CA2090552A1 - Insecticidal proteins and method for plant protection - Google Patents

Abstract

The present invention provides a composition and method of using plant non-specific lipid acyl hydrolases to protect plants otherwise susceptible to insect infestation by corn rootworms.

Description

289~2 ~:~
-1- '`~. ' . ' .;

.. . ~ .
.

INSECTICIDAL PROTEINS AND METHOD FOR PLANT PROTECTION
The present invention relates to the fields of genetic engineering and plant husbandry. More :. : .
specifically, the invention provides methods and compounds for controlling or combating insects in agriculture or horticulture.
~ - -Many vegetable and field crops are attacked by insect pests. For example, economically important phytophagous insects include corn rootworms e.g., Diabrotica spp., especially D. barberi (northern corn 10 rootworm), D. undecimpunc~ata (cucumber beetles~ and D. ~;
virgifera (western corn rootworm)).
Control of such insects has traditionally been partially addressed by cultural and breeding methods. -Most plants show some resistance to certain insects; the resistance can be physical or chemical. For example, the hairs on the leave~ of many plants can stop small insect~ from getting near enough to the surface to chew it. In other cases plants use a range of complex secondary chemicals to make their tissues unattractive or toxio. An effective way to reduce these losses is to use crop cultivars having gene~ for pest resistance (see Painter (19511, Insect Re~istance in Crop Plants, ~5 Macmillan: New York). Plant breeders have attempted to 38,424-F -1- ~ -r~ 2090a52 ~ -2-::
reduce losse~ caused by insect attack by incorporating insect resistance genes into their varieties via ¢onventional breeding program~.
ClasYical approaches to host plant reqistance, though remarkably successful in some instances, are rather empirical. Once "traits" for resistance are discovered 7 they are moved into agronomically acceptable lines by selection procedures. One limitation oY the classical approach is that the movement of genes for resistance from one plant to another is restricted to species that can be interbred. Additionally, these types of resistance are likely to be under the control of many genes, and so are difficult for the plant breeder to fully sxploit. Often resistant varieties have shown a yield depression and so have not been economicàlly viable. MoreoYer, if no resistance can be identified within a species or within related specie~, then no improvement in insect pest resistance is possible by classical breeding.
i Chemical insecticides have been heavily relied upon to control insects. These agents typically are applied on or banded into the soil, or to the plant foliage or in bait stations. In spite of the availability of a wide range of chemical pesticides, phytophagous insects remain a serious problem. Many chemical pesticides have the disadvantage of requiring -~
repeated applications. A major problem in the use of 3 many pesticides is the ability of insects to become resistant to the applied agent~O This phenomenon occurs ~ ~
through selectio~ of the most reqistant members of the - -insect population during repeated application of the agent. A need, therefore, exists for new insect control 38,424-F -2 `~
: .

_3_ 209~52 -: ~

agents, partlcularly agents that have a mode of action different from conventional insecticides.
A~ alternatives to synthetic compounds9 certain naturally-occurring agents have been i~olated and developed as pesticides. These include plant and mierobial secondary metabolites and proteins, and natural predators or pathogens of in3ects (including other insects, fungi, bacteria and viruses).
Furthermore, as recombinant DNA technology has advanced, genes from a donor organism may be transferred to a recipient organism resulting in a new phenotyp~ in the recipient. In the case of transgenic plants, this phenotype may be resistant to insect damage if the introduced gene encodes a polypeptide, the action of which result~ in a deleterious effect on the pest.
Consequently, there is a great interest and utility in finding polypeptides that have such an e~feet. Genes for the3e polypeptides can be used to modify organisms, especially plants and insect pathogens, so that they adversely affect the growth and development of insect pests. A very limited number of such polypeptides have been described, e.g., polypeptides from Bacillus thuringiensis, various proteinaceous protease and amylase inhibitors, variou~ plant lectins, ete. However, to date no publieation has suggested the use of plant non-specific lipid acyl hydrolase~ for use in insect control.
3 Plant non-speci~ic lipid acyl hydrolases have been identified from a variety of plant sourceq ineluding potato tubers, flowers and leaves, bean leave3 -and riee bran. The aetivity of plant non-speeific lipid ~-~
acyl hydrolases is extremely high in many tissue~.
Although their action in causing rancidity in stored -- 209~2 agricultural products and in damaged or infected tissues has been quite well documented, their ~n ~ivo physiological role is still unclear.
Speculation on the role of lipid acyl hydrolases has mainly been centered on their involvement in the turnover of membrane lipids. Alteration~ of membrane lipids occur in development and differentiation, such as during seed maturation and germination and fruit ripening. In addition~ the free fatty acids released from the enzymatic reaction may undergo oxidation catalyzed by several known oxidases to produce nonvolatile and volatile metabolites that may be of hormonal nature. In injured potato tuber cells, the hydrolytic and acyl-transferring activities of lipid acyl hydrolase, together with lipoxygenase, may release cytotoxic, oxidized fatty acid derivativeq and water-insoluble waxes that inhibit microbial invasion.

