KR20000029948A - Peptide with inhibitory activity towards plant pathogenic fungi - Google Patents

Abstract

PURPOSE: Provided is a method of controlling plant pathogens by a peptide which is provided by genetically modifying the plant to produce the peptide, and to genes and plants useful in that method. In particular, a lactoferricin and its use in controlling plant pathogens are provided. CONSTITUTION: Lactoferricin has been found to have antifungal activity against plant pathogens. Genetic constructs comprising a synthetic gene for bovine lactoferricin are prepared and used to provide transgenic disease-resistant plants. A method of transforming plants to express lactoferricin which is expressed in plants to provide disease resistance to those plants is also provided.

Description

Peptide with inhibitory activity towards plant pathogenic fungi

The present invention relates to methods for controlling plant pathogens by peptides provided by genetically modifying plants to produce specific peptides, and genes and plants useful in such methods. In particular, the present invention relates to lactoferricin and its use for controlling plant pathogens.

Many fungi and bacteria are pests that seriously damage economically important crops. Various methods have been used to control diseases in plants, and their success and degree vary. One way is to apply antimicrobial chemicals to crops. This method has a number of problems recognized in the art. More recent methods also use biological control organisms ("biocontrols") that are natural competitors or inhibitors of pest organisms. However, it is difficult to apply biocontrol to large areas, and it is even more difficult to keep these living organisms only in the treated areas for a long time. More recently, recombinant DNA technology has allowed the insertion of cloned genes expressing antimicrobial compounds into plant cells. However, this technique raises the concern that microorganisms may someday be resistant to well-known natural antimicrobial substances. Thus, there is a continuing desire to identify natural antimicrobial compounds that can be formed by plant cells by directly deciphering a single gene.

Since peptides with antipathogenic and antimicrobial activity are already known in the art, particular attention has been paid to identifying new peptides and DNA sequences encoding such peptides. For example, there are a number of peptides called soluble peptides that are derived from animal, plant, insect, and microbial sources, including mammalian defensins, cecropins, thionines, melittins, insect defensins, and the like.

Another class of peptides with antipathogenic activity are hydrolytic enzymes such as chitinase and β-1,3-glucanase, which are known to control fungal growth. See Schlumbaum, et al., 1986; Mauch, et al., 1988.

Enzymatic hydrolysates of the milk protein lactoferrin have also been found to have antimicrobial activity. Lactoferrin is an iron-binding glycoprotein present in most biological fluids secreted from mammals, including milk, tears, and mucus secretions. Brock, J., Arch. Dis. Child. 55: 417 (1980); Bullen, J. Rev. Infect. Dis. 3: 1127 (1981). Lactoferrin has been associated with promoting cell growth in vitro, regulating hematopoietic action, protection from microbial infections and immunomodulatory properties. However, little is known about the function of lactoferrin in vivo. Extracellular lactoferrin has been reported to have antibacterial and antiviral activity. Studies with bovine lactoferrin have shown that the antimicrobial activity of enzymatic hydrolysates produced by digestion with porcine pepsin is more potent than the activity of complete protein against Escherichia coli lysates [ See Tomita, et al., J. Dairy Sci. 74: 4137-4142 (1991).

The antifungal activity of lactoferrin has also been demonstrated in humans. The susceptibility of Candida albicans to inhibition and inactivation by lactoferricin B has been investigated in Bellamy et al., Med. Microbiol. Immunolog. 182: 97-105 (1993). Its effect is lethal, so it quickly loses its ability to form colonies, which is the active peptide of lactoferrin. Suggests a strong influence on host defense against albicans.

Recently, to test the antibacterial activity of lactoferrin in plants, human lactoferrin cDNA was expressed in tobacco suspension cells. Transgenic callus produced a 48kD single peptide significantly smaller than the full length lactoferrin protein. The antibacterial activity of total protein extracts made from transgenic tobacco callus was determined to be in terms of reduced colony forming units when tested with four phytopathogenic species of bacteria, which was much higher than the antibacterial activity of commercially available purified lactoferrin. . In transgenic callus, full-length lactoferrin was never detected, suggesting that the lactoferrin gene product has undergone post-translational processing. Since the human lactoferrin gene was expressed in Aspergillus nidulans while producing large amounts of full-length lactoferrin, the full-length plant-produced lactoferrin does not undergo proper folding and the unfolded portion is degraded. There is this. Thus, a truncated protein that exhibited antibacterial activity in callus was identified as its amino or carboxy-terminus.

The present invention provides enzymatic hydrolysates of lactoferrin that can be safely expressed in plants to provide disease resistance. Genetic constructs comprising genes for synthesis of lactoferrin are prepared and used to provide transgenic disease-resistant plants. Also described are methods for transforming such plants by expressing lactoferricin expressed in the plants to provide disease resistance to these plants.

1: Plasmid pCIB7703 containing the lactoferricin B gene (from positions 1995-7979) under the control of the ubiquitin promoter (15-1995) and the nos terminator (2079-2339).

Figure 2: Plasmid pCIB7704, similar to pCIB7703, with the ubi-SynPat-nos selection cassette (from positions 15-2845).

Figure 3: Plasmid 7705 containing ubi-SynPat-nos--ubi-lactoferricin B-nos fragment in an NptII containing plasmid.

4: Plasmid 7706 containing ubi-lactoferricin B-nos fragment in an NptII containing plasmid.

The present invention utilizes lactoferricin, which is an enzymatic hydrolyzate of lactoferrin that has antipathogenic activity and corresponds to the N-terminal portion of lactoferrin. Lactoferrin is a protein produced in the milk of mammals that has structural and functional homology among different species, although there are some differences in exact amino acid sequences from species to species. Preferred lactoferricins for use in the present invention are lactoferricin B (bovine lactoferricin) or lactoferricin H (human lactoferricin). It has been found by the present invention that lactoferricin confers disease resistance by inhibiting the growth of a number of pathogens of agricultural economic importance and by being able to be expressed in plants. Lactoferricin B (or bovine lactoferricin) is a 25 amino acid long peptide with precise homology with the N-terminus of the complete bovine lactoferrin sequence:

Phe-Lys-Cys-Arg-Arg-Trp-Gln-Trp-Arg-Met-Lys-Lys-Leu-Gly-Ala-Pro-Ser-Ile-Thr-Cys-Val-Arg-Arg-Ala-Phe ( SEQ ID NO: 1

Lactoferricin H (or human lactoferricin) corresponds to amino acids 1-33 of human lactoferrin and is therefore a peptide of 33 amino acids length as follows:

G R R R R S V Q W C A V S Q P E A T K C F Q W Q R N M R K V R G P (SEQ ID NO: 2)

When expressed, these peptides may comprise an N-terminal methionine residue corresponding to the start codon.

Based on this protein sequence, the lactoferricin gene is designed to be expressed in plants. The codon usage of these synthetic genes uses codons for each of the amino acids most frequently used in corn expressed genes, making them most effective for expression in monocotyledonous plants. A list of corn codon usage is described in Murray, Lotzer and Eberle, Nucl. Acids Res. 17, 477-498, 1989. In addition, the codon usage of the synthetic gene can be most effectively optimized according to different methods such as those described in EP-A-359 472.

Sequences designed for the plant optimized lactoferricin B gene include the following coding sequences:

5'-TTC-AAG-TGC-CGC-CGC-TGG-CAG-TGG-CGC-ATG-AAG-AAG-CTG-GGC-GCC-CCC-AGC-ATC-ACC-TGC-GTG-CGC-AGG-GCC -TTC-3 '(SEQ ID NO: 3)

When a stop codon (TAA) is added at the 3 'end, the sequence is as follows:

5'-TTC-AAG-TGC-CGC-CGC-TGG-CAG-TGG-CGC-ATG-AAG-AAG-CTG-GGC-GCC-CCC-AGC-ATC-ACC-TGC-GTG-CGC-AGG-GCC -TTC-TAA-3 '(SEQ ID NO: 4)

The plant optimized sequence for the lactoferricin H gene is as follows:

5'-GGC-CGC-CGC-CGC-CGC-AGC-GTG-CAG-TGG-TGC-GCC-GTG-AGC-CAG-CCC-GAG-GCC-ACC-AAG-TGC-TTC-CAG-TGG-CAG -CGC-AAC-ATG-CGC-AAG-GTG-CGC-GGC-CCC-5 '(SEQ ID NO: 5)

Preferably, methionine start codon and stop codon (TAG) are added. In addition, ACC sequences from Kozak Consensus sequences are added to enhance the likelihood of efficient translation. This produces the Met-lactoferricin H gene sequence shown below, with the start codon and stop codon underlined:

5'-ACC-ATG-GGC-CGC-CGC-CGC-CGC-AGC-GTG-CAG-TGG-TGC-GCC-GTG-AGC-CAG-CCC-GAG-GCC-ACC-AAG-TGC-TTC-CAG -TGG-CAG-CGC-AAC-ATG-CGC-AAG-GTG-CGC-GGC-CCC-TAG-3 '(SEQ ID NO: 6)

Structural coding sequences encoding lactoferricin are expressed in plant cells under the control of promoters that can act on plant cells to generate 3 'non-translated regions and RNA sequences while inducing polyadenylation of the transcribed RNA. . Examples of promoters capable of acting on plants or plant cells, ie promoters capable of driving the expression of bound structural genes such as lactoferricin in plant cells, include cauliflower mosaic virus (CaMV) 19S or 35S promoters and CaMV dual promoters; Nopaline synthase promoter; Pathogen-associated (PR) protein promoters; SsuRUBISCO promoter of Rebulose bisphosphate carboxylase. Rice actin promoter [McElroy et al., Mol. Gen. Genet. 231: 150 (1991)], ubiquitin promoters such as the corn ubiquitin promoter (see EP 0 342 926; Taylor et al., Plant Cell Rep. 12: 491 (1993) and Pr-1 promoters from tobacco, Arabidopsis or corn. In addition, the 35S promoter and an enhanced or dual 35S promoter as described in Kay et al., Science 236: 1299-1302 (1987), and a double 35S promoter cloned into pCGN2113 deposited as ATCC 40587, desirable. According to methods known in the art, promoter strength can be manipulated to modify the promoter itself to increase lactoferricin expression.

Signal or transit peptides can be fused to the lactoferricin coding sequence in the chimeric DNA constructs of the invention to direct that the expressed lactoferricin peptide is transported to the site of action of interest. Examples of signal peptides include peptides that are naturally linked to plant pathogen-associated proteins such as PR-1, PR-2, and the like. See Payne et al., Plant Mol. Biol. 11: 89-94 (1988). Examples of transcit peptides are described in Von Heijne et al., Plant Mol. Biol. Rep. 9: 104-126 (1991); Mazur et al., Plant Physiol. 85: 1110 (1987); Chloroplast Transcript Peptides as described in Vorst et al., Gene 65:59 (1988), and mitochondria as described in Boutry et al., Nature 328: 340-342 (1987). Peptides are included. The full text of these documents is incorporated herein by reference. For cytoplasmic expression, methionine start codon is added.

The chimeric DNA construct (s) of the invention may contain multiple copies of the promoter or multiple copies of the lactoferricin structural genes. In addition, such construct (s) may include coding sequences for markers and coding sequences for other peptides, such as signal or transpeptide peptides, each of which may be combined with other functional elements in the DNA molecule in a suitable reading frame. Is in. Preparation of such constructs is routine to those skilled in the art.

Useful markers include peptides that provide resistance to herbicides, antibiotics or drug resistance, such as hygromycin, kanamycin, G418, gentamicin, lincomycin, methotrexate, glyphosate, phosphinothricin, and the like. These markers can be used to select cells transformed with the chimeric DNA constructs of the invention from untransformed cells. Other useful markers are peptidic enzymes, such as luciferase, β-glucuronidase or β-galactosidase, which can be easily detected by visual reactions such as color reactions.

Transgenic plants,

(a) inserting a recombinant DNA molecule according to the invention into the genome of a plant cell;

(b) obtaining transformed plant cells;

(c) therefrom obtained by regenerating a transgenic plant that expresses an amount of lactoferricin effective to reduce damage from disease.

Recombinant DNA molecules can be introduced into plant cells in a number of well known ways. Those skilled in the art will recognize that this method of introduction can be selected according to the type of plant to be transformed, i.e. monocot or dicotyledonous plant. Suitable methods for transforming plant cells include microscopy (Crossway et al., Bio Techniques 4: 320-334 (1986)), electroporation (Riggs et al., Proc. Natl. Sci. USA 83: 5602-5606 (1986)], Agrobacterium mediated transformation methods (Hinchee et al., Biotechnology 6: 915-921 (1988)), direct gene transfer methods [Paszkowski et al. , EMBO J. 3: 2717-2722 (1984), and Agratus, Inc., Madison, Wisconsin and Dupont, Inc., Wilmington, Delaware Ballistic particle acceleration using a device commercially available from Sanford et al., US Pat. No. 4,945,050; And McCabe et al., Biotechnology 6: 923-926 (1988). In addition, Weissinger et al., Annual Rev. Genet. 22: 421-477 (1988); Sanford et al., Particulate Science and Technology 5: 27-37 (1987) (onion); Christou et al., Plant Physiol. 87: 671-674 (1988) (soybeans); McCabe et al., Bio / Technology 6: 923-926 (1988) (soy); Datta et al., Bio / Technology 8: 736-740 (1990) (rice); Klein et al., Proc. Natl. Acad. Sci. USA, 85: 4305-4309 (1988) (corn); Klein et al., Bio / Technology 6: 559-563 (1988) (corn); Klein et al., Plant Physiol. 91: 440-444 (1988) (corn); Fromm et al., Bio / Technology 8: 833-839 (1990); And Grodon-Kamm et al., Plant Cell 2: 603-618 (1990) (corn).

