium, and in the monocot: rice.

[00184] The P12::PGE gene (SEQ ID NO. 17) was enzymatically recloned from pIPG746 into pC AMBIA 1305.2 (Cambia, Canberra, AU), such that the PGE gene was driven from the reverse CaMV promoter of pCAMBIAl 305.2, forming pIPG774. pCAMBIA1305.2 carries the hygromycin resistance gene driven by a dual CaMV promoter for plant selection. The P12::PGE gene (SEQ ID NO. 17) was also enzymatically recloned from pIPG746 into pCAMBIA2301 (Cambia, Canberra, AU), such that the PGE gene was driven from the reverse CaMV promoter of pCAMBIA2301, forming pIPG768.

[00185] In order to remove the artificially added ER retention signal, a 325 bp fragment of the 3' end of the PGE gene was PCR amplified from pIPG442-108 using IPG929 5'- cgaacggctgttaagtctgggaa (SEQ ID NO.: 19) and IPG928 5'- ccaactagtattactttttgtcttcggccatc (SEQ ID NO.: 20). The PCR product was digested with restriction enzymes Hind III and Spe I and ligated to pIPG442-108 digested with the same enzymes, resulting in pIPG831. The insert in pIPG831 was verified by sequencing and digested with Apa I and Spe I to release an 846 bp internal fragment of the bovine PGE gene. This 846 bp band was ligated to pIPG768 digested with Apa I and Spe I, resulting in the elimination of the final two amino acids of Seq ID 5 and resulting in pIPG852. The bovine PGE translation product encoded on pIPG852 has a P 12 signal sequence and lacks the added ER retention signal (SEQ ID NO. 21).

[00186] pCAMBIA2301 carries the kanamycin resistance gene driven by a dual CaMV promoter for plant selection. The dual CaMV promoter was disabled, in part, by replacing the minimal CaMV promoter used to drive PGE expression in both cases by the PAL promoter (SEQ ID NO. 18), forming pIPG782 and pIPG783. pIPG774 and pIPG782 were used for transformation and regeneration of geranium and rice. pIPG768 and pIPG783 were used for transformation and regeneration of tomato, and pIPG852 was used for transformation and regeneration of tobacco.

[00187] Example 16: Construction of a nematode triglyceride lipase-cholesterol esterase expression cassette in a plant expression vector. The CaMV promoter from pBI221 (Clontech, Palo Alto, CA) was enzymatically recloned into the polylinker cloning site of pCAMBIA0390 (Cambia, Canberra, AU), which has a left T-DNA border, the polylinker site, a NOS transcriptional terminator and right T-DNA borders, creating pIPG700. The P12 leader was cloned into pIPG700 using BamHl and Spel, creating pIPG701. The nematode triglyceride lipase-cholesterol esterase gene in pGEM-T was excised by digesting with Spel and Pvull . The excised fragment was ligated to pIPG701 digested with PvwII and Spel, resulting in pIPG823, carrying a translational gene fusion between P12 and nematode triglyceride lipase-cholesterol esterase (SEQ ID NO. 22). Clone pIPG823 was used for transient expression assays in tobacco and geranium.

[00188] Example 17: Use of plants to express active, correctly folded bovine PGE. For transient expression assays of bovine PGE, the plant transformation and expression vectors constructed in Example 15 were moved into A. tumefaciens strain GV2260 by either electroporation or bacterial conjugation as described (Kapila et al., 1997). GV2260 carrying pIPG745, pIPG746 or pIPG781 was used for transient expression in tobacco, pepper, tomato, citrus, geranium, and rice plants as described (Kapila et al. 1997; Duan et al., 1999; Wroblewski et al. 2005). Cultures of Agrobacterium harboring the constructs of interest were grown in minimal medium in the presence of acetosyringone to induce the Agrobacterium vir genes. The optical density of the cultures was maintained at 0.008 for pepper and tomato and at 0.25 for citrus, geranium and rice. Strain GV2260 was flooded into healthy, young, fully expanded leaves of vigorous plants into the apoplastic space through open stomata by injection using a tuberculin syringe without a needle, flooding entire leaves. After 3-4 days, two grams of leaf tissue (fresh weight), was ground in liquid nitrogen to a fine powder, and 0.5 ml of ice cold phosphate buffered saline (PBS; 137 mM NaCl, 2.7 mM KCl, 10 mM potassium phosphate, pH 7.4) was added and mixed thoroughly at 4 C. The mixture was mixed on an orbital shaker at 4 C for 30 minutes, and plant debris was pelleted at 10,000 X g for 15 minutes and discarded. The supematants from these crude plant leaf extracts were directly used in lipase/esterase assays.

[00189] Two lipase/esterase activity assays were used. The first was a rhodamine lipase assay using olive oil as a substrate as described by Jette & Ziomek (1994), with modifications. Briefly, a solution of 0.02% rhodamine (from a 2% rhodamine in ethanol stock) and 2.5% olive oil in water was mixed and sonicated thoroughly before use. The suspension was used to make agar plates, upon which 0.025 ml droplets from the crude plant extracts from leaf tissue inoculated with pIPG746 and empty vector control were placed. As a positive control, 0.025 ml droplets containing 20 U of Sigma porcine lipase was also placed, and the rhodamine agar plates incubated at 30 C overnight. Bright fluorescent spots were observed from both the porcine lipase control and from pIPG746. Lower intensity fluorescence was also observed from the empty vector controls. In order to quantify the difference, 0.2 ml of the rhodamine olive oil suspension was mixed with 0.1 ml of plant extract and allowed to incubate at 30 C for 24 hrs. Fluorescence was measured using a Tecan

SJ^ i v i /np -51- Spectraluor Plus spectrofluorimeter (excitation = 360 nm; emission = 535 nm). The results were that extracts from plant tissue inoculated with pIPG746 exhibited 17 - 43% higher fluorescence than the background fluorescence observed using extracts from plant tissue inoculated with the empty vector controls.

[00190] The second activity assay was a phenol red lipase/esterase assay using tributyrin, olive oil or Tween 20 as substrates as described by Singh et al. (2006), except that liquid medium, rather than solidified agar medium, was used. Twenty microliter droplets of crude plant leaf extracts and the positive control were placed in the tributyrin/phenol red medium containing tributyrin, olive oil or Tween 20 and incubated at 30 C overnight. In these assays, only the porcine lipase positive control and plant tissue inoculated with pIPG746 (cloned bovine PGE) exhibited the color change from red to bright yellow in the indicator tubes (refer Figure 2). Both the porcine lipase and the transiently expressed bovine PGE utilized all three substrates: tributyrin, olive oil and Tween 20. Transient expression of bovine PGE was confirmed in tobacco, pepper, tomato, citrus, geranium, and rice plants. These plant assays demonstrated that the bovine PGE gene cloned in Example 10 and operationally constructed for plant expression in Example 15 was expressed in all plants tested, whether monocot or dicot, in an enzymatically active form.