An object of the present invention i~ to provide a method for protecting a plant or a part thereof from insect pests.
A further object of the present invention is to provide novel compositions which are capable of protecting from attack a plant or a part thereof otherwise susceptible to insect infestation by corn rootworms.
A further object of the present invention is to provide a process for preparing genetically transformed host cells comprising the transformation of host cells with a gene encoding a protein capable of having a deleterious effect, upon ingestion, by corn rootworms.
,~ , "

38,424-F -4_ - ~ ~

2~0~5 2 Other object~ and advantages of the present invention will become apparent from the description of the invention provided hereunder.
Accordingly, in one aspect, the invention relates to a method of controlling corn rootworms. It is especially concerned with providing a plant non-specific lipid acyl hydrolase in, on or near a plant tissue otherwise susceptible to attack by one or more of such insects, whereby the plant tissue has improved resistance to such insects.
In a second aspect9 the invention relates to ~ -transformed cells which possess genes encoding a plant non-specific lipid acyl hydrolase capable of protecting from attack a plant tissue otherwise susceptible to insect infestation by corn rootworms.
In a third aspect, the present invention relates to a method oP preparing an insecticidal composition of at least one plant non-specific lipid acyl hydrolase, wherein the composition is capable of improving the resistance of plants or parts thereof susceptible to insect infestation by corn rootworms.
In other aspects, the invention i~ directed to expression vehicles capable oP effecting the production -of such aforementioned proteins in suitable host cells.
It also include~ the host cells and cell cultures which ~-

3~ result from transPormation with these expression vehicles.
A number of aspects of the present invention ~ -~
are further illustrated in the accompanying drawings, in which~

. , .:
38,424-F -5- ~

-~- 2090~S2 Figure 1 ~qhows the nucleotide sequence of a patatin cDNA in ert in pDAB1008. The end of the sequence coding for a fir~qt patatin isoform i3 underlined.
Figure 2 shows the nucleotide sequence of a patatin cDNA insert in pDAB1011. The end of the sequence coding for a ~econd patatin isoform is underlined.
Figure 3 shows the deduced amino acid sequences of two patatin cDNAs in pDAB1008 and pDAB1011. Amino acids are numbered from the initiator methionine of full-length prepatatin. Vertical bars indicate identity of sequence, and dashes indicate the absence of amino acids. The expected amino-termini of the mature patatins are underlined.
Figure 4 show~ a flow diagram of the construction of pDAB219 Figure 5 show~ a partial plasmid map of pDAB303.
Figure 6 showq a nucleotide sequence of a 2~ promoter comprising the doubly-enhanced CaM~ 35S
promoter, and a deleted ADH1 sequence inserted into an ;
MSV leader sequence.
Figure 7 shows a partial plasmid map of pDAB219~.
The entire teachings of all reference~ cited i herein are her~by incorporated by reference. ``

-- ~09~2 It has now been surpriqingly found that plant non-specific lipid acyl hydrolases can control insect growth (inoluding larvae) o~ corn rootworms~
An "insect controlling amount" i~ an amount o~
a plant non-speci~ic lipid acyl hydrolaqe qu~ficient to deleteriously di~rupt the normal li~e processe of an insect [i.e., amount~ which are lethal (toxic) or sublethal (injuring, growth or development inhibiting or repelling)].
A~ used herein the term "plant non-specific lipid acyl hydrolase~' includes a protein that hydrolyzes acyl groups from at least one of several classes of lipids, including glycolipid~, phospholipids, sulfolipids, and mono- and diacylglycerol~, but is inactive on triacylglycerolq. The acyl hydrolase releases both fatty acids from diacyl glycerolipids, and in many cases, there is no preference for either the l-or 2-position of the acyl ester linkage. Thus, the - enzyme possesses a combined catalytic capacity of phospholipase Al, A2 and B, as well as glycolipase, sulfolipases and monoacylglycerol lipase. Similarities of the plant non-specific lipid acyl hydrolase enzymes from various tissues include the following: (l) they exert a similar pattern of substrate specificity as described above; (2) they may occur as isozymes in each ~ -tissue and they have fairly similar patterns of substrate specificity; t3) the activity ratio of the 3 enzyme preparation on galactolipid and phospholipid remains fairly constant throughout an enzyme purification procedure; and (4) the enzyme carries out acyltransferase reactions with each of the substrates (Galliard, T. (1980), In: "The Biochemistry of Plants"

38,424-F -7-i 2~90~2 (P. K. Stump~ and E. ~. Conn eds.3, Vol. 4, pp 85-116, Academic Press, ~ew York).
The most studied plant non-speciPic lipid acyl hydrolase is patatin, the moqt abundant protein in the storage parenchyma cells of potato tubers (Solanum tuberosumL.) (see Racusen and Foote (1980), Journal of Food Biochemistry, 4:43-52). Patatin is a mixture of at least 6 to 10 closely-related polypeptides, or isoforms, which differ in their primary sequence, patterns of glycosylation, and hydrolytic activities (Hofgen and Willmitzer ~1990), Plant 5cience, 66:221-230). They are encoded by a family of about 15 genes per haploid genome (Twell & Ooms (1988), Mol. Gen. Genet., 21~:325-336). ~ -~
The genes encoding several patatin isoforms have been ~- -sequenced and published (see Mignery etal. ((1984), `
Nucleic Acids Research, 12:7987-8000). Further, the ~-~equences of genes encoding additional patatin isoforms are set forth in Figures 1 and 2.
' - '`~
Patatin is synthesized as an approximately -~
43,000 kilodalton ~43 kDa) preprotein with a 23 amino-acid amino-terminal signal peptide. After passage ~ -through the endoplasmic reticulum and Golgi complex -(where the polypeptide i glycosylated) the protein is targeted to the vacuole where it accumulates as a mature ~-protein of about 40 kDa during tuber development.
However, the patatin-like polypeptide found in flowers appears to be approximately 3 kD larger than the mature 3 patatin obtained from tubers (Vancanneyt9 etal. (1989), Plant Cell, 1:533-540).
The present invention specifically contemplates ` the use of any of the patatin isoforms. There are slight differences in the various isozymes; however, the 38,424-F -8--' 2~90~2 g homology between the isoforms of patatin has been demonstrated by amino-terminal amino acid sequence analysis and comparison of characterized ~enomic and cDNA sequences. In fact, it is generally known that variations may exist in the amino acid sequence of a protein without any significant effect on its functional characteristics.
Plant non-specific lipid acyl hydrolases are present in other plant tissues as well. Those skilled in the art recognize that such other plant non-specific lipid acyl hydrolases exhibiting insect control of corn rootworms are included within the scope of present invention.
Leaf enzymes from Phaseolusmutli~ora (see Burns et al. ( 1977), Biochem Soc. Trans, 5:1302-1304), P. vulgaris (see Matsuda and Hirayama (1979), Biochim. Biophys.
Acta, 573:155-165) and potato (see Matsuda etal. ( 1980), A~ric. Biol. Chem., 43:563-570) exhibit a pattern of substrate specificity similar to patatin. Furthermore, patatin and the leaf enzymes generally have an optimal ~ ;
activity at acidic pH.