Selection of the promoter used in the expression cassette will determine the spatial and temporal expression profile of the transgene in the transgenic plant. Selected promoters will express the transgene in a specific cell type (e.g. leaf epithelial cells, lobe cells, myocortical cells) or in a particular tissue or organ (e.g. root, leaf or flower) and this selection will result in the transformation It will reflect the desired expression site of the gene. In addition, the selected promoter can drive the expression of the gene under other promoters that are photo-induced or temporally regulated. A further alternative is that the selected promoter is chemically regulated. This makes it possible to induce the expression of the transgene only when desired and when caused by treatment with chemical inducers.

Various transcription terminators can be used in the expression cassette. These are associated with the termination of transcription beyond the transgene and its precise polyadenylation. Suitable transcriptional terminators known to function in plants include the CaMV 35S terminator, the tml terminator, the nopaline synthase terminator, and the pea rbcS E9 terminator. They can be used for both monocotyledonous and dicotyledonous steels.

Numerous sequences have been found that enhance gene expression from within a transcription unit and these sequences can be used in conjunction with the genes of the invention to increase their expression in transgenic plants.

Various intron sequences have been found to enhance expression, particularly in monocotyledonous cells. For example, introns of maize Adh1 gene have been found to significantly enhance the expression of the wild type genes under promoters homologous to the wild type genes upon introduction into maize cells. Intron 1 has been shown to be particularly effective and enhance expression in fusion constructs with the chloramphenicol acetyltransferase gene. See Callis et al., Genes Develop. 1: 1183-1200 (1987). In the same experimental system, introns from the corn bronze 1 gene have similar effects in enhancing expression (Callis et al., Supra). Intron sequences are typically inserted into plant transformation vectors, typically in a non-translated leader.

Numerous non-translated leader sequences derived from viruses are also known to enhance expression and are particularly effective for dicotyledonous cells. Specifically, tobacco mosaic virus (TMV, "W-sequence"), maize haploid virus (MCMV) and alfalfa mosaic virus (AMV) have been shown to be effective in enhancing expression. See, for example, Gallie et al. , Nucl. Acids Res. 15: 8693-8711 (1987); Skuzeski et al., Plant Molec. Biol. 15: 65-79 (1990).

Various mechanisms for targeting gene products are known to exist in plants and sequences that regulate the action of these mechanisms have been identified in some detail. For example, targeting gene products to chloroplasts is regulated by signal sequences that are found at the amino terminus of various proteins and are cleaved during generation of chloroplasts to produce mature proteins. Comai et al., J. Biol. Chem. 263: 15104-15109 (1988). These signal sequences can be fused to the heterologous gene product to allow the heterologous product to be introduced into the chloroplasts (van den Broeck et al., Nature 313: 358-363 (1985)). DNA encoding the appropriate signal sequence can be isolated from the 5 'end of the cDNA encoding RUBISCO protein, CAB protein, EPSP synthase enzyme, GS2 protein and many other proteins known to be chloroplast localized.

Other gene products are localized to other organelles such as mitochondria and peroxysomes. See Unger et al., Plant Molec. Biol. 13: 411-418 (1989). CDNAs encoding these products can be engineered to allow heterologous gene products to target these organelles. Examples of such sequences are nuclear-encoded ATPases for mitochondria and specific aspartate amino transferase isoforms. Targeting to intracellular protein bodies is described by Rogers et al., Proc. Natl. Acad. Sci. USA 82: 6512-6516 (1985).

In addition, sequences have been identified that allow gene products to target different cell compartments. The amino terminal sequence is involved in targeting to extracellular secretions from ER, apoplasts, and alleron cells. Koehler & Ho. Plant Cell 2: 769-783 (1990). In addition, amino terminal sequences are involved in the vacumetric targeting of gene products in conjunction with carboxy terminal sequences. Shinshi et al., Plant Molec. Biol. 14: 357-368 (1990).

By fusing the appropriate targeting sequence mentioned above to the transgene sequence of interest, it is also possible to direct the transgene product to any organelle or cell compartment. In the case of chloroplast targeting, for example, chloroplast signal sequences from the RUBISCO gene, CAB gene, EPSP synthase gene or GS2 gene are fused to the amino terminal ATG of the transgene in the same frame. The signal sequence thus selected should comprise a known cleavage site and the constructed fusion should take into account any amino acids present after the cleavage site necessary for cleavage. In some cases, this requirement can be met by adding a few amino acids between the cleavage site and the transgene ATG or replacing some amino acids in the transgene sequence. Fusions constructed for chloroplast introduction were tested for the efficacy of chloroplast uptake by in vitro detoxification of in vitro transcribed constructs, followed by Bartlett et al., In: Edelmann et al. Eds.) Methods in Chloroplast Molecular Biology, Elsevier. pp 1081-1091 (1982); Wasmann et al., Mol. Gen. Genet. 205: 446-453 (1986), can be used to test for in vitro chloroplast uptake efficacy. These construction techniques are well known in the art and are equally applicable to mitochondria and peroxysomes. The choice of targeting that may be required for the expression of the transgene will depend on the intracellular positioning of the required precursor as a starting point for a given pathway. It will typically be cytoplasmic or chloroplast, but in some cases may be mitochondrial or peroxysomal. Transgene expression products will typically not require targeting for ER, apoplasts or vacuoles.

The above-mentioned mechanisms for intracellular targeting are utilized not only in connection with their homologous promoters, but also in conjunction with heterologous promoters, under specific transcriptional control of promoters that exhibit different expression patterns than those of the promoter driving the targeting signal. Cell targeting purposes can be achieved.

Transformation techniques for dicotyledonous plant ganglia are well known in the art and examples thereof are Agrobacterium-based techniques that do not require Agrobacterium. Non-Agrobacterium technology involves the direct uptake of exogenous genetic material by protoplasts or cells. This can be done by PEG or electroporation mediated absorption, particle impact-mediated delivery or microscopic injection. Examples of these techniques are described in Paszkowski et al., EMBO J. 3: 2717-2722 (1984); Portykus et al., Mol. Gen. Genet. 199: 169-177 (1985); Reich et al., Biotechnology 4: 1001-1004 (1986) and Klein et al., Nature 327: 70-73 (1987). In each case, the transformed cells can be regenerated into complete plants using standard techniques known in the art.

Agrobacterium mediated transformation is the preferred technique for transforming dicotyledonous plant cavities because it exhibits high transformation efficiency and is widely used in many different species. Many crop species that can normally be transformed with Agrobacterium include tobacco, tomatoes, sunflower, cotton, rapeseed oil, potatoes, soybeans, alfalfa and poplars (see EP 0 317 511 (cotton)); EP 0 249 432 (tomato; Calgene); WO 87/07299 (rapeseed; Calgene); US Patent No. 4,795,855 (Poplar). Agrobacterium transformation typically involves a binary vector carrying the foreign DNA of interest, either on coexisting Ti plasmids or strain CIB542 against host Agrobacterium strains of the chromosome [eg, pCIB200 and pCIB2001 (see Uknes). et al., Plant Cell 5: 159-169 (1993)] to transfer to a suitable Agrobacterium strain that may be dependent on the complement of the vir gene. Three-pair parental hybridization using a helper E. coli strain carrying an E. coli carrying this recombinant binary vector, ie a plasmid such as pRK2013 and immobilizing the recombinant binary vector to the target Agrobacterium strain Alternatively, the recombinant binary vector can be transferred to Agrobacterium by DNA transformation. Hofgen & Wil lmitzer, Nucl.Acids Res. 16: 9877 (1988).

Transformation of the target plant species by recombinant Agrobacterium typically involves co-culturing Agrobacterium with explants from the plant and performs protocols well known in the art. Transformed tissue is regenerated on selectable media with antibiotic or herbicide resistance markers present between the binary plasmid T-DNA boundaries.

Transformation of most monocotyledonous species is also common in the present invention. Preferred techniques include the direct transfer of genes to protoplasts using PEG or electroporation techniques and impact particles on callus tissue. Transformation can be carried out using a single DNA species or multiple DNA species (ie, co-transformation), all of which techniques are suitable for use in the present invention. Co-transformation can have the advantage of avoiding complex vector construction and generating transgenic plants with unlinked sites for the genes of interest and selectable markers, which can be removed in the next generation. It should be considered as desirable. However, a disadvantage of co-transformation is that the frequency of integrating distinct DNA species into the genome is less than 100%. Schocher et al. Biotechnology 4: 1093-1096 (1986).

Patent applications EP 0 292 435, EP 0 392 225 and WO 93/07278 describe the preparation of callus and protoplasts from elite co-crossed cell lines of corn, the technique of transforming protoplasts using PEG or electroporation, and transformation Techniques for regenerating corn plants from isolated protoplasts have been described. Gordon-Kamm et al., Plant Cell 2: 603-618 (1990) and Fromm et al., Biotechnology 8: 833-839 (1990) describe the use of particle bombardment to identify A188-derived corn strains. Transformation techniques have been reported. Furthermore, WO 93/07278 and Koziel et al., Biotechnology 11: 194-200 (1993) describe techniques for transforming elite co-crossed cell lines of maize by particle bombardment. The technique uses 1.5-2.5 mm long immature corn embryos cut from corn fruit 14-14 days after pollination and a PDS-1000He Bioolistics device for impact.

Transformation of rice can also be performed by direct gene transfer techniques using protoplasts or particle bombardment. Protoplast-mediated transformation methods are described for the Japonica-type and the Indica-type (Zhang et al., Plant Cell Rep 7: 379-384 (1988); Shimamoto et al., Nature 338: 274-277 (1989); Datta et al., Biotechnology 8: 736-740 (1990). Both types can also be conventionally transformed using particle bombardment (Christou et al., Biotechnology 9: 957-962 (1991)).

Patent application EP 0 332 581 describes a technique for the generation, transformation and regeneration of Poidee protoplasts. These techniques allow the transformation of poideae such as Dactylis and wheat. In addition, wheat transformation using particle bombardment into cells of type C prolonged regenerative callus is described in Vasil et al., Biotechnology 10: 667-674 (1992), and also in immature and immature embryos. Wheat transformation methods using particle bombardment of induced callus are described in the literature; Vasil et al., Biotechnology 11: 1553-1558 (1993) and Weeks et al., Plant Physiol. 102: 1077-1084 (1993). However, a preferred technique for wheat transformation involves the transformation of wheat by particle bombardment of immature embryos and includes a high sucrose or high maltose step prior to gene transfer. Prior to impact, MS medium with 3 mg / L 2,4-D and 3% sucrose to induce somatic embryos, allowing any number of embryos (0.75-1 mm long) to proceed in the dark [Murashige & Skoog, Physiologia Plantarum 15: 473-497 (1962). The impact days are selected and the embryos are removed from the induction medium and plated onto osmoticum (ie, induction medium with sucrose or maltose added at the desired concentration, typically 15%). The embryos are plasma dissolved for 2-3 hours and then shocked. Twenty embryos per target plate are typical, but not critical. Suitable gene-carrying plasmids (eg pCIB3064 or pSG35) are precipitated onto microtiter size gold particles using standard procedures. Each embryo plate is sprouted using a DuPont Bioistics helium device using an explosion pressure of approximately 1000 psi using a standard 80 mesh screen. After the impact, the embryo is placed back in the dark and restored for about 24 hours (performed continuously on Osmoticum). After 24 hours, the embryos are removed from Osmotichum and placed back in the induction medium and left for about one month before regeneration. After approximately one month, embryonic tissue cultures in which embryogenic callus were generated were regenerated medium (MS + 1 mg) additionally containing appropriate selection agents (10 mg / L basta for pCIB3064 and 2 mg / L methotrexate for pSOG35). / l NAA, 5 mg / l GA). After approximately one month, the resulting young eggplants are transferred to a larger sterile container known as "GA7s" containing half the concentration of MS, 2% sucrose and the same concentration of the selection agent.

When lactoferricin is expressed in plants, it controls a broad spectrum of plant pathogens, including viral, bacterial and fungal plant pathogens. Commercially important plant diseases suitable for control by expressing lactoferricin in plants include the following.

Corn pathogens

Fungal: Gibberella zeae

Aspergillus flavus

a. A. parasiticus

Fusarium moniliforme

Diplodia maydis

Colletotrichum graminicola

Cephalosporium acremonium

Macrophomina phaseolina

Sercospora zeae-maydis

Exserohilum turcicum

Bipolaris maydis

Kabatatiella zeae

Puccinia sorghi

Puccinia polysora

Spacelotheca reiliana

Ustilago maydis

Colletotlehum graminicola

Helminthosporium carbonum

Peronosclerospora sorghi

Sclerophthora rayssiae

Peronosclerospora sacchari

Feronoscler. Phillippines (Peronoscler. Philippinensis)

Peronosclerospora maydis

Peronosclerospora spontanea

Peronosclerospora heteropogoni

Sclerospora graminicola

Bacterial: Erwinia stewartii

Corynebacterium nebraskense

Viral: Maize dwarf mosaic virus

Corn Natural Dwarf (Corn Rio Cuarto) Virus

(Maize rough dwarf (Maize rio cuarto) virus)

Maize streak virus

Maize chlorotic dwarf virus

Maize chlorotic mottle virus

Barley yellow dwarf virus

Corn lethal necrosis virus

High plains virus

Maize stripe virus

Sweet Cone Pathogens:

A. Bacterial Disease

Erwinia Stewarti

Pseudomonas avenae

Erwinia chrysanthemi

B. Fungal Diseases

Bipolaris Mydis

Exerohilum turcicum

Collettotrichum graminicola

Phyllosticta maydis

Cabatiela Zea

Sercosphora Zeae-Midis

Sclerophthora spp.