[00191] Example 18: Use of plants to express an active, correctly folded nematode triglyceride lipase-cholesterol esterase. For transient expression assays, the plant transformation and expression vectors constructed in Example 16 were moved into A. tumefaciens strain GV2260 by electroporation. GV2260 carrying pIPG823 was used for transient expression in tobacco and geranium plants exactly as described in Example 17. The supernatants from crude plant leaf extracts were directly used in phenol red lipase/esterase assays using tributyrin and olive oil as substrates exactly as described in Example 17. In these assays, only the porcine lipase positive control and plant tissue inoculated with pIPG823 (cloned nematode triglyceride lipase-cholesterol esterase) exhibited the color change from red to bright yellow in the indicator tubes (refer Figure 2). Both the porcine lipase and the transiently expressed nematode triglyceride lipase-cholesterol esterase utilized tributyrin and olive oil. Transient expression of bovine PGE was confirmed in both tobacco and geranium. These plant assays further demonstrated that active esterase cloned from any source and operationally constructed for plant expression can be expressed in all plants tested in an enzymatically active form, without evident injury to the plant. [00192] Example 19: Use of transient expression of PGE in sweet pepper plants to demonstrate inplanta degradation or compromise of the LPS barrier of four different Xanthomonas pathogens. Strain GV2260 carrying pIPG745 (PGE with native secretion signal and CaMV promoter), pIPG746 (PGE with citrus Pl 2 leader and CaMV promoter), pIPG781 (PGE with citrus P 12 leader and citrus PAL promoter) or empty vector control was first flooded into the apoplastic spaces of sweet pepper {Capsicum) leaves through open stomata by injection using a tuberculin syringe without a needle. An area of from 2 to 10 cm of leaf was flooded and the area inoculated was then circled with a permanent marker. This was followed 3 days later by challenge inoculations within the previously inoculated area, again by syringe injection, this time with ca. 2 X 10⁶ colony forming units (cfu) of various Xanthomonas pathogens, including X. citri, X. pelargonii, X. oryzae and X. vesicatoria grown in overnight cultures. This gave an inoculum density of Xanthomonas pathogen of about 2 X 10⁴ cfu/ cm². All Xanthomonas strains used were published reference strains of confirmed pathogens and all strains used are known to be very host specific: X. citri attacks only citrus and causes citrus canker disease, X. vesicatoria attacks only pepper and tomato and causes pepper and tomato speck disease, X pelargonii attacks only geranium and causes bacterial blight disease of geranium, X. oryzae attacks only rice and causes rice blight disease. (Plants that are attacked in nature are considered to be "hosts" of the indicated pathogens. All other plants are considered to be "nonhosts" of the indicated pathogens. When these same pathogens are inoculated at the indicated densities onto nonhost plants or onto host plants carrying certain resistance (R) genes, a rapid hypersensitive response (HR), is observed. The HR appears as a confluent, necrotic, collapsed zone at the inoculation site within 24 - 48 hrs.).

[00193] Results were assessed visually according to presence or absence of HR symptoms observed after 48 hrs for Xanthomonas inoculations on non-host (in the cases of X. citri, X. pelargonii and X. oryzae) or resistant host (in the case of X. vesicatoria) pepper plants. In all cases, a "split leaf assay was used in which pIPG745, pIPG746 or pIPG781 were inoculated on one half of the leaf and the empty vector control was inoculated on the other half of the same leaf. In repeated experiments; HR symptoms were abolished in the presence of transiently expressed bovine PGE on pIPG746 or pIPG781. Similar results were observed for all Xanthomonas strains tested, without exception, including X. citri, X. vesicatoria and X, oryzae, demonstrating that all of these diverse Xanthomonas pathogens were either killed or disabled from eliciting the HR on sweet pepper. In Figure 3 is shown a representative experiment using X. pelargonii on pepper and the effect of bovine PGE using a plant secretion signal on pIPG746. Inoculated within the solid white lines were A. tumefaciens GV2260/pIPG746. Inoculated within the broken white lines 48 hrs later (to give time for transient gene expression) was X. pelargonii strain CHSC. The photo was taken 48 hrs. after inoculation with X. pelargonii.

[00194] Similarly, pIPG745, carrying the native bovine PGE secretion signal, reduced the HR of all tested Xanthomonas strains.

[00195] These results confirmed that enzymatically active, cloned bovine PGE was transiently expressed in a wide variety of both dicot and monocot plants and demonstrated that bovine PGE was efficacious in killing multiple different Xanthomonas species in planta.

[00196] Example 20; Use of transient expression of PGE in sweet pepper plants to demonstrate in planta degradation or compromise of the LPS barrier of Ralstonia solanacearum. In order to determine if Ralstonia pathogens were also affected by PGE expressed in plants, assays identical to those described in Example 20 were performed, this time using Ralstonia solanacearum. R. solanacearum also elicits an HR on sweet pepper, which is a nonhost of the pathogen. Again, and as with all tested Xanthomonas pathogens, HR symptoms that would ordinarily appear 2 days after inoculation were abolished in the presence of transiently expressed bovine PGE on pIPG746 or pIPG781, demonstrating that different Gram-negative pathogenic genera were either killed or disabled from being able to elicit the HR on sweet pepper. Combined with Examples 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18 and 19, these results demonstrated or strongly suggested that expression of lipase in plants would result in the killing or growth inhibition of all Gram negative bacterial genera tested, including Xanthomonas, Xylella, Ralstonia, Pseudomonas and Escherichia, since plants naturally produce phytoalexins such as berberine on infection. When all Examples are taken together, these results demonstrate that lipase (e.g., PGE), can be expressed in plants for the purpose of killing or pathogenically disabling many different Gram-negative pathogenic genera.

[00197] Example 21 : Use of transient expression of PGE in geranium {Pelargonium X hortorum), a natural host plant, to demonstrate in planta degradation or compromise of the LPS and resistance to X. pelargonii. Florist's geranium {Pelargonium X hor tor um) plants were used in transient expression assays because these plants are a host of X. pelargonii. This was done in order to confirm that the killing or disabling of this pathogen's ability to elicit an HR on nonhosts also extended to pathogens of susceptible host plants. Assays identical to those described in Examples 19 and 20 above were performed using florist's geranium plants, except that for these pathogenicity assays in a plant that is highly susceptible to disease from this pathogen, the results were examined daily for a period of from 2 to 7 days after challenge inoculation. Again, the results were similar to those described for the HR in Examples 19 and 20. Pathogenic symptoms caused by X. pelargonii were greatly reduced when pIPG746 or pIPG781 were used. These results confirmed and extended the concept that lipase/exterase can be expressed in plants for the purpose of killing or disabling Gram-negative pathogenic bacteria to include host plants, most likely due to the combined effects of native phytoalexins produced by the host plant and transient expression of bovine PGE to disable the LPS barrier of these pathogens.

[00198] Example 22: Use of transient expression of PGE in transgenic geranium (Pelargonium X horlorum) expressing a phage endolysin to demonstrate enhanced disease resistance against both X. pelargonii and R. solanacearum by combining two anti-microbial agents.