The enzyme from rice bran can release fatty acids from different lysopho~pholipids, with the highest activity on lysophosphatidylcholine containing palmitic acid (see Matsuda and Hirayama (1979), Agric. Biol.
Chem., 43:463-469).
3o SeveraI forms of a lysophospholipase have been purified from barley endosperm in postgermination. The enzyme is a polypeptide with a molecular mass of 36 kDa and an extra mass of 10 to 12 percent (see Fujikura and Baisted (1985), Arch. Biochem. Bioph~s., 234:570-578).

38,424-F -9_ . ~....... .. ~ . . . ~ . .

20~a~

Hydrolase activity that releases fatty acids from phosphatidylcholine and lysophosphatidylcholine i~
present in barley grains (see von Rebmann and Acker (1973), Fette. Seifen An~trichm., 75:409-411). A plant non-specific lipid acyl hydrolase that releases fatty ~-acid from sulfolipid~ ha~ been detected in alfalfa leaves and roots, and in maize roots (see Yagi and Benson (1962), Biochim. Biophys. Acta, 57:601-603). ~ ;
A patatin-like protein has been described from sweet pepper (Vancanneyt (1989), supra) . Additionally, activities have been noted in eggplant leaf and fruit7 pumpkin, pepper 9 radish, barley, carrot, tomato, -soybean, tobacco9 beet, pea and spinach (Moreaun (1987), Phytochem. 9 26:1899-1902).
Using a biochemical assay that monitors the esterolytic or lipolytic activity of a plant non-specific lipid acyl hydrolase, a skilled arti3an may routinely survey plants for proteins with plant non-specific lipid acyl hydrolase activity. Generally, protea~e activity may be measured essentially using any one of a variety of known assay procedures ~see Wolfson and Murdock (1987), supra), and Andrews etal. (1988), ~ ; -~Biochem. J., 252:l99-206). To validate that the presence of the plant non-specific lipid acyl hydrolase in the diet of the target insect would indeed suppress the growth of it~ populations, a second screen may be applied in which the purified or partially purified 3 plant non-specific lipid acyl hydrolase i~ added on or~
into the laboratory diet, or applied to the plant surface.
Once appropriate activity i~ determined, the amino acid sequence of the plant non-qpecific lipid acyl 38, 424-F -10~

-1, 2~9~

hydrolase, or at least a portion thereof, may be determined by N-terminal sequencing or sequencing of oligopeptides derived by proteolysis. In addition, antisera can be prepared that specifically recognizes the plant non-specific lipid acyl hydrolase.
It should be understood that, given the present teachings, one may synthesize or isolate substantially ~ -pure functional derivatives of the naturally-occurring plant non-specific lipid acyl hydrolases. A "~unctional derivative" of the plant non-specific lipid acyl hydrolase is a compound which possesses a biologioal activity that is substantially similar to a biological activity of the plant non-specific lipid acyl hydrolase.
The term functional derivative is intended to include "fragments", "effectively homologous variants", or "analogues".
A "fragment" is meant to refer to any hydrolytically-active polypeptide subset of a plant non-specific lipid acyl hydrolase molecule.
An "effectively homologous variant" of a molecule such as the plant non-specific lipid acyl hydrolase is meant to refer to a molecule substantially similar in sequence and function to either the entire molecule or to a fragment thereof. For purposes of this invention, one amino acid sequence is effectively homologous to a second amino acid sequence if at least 70 percent, preferably at least 80 percent, and most preferably at lea~t 90 percent of the active portions of the amino acid sequence are identical or equivalent.
General categories of potentially-equivalent amino acids are set forth below, wherein, amino acids within a group may be substituted for other amino acids in that group:

38,424-F

,r~
2 ~ 2 -12~

(1) glutamic acid and aspartic acid; (2) ly~ine, arginine and hi~tidine; (3) alanine, valine, leucine and isoleucine; (4) asparagine and glutamine; (5~ threonine and serine; (6~ phenylalanine, tyrosine and tryptophan;
and (7) glycine and alanine. More importantly and -~
critical to the definition, the function o~ a ~econd amino acid sequence i3 effectively homologous to another amino acid sequence if the second amino acid ~equence conforms to a tertiary structure having the capacity to hydrolyze acyl groups from a lipid substrate.
An "analog" of a molecule such as the plant non-specific lipid acyl hydrolase is meant to refer to a molecule substantially similar in function to either the entire molecule or a fragment thareofO Thus, provided that two molecules possess a similar activity, they are considered analogs as that term is used herein even if the structure of one of the molecules is not found in the other, or if the iequence of amino acid residues is not identical.
As used herein, the term "substantially pure"
is meant to describe the plant non-specific lipid acyl hydrolase which i~ homogeneous by one or more purity or 25 homogeneity characteristics. For example, a ;
substantially pure plant non-specific lipid acyl hydrolase will show constant and reproducible characteristics within standard experimental deviations for parameters such ai molecular weight, chromatographic 3 behavior and the like. The term, however, is not meant - ~-to exclude artificial or synthetic mixtures of the plant non-specific lipid acyl hydrolase with other compounds.
The term iCi also not meant to exclude the presence of minor impurities which do not interfere with the ~ -biological activity of the plant non-specific lipid acyl 38,424-F -12-,:

~9~5~2 : ~

~ , ~
hydrolase and which may be present, for example, due to incomplete purification.
A substantially pure plant non-specific lipid acyl hydrolase may be purified directly from plants in which they are naturally occurring by any appropriate protein purification technique. Exemplary techniques include chromatographic techniques, such as gel filtration liquid chromatography, ion exchange chromatography, high performance liquid chromatography, reverse phase chromatography or by the use of immunological reagents employing plant non-specific lipid acyl hydrolase-specific antibodies.
It is possible to synthesi7e invitro a plant non-specific lipid acyl hydrolase from the constituent aminoacids (see Merrifield (1963), J. Amer. Chem. Soc., 85:2149-2154; and Solid Phase Peptide Synthesis (1969), (eds.) Stewart and Young). The peptides thus prepared may be isolated and purified by procedures well known in the art (see Current Protocol~ in Molecular Biolo~y (1989~, (eds.) Ausebel, etal., and Sambrook etal. (1989), Molecular Clonin~: A Laboratory Manual).

Although it is possible to determine and synthesize the entire amino acid sequence of the plant non-specific lipid acyl hydrolase, it is preferable to isolate the entire sequence of the plant non-specific lipid acyl hydrolase gene. DNA encoding a plant non-specific lipid acyl hydrolase may be prepared from chromosomal DNA, cDNA or DNA of synthetic origin by using well-known techniques.
Genomic DNA encoding plant non-specific lipid acyl hydrolase may be isolated by standard techniques 38,424-F -13-"~ 209~5~

(Sambrook etal. ( 1989), supra3. Specifically comprehended as part of this invention are genomic DNA sequences encoding allelic variant ~orms of the plant non-speci~ic lipid acyl hydrolase gene, as well as its 5' and 3' flanking regions. It is also possible to use primer~
and exponentially amplify DNA in uitro using sequence specified oligonucleotides by the polymerase chain reaction (PCR) (see Mullis etal. ( 1987), Meth. Enz., 155:335~350); Horton etal. (1989), Gene, 77:61; and PCR
Technology: Principles and Applications for DNA
Amplification, (ed.) Erlich (1989).
A DNA isolate encoding a plant non-specific lipid acyl hydrolase may also be obtained from a complementary DNA (cDNA) library. cDNA preparations are ligated into suitable recombinant vectors to form a gene library. Alternatively, thc cDNAs may be expressed in a vector such as Agt11 and the library screened using antibodies against the plant non-specific lipid acyl hydrolase.
A suitable oligonucleotide or set of -oligonucleotides may be used, by techniques well known in the art, to screen the genomic DNA or cDNA libraries. ~ -To facilitate the detection of the desired sequence, the oligonucleotide probe may be labeled with any material having a detectable physical or chemical property.
General procedures for isolating, purifying and sequencing the desired sequences are well known in the 3 art (see Current Protocols in Molecular Biolog~ (1989)~
supra; and Sambrook etal. ( 1989), supra). ~ ~:
An alternative method of obtaining a genetic sequence which is capable of encoding the plant non-specific lipid acyl hydrolase is to prepare it by 38,424-F -14-i 2 oligonucleotide synthecii~, after the gene ~equence o~
interest is determined (see Caruthers (1983), In:Methodolo~y of DNA and RNA, (ed.) Weissman; or Beaucage etal. ( 1981), (Tetrahedron Letter~, 22:1859-1962). A series of oligonucleotides may be synthesized in order to provide a serie~ of overlapping fragments which when annealed and ligated will produce both strands of the gene. Thes~ fragments are then annealed and ligated together using well-~known techniques (see Sambrook etal. ( 1982), supra) . Alternatively, the gene may be produced by synthesizing a primer having a so-called "wagging tail", that does not hybridize with the target DNA; thereafter, the genomic sequences are amplified and spliced together by overlap extension (see Horton etal. (1989), Gene, 77:61-68). The resulting DNA
fragment with the predicted size is isolated by electrophoresi3 and ligated into a suitable cloning vector for amplification and further manipulation (see Mullis etal. (1987), supra; and PCR Technology: Principles and A~lications for DNA Amplification, supra).
Of course, one may incorporate modifications into the isolated sequences including the ~ddition, ;
deletion, or nonconservative substitution of a limited number of various nucleotides or the conservative substitution of many nucleotides, proYided that the proper reading frame is maintained. Translational stop and start signals are added at the appropriate points, and sequences to create convenient cloning sites are ' added to the ends. Exemplary techniques for modifying oligonucleotide sequences include using polynucleotide-mediated, site-directed mutagenesis (see Zoller etal.
(1984), DNA, 3:479-488; Higuchi etal. (1988), Nucl. Acids Res., 16:7351-7367; Ho etal. ( 1989), Gene, 77 51-59; and 38~424-F -15_ .