Peronosclerospora spp.

Ustilago Midis

Spaceloteca Laliana

Puchnia Sorgi

Puccinia Polysora

Physopella zeae

Fusarium Moniliforme

Pythium spp.

Penicillium oxalicum

Fusarium spp.

Diplodia Madis

Giberella Zea

C. Viral Diseases

Sugarcarne Mosaic

Corn Dwarf Mosaic

Corn Halves Dwarf

Highland virus

Corn Halves

Wheat Streak Mosaic

Barley Yellow Dwarf

Wheat pathogens:

Fungal Pathogens:

Puccinia Graminis f.sp. Tritici (Puccinia graminis f.sp.tritici)

Puccinia Recondita f.sp. Tritici (Puccinia recondita f.sp.tritici)

Puccinia striiformis

Tilletia tritici

Tilletia controversa

Tilletia indica

Ustilago tritici

Urocystis tritici

Gaeumannomyces graminis

Phytium species

Fusarium culmorum

Fusarium graminaerum

Fusarium avenaceum

Drechslere tritici-repentis

Rhizoctonia spp.

Colletotricum graminicola

Helminthosporium spp.

Microdochium nivale

Pseudosercosporella Herporticoides

(Pseudocercosporella herpotrichoides)

Ericife graminis f.sp. Tritici (Erysiphe graminis f.sp.tritici)

Sclerophthora macrospora

Septoria tritici

Septoria nodorum (Stagonospora nodorum)

Bipolaris sorokiniana

Fusarium roseum

Cephalosporium gramineum

Cochliobolus sativus

Claviceps purpurea

Bacterial Pathogens:

Pseudomonas Syringe pv. Atrofaciens (Pseudomonas syringae pv.

atrofaciens)

Pseudomonas Syringe pv. Syringe (Pseudomonas syringae pv. Syringae)

Xanthomonas Campestris pv. Translucent (Xanthomonas campestris pv.

translucens)

Viral Pathogens:

Barley Yellow Dwarf virus

Soilborne Wheat Mosaic Virus

Wheat Spindle Streak Mosaic Virus

virus)

Wheat Yellow Mosaic Virus

Soybean Pathogens:

1. Fungi

Phytophthora megasperma var.sojae

Colletotrichum truncatum

Septoria glycines

Sercospora kikuchii

Sercospora sojina

Peronospora manshurica

Microsphaera diffusa

Rhizoctonia solani

Pakopsora pachyrhizi

Corynespora cassicola

Calonectria crotalariae

Fusarium solani

Fusarium oxysporum

Macropomina Paseolina

Diaforte Paseoolo Room Kaulibora & Meridionalis

(Diaporthe phaseolorum var caulivora ＆ meridionalis)

Diaporthe phaseolorum var.sojae

Pialophora gregata

Phytium species

Sclerotinia sclerotiorum

Sclerotium rolfsii

Thielaviopsis basicola

2. Bacterial

Pseudomonas Syringe pv. Glycinea (Pseudomonas syringae pv. Glycinea)

Xanthomonas Campestris pv. Paseoli (Xanthomonas campestris pv.

phaseoli)

3. Viral

Soybean mosaic

Bean pod mottle

Bud blight

Peanut mottle

Copepea Chlorotic Mottle

Yellow mosaic

Pea pathogen

I. Seed & Sowing Disease

Pythium ultimum

Lizhatonia Solani

II. A disease caused by bacteria

Pseudomonas Syringe pv. Fish (Pseudomonas syringae pv. Pisi)

Pseudomonas Syringe pv. Syringe (Pseudomonas syringae pv. Syringae)

III. Leaf diseases caused by fungi

Ascochyta pisi

Mycosphaerella pinodes

Ascochyta pinodella

Sclerotinia sclerotiorum

Peronospora pisi

Erysiphe pisi

Colletotrichum pisi

Alternaria alternata

Botrytis cinerea

Ⅳ. Root disease caused by fungi

Fusarium oxysporum f.sp. Fish (Fusarium oxysporum f.sp.pisi)

Apanomyces euteces f.sp. Fish (Aphanomyces euteiches f.sp.pisi)

Phytium Ultimum

Fusarium Solani f.sp. Fish (Fusarium solani f.sp.pisi)

Tielaviopsis Bashi Cola

Ⅴ. A disease caused by a virus

Pea Enation Mosaic

Bean (Pea) Leaf Roll

Pea Seedborne Mosaic

Pea Streak

Pea Mosaic

Cucumber Mosaic

Pea Early Browning Virus

Red Clover Vein Mosaic

Soybean pathogen

I. Root disease

Apanomyces eutices f.sp. Paseooli (Aphanomyces euteiches

f.sp. phaseoli)

Phytium Ultimum

Lizhatonia Solani

Fusarium Solani f.sp. Paseoli (Fusarium solani f.sp.phaseoli)

Tielaviopsis Bashi Cola

Sclerotium Rolfsey

II. Fungal diseases in aerobic areas

Colletotricum lindemuthianum

Uromyces appendiculatus

Sclerotinia scleronium

Fusarium oxysporum f.sp. Paseoli (Fusarium oxysporum f.sp.phaseoli)

Phoma exigua var exigua

Sercospora canescens

Caetoseptoria wellmanii

Phytophthora nicotianae

Erysiphe polygoni

Pythium ultimum ＆ debaryanum

Alternaria alternata, various species

Phaeoisariopsis griseola

Macropomina Paseolina

Botrytis Cinerea

Lizhatonia Solani

III. A disease caused by bacteria

Pseudomonas Syringe pv. Paseolicola (Pseudomonas syringae pv. Phaseolicola)

Pseudomonas Syringe pv. Syringe (Pseudomonas syringae pv. Syringae)

Xanthomonas phaseoli

Ⅳ. Diseases caused by nematodes

Meloidogyne incognita

Pratylenkus species

Ⅴ. A disease caused by a virus

Bean Common Mosaic

Bean Golden Mosaic

Curly Top

Bean Curly Dwarf Mosaic

Bean Pod mottle

Clover Yellow Vein

Red Node

Cucumber Mosaic

Peanut Stunt

Beet Pathogen

1. Fungus:

Cercospora beticola-leaf spot disease

Aphanomyces cochlioides

Lizhatonia Solani-Rotting Root

Erysiphe betae-powdery mildew

Lithuanian viola bird (Helicobacidium purpurium)

(Rhizoctonia violacea (Helicobasidium purpureum))

Ramularia beticola

Phytium species

Phoma betae

Uromyces betae

Peronospora farinosa

Alteraria tenuis

Fusarium Oxysporium

Verticillium dahliae

Sclerotium rolfsii

Erythrope polygony-powdery mildew germ

Polymyxa betae

2. Bacterial

Pseudomonas syringae

Erwinia carotovora-erwinia

root rot)

3. Viral

Rhizomania Beet necrotic yellow vein virus (BNYVV)

Beet mild yellowing virus (BMYV)

Beet yellows virus (BYV)

Beet curly top virus

Beet mosaic virus

The present invention provides plants and seeds that express lactoferricin when germinated and cultured. Preferably, lactoferricin is expressed from recombinant DNA that is stably integrated into the genome. The transgenic plant or seed is monocotyledonous or dicotyledonous, preferably corn, rice, wheat, barley, sorghum, rye, oats, millet, cotton, soybeans, peas, soybeans, sunflowers, poultry plants and rape seed oil It is selected from the group consisting of. The transgenic seed can preferably be packaged in a bag containing a label indicating the use for controlling plant pathogens.

The genetically engineered genetic properties of the above-mentioned transgenic seeds and plants are repeatedly shown by sexual reproduction or plant growth, so these properties are preserved and propagated in progeny plants. In general, such preservation and propagation can be used in known farming methods developed for specific uses such as cultivation, seeding or harvesting. It can also be applied to special processes such as hydroponics and greenhouse cultivation. Growing crops are not only susceptible to damage and attack caused by pests or infectious diseases, but also compete with weeds, so measures are taken to control yields by controlling weeds, plant diseases, pests, nematodes and other harmful conditions. These measures include the application of agricultural chemicals such as herbicides, fungicides, germ killers, nematicides, growth regulators, aging agents and insecticides, as well as mechanical measures such as plowing soil or removing weeds and contagious plants. It is included.

The beneficial genetic properties of the transgenic plants and seeds according to the invention are those with improved properties such as resistance to pests, herbicides or stress, improved nutritional value, increased yields or structural improvements that reduce losses from loading or threshing. It can be used to improve plant varieties aimed at development. The various breeding stages are determined by how well-established techniques are applied, such as selecting plant lines to mate, indicating the pollination of the parent plant line or selecting suitable offspring plants. Different varieties improvement measures are taken according to the desired properties. Related arts are well known in the art and examples include, but are not limited to, hybridization, homocrossing, backcross breeding, multi-week breeding, variant blends, cross-specific hybridization, diploidity, and the like. . Hybridization techniques also include infertile plants to produce male or male sterile plants by mechanical, chemical or biochemical means. The cross pollination of male non-breed plants using different pollen results assures that the male non-breed plants, which are not magnetically incapable plants, will equally obtain the properties of both parental strains. Thus, the transgenic seeds and plants according to the present invention enhance the efficacy of conventional methods such as, for example, spraying herbicides or pesticides, or do not require such methods due to their modified genetic properties. It can be used for breeding improved plants. In addition, their optimized genetic "capacity" can result in new crops with improved stress tolerance, which yield higher quality products than those that cannot tolerate significantly harmful developmental situations.

Germination and seed uniformity are essential product characteristics in seed production, while germination and seed uniformity are not important for farmers who harvest and sell. Seed producers working in the field of growing pure seeds, meeting growing conditions and selling them, because growing crops so that they are free of other crops and weeds, controlling disease caused by seeds and producing seeds with good germination is difficult. A highly concentrated and well-established seed production technology has been developed. Therefore, it is common for farmers to buy certified seeds that meet certain qualities instead of using seeds harvested from their crops. Propagation materials to be used as seeds are usually treated with a protective coating comprising herbicides, insecticides, fungicides, fungicides, nematicides, fungicides, or mixtures thereof. Commonly used protective coatings include compounds such as captan, carboxycin, tiram (TMTD ^R ), metallaxyl (Apron ^R ) and pyrimifos-methyl (Actellic ^R ). If desired, these compounds are formulated with carriers, surfactants or dosage enhancing aids commonly used in the formulation art to provide protection against damage caused by bacterial, fungal or animal pests. Such protective coatings may be applied by impregnating the proliferative material with a liquid formulation or by coating the combined wet or dry formulation. Other application methods are also possible, such as processing directly on buds or berries.

A further aspect of the present invention provides a new agricultural method, such as the method exemplified above, which uses the transgenic plant, the transgenic plant material or the transgenic seed according to the invention to provide control against plant diseases. To provide.

In order to breed offspring from plants transformed according to the method of the present invention, the following methods can be used: Plants produced as described in the following examples can be grown in pots or soil in greenhouses as known in the art. Let it grow and blossom. Pollen is obtained and pollinated to the same plant, progeny plant or all desired plants. Similarly, such transformed plants can be pollinated with pollen obtained from the same plant, progeny plant or any desired corn plant. Transformed progeny obtained by this method can be distinguished from untransformed progeny by the introduction of gene (s) and / or by the concomitant DNA (genotype) or awarded phenotype. Such transformed offspring can also be hybridized with other plants, as is commonly done in all plants that autologize or carry the desired traits. Similarly, other transformed plants produced by this method can also be bred as known in the art for self propagation or production of progeny with the desired traits.

Therefore, in the first aspect of the present invention,

1. (a) a promoter that acts on a plant cell to produce an RNA sequence, eg, a promoter as described above, eg, a corn ubiquitin promoter;

(b) the peptide of SEQ ID NO: 1 or 2 optionally having a structural coding sequence encoding the production of lactoferricin, eg, lactoferricin B or lactoferricin H, for example, N-terminal methionine; Preferably a plant optimized coding sequence, eg, a peptide of SEQ ID NO: 3, 4, 5 or 6; And

(c) a 3 'non-translated region that acts on plant cells to add a polyadenylate nucleotide to the 3' end of the RNA sequence, e.g., a transcription terminator as mentioned above, e.g. Agrobacterium Including a nopaline synthase transcriptional terminator from tumifaciens,

Optionally, recombinant DNA molecules further comprising one or more enhancers or targeting sequences as described herein.

In a second aspect, the present invention,

2. (a) a promoter that acts in a plant cell to produce, for example, (i) an RNA sequence; (Ii) a structural coding sequence encoding the production of lactoferricin; And (iii) inserting a recombinant DNA molecule as mentioned above into the genome of the plant cell comprising a 3 'non-translated region that acts on the plant cell to add a polyadenylate nucleotide to the 3' end of the RNA sequence. step;

(b) obtaining transformed plant cells; And

(c) regenerating from the transfected plant cells a genetically transformed plant that expresses an effective amount of lactoferricin that is effective to reduce damage from infection by the pathogen. Provided are methods for producing plants, for example plants as mentioned above (eg corn or wheat plants capable of expressing lactoferricin).