[00199] AnX pelargonii phage, P15, was completely sequenced (GenBank NC_007024) and the endolysin gene, lysY (GenBank Accession YP_239293) identified and cloned in pGemT without a promoter. To determine if lysY from phage 15 had enzymatic peptidoglycan degrading activity similar to that of lysozyme, lysY was recloned into a modified pET27b expression vector (Novagen) and was expressed in E.coli by inducing with IPTG (Isopropyl beta-D-thiogalactoside). The induced culture was treated with chloroform (2% final concentration) as described by Garcia et αl. (2002). Since the pelB leader was not present in the clone, the expressed endolysin protein was not exported to the periplasm. The chloroform treatment helps in permeabilizing the membrane (similar to holin action in a natural phage infection) so that the endolysin can cross the membrane barrier and attack the murein layer. Lysis of the bacteria was observed only after treatment with chloroform. All attempts to clone the endolysin gene into pET27b with apelB leader sequence failed, demonstrating peptidoglycan degrading activity of the endolysin.

[00200] The citrus PAL promoter (SEQ ID NO. 18) was used to functionally express a translational gene fusion with Pl 2 as the N-terminal leader, lysY in the middle end and GUS at the C-terminal end (eg., ? 12: :lys Y: :GV S) in a modified pCAMBIA 1302 vector, forming pIPG492. Over 20 independent transgenic geranium (Pelargonium Xhortorum) var. "Avenida" plants expressing P12::/y,sF::GUS were created. After demonstrating that the plants were transgenic by PCR, GUS activity assays were performed on leaves and root segments of all plants.

[00201] Selected transgenic plants of line Avenida 696 that yielded strong GUS positive leaves and root sections were vegetatively propagated and tested for resistance to two important pathogens of geranium, X. pelargonii and to R. solanacearum. None of these transgenic Avenida 696 plants consistently exhibited resistance to either pathogen, either in terms of symptom reduction or in terms of cell counts taken from inoculation zones from Day 0 to Day 3 after inoculation (refer Example 19). Vegetatively propagated clones of these same Avenida 696 transgenic plants were used in transient expression assays using pIPG746 that were identical to those described in Examples 19, 20 and 21 above, except that in addition to symptom observation, cell counts of the pathogen were recorded daily from Day 0 to Day 3 following inoculation. Results from cell counts taken on Day 3 after inoculation in six separate experiments are summarized below:

X. pelargonii L. solanacearum cfu/cm^'

NT Avenida/emptv l,000,00C 1,000,000 vector

NT Avenida/pIPG746 100,000 - 1,000,000

500,000

(PGE only)

Avenida 696/empty 1,00O₅OOC 1,000,000 vector

(endolysin only)

Avenida 696/pIPG746 100,000

10,000

(PGE + endolysin) [00202] Again, pathogenic symptoms caused by X. pelargonii were greatly reduced when pIPG746 was used for transient expression, either in transgenic Avenida 696 geraniums (expressing endolysin fused with GUS) or in nontransgenic (NT) Avenida geraniums as in Example 21. Interestingly, cell counts of X. pelargonii were only reduced by two fold to ten fold in the nontransgenic (NT) Avenida plants (depending on the experiment). However, and confirming the results of earlier examples using PGE and lysozyme, there was clear synergism between the PGE and the endolysin inplanta, resulting in a dramatic IOOX drop in cell count when the LPS was degraded by the PGE, allowing the endolysin to attack the cell wall and natural plant phytoalexins easier access to the invading pathogenic bacterium.

[00203] Indeed, these results were confirmed by the cell counts taken from a second pathogen, R. solanacearum, which did not show any apparent reduction of symptoms in the presence of transiently expressed PGE, even on the transgenic Avenida 696 geraniums. However, the Avenida 696 plants transiently expressing PGE showed a 1OX reduction in R. solanacearum cell count, demonstrating a synergistic effect of PGE and cell wall degrading endolysin.

[00204] Taken together, these results confirmed and extended the concept that lipase/exterase can be expressed in plants for the purpose of killing or disabling Gram- negative pathogenic bacteria to include host plants, most likely due to the combined effects of native phytoalexins produced by the host plant and lipase/esterase disabling the LPS barrier of these pathogens. These results also strongly indicated that additional anti-microbial peptides and/or enzymes, in combination with PGE, could be beneficially "stacked" and utilized to enhance the antimicrobial effect of attacking the LPS using lipase/esterase.

[00205] Example 23: Use of transgenic geranium (Pelargonium X hortorum) plants to express enzymatically active bovine PGE. Transgenic geranium (Pelargonium X hortorum) plants expressing bovine PGE were created using three different methods: Agrobacteήum tumefaciens, Rhizobium spp. and the silicon carbide powder method of PCT/US2006/041702 using the bovine PGE gene cloned into pIPG774 or pIPG782. The most efficient methods for production of transgenic geraniums were either A tumefaciens (Robichon et ah, 1995), or Rhizobium spp (modified from Robichon et ah, 1995), both which yielded 1% PCR positive petiole explants out of total petiole explants subjected to the transformation protocols. A total of 14 transgenic geranium plants were obtained, based on PCR amplification of the bovine PGE gene (refer Figure 4). After demonstrating that the plants were transgenic by PCR, phenol red lipase/esterase assays were performed using ground leaf tissue as described in Example 17 and illustrated in Figure 2 to ensure gene expression. In a typical experiment, 100% of transgenic (PCR positive) geraniums expressed a moderate to high level of bovine PGE. Selected plants were quantitatively tested for level of PGE expression, asexually reproduced and challenge inoculated with different pathogens as described below. These results demonstrated that the bovine PGE gene could be stably transformed and expressed in geraniums, resulting in enzymatically active esterase activity in geranium leaf tissue.

[00206] Example 24: Use of transgenic tomato plants to express enzymatically active bovine PGE. Transgenic tomato plants expressing bovine PGE were created using Agrobacterium tiimefaciens (Robichon el ah, 1995) and the bovine PGE gene cloned into pIPG768 or pIPG783 at an efficiency of 3% (ie., 3% of all leaf piece explants yielded PCR positive rooted shoots) in a typical transformation experiment. A total of 15 transgenic tomato plants were obtained, based on PCR amplification of the bovine PGE gene (refer Figure 4). After demonstrating that the plants were transgenic by PCR, phenol red lipase/esterase assays were performed using ground leaf tissue as described in Example 17 and illustrated in Figure 2 to ensure gene expression. In a typical experiment, 100% of PCR positive tomato plants expressed a moderate to high level of bovine PGE. Selected plants were quantitatively tested for level of PGE expression, asexually reproduced and challenge inoculated with different pathogens as described below. These results demonstrated that the bovine PGE gene could be stably transformed and expressed in tomato, resulting in enzymatically active esterase activity in tomato leaf tissue.