-16- 2090~$2 Horton etal. (1989), Gene, 77:61; and PCR Technolo~y:
Principles and Applications for DNA Amplification, (ed.) Erlich (1989)).
In order to further characterize ~uch genetic sequences, it i3 desirable to introduce the ~equence into a suitable host to express the protein which these sequences encode, and confirm that they possess characteristics of plant non-specific lipid acyl hydrolases. Techniques for such manipulations are well known in the art and disclosed by Sambrook etal. ( 1989), supra. -Vectors are available or can be readily prepared for transformation of viruse~, prokaryotic or 15 eukaryotic cells. In general, plasmid or viral vectors -should contain all the DNA control sequences neces~ary -~
for both maintenance and expression of a heterologous DNA sequence in a given host. Such control sequences -20 generally include a promoter sequence having, a -transcriptional start, a leader sequence~ a DNA sequence coding for translation start-signal codon, a tran31ation terminator codon, and a DNA sequence coding for a 3' non-translated region containing signals controlling -~
termination of RNA synthesis and/or messenger RNA
; modification. Finally, the vectors qhould desirably ~
have a marker gene that is capable of providing a -~ -~;~ phenotypical property which allows for identification of host cells containing the vector, and an intron in the - -3 5' untranslated region, e.gr, i~tron 1 from the maize alcohol dehydrogenase gene that enhance~ the ~teady -~
state levels of mRNA. -Exemplary host cells include prokaryotic and eukaryotic strains. The appropriate procedure to 38,424-F -16~

2~5~2 -17~

transform a selected host cell may be chosen in accordance with the ho~t cell used. Based on the experience to date, there appears to be little difference in the expression o~ genes, once inserted into cell~, attributable to the method of transformation itsel~.
Conventional technologies for introducing biological material into host cells include ;~
electroporation [see Shigekawa and Dower (1988), Biotechniques, 6:742; Miller, etal. (1988), Proc. Natl~
Acad. Sci. USA, 85:856-860; and Powell, etal (1988), A~pl. Environ. Microbiol.~ 54:655-660]; direct DNA ~;
uptake mechanisms [see Mandel and Higa (1972), J. Mol.
Biol., 53:159-162; Dityatkin, etal. ( 1972), Biochimica et Biophysica Acta, 281:319-323; Wigler, etal. (1979), Cell, 16:77; and Uchimiya, etal. t 1982), In: Proc. 5th Intl.
Con~. Plant Tissue and Cell Culture, A. Fujiwara (edO), Jap. Assoc. for Plant Tissue Culture, Tokyo, pp. 507--508]; ~usion mechanisms [see Uchidaz, etal. ( 1980), In:
Introduction o~ Macromolecules Into Viable Mammallan Cells, C. Baserga, G. Crose, and G. RoYera (eds.) Wistar Symposium Series, Vol. 1, A. R. Liss Inc., NY, pp. 169-185]; infectious agents [see Fraley, etal. ( 1986), CRC Crit. ~ev. Plant Sci., 4:1-46; and Anderson (1984), Science, 226:401-409]; microinjection mechanisms [see Crossway, etal. (1986), Mol. Gen. Genet., 202:179-185];
and high velocity projectile mechanisms (see EP0 0 405 696).
The appropriate procedure to transform a selected host cell may be chosen in accordance with the host cell used. Based on the experience to date, there appears to be little difference in the expression of 38,424-F -17--18- 2 ~ ~ O ~ ~ 2 genes, once inserted into cell~, attributable to the method of tran~formation itself.
Transformants are isolated in accordance with conventional methods, usually employing a selection technique, which allow~ for selection of the desired organism as against unmodified organ;sms. Generally, after being tran~formed, the ho~t cells are grown for about 48 hours to allow for expression o~ marker genes.
The cells are then placed in selective and/or screenable 0 media, where untransformed cells are distinguished from transformed cells, either by death or a biochemical property. The selected cells can be screened ~or expression of the plant non-specific lipid acyl -15 hydrolase by as~ay techniques such as immunoblot -analysis, enzyme-linked immunosorbent assay radioimmunoassay, or fluorescence-activated cell sorter analysis, immunohistochemistry and the like. The transformed tissues are then tested for insect-controlling activity.
A host cell may be transformed to provide a source from which significant quantities of the vector containing the gene of interest can be isolated for subsequent introduct;on into the desired host cells or for which significant quantities of the protein may be expressed and isolated. Exemplary recombinant host cells include unicellular prokaryotic and eukaryotic strains. Prokaryotic microbes that may be used as hosts 3 include Escherichiacoli, and other Enterobacteriaceae, Bacil~i, and various Pseudomonas. Common eukaryotic microbes include Sacchromycescerevisiae and Pichia pastoris. Co~mon higher eukaryotic host cells include Sp2/0 or CH0 cells.
Another preferred host i insect cells, for example Drosophila larvae, in which the vector contains the 38,424-F -18-2090~52 ~ ~ , Drosoph~la alcohol dehydrogenase promoter.
Alternatively, baculovirus vector~q, e~g., Autograp~a californica nuclear polyhedrosis virus (see Miller etal.
(1983), Science, 219:715-721) may be engineered to express large amounts of the plant non-specific lipid acyl hydrolase in cultured insects cells (see Andrew~ et ~l. (1988), Biochem. J., 252:199--206).
The present invention provides an agricultural composition for application to plants or parts thereof which are qusceptible to infestation by corn rootworms, said agricultural composition comprising one or more plant non-specific lipid acyl hydrolase. Often the agricultural composition will contain an agriculturally acceptable carrier. By the term "agriculturally acceptable carrier" is meant a substance which may be used to dissolYe, disperse or diffuse an active compound in the compositiQn without impairing the effectiveness of the compound and which by itself has no detrimental effect on the qoil~ equipment, crops or agronomic environment.
The agricultural compositions may be applied in a wide variety of form~ including powders, crystals, suspensions, dusts, pellets, granules, encapsulations, microencapsulations9 aerosols, solutions, gels or other dispersions. In addition to appropriate liquid or solid carriers, compositions may include adjuvants, such as emulsifying and wetting agent~, spreading agents, dispersing agents, adhesives or agents which stimulate insect feeding according to conventional agricultural practices. Adjuvantq for the formulation of inseoticides are well known to those skilled in the art.