In a third aspect, the present invention,

3. Plants composed of cells expressing lactoferricin (eg corn, wheat or beet plants), eg

(a) a promoter that acts on plant cells to produce RNA sequences;

(b) a structural coding sequence encoding the production of lactoferricin; And

(c) Recombinant DNA comprising a 3 'non-translated region in the working sequence that acts on a plant cell to add a polyadenylate nucleotide to the 3' end of the RNA sequence is stably integrated into its genome, developmental and morphological Provide plants that are academically normal.

In a fourth aspect, the present invention,

4. Optionally coating (eg, polymer, fungicide, insecticide, dye or other seed coating) to produce a plant consisting of cells expressing lactoferricin when germinated and cultured, for example the aforementioned plants. And / or seeds in bags or other packaging for sale or transport.

In a fifth aspect, the present invention,

5. Use of lactoferricin to control plant pathogens, eg, plant bacterial, fungal or viral pathogens as mentioned above; And exposing such pathogens to plants expressing lactoferricin.

The following description is intended to further illustrate the methods and compositions of the present invention. However, it should be appreciated that other methods known by those skilled in the art can equally be used in the present invention.

Example 1 Antimicrobial Activity of Lactoferricin B on Plant Pathogenic Fungi and Other Microorganisms

a. Spore Germination Suppression

The activity of lactoferricin B is tested in the spore germination inhibition assay using Diplodia mydis and choletotricum graminicola spores. Fungal strains are purchased from Loral Castor (CIBA-GEIGY, Illinois). Lactoferricin B peptide and lactoferrin are obtained from the following companies (Morinaga Milk Industry Co., LTD, Tokyo, Japan). Fungal spores are harvested from spore-forming cultures grown on potato dextrose agar (PDA, Difco) plates. D. Mydis spores are freshly used or stored at -80 ° C in 25% glycerol. Seed. Use Graminicola Spores freshly.

For this assay, 10 ml of molten medium (1.5% agar, containing 8% carrot extract) is cooled to about 50 ° C. 10 microliters of streptomycin (250 mg / ml) was added, followed by di. Midis or Mr. 10 microliters of Graminicola spores are added at a concentration of about 10 ⁶ / ml (D. mydis) and 10 ⁷ / ml (C. graminicola). The solution is mixed by gently vortexing and poured into sterile petri dishes. After the medium has solidified, a 1/4 inch diameter sterile filter disc is placed on top of the exclusion and pipet the test solution onto this disc. Test solutions are lactoferrin (10 micrograms), lactoferricin B (10 micrograms), furothionine (positive controls of 0, 5, 10 and 20 micrograms; purchased from Calbiochem) and buffer (20 mM Tris pH 7.5) . After incubation at room temperature for 2-5 days, fungal growth was clearly visible on the plate except around the filter disc containing furothionine and lactoferricin B. The size of the inhibitory region is represented by one. D. In Mydis experiments, a filter disk with 10 micrograms of lactoferricin B exhibited an inhibitory region of 4.95 mm, whereas 20 micrograms of furothionine showed an inhibitory region of 4.5 mm. Seed. In the graminicola experiments, lactoferricin B produced an inhibitory region of 1.7 mm, whereas furothionine produced an inhibitory region of 2.1 mm. Lactoferrin did not produce any inhibition on fungal germination and growth.

Erwinia stewarti was also tested in this system and it was found that lactoferricin B inhibited the growth of the bacteria.

Inhibition of Spore Germination by Lactoferricin B Suppression zone Fungus Buffer Furotionine 20µg Lactoferricin B10µg D. Mydis 0 mm 4.5mm 4.95mm Seed. Graminicola 0 mm 2.1mm 1.7mm

b. Inhibition of growth of mycelium

The second method used to assess antifungal activity involves measuring growth inhibition of mycelium. In this assay, the wells are drilled using the wide end of the Pasteur pipette in the field of view of a 1.5% agarose plate containing 4% Carrot extract. Seal the bottom of the well with one drop of molten agarose solution. Individual fungal plugs are taken from the master plates of Bipolaris Mydis, Fusarium Monoliforme, Giberella Zea, Pitanium Apanidermatum or Lizatonia Solani and placed in the center of each test plate. The test solution (40 microliters) placed in the wells is lactoferricin B (100 micrograms), lactoferrin (100 micrograms) or buffer (20 mM Tris pH 7.5). After incubation at room temperature for the time required for fungi to grow from the inoculated plug into the wells, fungal growth inhibition is scored. All fungi have been shown to inhibit growth near wells containing lactoferricin B, but no inhibition near lactoferrin or buffer control wells. The results are shown in Table 2.

Inhibition of fungal growth by lactoferricin B Growth inhibition (mm) Fungus Buffer Lactoferricin B (100 μg) Bipolaris Mydis 0 8 Fusarium Monoliforme 0 9.7 Giberella Zea 0 9.8 Phytium Aparnidermathum 0 20.9 Lizhatonia Solani 0 1.6

c. Minimum inhibitory concentration in liquid culture

The activity of lactoferricin B and two derivatives against Fusarium Kummorum and Septoria nodorum is tested in the liquid inhibition assay. Peptides include lactoferricin B (as mentioned above), Met-lactoferricin B (lactoferricin B with additional N-terminal methionine) and Gln-lactoferricin B (with additional N-terminal glutamine Lactoferricin B). All peptides are purchased from W.M. Keck Biotechnology Resource Center, New Haven, CT. Peptides are dissolved at 1.5 mg / ml in double distilled sterile water.

Fungal spores are harvested from spore-forming cultures grown on potato dextrose agar (PDA, Difco) plates as mentioned above and diluted to 15,000 / ml in 1/2 concentration PDA. 250 microliters of peptide serially diluted in the entire 96 well plate is added to 50 microliters of spores. After mixing the wells, the OD at 590 nm is measured (measured on fungal growth). The plates are then incubated at 28 ° C. and the OD at 590 nm is measured at regular intervals over the next two days. The minimum concentration of lactoferricin B peptide that completely inhibits growth is indicated as the minimum inhibitory concentration (MIC). These values are shown in Table 3.

Peachia pastoris are grown on YPD plates and Pseudomonas Syringe BL882 and E. coli. E. coli DH5α is grown in L broth. A small amount of blood. Pastoris cells are resuspended in YPD, the cell concentration is counted and then adjusted to 30,000 cells / ml using YPD. The OD at 600 nm of the cultures of DH5α and BL882 is measured. The cell concentration is adjusted to 30,000 cell counts / ml in L broth, assuming OD at 600 nm for BL882 corresponding to DH5α corresponding to 109 cell counts / ml and BL × 2 corresponding to 5 × 10 cell counts / ml.

20 microliters of lactoferricin B peptide serially diluted in total 96 well plates is added to 80 microliters of cells. The OD at 590 nm of this plate is then read and then the plate is incubated at 28 ° C. The OD is then read at 590 nm at regular intervals over two days. The minimum concentration of lactoferricin B peptide that completely inhibits growth is expressed as the minimum inhibitory concentration (MIC). These values are shown in Table 3.

Minimum inhibitory concentration of lactoferricin B organism Peptide Lactoferricin B Met-lactoferricin B Gln-lactoferricin B F. Kulmorum 20 20 20 s. Nodo Room 100 100 100 Seed. Graminicola 100 100 100 blood. Syringe BL882 20 20 20 this. E. coli DH5α 100 100 100 Peachia Pastoris 300 300 300

Example 2: Stability of Gln-lactoferricin B peptide in plant extracellular fluid

The lactoferricin B peptide is expressed in plants using control sequences that direct the lactoferricin B peptide to several different subcellular locations (described in more detail in Examples 3-6 below). In the case of extracellular expression, the coding sequence of lactoferricin B is fused to the leader sequence of the maize PR-1 gene which secretes the peptide into the extracellular space. Since the leader sequence used for this purpose contains a glutamine residue in the starting sequence of the secreted mature PR-1 protein, lactoferricin B peptide (Gln-lactoferricin B) with an additional N-terminal glutamine residue is secreted. do. Synthetic Gln-lactoferricin B peptides are tested for their stability in extracellular washings of wheat, corn and tobacco.

Extracellular wash (ECF) is obtained by infiltrating leaf tissue with sterile double distilled water, and the tissue thus infiltrated is recovered by centrifugation. For wheat, the leaves of the UC703 plant are used, and for corn, the leaves of the 6N615 plant. These leaves are cut into small pieces and placed in a 20 ml syringe barrel containing cotton wool at the bottom. The cleavage is washed with water to remove cellular secretions from the cleavage surface. Water is then added and the piston is placed in a syringe barrel. The syringe is placed upside down in a freeze dryer container and then connected to the freeze dryer. After applying a slight vacuum for 30-40 seconds, the vacuum is released. Repeat this one more time. The leaf pieces are then placed in a 10 ml syringe pail and placed in a centrifuge tube. It is spun at 1000 to 2000 rpm in a clinical centrifuge to recover the extracellular wash and then frozen.

For tobacco (Cultivar xanthi, nc), water is injected into the leaves using a 10 ml syringe. The leaves are then removed from the plant, dry blotted, rolled up, cut into short cylinders and placed in a 10 ml syringe pail. The syringe is placed in a centrifuge tube and spun at 1000 rpm in a clinical centrifuge. The wash solution collected in this tube is collected and frozen.

Aliquots of ECF are performed on 10% Tricine gel according to manufacturer's instructions (Novex). Relative protein concentration criteria are made for each plant ECF. This is used to make an estimate of the amount of ECF needed from each solution collected to have approximately the same amount of total ECF protein in successive cultures. Thus, 18.5 microliter ECF from wheat, 31 microliter ECF from corn and 60 microliter ECF from tobacco were total 75 containing 10 mM Tris pH 7.5, 50 mM NaCl, 2.5 mM MgCl ₂ and 2.5 mM CaCl ₂ , respectively. Incubate with 11.25 micrograms Gln-lactoferricin B peptide in microliter volume. The reaction is incubated at 37 ° C. and 10 microliter aliquots are taken at 0, 15, 30, 60, 90, 120 and 180 minutes. These samples are frozen immediately.

This sample is subjected to heat inactivation and alkylation and then analyzed for the presence of Gln-lactoferricin B by gel electrophoresis. After 10 minutes of incubation at 100 ° C., the sample is cooled and rapidly spun in an Eppendorf centrifuge. The alkylation reaction of each sample is first performed by reducing the sample with 2 microliters 1 mM DTT for 10 minutes at 100 ° C. in N ₂ atmosphere. Iodoacetamide (10 mM 2 microliters) and 1.4 microliters 1M Tris (pH 8.5) are then added to make the solution more basic. After flushing the tube with N ₂ , the sample is incubated in the dark at 50 ° C. for 50 minutes. Control peptide samples (Gln-lactoferricin B peptide without buffer or ECF) are alkylated in the same manner. The sample is stored frozen until analyzed by gel electrophoresis.

To each sample, an equivalent amount of 2 × Tricine / SDS sample buffer is added (Novex), and then they are incubated at 100 ° C. for 5 minutes. This sample is then run on a 10-20% Tricine / SDS gel (Novex) according to the manufacturer's instructions. This gel is stained with Pharmacia and bleached to visualize the peptide bands.

Gln-lactoferricin B peptide is very stable in wheat ECF. A significant amount of peptide still exists after 3 hours of incubation, indicating that degradation of this peptide is relatively slow in the ECF. In corn and tobacco ECF, Gln-lactoferricin B peptides are reduced but still exist after 3 hours of incubation.

The results indicate that Gln-lactoferricin B peptides only slowly degrade in the ECF of these three plant species. Degradation of these peptides in ECF takes more than 3 hours under these conditions.

Example 3: Construction of a Gene for Cytoplasmic Expression of Lactoferricin B in Plants

Coding and non-coding DNA sequences for the cytoplasmically expressed synthetic lactoferricin B gene are obtained by synthesizing two partially complementary oligonucleotides. These oligonucleotides (from 5 'to 3' on the coding chain) terminate the BamHI restriction enzyme, the Kozak consensus site including the methionine start codon, the 75 base pairs encoding the amino acid sequence of the lactoferricin B peptide, the stop codon, and the NotI restriction. Encode the end of the enzyme.

The nucleotides of the oligos are as follows:

Oligo 1 (SEQ ID NO: 7):

5'-GATCCACCATGTTCAAGTGCCGCCGCTGGCAGTGGCGCATGAAGAAGCTGGGCGCCCCCAGCATCACCTGCGT

GCGCAGGGCCTTCTAAGC-3 '

Oligo 2 (SEQ ID NO: 8):

5'-GGCCGCTTAGAAGGCCCTGCGCACGCAGGTGATGCTGGGGGCGCCCAGCTTCTTCATGCGCCACTGCCAGCGG

CGGCACTTGAACATGGTG-3 '

These synthetic oligonucleotides are purchased and electrophoresed on 10% urea / polyacrylamide gels and the bands containing the full length oligonucleotides are cleaved. This oligonucleotide is eluted, annealed and used for PCR amplification using oligos 1-1 and 2-1.