[00207] Example 25: Use of asexually reproduced progeny of transgenic geranium and tomato plants to express enzymatically active PGE. Transgenic geranium plants were obtained as set forth in Example 23, and transgenic tomato plants were obtained as set forth in Example 24, wherein the transgenic plants expressed the introduced nucleic acid molecule encoding an enzymatically active bovine PGE protein as evidenced by phenol red lipase/esterase activity assays using ground tissue as described in Example 17 and illustrated in Figure 2. The transgenic geranium and tomato plants were asexually propagated to produce progeny clones using techniques well known to one skilled in the art of geranium or tomato propagation. For geranium, tomato and other vegetative species that are normally propagated by taking cuttings, an internode with two nodes are cut from a mother plant and rooted, normally using a support medium, with or without root inducing hormones, producing a single new plant for each such clone or "cutting". The cuttings were in all cases genetically identical to the mother plant (ie., 100% PCR positive for bovine PGE and 100% positive for PGE activity by phenol red assay). These results demonstrated that the genetic modifications performed in the mother plant were stable through at least two asexual generations, based on continued production of active bovine PGE enzyme as evidenced by phenol red lipase/esterase assays in Example 17 and illustrated in Figure 2

[00208] Example 26: Use of sexual reproduction to stably propagate transgenic plants expressing active bovine PGE. Transgenic diploid tomato plants were obtained as set forth in Example 24, wherein the transgenic plants expressed active bovine PGE. Several parental To plants were selected and allowed to flower and self-pollinate. The seed was harvested from the self-pollinated plants, processed, planted, and Ti generation progeny plants grown. The first T) result from a single self-pollinated transgenic plant was 15 PCR positive to 10 PCR negative, which most closely fits a 3:1 ratio. In all cases examined, the seed exhibited a 3:1 ratio of PCR positive to PCR negative, demonstrating that the nucleic acid molecule carrying the gene encoding the bovine PGE was present in a single copy. (If the DNA had been present in two copies, for example, the ratio would be 15:1 of PCR positive to PCR negative). These tests demonstrated that that the introduced nucleic acid molecules encoding active bovine PGE were stably integrated into tomato using the methods of the present invention and that such nucleic acid molecules are stably heritable.

[00209] Example 27: Use of bovine PGE expressed in transgenic geranium (Pelargonium X hortoruni) host plants to confer resistance to X. pelargonii. Pathogen challenge inoculations of transgenic Florist's geranium {Pelargonium X hortoruni) plants expressing active bovine PGE enzyme of Example 23 and of asexually propagated Florist's geranium plants expressing active bovine PGE enzyme of Example 25 were conducted using X. pelargonii . The transgenic parental or asexually produced progeny clones obtained from the transgenic parental plants killed X. pelargonii cells and controlled disease symptoms. Inoculations were performed using liquid culture grown X. pelargonii cells sprayed on the leaves at a concentration of 10⁷ colony forming units per milliliter (cfu/ml) and also using scissors dipped in 10⁹ cfu/ml of cells to clip the leaves in several places. Following inoculation, plants were held at 32° C to encourage pathogen growth and symptom development. Four weeks after inoculation, photographs were taken of both transgenic geranium expressing enzymatically active bovine PGE (Figure 5) and nontransgenic (Figure 6) geranium plants of the same variety, and circular sections totaling 1 square centimeter (cm²) were removed using a cork borer from three inoculated leaves in the area most likely to contain pathogen cells (refer Figures 5 and 6). Consistently, 10⁵ cfu/ml of pathogen was recovered from nontransgenic plants at four weeks after inoculation (Figure 5), and symptoms progressed systemically until the entire plant was dead, usually by 12 weeks after inoculation. A range of from 10 - 1000 cfu/ml (most typically, 100 cfu/ml) of pathogen was recovered from transgenic plants expressing bovine PGE (Figure 6), and symptoms failed to progress or progressed only partially, killing a portion of the leaf, but the disease never became systemic. These tests confirm that the introduced nucleic acid molecules coding for the PGE proteins have been stably integrated into geranium using the methods of the present invention, and demonstrate that transgenic geraniums, whether vegetatively propagated or not, are resistant or immune from disease caused by X. pelargonii.

[00210] These results further demonstrate that transgenic geraniums expressing esterase, whether vegetatively propagated or not, kill off X. pelargonii. These results also confirm and extend the demonstration of disruption of the LPS of Gram negative bacteria generally, as anticipated from tests of cells grown in culture in Examples 1, 2, 3, 4, 5, 6, 7, 8 and 9, and that such LPS disruption results in resistance to disease as anticipated from transient expression assays in Examples 19, 20, 21 and 22.

[00211] These results, combined with the results regarding the use of porcine pancreatic lipase in Examples 1, 2, 3, 4, 5, 6, 7 and 8, Candida lipase in Example 9, bovine pregastric esterase in Examples 19, 20, 21 and 22 and this Example 23 to degrade or compromise lipase to kill bacteria, whether plant pathogenic or not lead us to anticipate that transgenic geranium and tomato expressing esterases generally, including but not limited to PGE, and whether said transgenic plants are vegetatively propagated or not, will either naturally through the action of plant phytoalexins and phytoanticipins or with the assistance of an additional lytic protein transgenically expressed, kill off all Gram negative bacteria, including but not limited to plant and animal pathogens, including but not limited to, X. vesicatoria and R. solanacearum.

[00212] Example 28: Use of transgenic tobacco plants to express enzvmatically active bovine PGE lacking the ER retention signal sequence. Transgenic tobacco plants expressing bovine PGE lacking the ER retention signal sequence were created using Agrobacterium tumejaciens (Robichon el al,, 1995) and the bovine PGE gene cloned into pIPG852 at an efficiency of 6% (ie., 6% of the tobacco leaf explants were PCR positive) in a typical experiment. A total of 26 transgenic tobacco plants were obtained, based on PCR amplification of the bovine PGE gene (refer Figure 4). After demonstrating that the plants were transgenic by PCR, phenol red lipase/esterase assays were performed using ground leaf tissue as described in Example 17 and illustrated in Figure 2 to ensure gene expression. In a typical experiment, 100% of PCR positive tobacco plants expressed a moderate to high level of bovine PGE. Selected plants were quantitatively tested for level of PGE expression. These results demonstrated that the bovine PGE gene without the added ER retention signal sequence could be stably transformed and expressed in tobacco, resulting in enzymatically active esterase activity in tobacco leaf tissue.

[00213] These results, combined with the results regarding the use of lipase and PGE in the above Examples, particularly Examples 6 and 20 to degrade the LPS of R. solanacearum, lead us to anticipate that transgenic tobacco plants expressing esterases, including but not limited to PGE, and whether said transgenic plants are vegetatively or sexually propagated, will either naturally or with the assistance of an additional lytic protein, kill off all Gram negative bacteria, including but not limited to plant and animal pathogens, including but not limited to, R. solanacearum

[00214] These results, taken together with the examples of expression of enzymatically active PGE in two other dicots (geranium and tomato), lead us to anticipate that all transgenic dicot plants are capable of expressing active PGE and that said transgenic plants, whether vegetatively or sexually propagated, will either naturally or with the assistance of an additional lytic protein, kill off all Gram negative bacteria, including but not limited to plant and animal pathogens.