38,424-F -19-..

2 ~ 9 0 ~ ~ 2 The concentration of plant non-specific lipid acyl hydrolase will vary widely depending upon the nature of the particular formulation, particularly whether it is a concentrate or it is to be used directly. The plant non-specific lipid acyl hydrolase will be present in at least 1 percent by weight and may be up to lO0 percent by weight.
The presentation of the agricultural composition may be achieved by external application -either directly or in the vicinity of the plant~ or plant parts. The agricultural compositions may be - -applied to the environment of the insect pest(s), e.g., plants, soil or water, by spraying, dusting, ~prinkling, or the like.
The present invention further contemplates using recombinant hosts (e.g., microbial host~ and insect viruses) trans~ormed with a gene encoding the 20 plant non-specific lipid acyl hydrolase and applied on -or near a selected plant or plant part susceptible to attack by a target insect. The hosts may be capable of colonizing a plant tissue susceptible to insect infestation or of being applied as dead or non-viable cells containing the plant non-specific lipid acyl hydrolase. Microbial hosts o~ particular interest will be the prokaryotes and the lower eukaryotes, such as fungi.
Characteristics of microbial hosts for encapsulating a plant non-specific lipid acyl hydrolase include protective qualities for the protein, ~uch as thick cell walls, pigmentation, and intracellular packaging or formation of inclusion bodies; leaf affinity; lack of mammalian toxicity; attractiveness to -~

38,424-F -20-2 ~

pests for ingestion; ease of killing and ~ixing without damage to the plant non-speciPic lipid acyl hydrolase;
and the ability to be treated to prolong the activity of the plant non-specific lipid acyl hydrolase.
Characteristics of microbial ho~ts for colonizing a plant include non-phytotoxicity~ ease of introducing a geneti~ sequence encoding a plant non-speci~ic lipid acyl hydrolase, availability o~ expression qystems 9 efficiency of expression and stability of the insecticide in the host.
Illustrative prokaryotes, both Gram-negative and -positive, include Enterobacteriaceae, such as Escherichia; Bacillaceae; Rhizoboceae, such as Rhizobiumand Rhizobacter; Spirillaceae (such a~ photobacterium), Zymomonas, Serratia, Aeromonas, Vibrio, Desulfovibrio, Spirillum; Lactobacillaceae; Pseudomonadaceae ( such as Pseudomonas and Acetobacter); Azotobacteraceae and ~: Nitro~acteroceae. Among eukaryotes are fungi (such as 20 Phycomycetes and Ascomycetes), which includes yeast (such as Saccharomyces and Schizosaccharomyces ), and Basidiomycetes yeast (such a~ Rhodotorula, Aureobasidium, Sporo~olomyces) and the like.
The present invention also contemplates the use of a baculovirus containing a gene encoding a plant non-specific lipid acyl hydrolase. Baculoviruses including those that in~ect Heliothisvirescens (cotton bollworm), Orgylapseudotsugata (Dougla~ fir tussock moth), Lymantria 30 dispar (gypsy moth), Autographicaculi~ornica (alfalPa looper), Neodiprionsertifer (European pine Ply) and Laspeyresia :
pomonella (codling moth) have been registered and used a3 pesticides (see US 4,745,051 and EP 175 852).
.

38, 424-F -21-.. ~:

~ .

~ 2090~5 2 ::

The recombinant host may be formulated in a variety of ways. It may be employed in wettable powders, granules or dusts, or by mixing with variou9 inert materials, ~uch as inorganic minerals (phyllosilioate~, carbonates, sulfates, phosphates, and the like) or botanical materials (powdered corncobs, rice hulls, walnut shells, and the like). The formulations may include spreader-sticker adjuvantq, stabilizing agent~, other insecticidal additives surfactants, and bacterial nutrients or other agents to enhance growth or stabilize bacterial cellq. Liquid formulations may be aqueous-based or non-aqueous and employed as foams, gelq, suspensions, emulsifiable concentrates, or the like. The ingredients may include rheological agents, surfactants, emulsifiers, dispersants, or polymers. In general, inoculants can be applied at any time during plant growth. Inoculation of large fields can be accomplished most effectively by spraying. -~
'~
Alternatively, the plant non-specific lipid acyl hydrolase can be incorporated into the tissues of a susceptible plant so that in the course of infesting the plant the insect consumes insect-controlling amounts of the selected plant non-specific lipid acyl hydrolase.
One method of doing this is to incorporate the plant non-specific lipid acyl hydrolase in a non-phytotoxic vehicle which is adapted for systemic administration to the susceptible plants. However, since the genes which code for plant non-specific lipid acyl hydrolase may be isolated, the invention contemplates, in a preferred embodiment, transgenic plants which are capable o~
biologically synthesizing plant non-specific lipid acyl hydrolase to provide the plants with a new, or an 38,424-F -22 , ... . . . . . . . . . .. .. .. . ~ . ~ . .