Oligo 1-1 (SEQ ID NO: 9):

5'-AGTAGGATCCACCATGTTCAAGTGCC-3 '

Oligo 2-1 (SEQ ID NO: 10):

5'-TACTGCGGCCGCTTAGAAGGCCCTGCGC-3 '

This PCR product is linked to pCRII, clones containing such inserts are identified and the inserts are sequenced to confirm the absence of mutation introduction. The BamHI-NotI insert of the clone with the correct sequence is cloned into BamHI and NotI predigested bluescripts. A 2 kb HindIII-BamHI fragment containing the ubiquitin promoter (Toki et al., Plant Physiol. 100: 1503) is cloned into the HindIII-BamHI site of the clone. The nos terminator was linked to the NotI-SacI site to generate a plasmid with pCIB7703 (shown in FIG. 1), ie the ubiquitin-lactoferricin B-nos gene cassette. DNA fragments containing ubi-SynPAT-nos are cloned into the HindIII site of the plasmid. The resulting plasmid pCIB7704 (shown in FIG. 2) contains the ubi-SynPAT-nos and ubi-lacto-nos gene cassettes. This plasmid contains the SynPAT gene for selection in plants and is useful for transforming plants with lactoferricin B gene under the control of a corn ubiquitin promoter.

Plasmid pCIB7704 was cleaved with KpnI and SacI to release fragments containing the ubi-SynPAT-nos--ubi-lacto-nos gene fusion. This fragment was cloned into KpnI, SacI digested pCIB6848 to form pCIB7705 (shown in FIG. 3). Plasmid pCIB7705 contains the NPTII (kanamycin resistance) gene for selection in bacteria and the SynPAT gene for selection in plants and is useful for transforming plants with lactoferricin B gene under the control of a corn ubiquitin promoter.

KpnI-SacI fragments from pCIB7703, containing the ubi-lacto-nos construct, are cloned into plasmid pCIB6848 to generate pCIB7706 (shown in FIG. 4). This places the ubi-lacto-nos gene construct in the plasmid containing the kanamycin resistance gene.

Example 4 Construction of Synthetic Gene for Extracellular Expression of Lactoferricin B in Plants

For extracellular expression of lactoferricin B, the leader sequence is located at the 5 'end of the lactoferricin B gene. Leader sequences are cloned from the maize cDNA library (using the barley PR-1 gene probe) and derived from the sequenced maize PR1 cDNA (PR-1mz) (Patent Publication WO 95/19443). The gene construct is prepared in two steps using synthetic oligonucleotide and PCR amplification techniques. Oligonucleotide 3 is identical to the starting sequence of the PR-1 leader and lactoferricin B coding sequence, except for a single asymptomatic nucleotide change (to prevent potential secondary structural problems). Oligo 4 is complementary to the lactoferricin B coding sequence (the design of which is described in the detailed description), and the 3 'end of the PR-1 leader sequence. Oligo 3-1 is identical to the 5 'end of the PR-1 coding sequence.

The nucleotide sequence of the synthetic oligonucleotide is as follows:

Oligo 3 (SEQ ID NO: 11):

5'-GATCCACCATGGCACCGAGGCTAGCGTGCCTCCTAGCTCTGGCCATGGCAGCCATCGTCGTGGCGCCATGCACG

GCCTTCAAGTGCCG-3 '

Oligo 4 (SEQ ID NO: 12):

5'-GGCCGCTTAGAAGGCCCTGCGCACGCAGGTGATGCTGGGGGCGCCCAGCTTCTTCATGCGCCACTGCCAGCGGC

GGCACTTGAAGGCC-3 '

Oligo 3-1 (SEQ ID NO: 13)

5'-AGTAGGATCCACCATGGCACCGAGGCTAG-3 '

Oligo 5 (SEQ ID NO: 14):

5'-AGTACCATCGTCGTGGCGCCATGCACGGCCCAGTTCAAG-3 '

First, oligo 3-1 and 4 are used to PCR amplify the maize PR1 leader sequence, using maize PR-1 cDNA clone as a template. This produces a PCR fragment containing a portion of the original BamHI restriction site, RP-1 leader, lactoferricin B and NotI restriction site. Using oligo 2-1 (described in Example 3 above) and oligo 3 as primers, the lactoferricin B template is used for the PCR reaction. These two PCR fragments are then mixed, denatured at 94 ° C. and then expanded with Taq DNA polymerase at 72 ° C. for 5 minutes. The reaction is then raised and PCR amplified for 10 cycles using 2-1 and 3-1. This PCR fragment is cloned into PCRII. Clones containing the inserts are identified and the inserts are sequenced to confirm the absence of mutation introduction. Isolate plasmid # 10 containing the insert with one mutation in the leader sequence (12th amino acid changed from GCC to GAC). The experiment was repeated to isolate plasmid # 11 with one mutation in the lactoferricin B gene sequence (15th amino acid changed from GCC to ACC). These two plasmids, each with different mutations generated, are used to make corrected sequences. The BamHI-NotI insert is cloned into pBluescript as the BamHI-NotI insert. The BstXI fragment containing the mutation is removed from the BlueScript plasmid containing Insert # 11 and replaced with the corresponding BstXI fragment from the BlueScript plasmid containing Insert # 10. 2kb HindIII-BamHI fragment containing the ubiquitin promoter [Toki et al., Plant Physiol. 100: 1503] is cloned into the HindIII-BamHI site of the clone and the nos termination is linked to the NotI-SacI site. The resulting plasmid is referred to as p # 10/11. This calibrated plasmid is used as template in PCR reactions using oligo 5 and oligo 2-1 as primers. Oligo 5 adds one amino acid, glutamine, before the first amino acid of lactoferricin B. This produces the original leader cleavage site at the junction of the PR-1 leader and lactoferricin B sequence. This is expected to result in the removal of the PR1 leader in plant cells, resulting in lactoferricin B peptides with added N-terminal glutamine.

The resulting PCR fragment is cloned into pCRII and the clone is sequenced. BstXI-NotI inserts with the correct sequence (containing additional glutamine) are isolated and then cloned into BstXI, NotI digested p # 10/11 to generate pCIB7707. Thus the maize PR1 leader-lactoferricin B coding sequence is located under the control of the ubiquitin promoter and the nos terminator (ubi-PR1-lactoferricin B-nos). Cloning the DNA fragment containing ubi-SynPAT-nos to the HindIII site of the plasmid yields plasmid pCIB7708 containing SynPAT and PR1-lactoferricin B gene cassette.

The plasmid was cleaved with KpnI and SacI to release the insert containing the ubi-SynPAT-nos--ubi-PR1-lacto-nos gene fusion. This fragment is cloned into KpnI, SacI digested pCIB6848 to form pCIB7709. This plasmid contains the NPTII (kanamycin resistance) gene for selection in bacteria and the SynPAT gene for selection in plants and is useful for transforming plants with the lactoferricin B gene under the control of a corn ubiquitin promoter.

KpnI-SacI fragment from pCIB7707, containing the ubi-lacto-nos cassette, is cloned into plasmid pCIB6848 to generate pCIB7710. This places the ubi-lacto-nos gene construct in the plasmid containing the kanamycin resistance gene.

Example 5: Construction of genes for vacuole expression of lactoferricin B in plants

For vesicular expression of lactoferricin B, the PR1 leader-lactoferric B gene described in Example 4 above (construction of synthetic gene for extracellular expression of lactoferricin B in plants) To the 3 'end of the cassette. This additional 18 base pair sequence encodes the C-terminal Val-Phe-Ala-Glu-Ala-Ile vacuole targeting sequence (Dombrowski et al., Plant Cell 5, 587-596, 1993), followed by a stop codon. . Restriction ends are also inserted at the 5 'and 3' ends of the synthetic gene to facilitate cloning.

Two oligonucleotides are used to construct the synthetic gene. The sequence of oligo 3-1 is described in Example 4 above. The sequence of oligo 6 contains the complement of the 3 'end of the lactoferricin B coding sequence, the codons for vacuole targeting sequence, the stop codon and the NotI restriction enzyme site. Its sequence is as follows:

Oligo 6 (SEQ ID NO: 15):

5'-AGTAGCGGCCGC-TTA-GATGGCCTCGGCGAACAC-GAAGGCCCTGCGCACGCA-3 '

Oligo 3-1 and oligo 6 are used to PCR amplify the PR1 leader-lactoferricin B gene construct in plasmid pCIB7707 described in Example 4 above. These PCR fragments are cloned into pCRII and clones with inserts are selected. This insert is sequenced and the BamHI-NotI fragment is cleaved using a clone with the correct sequence. This fragment was cloned into BlueScript and contained a 2 kb HindIII-BamHI fragment containing the ubiquitin promoter [Toki et al., Plant Physiol. 100: 1503] is cloned into the HindIII-BamHI site of the clone and the nos terminator is linked to the NotI-SacI site. This produces pCIB7712. As such, the maize PR1 leader-lactoferricin B-vesicle target sequence is located under the control of the ubiquitin promoter and the nos terminator (ubi-PR1-lactoB-vac-nos). Linking a DNA fragment consisting of ubi-SynPAT-nos to the HindIII site of the plasmid produces plasmid pCIB7713.

Plasmid pCIB7713 was digested with KpnI and SacI to release fragments containing the ubi-SynPAT-nos--ubi-PR1-lacto-nos gene fusion. This fragment is cloned into KpnI, SacI digested pCIB6848 to form pCIB7714. This plasmid contains the NPTII (kanamycin resistance) gene for selection in bacteria and the SynPAT gene for selection in plants and is useful for transforming plants with the lactoferricin B gene under the control of a corn ubiquitin promoter.

KpnI-SacI fragments from pCIB7712, containing the ubi-lacto-nos cassette, are cloned into plasmid pCIB6848 to generate pCIB771015. This placed the ubi-lacto-nos gene construct in a plasmid containing kanamycin resistance gene.

Example 6: Construction of a gene for chromosome expression of lactoferricin B in plants

For chromosomal expression of lactoferricin B, the chloroplast target sequence of the ribulose-1,5-biphosphate carboxylase subunit (ssu) gene is cloned and placed 5 'to the lactoferricin B gene sequence. This transpeptide peptide sequence directs the bovine unit protein to the chloroplast, which cleaves it to release the mature protein. Designed transcit peptide-lactoferricin B gene constructs (from 5 'to 3') include BamHI restriction sites, Kozak consensus sites including methionine start codons, chloroplast target sequences fused to lactoferricin B peptide coding sequence, and quiescence Codon and NotI restriction enzyme sites. Chloroplasts of the ssu gene from Arabidopsis (ats1A; Wong et al., Plant Mol. Biol. 20, 81-93, 1992) and corn (Matsuoka et al., J. Biochem. 102, 673-676, 1987) A lactoferricin B gene construct with the target sequence is made. Coding sequences of the transit peptides of these ssu genes (Wang et al., Plant Mol. Biol. 20, 81-93, 1992] are cloned by PCR amplification from genomic DNA, cDNA or cDNA libraries. Three series of transit peptide sequences (TP1, TP2 and TP3) are described in Wong et al., Plant Mol. Biol. 20, 81-93, 1993] are constructed from both arabidopsis and maize ssu genes. Thus, TP1 contains the coding sequence of the transpeptide peptide alone (up to the cleavage site), while TP2 and 3 have the complete coding sequence for the transpeptide peptide and a portion of the coding sequence of the mature ssu protein, having a double cleavage site. TP2 has an additional two amino acid codons that pass through the double cleavage site. TP3 terminates exactly at the double cleavage site.

a. Arabidopsis chloroplast target sequence-lactoferricin B gene construct

The first transcit peptide sequence is cloned using oligonucleotides ATP-5 'and ATP1-3' for amplification. The sequences for these oligonucleotides are as follows:

ATP-5 '(SEQ ID NO: 16):

5'-AGTAGGATCCACCATGGCTTCCTCTATGCTC-3 '

ATP1-3 '(SEQ ID NO: 17):

5'-GCAGTTAACTCTTCCGCCGTT-3 '

The ATP-5 'oligonucleotide contains a BamHI restriction site for facilitating cloning, a Kozak consensus sequence in the 5' direction to the start codon, and the first 18 nucleotides of the coding sequence of the ats1A gene. Genomic DNA is used as a template. The amplified product was cloned into pCR-Script (SK +) and the clones were sequenced to confirm that the insert contained 165 bp of the ats1A transcit peptide coding sequence, expanding from +1 to +165 bp. Is referred to as pATP1.