[00215] Example 29: Use of transgenic rice plants to express enzymatically active bovine PGE. Transgenic rice plants expressing bovine PGE were created using Agrobacterium tumefaciens (Hiei et al., 1997) carrying the bovine PGE gene cloned into pIPG774 or pIPG782 at an efficiency of 16% (i.e., 16% of the callus pieces derived from an individual rice grain were PCR positive) in a typical experiment. A total of 16 transgenic rice plants were obtained, based on PCR amplification of the bovine PGE gene (refer Figure 4). After demonstrating that the plants were transgenic by PCR, phenol red lipase/esterase assays were performed using ground leaf tissue as described in Example 17 and illustrated in Figure 2 to ensure gene expression of enzymatically active protein. In a typical experiment, 100% of PCR positive rice plants expressed low levels of bovine PGE. Selected plants were quantitatively tested for level of PGE expression. These results demonstrated that the bovine PGE gene could be stably transformed and expressed in rice, resulting in enzymatically active esterase activity in rice leaf tissue.

[00216] These results, taken together with the examples of expression of enzymatically active PGE in three dicots (geranium, tomato and tobacco), lead us to anticipate that all transgenic plants, whether monocot or dicot, are capable of expressing active PGE and that said transgenic plants, whether vegetatively or sexually propagated, will either naturally or with the assistance of an additional lytic protein, kill off all Gram negative bacteria, including but not limited to plant and animal pathogens.

[00217] Example 30: Method of Using Esterase Proteins Expressed in Transgenic Plants to Extend the Shelf-Life of Cut Flowers. We anticipate that lipase or esterase proteins, when produced in transgenic plants that are typically marketed as cut flowers, such as roses, carnations, chrysanthemums, gladiolas, etc., will enhance longevity of the cut transgenic flowers by suppressing bacterial growth in the vase water caused by opportunistic or soft- rotting bacteria such as Erwinia carotovora and Erwinia chrysanthemi. Transgenic plants that will later be marketed as cut flowers will be produced by methods described in the above examples.

[00218] Example 31 : Method of Using Esterase Proteins as an Additive to Extend the Shelf Life of Cut Flowers and Animal Feed. We anticipate that lipase or esterase proteins, possibly in combination with lytic proteins, when added to the vase or shipping container water of nontransgenic plants that are typically marketed as cut flowers, such as roses, carnations, chrysanthemums, gladiolas, etc., will enhance longevity of the cut transgenic flowers by suppression of fungal and bacterial growth in the vase water. Typical microbial species that shorten the shelf life of cut flowers are Erwinia carotovora and Erwinia chrysanthemi. For example, we anticipate that adding a dried protein to water used to sustain cut flowers will result in a longer shelf-life for the cut flowers when compared to cut flowers sustained in water from the same source without the addition of the dried protein.

[00219] The lipases or esterases will most likely be produced in transgenic plants. Crude extracts of protein will be harvested, and either dried using a granular additive or suspended in an appropriate liquid and packaged. In another example, when the dried protein is added to animal feed, it will control microbial contamination, including those microbes that may cause food poisoning. A dry or liquid preparation of lipase or esterase proteins could be added to animal feed during factory preparation or afterwards by the animal owner by mixing. Either way, the result will be a longer shelf life of the feed and reduced opportunity for growth of microbes that can result in food poisoning.

[00220] Example 32: Method of Using Lipase or Esterase Proteins in a Foliar Spray or Soil Drench Application to Control Microbial Plant Diseases. We anticipate that a dried protein preparation of Example 31 may be formulated for spray application to the foliage of nontransgenic plants in order to control Gram negative diseases of said plants. For example, we anticipate that when the dried protein preparation of Example 31 is sprayed onto greenhouse grown plants or field crop plants, it will control Gram negative bacterial diseases that infect the foliage of these plants, by the combined action of the esterase with natural plant defense compounds. When the dried protein preparation is formulated for soil drench application to nontransgenic plants, we anticipate it will control soil-borne Gram negative bacterial diseases of said plants. For example, when the dried protein is dissolved in water and used to treat the soil of greenhouse grown plants or field crops, we anticipate it will control bacterial diseases that infect the roots or crown areas of these plants by the combined action of the enzymes and natural plant defense compounds.

[00221] Example 33: Method of Using Lipase and Esterase Proteins in Transgenic Plants to Control Gram-Negative Bacteria, Whether Disease Agents of Plants or Not. We anticipate that when transgenic plants producing enzymatically active lipase or esterase, possibly in combination with production of a lytic protein, are planted in field situations, they will exhibit resistance to Gram negative bacterial diseases of said plants. Resistance in all cases is anticipated to be achieved through the combined action of natural defense compounds produced by the transgenic plants and the Lipase or Esterase enzyme, together with any lytic enzymes produced by the transgenic plants.

[00222] It must be noted that as used in this specification and the appended claims, the singular forms "a," "and," and "the" include plural referents unless the contexts clearly dictates otherwise. Thus, for example, reference to "a lipase" includes any one, two, or more of the lipases encoded by genes in at least 35 different families; reference to "a transgenic plant" includes large numbers of transgenic plants and mixtures thereof, and reference to "the method^"' includes one or more methods or steps of the type described herein. [00223] Unless defined otherwise, all technical and scientific terms herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although any methods and materials, similar or equivalent to those described herein, can be used in the practice or testing of the present invention, the preferred methods and materials are described herein. All publications cited herein are incorporated herein by reference for the purpose of disclosing and describing specific aspects of the invention for which the publication is cited.

[00224] The publications discussed herein are provided solely for their disclosure prior to the filing date of the present application. Nothing herein is to be construed as an admission that the present invention is not entitled to antedate such publication by virtue of prior invention.

[00225] While the invention has been described in connection with specific embodiments thereof, it will be understood that it is capable of further modifications and this application is intended to cover any variations, uses, or adaptations of the invention following, in general, the principles of the invention and including such departures from the present disclosure as come within known or customary practice within the art to which the invention pertains and as may be applied to the essential features hereinbefore set forth and as follows in the scope of the appended claims. LITERATURE CITED

[00226] Arce P et al. 1999. Enhanced resistance to bacterial infection by Erwinia carotovora subsp. Atroseptica in transgenic potato plants by expressing the attacin or the cecropin SB-37 genes. American Journal of Potato Research 76:169-177.

[00227] Ahn, J. M. et al. 2004. Probing lipase/esterase libraries for lipid A hydrolases — discovery of biocatalysts for the detoxification of bacterially-expressed recombinant protein. Chem. Commun. 2004:364-365

[00228] Brick, DJ. et al. 1995. A new family of lipolytic plant enzymes with members in rice, arabidopsis and maize. FEBS Letters 377:475-480.

[00229] Bornscheuer, U. T. 2002. Microbial carboxyl esterases: classification, properties and application in biocatalysis. FEMS Microbiology Reviews 26:73-81. [00230] Broekaert, W.F. et a 1997. Antimicrobial peptides from plants. Critical Reviews in Plant Sciences 16:297-323.