~ 2 0 ~ 2 additional mechanism of protection against attack by insects.
The invention provides method~ of imparting resistance to insect infestation by corn rootworms to plants of a susceptible taxon, compri~ing: ta) culturing cells or tissues from at least one plant from the taxon;
(b) introducing into the cellY of the cell or tissue culture a structural gene encoding a plant non-specific lipid acyl hydrolase, operably linked to plant 0 regulatory sequences which cause expression of the plant non-specific lipid acyl hydrolase gene in the cells, and (c~ regenerating insect-resistant whole plants from the cell or tissues culture.
Obviously9 the expression of uniquely high quantities of plant non-speci~ic lipid acyl hydrolase~
may be deleterious to the plant itself. The use of a signal sequence to secrete or sequester in a selected organelle allows the protein to be in a metabolically inert location until released in the gut environment of an insect pathogen. Moreover, some protein are accumulated to higher levels in transgenic plants when ~;
they are secreted from the cells, rather than ~tored in the cytosol (Hiatt, etal. ( 1989), Nature, 342:76-78).
The DNA sequence will generally be one which -~
originates from~ or has substantial sequence homology to a plant non-specific lipid acyl hydrolase, originating from a plant of a species different from that of the target organism. However, when the DNA sequence is one I ~`
which originates from, or has substantial sequence homology to a plant non-specific lipid acyl hydrolàse originating from, a plant of the same species a~ that of -.~
l ~-.. ;.~`
!1 38, 4 24 -F -23- .~
, ~

-- 209Q~2 ~24-the target plant, such sequence may be expreqsed in significantly greater amount~O
In order to optimize the transcriptional and translational efficiency of such systems, it i3 poYsible to examine the frequency o~ codon usage and determine which codons are, in essence, preferred within the transcriptional and translational ~ystems normally present in that plant. Using such preferred usage codons, it is possible to construct a protein coding sequence which may result in a significantly enhanced level of transcriptional and translational efficiency of the plant non-specific lipid acyl hydrolase gene compared to what would be achieved by taking the coding sequence directly in an unmodified form from the donor plant.
The promoter selected should be capable of causing sufficient expression to result in the production of an insect controlling amount of protein.
Suitable promoters may include both those which are derived from a gene which is naturally expressed in plants and synthetic promoter sequences which may include redundant or heterologous enhancer sequences.
In cases where the sequence is derived from a plant source, one can use the 5' and 3' non-translated region naturally associated with the particular gene. A number of promoters which are active in plant cells include the nopaline synthase, octopine synthase and mannopine 3 synthase promoters from the tumor-inducing plasmids of Agrobacterium tumefaciens.
In species which produce a plant non-specific lipid acyl hydrolase but in lower than insecticidal amounts, it may be preferable to overexpress the plant ;~

38,424~F -24-.. . . ..

2 ~ 2 -~5- -non-specific lipid acyl hydrolase in the same plant, and even tissue, from which it was deriYed, wherein the plant non-specific lipid acyl hydrolase is expressed at significantly greater levels than normally found. By significantly greater levels is meant the production of the plant non-specific lipid acyl hydrolase at levels at least 50g greater than normally found in untransformed plants of the same species. Accordingly, the present invention contemplates constitutive promoters such that the transformed plant has increased tolerance to insect pests. Examples of constitutive promoter~ include the CaMV 19S and 35S promoters (JP 63287485), ubiquitin promoter and the rice actin promoter (W0 9109948). ~ ~
In species which produce a native plant non- ~ ;
specific lipid acyl hydrolase which is not produced in or not distributed to tissues which are normally infested with the insects, a tissue specific promoter can be used to provide localized expression of or 20 overproduction of the plant non-specific lipid acyl `~
hydrolase. Examples of tissue specific promoters `-include the root specific promoters such as maize metallothionein tEP 452269), the root specific promoter (W0/9113992), the plant ~eed storage body promoter -~
(9113993), and the alcohol dehydrogenase-1 promoter.
Promoters known to be light inducible include the ~ `
promoter of the gene encoding the small subunit (ss) of the ribulose-1,5,-bisphosphate carboxylase from soybean ~n and the promoter of the gene encoding the chlorophyll a/b binding protein in greening leaves (Coruzzi et al., (1983), JO Biol. Chem., 258:1399; and Dunsmuir, etal.
(1983), J. Molecular and App. Gen., 2:285).
Finally, a wound or pathogen inducible promoter can be used to provide expression of the plant non-38,424-F -25-~ 2~90~S2 specific lipid acyl hydrolase when a ti~sue is attacked by a plant pest. Examples of wound or pathogen inducible promoter~ include the proteinase inhibitor II
promoter.
Suitable vector~ for transforming plant tissue and protoplasts have been described in the literature and are set forth herein (see deFrammond etal. ( 1983), Biotechnology, 1:262; An etal. (1985), EMB0 J. 4.277;
Potrykus etal. ( 1985), Mol. Gen. Genet 199:183;
10 Rothstein etal. (1987), Gene, 53:153; W0 90/08829 and W0 84/02913); and, in a preferred embodiment, pDAB219~ and pDAB303 (as described in the Examples)O It is not necessary in practice that the vector harboring the selectable marker gene also contains the gene of interest. Rather, co-transformation of such vectors may be used to transform plant cells.
The appropriate procedure to produce mature ~ -transgenic plants may be chosen in accordance with the plant species used. Regeneration varies from species to species of plantsO E~ficient regeneration will depend upon the medium, on the genotype and on the history of the culture. Once whole plants have been obtained, they can be sexually or clonally reproduced in such a manner that at least one copy of the sequence is present in the cells of the progeny of the reproduction. Such procedures may be chosen in accordance with the plant , species used.
Mature plants, grown from the transformed plant cells, may be selfed to produce an inbred plant. In diploid plant~, typically one parent may be transformed `
and the other parent may be the wild type. The parent will be crossed to form first generation hybrids (F1), 38,42~-F -26-` ~ 2~0~2 which are selfed to produce second generation hybrids (F2). F2 hy~rids with the genetic makeup of plant non-specific lipid acyl hydrolase/plant non-specific lipid acyl hydrola3e are chosen and selfed to produce inbred plants.
Conventional plant breeding methods can be used to transfer the plant non-specific lipid acyl hydrolase structural gene via cros~ing and backcrossing. Such methods comprise the further steps of (a) sexually crossing the insect-resistant plant with a plant ~rom the insect-susceptible variety; (b) recovering reproductive material ~rom the progeny of the cross; and ;
(c) growing insect-resistant plants from the reproductive material. Where desirable or neces~ary, the agronomic characteristics of the susceptible variety can be substantially preserved by expanding this method to include the further step~ of repetitively (d) ~ -backcros~ing the insect-resistant progeny with insect~
susceptible plants from the susceptible variety; and (e) selecting for expression of insect resistance (or an associated marker gene) among the progeny of the backcros~, until the de~ired percentage of the characteristics of the susceptible variety are present in the progeny along with the gene imparting insect resistance. Subsequently, the inbreds according to this invention may be crossed with another inbred line to produce the hybrid.
3 The present invention further contemplates using, with the plant non-specific lipid acyl hydrolase, adjuvants, chemical or biological additives in an effort to expand the spectrum of target pests, to extend the duration of effectiveness of the plant non-specific lipid acyl hydrolase or to help stabilize the 38,424-F ~27-~ 2~9~2 ~28-agricultural composition of the plant non-specific ~ipid acyl hydrolase. Exemplary potentiators would include lsctins, amphipathic proteins or proteinase inhibitors.
The present invention contemplates protecting any plant of a taxon which i~ susceptible to infestation and damage by corn rootworms. By the term "taxon" ~-herein is meant a unit, a botanical classification of genus or lower. It thus includes genu~, specie~
cultivar~, varieties, variants and other minor taxonomic -~
groups which lack a consistent nomenclature.
Exemplary plants include maize, rice and potato. However9 it is not to be construed as limiting, inasmuch as these in~ects may infest certain other crops. Thus, the methods of the invention are readily applicable to numerous plant species, if they are found ~ -to be susceptibl~ to the plant species listed hereinabove, including without limitation, species from the genera Medicago, Trifolium, Vigna, Citrus, Dazlcus, Arabidopsis, Brassic~, Raphanus, Sinapis, Capsicum, Lycopersicon, Nicotiana, Solanum, Helianthus, Bromus 9 Asparagus, Panicum, Pennisetum, Cucumis, Glycine, Lolium, Triticum and Zea.
Examples The present invention is illustrated in further detail by the following examples. The examples are for the purposes of illustration only, and are not to be construed as limiting the scope o~ the present invention. All parts and percentages are by weight unless otherwise specifically noted. All DNA sequences are given in the conventional 5' to 3' direction. All 38,424-F -28- ~ .