Fusing the transcit peptide sequence to lactoferricin B comprises four primers: a sequence from the 5 'end of the ATP1 amplification product, ATP-LF 5' (SEQ ID NO: 18): 5'-GTAGGATCCACCATGGCT-3 '; The same sequence as Oligo 2-1 described in Example 3, ATP-LF 3 '; And two bridge primers spanning the ats1A / lactoferricin B fusion and consisting of 18 nucleotides at the 3 'end of ATP1 and 18 nucleotides at the 5' end of the lactoferricin B coding sequence. do. The sequence of the 5 'bridge primer is as follows:

ATP-LFB 5 '(SEQ ID NO: 19):

5'-GGCGGAAGAGTTAACTGCTTCAAGTGCCGCCGCTGG-3 '

The sequence of the 3 'bridge primer is as follows:

ATP-LFB 3 '(SEQ ID NO: 20):

5'-CCAGCGGCGGCACTTGAAGCAGTTAACTCTTCCGCC-3 '

For each transfusion fusion construct, two rounds of amplification process are performed. The first round involves two sets of responses. Reaction 1 generates specific ATP1 PCR fragments with short lactoferricin B sequence extensions. These reactions included primers ATP-LF 5 'and APT-LFB 3' and plasmid pATP1 DNA. Reaction 2 results in a lactoferricin B PCR fragment with a short 5 ′ ATP1 sequence extension. These reactions included either ATP1-LFB 5 ′ using primer ATP-LF 3 ′ and cloned lactoferricin B as template. The second round of the amplification process mixes the products of reactions 1 and 2 in equal volumes, denatures at 94 ° C. for 1 minute, then extends the annealed product at 72 ° C. for 5 minutes in the presence of Taq DNA polymerase and nucleotides. By forming a “complete length” mold. Subsequently, primers ATP-LF 5 'and ATP-LF 3' are added and PCR amplification is performed. This produces the ATP1-lactoferricin B gene fusion. This PCR product is cloned into a PCRII vector. Clones are isolated and sequenced. Plasmids with the correct sequence are digested with BamHI and NotI and the insert is cloned into BamHI, NotI predigested Bluescript. A 2 kb HindIII-BamHI fragment containing the ubiquitin promoter (Toki et al., Plant Physiol. 100: 1503) is cloned into the HindIII-BamHI site of the clone and the nos terminator is linked to the NotI-SacI site. The resulting plasmid contains the ATP1 chloroplast target sequence on top of the lactoferricin B coding sequence. This gene construct is placed between the ubiquitin promoter and the nos terminator. DNA fragments containing the ubi-SynPAT-nos gene construct are cloned into the HindIII site of the plasmid to generate plasmid pCIB7721. The resulting plasmid was cleaved with KpnI and SacI to release an insert containing the ubi-SynPAT-nos--ubi-ATP1 / 2 / 3-lacto-nos gene fusion. This fragment is cloned into KpnI, SacI digested pCIB6848 to form pCIB7722. This plasmid contains the NPTII (kanamycin resistance) gene for selection in bacteria and the SynPAT gene for selection in plants and is useful for transforming plants with the lactoferricin B gene under the control of a corn ubiquitin promoter. KpnI-SacI fragment from pCIB7720, containing the ubi-ATP1-lacto-nos gene fusion, is cloned into plasmid pCIB6848 to generate pCIB7723. This places the ubi-ATP1-lacto-nos gene fusion in the kanamycin resistance gene containing plasmid.

The second transpeptide peptide coding sequence, ATP2, is cloned in the same manner as ATP1 using oligonucleotides ATP-5 'and ATP2-3' and using genomic DNA or oligo dT-primed reverse-transcribed RNA as a template.

Oligo ATP2-3 'Sequence (SEQ ID NO: 21):

5'-CTGCATGCAGTTGACGCGACCACCGGAATCGGTAAGGTCAGG-3 '

Cloning the PCR product and sequencing the clone with the insert confirms that the clone contains 261 bp of ats1A transit peptide coding sequence extending from +1 to +261. Clones with the correct sequence are referred to as plasmid pATP2. A third transcit peptide coding sequence, ATP3, is cloned in the same manner as ATP2 using oligonucleotides ATP-5 'and ATP3-3'.

Oligo ATP3-3 'Sequence (SEQ ID NO: 22):

5'-GCAGTTGACGCGACCACCGGAATCGGTAAGGTCAGG-3 '

Clones with the correct sequence, which clone the PCR product and contain ats1A transcit peptide coding sequence 255bp extending from +1 to +255, are referred to as plasmid pATP3.

These transpeptide peptide sequences are fused to the lactoferricin B gene sequence as described for ATP1 above. The sequence of the 5 'bridge primer set is as follows:

ATP2-LFB 5 '(SEQ ID NO: 23):

5'-CGCGTCAACTGCATGCAGTTCAAGTGCCGCCGCTGG-3 '

ATP3-LFB 5 '(SEQ ID NO: 24):

5'-GGTGGTCGCGTCAACTGCTTCAAGTGCCGCCGCTGG-3 '

The sequence of the 3 'bridge primer (complement of 5' bridge primer) set is as follows:

ATP2-LFB 3 '(SEQ ID NO: 25):

5'-CCAGCGGCGGCACTTGAACTGCATGCAGTTGACGCG-3 '

ATP3-LFB 3 '(SEQ ID NO: 26):

5'-CCAGCGGCGGCACTTGAAGCAGTTGACGCGACCACC-3 '

The resulting PCR fusion product is cloned. Clones with the correct sequence have ATP2-lactoferricin B and ATP3-lactoferricin B gene fusions. These fragments are cloned into BlueScript and the ubiquitin promoter and nos terminator are added as mentioned above to generate pCIB7730 and pCIB7740. ATP1 / 2 / 3-lactoferricin B gene construct is located between the ubiquitin promoter and the nos terminator. New constructs with the ubiquitin-SynPAT-nos fragment were generated as described for pCIB7720, resulting in plasmids pCIB7731 and pCIB7741.

b. Corn Chloroplast Target Sequence-Lactoferricin B Gene Construct

The corn ssu gene in a similar manner as described for the arabidopsis ssu transpeptide peptide-lactoferricin B gene construct [Matsuoka et al., J. Biochem. 102, 673-676, 1987] is used to synthesize additional transcit peptide-lactoferricin B fusion constructs. The only difference is the source of the template DNA and the oligonucleotide sequence for producing the transit peptide. Template DNA for PCR amplifying the maize ssu transit peptide sequence is maize genomic DNA, cDNA or cDNA library. Oligonucleotide sequences (5 'to 3') are as follows:

MTP-5 '(SEQ ID NO: 27):

5'-AGTAGGATCCACCATGGCGCCCACCGTGATG-3 '

MTP1-3 '(SEQ ID NO: 28):

5'-GCACCGGATTCTTCCGCCGTT-3 '

MTP2-3 '(SEQ ID NO: 29):

5'-CTGCATGCACCGTATGCGACCACCGTCCGTCGACAGCGGCGG-3 '

MTP3-3 '(SEQ ID NO: 30):

5'-GCACCGTATGCGACCACCGTCCGTCGACAGCGGCGG-3 '

MTP-LF 5 '(SEQ ID NO: 31):

5'-GTAGGATCCACCATGGCG-3 '

MTP-LF 3 '(SEQ ID NO: 32):

5'-GCGGCCGCTTAGAAGGC-3 '

MTP1-LFB 5 '(SEQ ID NO: 33):

5'-GGCGGAAGAATCCGGTGCTTCAAGTGCCGCCGCTGG-3 '

MTP2-LFB 5 '(SEQ ID NO: 34):

5'-CGCATACGGTGCATGCAGTTCAAGTGCCGCCGCTGG-3 '

MTP3-LFB 5 '(SEQ ID NO: 35):

5'-GGTGGTCGCATACGGTGCTTCAAGTGCCGCCGCTGG-3 '

MTF1-LFB 3 '(SEQ ID NO: 36):

5'-CCAGCGGCGGCACTTGAAGCACCGGATTCTTCCGCC-3 '

MTF2-LFB 3 '(SEQ ID NO: 37):

5'-CCAGCGGCGGCACTTGAACTGCATGCACCGTATGCG-3 '

MTF3-LFB 3 '(SEQ ID NO: 38):

5'-CCAGCGGCGGCACTTGAAGCACCGTATGCGACCACC-3 '

The resulting plasmid contains the corn transit peptide sequences (MTP1, 2 and 3) fused to the lactoferricin B coding sequence.

Example 7: Lactoferricin B Gene Expression in Corn Protoplasts

Protoplasts known to allow transient expression are used for transient expression of lactoferricin B containing plasmids. Protoplasts were isolated from suspension cultured cells and described as 20 × 10 ⁶ as described in Shillitto et al., US Pat. No. 5,350,689: Zea mays plants and trangenic zea mays plants regenerated from protoplasts or protoplast derived cells, 1989. Resuspend in 0.5 M mannitol / 15 mM MgCl ₂ at a concentration of / ml. Plasmid DNA used for transformation was as follows: pUbi-bar containing ubiquitin promoter plus first exon and intron, bar gene and nos terminator; PUbi-GUS containing ubiquitin promoter plus first exon and intron, GUS gene and nos terminator; And pCIB7703. Plasmid DNA is introduced into the protoplasts by PEG precipitation (Kramer et al., Planta 190, 454-458, 1993) as follows: heat-shock the protoplasts by gently shaking the tubes for 4 minutes in a 45 ° C. water bath. Let's do it. An aliquot of 500 microliters containing 10 million protoplasts is transferred to sterile tubes and 25 to 50 μg of each plasmid and 450 microliters of 40% PEG are added to each tube. PEG is prepared from PEG 8000 (Sigma Chemical Co., St. Louis, Mo.) dissolved in a solution of 0.4 M mannitol and 0.1 M Ca (NO ₃ ) 2 .4H ₂ O and its pH adjusted to 8.0. Allow the tube to stand for 20 minutes with gentle vortex intermittently and then, at 5 minute intervals, remove 1 ml, 2 ml and 5 ml volumes of W6 solution (5 mM KCl, 61 mM CaCl ₂ H ₂ O, 154 mM NaCl, 51 mM glucose, 0.1% 2 -(N-morpholino) ethanesulfonic acid, pH 6.0). After final dilution, centrifugation of the protoplasts at 60-100 g for 10 minutes and removal of most of the supernatant leaves approximately 0.5 ml of liquid throughout the protoplasts. The protoplasts are resuspended in the remaining solution by gentle shaking. Protoplasts are resuspended at a density of 2 × 10 ⁶ / ml in FW medium and incubated at room temperature in the dark for 18 hours after introduction of DNA for RNA analysis and protein expression. Protein extracts are prepared from all transformants in aliquots according to the manufacturer's instructions (Tropix) for use in subsequent GUS activity measurements. The results show that cells transformed with the combination of pCIB7703 and ubi-GUS are comparable to the GUS activity (10 × 10 ⁶ counts / min / 1 × 10 ⁶ protoplasts) of cells transformed with ubi-bar and ubi-GUS. It appears to have abundant GUS activity (10 × 10 ⁶ counts / min / 1 × 10 ⁶ protoplasts). This indicates that the expression of the lactoferricin B gene construct has no effect on GUS gene expression in transiently expressed cells, ie no cytotoxicity is shown. Cells transformed with ubi-bar and pCIB7703 showed only background levels of GUS activity (5000 counts / min / 1 × 10 ⁶ protoplasts).

RNA samples are prepared for reverse transcription-PCR (RT-PCR) analysis to assess the presence of lactoferricin B mRNA. To this end, total and poly (A) RNA are isolated from the transfected protoplasts. RT-PCR is performed using a commercial kit (Stratagene) according to the manufacturer's instructions. To detect ubi-lactoferricin B-nos cDNA, PCR primers are used that are complementary to the sequence directly adjacent to 5 'for the first exon in the polyadenylation signal of the nos terminator and the ubiquitin promoter. Since there is an intron between the exon and the lactoferricin B coding sequence / nos terminator in the pCIB7703 construct, it can be seen that the generated PCR band was derived from RNA based on its size. For RT-PCR reactions, 1 μl total RNA is reverse transcribed in 50 μl reaction volume according to manufacturer's instructions. Of these, 1 μl was added to primers 176 (SEQ ID NO: 39'5'-TTCCCCAACCTCGTGTTGTTC-3 ') and 179 (SEQ ID NO: 40'5'-CCAAATGTTTGAACGATCGCG-3'), or primer 177 (SEQ ID NO: 41'5'-CACAACCAGATCTCCCCCAAA-3 '). And 180 (SEQ ID NO: 42: 5'-AAATTCGCGGCCGCTTAGAAG-3 ') for PCR amplification. The reaction conditions were as follows: 45 seconds at 94 ° C., 45 seconds at 60 ° C. and 2 minutes at 72 ° C., 43 cycles. Samples are separated by size on agarose gel. Primers 176 and 179 produce a PCR fragment of about 220 bp, as expected with template DNA derived from cells transformed with the pCIB7703 plasmid. PCR bands derived from plasmids are expected to be 1.3 kb in size.

For northern analysis, RNA samples are sized on agarose gels and blotted onto nylon membranes. This blot subsequently hybridizes to a radioactive probe containing the lactoferricin B gene construct sequence.

Protein extracts for immunoblotting are prepared by preparing protoplast suspensions in suitable buffers. This suspension is centrifuged for 5 minutes and the supernatant and pellets are suspended in Laemmli sample buffer and Rammelli SDS gel electrophoresis. Since the disulfide binding of lactoferricin B peptides to proteins may be problematic, it may be required to reduce the protein-SH group in the extract and then block the iodoacetamide in the extract before electrophoresis. have. Electrophoresis gels are electroblotted to nitrocellulose for western analysis using anti-lactoferricin B antiserum.

Protein extracts for mass spectrometry are prepared by vortexing protoplast suspensions vigorously in buffer, which is microcentrifuged twice for 10 minutes, and then the supernatant is collected every time. Using standard protocols for peptide analysis, appropriate dilutions are analyzed by MALDI-MS (Voyager, Perceptive Biosystems). If the sample needs to be further purified, the extract is fractionated on a C18 column. The fractions are then analyzed for the presence of lactoferricin B peptide by MALDI-MS.

Protein extracts are prepared for antifungal activity evaluation. In this case, the protoplasts are homogenized in 20 mM Tris buffer (pH 7.5) containing 1.5% PVPP, 5 mM DTT, and 10 μM AEBSF (4- (2-aminoethyl) -benzenesulfonyl fluoride, hydrochloride). The extracts are evaluated for antifungal activity based on in vitro fungal inhibition assays as described in Example 1 above.

Transient expression analysis of other lactoferricin B gene containing constructs is performed using the methods described in this example.