[00231] Broothaerts, W. et ah, 2005. Gene transfer to plants by diverse species of bacteria.

Nature 433:629-633.

[00232] Callis, J., M. Fromm, and V. Walbot. 1987. Introns increase gene-expression in cultured maize cells. Genes & Development 1 :1183-1200.

[00233] Calvo, M.V. and Fontecha, J. 2004. Purification and characterization of a pregastric esterase from a hygienized kid rennet paste. J. Dairy Sci. 87:1132-1142.

[00234] Ceccardi, T. L., G. A. Barthe, and K. S. Derrick. 1998. A novel protein associated with citrus blight has sequence similarities to expansin. Plant Molecular Biology 38:775-783

[00235] Cepeljnik, T., Rincon, M. T., Flint, H. J., and Marinsek-Logar, R. 2006. Xynl IA, a multidomain multicatalytic enzyme from P seudobutyri vibrio xylanivorans Mz5(T). Folia Microbiologica 51 :263-267.

[00236] Del Sorbo, G., Schoonbeek, FL-J., and De Waard, M. A. 2000. Fungal transporters involved in efflux of natural toxic compounds and fungicides. Fungal Genet. Biol. 30: 115.

[00237] Desnuelle, P. and Savary, P. 1963. Specificity of lipases. J. Lipid Research 4:309- 384.

[00238] Dixon, R. A. 2001. Natural products and plant disease resistance. Nature 411 :843- 847.

[00239] Doyle, M. P. 2000. Reducing foodborne disease: What are the priorities? Nutrition 16:647-649.

[00240] Duan YP et a 1999. Expression of a single, host-specific gene in citrus cells elicits division, enlargement and cell death. Molecular Plant-Microbe Interactions 12:556-560

[00241] During K et a 1993. Transgenic potato plants resistant to the phytopathogenic bacterium Erwinia carotovora. Plant J 3:587-598

[00242] During, K., P. Porsch, A. Mahn, O. Brinkmann, and W. Gieffers. 1999. The non- enzymatic microbicidal activity of lysozymes. FEBS Letters 449:93-100. [00243] Frey, M., Chomet, P., Glawischnig, E., Stettner, C₅ Grϋn, S., Winklmair, A., Eisenreich, W., Bacher, A., Meeley, R. B., Briggs, S. P., Simox, K., and Gierl, A. 1997. Analysis of a chemical plant defense mechanism in grasses. Science 277:696-699.

[00244] Gabriel, D.W., Allen, C, Schell, M., Denny, T.P., Greenberg, J.T., Duan, Y.P., Flores-Cruz, Z., Huang, Q., Clifford, J.M., Presting, G., Gonzalez, E.T., Reddy, J.D., Elphinstone, J., Swanson, J., Yao, J., Mulholland, V., Liu, L., Farmerie, W., Patnaikuni, M., Balogh, B., Norman, D., Alvarez, A., Castillo, J.A., Jones, J., Saddler, G., Walunas, T., Zhukov, A., Mikhailova, N. 2006. Identification of open reading frames unique to a Select Agent: Ralstonia solanacearum race 3 biovar 2. Molec. Plant-Microbe Interact. 19:69-79.

[00245] Glazebrook, J., and Ausbel, F. M. 1994. Isolation of phytoalexin-deficient mutants of Arabidopsis thaliana and characterization of their interactions with bacterial pathogens. Proc. Nat. Acad. Sci. U.S.A. 91 :8955-8959.

[00246] Gordillo, F., Caputo, V., Peirano, A., Chavez, R., Van Beeumen, J., Vandenberghe, L, Claeyssens, M., Bull, P., Ravanal, M. C, and Eyzaguirre, J. 2006. Penicillium purpurogenum produces a family 1 acetyl xylan esterase containing a carbohydrate-binding module: characterization of the protein and its gene. Mycological Research 1 10:1129-1139

[00247] Grayer, R. J., and J. B. Harbome. 1994. A survey of antifungal compounds from higher plants, 1982-1993. Phytochemistry 37:19-42.

[00248] Gruber, V., Berna, B.P., Arnaud, T., et al. 2001. Large-scale production of a therapeutic protein in transgenic tobacco plants: effect of subcellular targeting on quality of a recombinant dog gastric lipase. Molec. Breeding 7:329-340.

[00249] Gupta, R., Rathi, P., Gupta, N., Bradoo, S. 2003. Lipase assays for conventional and molecular screening: an overview. Biotechnol. Appl. Biochem. 37:63-71

[00250] Hammerschmidt, R. 1999. Phytoalexins: what have we learned after 60 years? Annu. Rev. Phytopathol. 37:285-306.

[00251] Harbome, J. B. 1999. The comparative biochemistry of phytoalexin induction in plants. Biochem. Syst. Ecol. 27:335-367. [00252] Hiei Y, Komari T, Kubo T., 1997.. Transformation of rice mediated by Agrobacterium tumefaciens . Plant MoI Biol. 35:205-18.

[00253] Ibrahim, H. R., Thomas, U., and Pellegrini, A. 2001. A helix-loop-helix peptide at the upper lip of the active site cleft of lysozyme confers potent antimicrobial activity with membrane permeabilization action. J. Biol. Chem. 276:43767-43774.

[00254] Jaynes JM et al. 1987. Increasing bacterial disease resistance in plants utilizing antibacterial genes from insects. Bioassays 6:263-270

[00255] Jaeger, K. E. and Reetz, M.T. 1998. Microbial lipases form versatile tools for biotechnology. Trends Biotechnol. 16:396-403.

[00256] Jette, J. F. and Ziomek, E.1994. Determination of lipase activity by a Rhodamine- Triglyceride-Agarose assay. Analytical Biochemistry 219:256-260.

[00257] Kapila, J., R. De Rycke, M. Van Montagu, and G. Angenon. 1997. An Agrobacterium-mediated transient gene expression system for intact leaves. Plant Science 122:101-108.

[00258] Kato, A., S. Nakamura, H. Ibrahim, T. Matsumi, C. Tsumiyama, and M. Kato. 1998. Production of genetically modified lysozymes having extreme heat stability and antimicrobial activity against Gram negative bacteria in yeast and in plant. Nahrung-Food 42: 128-130.

[00259] Kingsley, M. T., D. W. Gabriel, G. C. Marlow, and P. D. Roberts. 1993. The opsX locus of Xαnlhomonαs cαmpestris affects host range and biosynthesis of lipopolysaccharide and extracellular polysaccharide. J. Bacterid. 175:5839-5850.

[00260] Ko K. 1999. Attacin and T4 lysozyme transgenic in Galaxy apple: Regulation of transgene expression and plant resistance to fire blight {Erwiniα αmylovord). PhD dissertation, Cornell University, Ithaca NY. 194 pp.

[00261] Ko K et αl. 2000. Effect of untranslated leader sequence of AMV RNA 4 and signal peptide of patho genesis-related protein Ib on attacin gene expression, and resistance to fire blight in transgenic apple. Biotechnology Letters 22:373-38 ILi Q et αl. 2001. Enhanced disease resistance conferred by expression of an antimicrobial magainin analog in transgenic tobacco. Planta 212:635-639.