Example 8: Plant Transformation, Selection and Regeneration

a. Description of Plasmids and Selectable Markers

The lactoferricin B gene construct is placed under the control of the ubiquitin promoter and the nos terminator. For cone transformation, selectable markers are cloned into these plasmids consisting of the synthetic phosphinothricin acetyltransferase gene (named SynPAT) under the control of the corn ubiquitin promoter and the nos terminator (ubi-SynPAT-nos). . SynPAT is a synthetic version of the bar gene from Streptomyces strains optimized for expression in plants (Thomson et al., EMBO 6: 2519-2523, 1987) (US Pat. No. 5,276,268; Phosphinothricin-resistant genes and uses thereof. Plasmids containing the ubi-SynPAT-nos cassette (pUBIAc) are obtained from Hoechst Aktiengesellschaft, Frankfurt, Germany. Cones are transformed using plasmids containing the ubi-lactoferricin B-nos and ubi-SynPAT-nos cassettes. The presence of the SynPAT gene cassette allows for the secretion of transformed plants using herbicide BASTA. In the case of wheat transformation, the plasmid containing the ubi-lacto-nos gene cassette is bombarded together with the plasmid (pUBA or pUBA / kan) containing the mar selectable gene under the control of the ubiquitin promoter and the nos terminator. [Toki et al., 1992 Plant Physiol. 100: 1503-1506. Due to the presence of the bar gene cassette, it is possible to secrete transformed plants using the producer BASTA. pUBA plasmids are ubi-bar-nos and E. coli. It contains an ampicillin resistance gene for selection in E. coli. Plasmid pUBA / kan is E. coli. It contains kanamycin resistance gene instead of ampicillin resistance gene for selection in E. coli.

this. The hygromycin gene from E. coli (Gritz and Davies, Gene 25, 179-188, 1983) was isolated, the BglII linker was linked on the end, and the fragment was cloned into the BamHI site of vector pCIB710 to generate pCIB712. Let's do it. The gene from pCIB712 is PCR amplified using two oligonucleotides 5'-AGTAGGATCCATGAAAAAGCCTGAACTC-3 '(SEQ ID NO: 43) and 5'-TACTGGATCCCTATTCCTTTGCCCTC-3' (SEQ ID NO: 44). PCR fragments are digested with BamHI and cloned into the BamHI site of pPEH3. Clones with inserts are sequenced and clones with the correct sequence and the correct orientation of the gene are named pCIB7613. This plasmid contains the hydromycin resistance genes under the control of the ubiquitin promoter and the nos terminator. After impacting the plants with these plasmids, the transformed plants can be selected using hygromycin as the selection agent.

Using the arabidopsis gene as a probe, the acetohydroxy acid synthase (AHAS) gene is cloned from a lambda-Zap genomic library derived from sulfonylurea resistant corn tissues. See K. Sathasivan et al. , Nucl. Acid Res. 18, 2188. Transition from G base to A base is introduced at position 1862 of the gene by PCR amplification using one oligonucleotide that exhibits a suitable single base change. This nucleotide change causes Ser to turn into Asn. This gene is cloned into a specific vector to generate plasmid pCIB4247. PCR amplification using two oligonucleotides [5'-TATCTCTCTCTATAAGGATCCATGGTCACC-3 '(SEQ ID NO: 45) and 5'-TACTGGATCCTCAGTACACAGTCCTGCC-3' (SEQ ID NO: 46)] specific for the beginning and end of the maize AHAS gene in pCIB4247. Cloned fragments are generated. Inserts are sequenced to confirm the absence of mutations and plasmids with the correct inserts are used to isolate BamHI fragments with AHAS sequences. This fragment is cloned into the BamHI position of pPEH3 to generate pCIB7612. This plasmid contains the mutated maize AHAS gene under the control of the maize ubiquitin promoter and the nos terminator. These genes confer resistance to imidazolinone (imazaquin / ceptor) when transformed into plants.

Protoporpyrinogen oxidase (cDNA) from Arabidopsis and maize is isolated from the protox gene promoter from Arabidopsis. Arabidopsis and protox cDNA from maize. Cloned by the complementarity of E. coli strains. Mutant Arabidopsis and maize protox genes are selected that increase resistance to protox inhibitory herbicides. The herbicide-resistant Arabidopsis protox cDNA is cloned into the plasmid between the dual 35S promoter and the tmI terminator.

Using the fragment from the 5 'end of the Arabidopsis protox cDNA as a probe, the Arabidopsis protox promoter is isolated from the genomic library. Digestion of the plasmid with such promoter with NcoI and BamHI leaves the promoter attached to the vector, but removes the underlying sequence. NcoI-BamHI fragments containing herbicide resistant protox cDNA and tmI terminator are cloned above. This produces a plasmid with about 600 nucleotides of the arabidopsis protox promoter, herbicide resistant Arab protox gene and tmI terminator. Plants transformed with such plasmids can be selected on media containing the herbicide.

b. Transformation of Lactoferricin B Gene Constructs into Corn

The method used for maize transformation, using particle bombardment to immature embryonic cells, is described in Koziel et al., Biotechnology 11, 194-200, 1993. About 10 days after pollination of immature embryos of maize-cross-bred CGA00526, aseptically isolated and transformed blastane on the side of modified Duncan's "D" medium (Duncan et al., Planta 165, 322-332, 1985) smear on scutellum). This medium is supplemented with chloramben (5 mg / L) instead of dicamba. After about two weeks, callus is isolated from the embryos and plated on medium supplemented with 2,4-dichlorophenoxy acetic acid (5 mg / L) instead of chlorambene and then subcultured every 10-14 days in succession. 4-6 hours before transformation, 1-4 months old callus is transferred to fresh medium containing 12% sucrose as osmoticum. Plasmid DNA or isolated fragment DNA is precipitated onto the gold particles as described in the DuPont Bioistic Sticky Manual. The DuPont Violinious Helium Device is fired twice on each tissue plate. A burst pressure of 600 to 1100 psi and a standard 80 to 100 μm mesh screen are used. After the impact, the tissue is placed in the dark for 12 to 24 hours. After this time, the tissue is transferred back to the modified Duncan's "D" medium with the selection agent BASTA added at least 20 mg / L and grown in the dark. This modified Duncan “D” medium is an amino acid replaced with an amino acid supplement of modified cores (KWKao and MRMichayluk, Planta 126, 105-110, 1975), except that glutamine and asparagine are completely omitted. Have supplements. The tissues are transferred to fresh medium containing BASTA at a minimum concentration of 20 mg / L at intervals of at least 14 days for 60 to 80 days. During this subculture, non-embryonic callus is removed.

After a screening period in this dark room, the tissues contain MS-based media containing the following hormones to induce germination and development of somatic embryos (Murashige and Skoog, Physiol. Plant 15, 473-439, 1962: ancimidol (0.25 mg / L), kinetin (0.5 mg / L), naphthalin acetic acid (1 mg / L) and BASTA (minimum 5 mg / L). Seedlings are generated by incubating the tissues in this medium for 16 hours in a light regimen for 10-14 days and then incubating in MS-based medium with BASTA (3 mg / L) lacking the plant hormones. As seedlings grow, transfer them to 3/4 concentration MS medium and allow roots to grow. The rooted plants are transferred to the soil and grown in greenhouses.

c. Transformation of Lactoferricin B Gene Constructs into Wheat

Transformation of immature embryos and immature embryo derived callus using particle bombardment has been described by Vasil et al., Biotechnology 11: 1553-1558, 1993 and Weeks et al., Plant Physiology 102: 1077-1084, 1993 ]. Approximately 2 weeks after pollination of immature embryos of spring or winter wheat, MS-based media supplemented with sterile induction and supplemented with 2,4-D (dichlorophenoxy acetic acid), glutamine and asparagine for induction of callus (Murashige and Skoog) , 1962 Physiol. Plant 15: 473-439] The blastocyst is incubated for 6-10 days at the top. 4-6 hours prior to transformation, embryos are selected for embryogenic reactions and transferred to fresh medium containing 15% maltose as osmoticum. Constructs used for transformation include plasmids (pUBA or pUBA / kan) containing ubi-bar-nos cassettes that allow selection of transformed tissue with BASTA. It is also possible to use constructs containing genes that confer resistance to other herbicides (eg sulfonylureas, amidazolinones) or antibiotics (eg hygromycin). This construct is co-transformed into one of the lactoferricin B containing gene constructs described in Examples 2-6, including pCIB7706, pCIB7710, pCIB7715, pCIB7723, pCIB7733 and pCIB7743. For this purpose, plasmid DNA is precipitated onto the gold particles as described in the DuPont Bioistic Manual. Launch a DuPont PDS1000 helium device using a burst pressure of 1100 psi and a standard 80 mesh screen on each embryo plate. After 24 hours, the embryos are removed from Osmotichum and placed back into the induction medium. After approximately one month, embryonic explants in which embryogenic callus are growing are transferred to regeneration medium containing 1 mg / L BASTA (MS + 1 mg / L naphthalin acetic acid and 5 mg / L gibberellic acid) for 2 weeks, and then sprouts Transfer to regeneration medium containing 3 mg / L BASTA for 2-6 weeks without hormones until grown. The sprouted embryos are transferred to half the concentration of MS with 0.5 mg / L NAA and 3 mg / L BASTA until the roots grow, and when the roots grow, the seedlings are transferred to the soil to mature. Plant tissue is harvested for analysis (described in Example 10) and the plants are self-pollinated for seed production.

d. Transformation of Lactobacillin B Gene Constructs into Beet

As described in Hall et al., Nature Biotechnology, vol. 14, pages 1133-1138, 1996, coarse cells are isolated from leafless beet leaf segments. These leaf sections are homogenized with a blender (23,000 rpm; 60 seconds) in 50 ml Ficoll medium (100 g / l picol, 735 mg / l calcium chloride.2H ₂ O and 1 g / l PVP40) while keeping on ice. After filtration through nylon mesh (300 micrometers), the homogenate is washed with 500 ml of cold water and transferred to 10 ml CPW9M containing 3.8% (w / v) calcium chloride.2H ₂ O. The epidermis is then recovered by centrifugation and digested with cell wall degrading enzymes (0.5% cellulase and 3% maserozyme, Yakult Honsha, Japan) for 16 hours to release individual cells. After filtration through a 55 micrometer filter, the suspension is mixed with an equivalent volume of picol containing 15% sucrose. In the tube, 1 ml CPW15S is layered on top of the protoplast suspension, followed by 0.5 ml 9% mannitol / 1 mM calcium chloride. After spinning for 10 minutes at 55 g, the covariate cells are recovered from the upper layer and re-separated again in the same manner. DNA (500 micrograms per million cells) is added to covariate cells resuspended in 0.75 ml 9% mannitol / 1 mM calcium chloride (mannitol solution) followed by 0.75 ml 40% PEG 6000. After 30 minutes at room temperature, 2 ml aliquots of F medium are added every 5 minutes for a total of 4 aliquots. Protoplasts are washed with the mannitol solution and then embedded in Ca alginate. They are incubated in modified K8P medium and one week afterwards selection starts with Bialaphos at 200 micrograms / liter. After 11 days, small alginate sections are embedded in agarose and incubated in PG1B medium with 250 microgram bialaphos / liter. The resulting callus is transferred to a fresh plate with nonalophos and incubated for 2 weeks. Thereafter, they are incubated using light / dark regimen (16 hours / 8 hours) without selection at 25 ° C. Subcultures are performed every two weeks and seedlings are regenerated within four weeks. Plant them by rooting them in the soil.

Example 9 Analysis of Transgenic Plants Expressing Lactoferricin B

For tissues from transformed plants that overcome the selection process (Example 8), the presence of lactoferricin B gene construct (PCR), RNA derived from such transgenes (Northern blot hybridization, RT) -PCR) and proteins derived from the transgene (Western).

a. PCR analysis

DNA is extracted from the transformed plant tissue using an IsoQuick nucleic acid extraction kit (ORCA Research Inc.) according to the instructions given in the kit. PCR analysis is performed according to standard protocols. Primers used for amplification of the lactoferricin B gene construct are designed from known sequences of the transgene construct.

b. Northern analysis

Transformed plants are analyzed for the presence of RNA by northern blot hybridization. For northern blot analysis, RNA is extracted from the leaf tissue. After grinding frozen tissue, extraction buffer (0.1 M LiCl, 100 mM Tris pH 8, 10 mM EDTA, 1% SDS) is added and equivalent volumes of water-saturated phenol and chloroform are added. RNA is precipitated from the aqueous phase with sodium acetate / ethanol and sorted by size on formaldehyde containing agarose gel. The gel is blotted onto GeneScreen Plus nylon and hybridized to a probe derived from the lactoferricin B gene. After hybridization overnight, the blot is washed with high rigor (65 ° C.) and exposed to X-ray film.

c. RT-PCR Analysis

RNA samples are analyzed by RT-PCR as described in Example 7 above to determine the presence of lactoferricin B RNA.

d. Western analysis

Transgenic plants are tested for the presence of lactoferricin B or lactoferricin B-derived protein encoded by the transgene. For Western analysis, fresh leaves are slightly frozen in liquid nitrogen and ground to a fine powder. The sample is then treated with cold 10% trichloroacetic acid in acetone at −20 ° C. for 1 hour, spun down, washed with cold acetone and then air dried. This dried sample is then incubated with 0.05 M sulfuric acid (3 ml / fresh weight g) on ice for 1 hour. The extract is neutralized with 0.01 N sodium hydroxide and then dried. Samples are performed on 10-20% Tricine SDS gel (Novex) according to the manufacturer's instructions. The protein is transferred to nitrocellulose under constant current of 200 mA for 3 hours in a wet cell and then stained with Ponceau Red to visualize the membrane-bound protein. Proteins transferred to nitrocellulose are probed with immuno-affinity purified goat anti-lactoferricin B antibodies, followed by secondary and alkaline phosphatase-conjugated tertiary antibodies. The anti-lactoferricin B reactive band is detected after addition of the nitro blue tetrazolium / bromo-chloro-indolyl phosphate substrate solution.

e. Mass spectrometry

Protein extracts prepared from transformed plants are analyzed for the presence of lactoferricin B peptides using MALDI-MS as described in Example 7 above.

f. Evaluation of Antimicrobial Activity in Lactoferricin B Transgenic Plant Extracts

Lactoferricin B transgenic plant by homogenizing tissue in 20 mM Tris buffer (pH 7.5) containing 1.5% PVPP, 5 mM DTT and 10 μM AEBSF (4- (2-aminoethyl) -benzenesulfonyl fluoride, hydrochloride) Protein extracts are prepared from. Protein extracts are further subtracted by established protocols such as ammonium sulfate precipitation, HPLC chromatography, and immunopurification using anti-lactoferricin B antiserum. Protein concentration in each extract is determined and aliquots are used for antifungal analysis.