[00262] Levasseur, A., Navarro, D., Punt, P. J., Belaich, J. P., Asther, M., and Record, E. 2005. Construction of engineered bifunctional enzymes and their overproduction in Aspergillus niger for improved enzymatic tools to degrade agricultural by-products. Applied and Environmental Microbiology 71 :8132-8140

[00263] Levy S. B. 1992. The antibiotic paradox: how miracle drugs are destroying the miracle. Plenum, New York.

[00264] McNaIIy, D. J., Wurms, K. V., Labbe, C, Belangera, R. R. 2003. Synthesis of C- glycosyl flavonoid phytoalexins as a site-specific response to fungal penetration in cucumber. Physiol. MoI. Pl. Pathol. 63:293-303.

[00265] Mitra A and Zhang Z. 1994. Expression of a human lactoferrin cDNA in tobacco cells produces antibacterial protein(s). Plant Physiol 106:977-981.

[00266] Moore G. A., Jacono, CC, Neidigh J.L., Lawrence S.D. and Cline K., 1992.. Agrobacterium-mediated transformation of citrus stem segments and regeneration of transgenic plants.. Plant Cell Rep 11:238-242.

[00267] Mun, J. H., Lee, S. Y., Yu, H. J., Jeong, Y. M., Shin, M. Y., Kim, H., Lee, L, and Kim, S. G. Petunia actin-depolymerizing factor is mainly accmulated in vascular tissue and its expression is enhanced by the first intron. Gene 292, 233-243. 2004.

[00268] Nakajima H et al. 1997 ^'. Fungal and bacterial disease resistance in transgenic plants expressing expressing human lysozyme. Plant Cell Rep 16:674-679.

[00269] Norelli JL et al 1994. Transgenic Mailing 26 apple expressing the attacin E gene has increased resistance to Erwinia amylovora. Euphytica 77:123-128.

[00270] Norelli JL et al. 1998. Effect of cercropin-type transgenes on fire blight resistance of apple. Acta Hort 489:273-278.

[00271] Norelli JL et al. 1999. Genetic transformation for fire blight resistance in apple. Acta Hort 489:295-296 [00272] Osbourn, A. E. 1996. Preformed antimicrobial compounds and plant defense against fungal attack. Plant Cell 8:1821-1831.

[00273] Papadopoulou, K., Melton, R.E., Leggett, M., Daniels, M. J., and Osbourn, A. E. 1999. Compromised disease resistance in saponin-deficient plants. Plant Biol. 96:12923- 12928.

[00274] Owens, L. D. and Heutte, T. M. (1997) A single amino acid substitution in the antimicrobial defense protein cecropin B is associated with diminished degradation by leaf intercellular fluid. Molecular Plant-Microbe Interactions. 10, 525-528.

[00275] Pierce, M. L., Cover, E. C, Richardson, P. E., Scholes, V. E., Essenberg, M. 1996. Adequacy of cellular phytoalexin concentrations in hypersensitively responding cotton leaves. Physiol. MoI. Plant Pathol. 48:305-324.

[00276] Reddy, JD, Reddy, SL, Hopkins, DL, and Gabriel, DW. 2007. ToIC is required for pathogenicity oiXylellafastidiosa in grape plants. Molec. Plant-Microbe Interact. 20:403- 410.

[00277] Reynoird JP et al. 1999. First evidence for differences in fire blight resistance among transgenic pear clones expressing attacin gene. Plant Science 149:23-31.

[00278] Riggs, CD., K. Zeman, R. DeGuzman, A. Rzepczyk and A.A. Taylor. 2001. Antisense inhibition of a tomato meiotic proteinase suggests functional redundancy of proteinases during microsporogenesis Genome 44: 644-650.

[00279] Robichon, M. P., J.P. Renou and R. Jalouzot, 1995. Genetic transformation of Pelargonium X hortorum. Plant Cell Reports 15:63-67.

[00280] Rose, A. B. and Beliakoff, J. A. Intron-mediated enhancement of gene expression independent of unique intron sequences and splicing. Plant Physiol. 122, 535-542. 2004.

[00281] Rose, A. B. 2002. Requirements for intron-mediated enhancement of gene expression in Arabidopsis. Rna-A Publication of the Rna Society 8:1444-1453.

[00282] Sambrook, J., Fritsch, E.F. and Maniatis, T., 1989. Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, NY [00283] Schmeller, T., Latz-Bruning, B., and Wink, M. 1997. Biochemical activities of berberine, palmatine and sanguinarine mediating chemical defence against microorganisms and herbivores. Phytochemistry 44:257-266.

[00284] Schoonbeek, H., Del Sorbo, G., and De Waard, M. A. 2001. The ABC transporter BcatrB affects the sensitivity of Botrytis cinerea to the phytoalexin resveratrol and the fungicide fenpiclonil. MoI. Plan-Microbe Interact. 14:562-571.

[00285] Simionato, A.V.C., da Silva, D.S., Lambais, M.R., and Carrilho, E. 2007. Characterization of a putative Xylella fastidiosa diffusible signal factor by HRGC-EI-MS. J. Mass Spectrom. 42:490-496.

[00286] Simpson, G. G. and Filipowicz, W. Splicing of precursors to mRNA in higher plants: mechanism, regulation an sub-nuclear organization of the spliceosomal machinery. Plant MoI. Biol. 32, 1-41. 1996.

[00287] Singh, R., Gupta, N., Goswami, V.K. and R. Gupta. 2006. A simple activity staining protocol for lipases and esterases. Appl. Microbiol. Biotechnol. 70:679-682.

[00288] Shinohara, M., Nakajima, N., and Uehara, Y. 2007. Purification and characterization of a novel esterase (beta-hydroxypalmitate methyl ester hydrolase) and prevention of the expression of virulence by Ralstonia solanacearum. Journal of Applied Microbiology 103: 152-162.

[00289] Suzuki, T., Nakayama, T., Kurihara, T., Nishino, T., and Esaki, N. 2002. A cold- active esterase with a substrate preference for vinyl esters from a psychrotroph, Acinetobacter sp. strain no. 6: gene cloning, purification, and characterization. Journal of Molecular Catalysis B: Enzymatic 16:255-263.

[00290] Taguchi S et al. 2000. Functional mapping against Escherichia coli for the broad- spectrum antimicrobial peptide, thanatin, based on an in vivo monitoring assay system. J Biochem 128:745-754

[00291] Teuber, M. 1999. Spread of antibiotic resistance with foodborne pathogens. Cell MoI. Life Sci. 755-763. [00292] Timmermans, M.Y.J., Teuchy, H., and Kupers, LPM. 1998. The cDNA sequence encoding boving pregastric esterase. Gene 147: 259-262.

[00293] Trudel J et al. 1995. Secreted hen lysozyme in transgenic tobacco: Recovery of bound enzyme and in vitro growth inhibition of plant pathogens. Plant Science 106:55-62.

[00294] Vunnam S et al. 1997 ^'. Synthesis and antibacterial action of cecropin and proline- arginine-rich peptides from pig intestine. J Peptide Res 49:59-66.

[00295] Wang, L.H. et al 2004. A bacterial cell-cell communication signal with cross- kingdom structural analogues. Molec. Microbiol. 51 :903-912.

[00296] Wang Y et al. 1999. Porcine pulmonary surfactant preparations contain the antibacterial peptide prophenin and a C-terminal 18-residue fragment thereof. FEBS Lett

460:257-262.

[00297] Wroblewski, T., Tomczak, A. and Michelmore, R. 2005. Optimization of Agrobacterium mediated transient assays of gene expression in lettuce, tomato and Arabidopsis. Plant Biotechnology J. 3:259-273.

[00298] Zhang, L.H. 2003. Quorum quenching and proactive host defense. Trends Plant

Sci. 8:238-244.

Claims

We claim:

1. A method for obtaining and/or increasing the resistance of a plant cell, plant part or whole plant to infection or infestation by Gram-negative bacteria comprising introducing into the plant cell, plant part or whole plant an expression cassette comprising as operably linked components: a promoter region functional in plants; a region containing a nucleic acid encoding a protein or peptide having esterase activity, said nucleic acid coding region being located downstream from said promoter region and operably fused to said promoter; a terminator region functional in plants, said region being located downstream from said nucleic acid coding region; and obtaining the expression of enzymatically functional esterase from said expression cassette in said plant cell, plant part or whole plant.

2. The method of claim 1, wherein the nucleic acid encodes a carboxylesterase and/or a lipase.

3. The method of claim 1 , wherein the Gram-negative bacteria is a pathogenic bacteria.

4. The method of claim 3, wherein the pathogenic bacteria is a plant pathogen and/or an animal pathogen.

5. The method of claim 1, wherein the nucleic acid is a natural and/or synthetic nucleic acid.

6. The method of claim 1, wherein a secretion signal functional in plants is operably linked to the nucleic acid.

7. The method of any one of claims 1 to 6, wherein an endoplasmic reticulum (ER) retention signal functional in plants is operably linked to the nucleic acid.

8. The method of claim 1 , wherein the nucleic acid encodes an amino acid sequence for a complete esterase protein.

9. The method of claim 1, wherein the nucleic acid encodes an amino acid sequence for a portion of an esterase protein that has esterase activity.

10. The method of any one of claims 1 to 9, wherein said nucleic acid is operably linked to a nucleic acid encoding a nonenzymatic lytic protein or peptide fragment and/or encoding an enzymatic peptidoglycan degrading protein or peptide.

1 1. The method of claim 10, wherein the lytic protein or peptide fragment is selected from the group consisting of a lysozyme, endolysin, protease, mureinolytic enzyme or an enzyme with transglycosylase activity.

12. The method of claim 1, wherein the esterase is of plant or non-plant origin.

13. The method of claim 1, wherein the esterase is a pregastric esterase (PGE).

14. The method of claim 1, wherein the esterase is bovine pregastric esterase (PGE).

15. The method of any one of claims 1 to 14, wherein the plant is a dicot.

16. The method of any one of claims 1 to 14, wherein the plant is a monocot.

17. The method of any one of claims 1 to 14, wherein the plant is selected from the group comprising geranium, a citrus, tomato, tobacco and rice.

18. A geranium plant, plant part or cell produced by the method according to any one of claims 1 to 14.

19. A citrus plant, plant part or cell produced by the method according to any one of claims 1 to 14.

20. A tomato plant, plant part or cell produced by the method according to any one of claims 1 to 14.

21. A tobacco plant, plant part or cell produced by the method according to any one of claims 1 to 14.

22. A rice plant, plant part or cell produced by the method according to any one of claims 1 to 14.

23. A dicot plant, plant part or cell produced by the method according to any one of claims 1 to 14.

24. A monocot plant, plant part or cell produced by the method according to any one of claims 1 to 14.

25. The method of any one of claims 1 to 24 further comprising culturing the plant cell with the introduced expression cassette to produce a tissue culture of the cell.

26. The method of claim 25 further comprising producing a plant part or whole plant from the tissue culture, wherein the plant part or whole plant expresses the enzymatically functional esterase.

27. The method of any one of claims 1 to 24, wherein the whole plant which expresses the enzymatically functional esterase produces pollen and/or ovules comprising the expression cassette.

28. The method of any one of claims 1 to 24, wherein the method further comprises administering at least one lytic protein and/or at least one lytic peptide to the plant cell, plant part, or whole plant expressing the enzymatically functional esterase.

29. The method of claim 28, wherein the lytic protein and/or lytic peptide is nonenzymatic.

30. The method of claim 28, wherein the lytic protein and/or lytic peptide is enzymatic.

31. The method of any one of claims 1 to 24 further comprising self-pollinating the whole plant expressing an enzymatically functional esterase, harvesting seed produced by said self-pollination, and growing the seed to obtain plants which express the enzymatically functional esterase.

32. The method of any one of claims 1 to 24 further comprising cross-pollinating the whole plant expressing an enzymatically functional esterase with another plant in the same species of said whole plant, harvesting seed produced by said cross-pollination, and growing the seed to obtain plants which express the enzymatically functional esterase.

33. The method of any one of claims 1 to 24 further comprising growing the whole expressing the enzymatically functional esterase.

34. A method of producing an animal feed comprising utilizing the plant cell, plant part or whole plant of any one of claims 1 to 24 in an animal feed.

35. A method of preventing, treating or reducing microbial and/or insect contamination of food or food stuff, said method comprising contacting the food or food stuff with an esterase.

36. A method of preventing, treating or reducing microbial infection of an animal cell, animal tissue, or whole animal, said method comprising contacting the animal cell, animal tissue, or whole animal with an esterase.

37. A method of preventing, treating or reducing Gram-negative bacterial infection or infestations of a plant cell, plant part or whole plant, said method comprising contacting the plant cell, plant part or whole plant with an esterase.

38. The method of claim 39, wherein the plant part is a cut plant.

39. The method of claim 39, wherein the esterase is added to water which is provided to the plant cell, plant part or whole plant.

40. A method of preventing, treating or reducing microbial contamination of water, said method comprising adding the isolated protein or crude extract with an esterase.

41. A method of preventing, treating or reducing nematode infection or infestations of a plant cell, plant part or whole plant, said method comprising contacting the plant cell, plant part or whole plant of any one of claims 1 to 24 with an esterase.

42. A method to assay for useful anti-microbial genes consisting of: a) transiently expressing an anti-microbial gene in a marked region of a plant leaf and b) inoculating within the marked region with a target microbe, said assay including either: (i) a comparison of symptoms elicited by the target microbe within the marked region expressing the antimicrobial gene with symptoms elicited by the microbe on a different plant region used as a suitable control and/or (ii) a comparison of cell counts of the target microbe taken from within the marked region expressing the anti-microbial gene with those taken from a different plant region used as a suitable control.