Three assays described in Example 1 above were used to assess the presence of antimicrobial activity in incompletely and partially purified protein extracts. The organisms used to test for the presence of antimicrobial activity include those listed in Example 1 as well as other important fungal pathogens of corn and wheat and lactoferricin B sensitive bacterial laboratory strains such as E. coli. E. coli and Staphylococcus aureus are included. See, eg, W. Bellamy et al., J. Appl. Bacteriol. 73, 472-479, 1992].

Example 10 Test of Lactoferricin B Transgenic Plants for Increased Disease Tolerance

a. Transgenic Corn Plant Test

1. Southern Cone Leaf Mortar (SCLB) Analysis

SCLB is caused by Bipolaris mydis, previously called Cochliobolus heterostrophus and Helminthosporium maydis. ratio. Mydis cultures are grown on PDA (potato dextrose agar) with continuous irradiation of light near ultraviolet light to induce sporulation. Spores are collected by carefully scraping off the plate using a glass rod in 1% Tween-20. The solution is collected and the spore concentration is adjusted to 500-1000 spores / ml using double distilled sterile water. Transgenic plants and wild-type control plants are allowed to grow in the greenhouse until they are 3-5 years old. The spore suspension is sprayed onto the three leaves of the enlarged stomach by spraying a fine mist of spore suspension onto each leaf using an aerosol sprayer. The plant is then placed in a closed room and incubated overnight (16-20 hours) in a mist chamber in a humid environment. The plant is transferred from the mist room to the growth room. About one week after inoculation, the resulting lesions are counted and the size of 10-15 representative lesions is measured to compare the control plants with the transgenic plants. The disease progression of the plants is visually assessed at intervals of 3 to 4 days over 14 days after inoculation.

Plants from Tl week B10b expressing Met-lactoferricin B mRNA were found to have increased disease resistance because they showed less disease symptoms than the transgenic control and wild type controls.

2. anthracnose leaf granules

Collector Tricum Graminicola is the causative agent of anthrax leaf anemia. This necrosis the infected leaves. For disease testing, non. Spores are collected from spore forming agar plates as described for Mydis. Spore suspensions are sprayed at 3 to 5 perennial plant leaves at a concentration of approximately 10 ⁶ spores / ml. The inoculated plants were incubated overnight in the mist room and then rained. Transfer to the growth chamber as described for Mydis infected plants. Necrotic leaf area ratios are measured at 3-4 day intervals over 2 weeks to compare the transgenic and non-transgenic controls.

3. Carbonum Leaf Spot Test

Heliosporium carnum is the causative agent of maize carbonum leaf spots. For disease testing, non. Spores are collected from the sporulation culture as described for Mydis. Spore suspensions are sprayed at a concentration of 2.5 to 10 × 10 ⁴ spores / ml on the leaves of 3-5 main corn plants and then the plants are incubated overnight in the mist room. These plants are then grown in the growth room for about 14 days. Disease progression is involved, as described for anthrax leaf granules.

Plants from Tl week B10b that expressed RNA for Met-lactoferricin B were found to have increased disease resistance. In expressing plants, after carbonum leaf spot inoculation, reduced disease signs were shown as compared to the transgenic and wild type controls.

4. Fusarium Root Black

Fusarium Moniliformega Induces Fusarium fungus against cone fruit. F. Moniliforme was grown on PDA plates and b. Spores are harvested from the plate as described for MIDIS. Fold the perforated filter paper into the pouch and place the surface-sterilized cone seeds in the fold so that they grow from the drilled hole to the bottom of the pouch. F. A 12 ml of monoliforme spore suspension is placed at the bottom of the pouch and incubated in the growth chamber at 25-30 ° C. After 7 to 14 days, root growth inhibition and root necrosis due to fungal infections are assayed and the transgenic and non-transgenic controls compared.

5. titanium root black

Pythium aphinadermatum is one of the causative organisms associated with corn stem rot and root rot. For the disease test, f. Pouch formats made from dwellers or mycelium are used as described for Innocoolum. For ciliary formation, mycelia is contacted with leaf fragments of tall fescue grass, incubated under constant fluorescent light, and the resulting ciliary is harvested. In addition, potato dextrose medium is inoculated with myselium plugs from the lithium PDA plate and grown for 2-3 weeks. This mycelium is removed from the culture and dispersed using a blender in sterile double distilled water.

The cone seed is placed in the fold of the filter paper as described and an inoculum (appropriate concentration of dwellers or dispersed mycelium) is added to the pouch bottom. F. As described for the monoliforme, after incubation for 1-2 weeks, root length and necrosis are assayed and the transgenic and non-transgenic controls compared.

6. Stewart's bacterial wilt

Erwinia stewarti causes stewart hypertosis on corn plants. For disease assays, bacteria are grown at high density in nutrient medium and diluted to about 10 ⁷ bacteria / ml. The leaves are infected with the bacteria by stabbing the cone plant leaves with a needle immersed in a bacterial suspension. Lesions are measured 1, 2 and 3 weeks after inoculation.

7. Blade disk black

The complete-plant disease assay described above may be performed on leaf discs placed in wet Petri dishes.

b. Transgenic Wheat Plant Test

1. Pseudomonas Disease Assay

Pseudomonas Syringe pv. Half of the dogs cause bacterial leaf blight in wheat. For disease assays scoring scoring disease signs, the bacteria (strain BL882) are grown overnight on L-broth agar plates. One tooth line is scraped from the plate using a toothpick and resuspended in a solution of 10 mM MgCl ₂ . To determine the concentration of bacteria in the suspension, the absorbance of the suspension at 600 nm is taken and calculated as 1 × 10 ⁸ cfu per OD 600 of 0.1. Dilute the culture to 1 × 10 ⁷ bacteria / ml and withdraw a small amount by aspiration in a 1 ml plastic Pasteur pipette. Approximately 50 [mu] l of bacteria are injected into the leaves of three-weekly wheat plants. The size of the inoculated area is marked with a black felt pen. The plants are placed in a plastic box that moistens the internal environment by spraying a lot of water on the plants using a conventional garden sprayer. The box is tightly sealed and placed in a Percival chamber at 18-20 ° C. with daily light for 16 hours. After 5 days, the severity of the disease is recorded by estimating the percentage of lesioned area, as evidenced by the dark necrotic patch enclosed by a thin layered lobe, occurring in the inoculated area.

To more accurately quantify disease incidence, BL882 containing plasmids with kanamycin resistance gene is inoculated evenly to leaves by infiltrating bacteria at a concentration of 1 × 10 ⁷ cfu / ml. On the day of infiltration and on the next day, the bacterial titer in the injected area is measured. This combined the leaf punches from the infiltrated area collectively covering the 1 cm space, polished them at 10 mM MgCl ₂ and supplemented with 50 micrograms / ml kanamycin (the BL882 isolate was transformed with a kanamycin resistance gene). By diluting the dilution of the extract onto an LB plate. Three days after growth, single bacteria from the leaves grow into colonies that are easily counted. In this way, the growth rate of bacteria in the transformed plants is quantified and compared to that of the control, i.e., plants not transformed.

2. Septoria Nodorum Black

s. Nordorum causes leaf spots on wheat leaves and gum blotch on wheat berries. For disease assay, spores are collected from a sporulation plate or liquid culture and sprayed onto the leaves of the perennial plant at appropriate concentrations. The plants so inoculated are placed in a humid room for 2 to 3 days and then transferred to a growing room. In the next three weeks, the area percentage of the diseased leaves is measured and the presence or absence of pycnidium is recognized.

3. Septoria Tritici Test

s. Tritices cause leaf spot disease against wheat. For disease assay, spores are isolated from spore forming plates or liquid cultures and sprayed on leaves of 1-2 weekly wheat plants at appropriate concentrations. The inoculated plants are placed in a humid room for 3 days and then transferred to a growing room. Two to three weeks after inoculation, the percent area of diseased leaves is measured and the presence or absence of distributed magnetism is determined.

4. Blade disk black

The complete-plant disease assay described above may be performed on leaf discs placed in wet Petri dishes.

5. Fusarium Pouch Black

This assay was performed on F. coli for the corn described above. Monoliforme and p. Similar to the Apinadermata test. F. Rain spores from Kulmorum. Collected from the plate as described for mydis. Fold the perforated filter paper into the pouch and place the surface sterilized wheat seeds in the fold so that they grow from the rooted hole to the bottom of the pouch. F in Hewitt's medium (nutritional medium that allows wheat seeds to germinate and grow). A 12 ml spore suspension of Kulmorum is placed at the bottom of the pouch and incubated for 1 week in a growth chamber at 10-15 ° C., followed by continued at 15-18 ° C. Record root length and root browning after about 4 days.

6. Powdery mildew germ leaf black

Epicipa graminis f.sp. Tritice causes powdery mildew germ against wheat leaves. Since it is an obligate biotroph, the inoculum is kept on wheat leaves. Disease test plants are grown between 12 and 14 weeks old and 2.5 cm sections are cut from these leaves and placed on agar plates containing 50 mg / ml benzimidazole. Spores collected from infected leaves are used to inoculate them in leaf manipulation on agar plates at appropriate concentrations. The plate is then incubated at 17 ° C. with light irradiation. Approximately 10 days after the inoculation, the signs of disease on leaf fragments are evaluated.

Example 11: Human Lactoferricin (lacto H)

Antibacterial and antifungal peptides, referred to as lactoferricin H, were isolated from human lactoferrin. Such peptides correspond to amino acids 1 to 33 of the mature protein. A synthetic gene with a codon optimized for expression in corn (SEQ ID NO: 5), encoding the lactoferricin H peptide (SEQ ID NO: 2) is generated:

G R R R R S V Q W C A

GGC-CGC-CGC-CGC-CGC-AGC-GTG-CAG-TGG-TGC-GCC-

V S Q P E A T K C F Q

GTG-AGC-CAG-CCC-GAG-GCC-ACC-AAG-TGC-TTC-CAG-

W Q R N M R K V R G P

TGG-CAG-CGC-AAC-ATG-CGC-AAG-GTG-CGC-GGC-CCC

To transcription and translation of the gene sequence, methionine start codon and stop codon are added. In addition, ACC sequences from the Kozak consensus sequence are added at the beginning of the sequence to enhance the efficiency of translation. This produces the Met-lactoferricin H gene sequence as shown below, underlined by the start and stop codons:

5'-ACCATGGGCCGCCGCCGCCGCAGCGTGCAGTGGTGCGCCGTGAGCCAGCCCGAGGCCACCAAGTGCTTCCAGTG

GCAGCGCAACATGCGCAAGGTGCGCGGCCCCTAG-3 '(SEQ ID NO: 6)

Such gene sequences are expressed in plant cells under the control of appropriate promoters using methods similar to those described in the previous examples for lactoferricin B.

Claims (16)

In the working sequence, (a) a promoter that acts on plant cells to produce RNA sequences; (b) a structural coding sequence encoding the production of lactoferricin; And (c) a recombinant DNA molecule comprising a 3 'non-translated region that acts in a plant cell to add a polyadenylate nucleotide to the 3' end of the RNA sequence. The DNA molecule of claim 1, wherein the promoter is a ubiquitin promoter and the 3 ′ non-detox region is a nopaline synthase transcriptional terminator from Agrobacterium tumifaciens. 3. The DNA molecule of claim 1, wherein the lactoferricin is lactoferricin B. 4. (a) inserting the recombinant DNA molecule according to claim 1 into the genome of a plant cell; (b) obtaining transformed plant cells; (c) producing transgenic, disease resistant plants from such transformed plant cells, including regenerating a transgenic plant expressing an amount of lactoferricin effective to reduce damage from disease. How to. The method of claim 4, wherein the plant is selected from corn, wheat and beet. The method of claim 4 or 5, wherein the lactoferricin is lactoferricin B. 7. A plant comprising a cell expressing lactoferricin. 8. The plant of claim 7, having the recombinant DNA according to claim 1 stably integrated into the genome. The plant of claim 7 or 8, wherein the plant is selected from corn, wheat and beet. A seed which, when germinated and cultured, produces a plant according to any one of claims 7 to 9. The seed of claim 10 packaged or coated. The plant or seed according to any one of claims 7 to 11, wherein the lactoferricin is lactoferricin B. Use of lactoferricin in controlling plant pathogens. A method for controlling plant pathogens, comprising exposing the plant pathogens to plants according to claim 7. A cropping method comprising controlling plant pathogens using the transgenic plant of claim 7 or a progeny thereof. A commercial bag containing the seed according to claim 10.