` ~ 2 0 ~
-2g-amino acid sequences are given in conventional amino-terminus to carboxylic acid terminus direction.
Example 1: Purification of patatins Patatin was purified from tubers of the potato cutivars Atlantic, Superior, Desiree, Norcoda, Hilat, ~`;
and LaChipper. Patatin purification was performed according to Racusen and Foote l1980), J. Food Biochem.,

4:43-52, and involved homogenization and ammonium ~-sulfate fractionation then chromatography over DEAE
cellulose and Concanavalin-A Sepharose. Yields of patatin were typically 20% of the total protein in the ~ ~
initial crude homogenate. ~ -p-Nitrophenyl laurate (PNP-laurate~ esterase activity was determined for patatin samples puriied from different cultivars using a procedure adapted from Hofgen and Wilmitzer (Plant Science (199G) 66:221-230).
In a 96 well microtiter plate, increasing amounts of patatin (0-10 ~9) were added in a total volume of 0.05 ml 50 mM Tris, pH 8.5. 0.2 ml of a 3:1 diluted substrate (0.25 mM final concentration) was added to the protein samples and initial reaction rates were obtained by monitoring the production of para-nitrophenol at 405 nm using a Molecular Devices kinetic microplate reader.
Esterase activity was calculated as the change in optical density per minute per ~9 protein.
The phospholipase activity of patatin was examined and ~uantified using a procedure modified from Hosteller, etal. (1991), Methods Enzymol., 197:125-134.
Reactions, performed at pH 8.5 and pH 5.5 for 20 and 45 minutes, respectively, contained 1 mM
'phosphatidylcholine which contained with L-3 38,424-F -29~

~ 2 0 9 ~ 2 phosphatidylcholine 1,2-di(1-14C) palmitoyl in a total ;~
volume of 0.2 ml. Reactions were stopped by adding 0.]
volumes glacial acetic acid, followed by a two volume ~ ;
chloroform-methanol (2:1). The samples were then vortexed and the aqueous and organic phases were allowed to separate. Both products and substrates were found in the organic phase. The organic phase was spotted on silica gel 60 TLC plates and products and reactants were separated using a solvent system consisting of heptane/diethyl ether/formic acid (90:60:4). Lipids were visualized with iodine vapors, removed from the plate, placed in scintillation cocktail and counted.
Specific activities were calculated as nmols free fatty acid produced/min/mg protein. Values for the ~arious cultivars tested ranged from 210 to 2,242 nmol free fatty acid produced/minute/mg protein. Analysis of the specific products indicated that patatin exhibited phospholipase B activity at p~ 8.5 and pH 5.S (i.e., both acyl groups were removed from phosphatidylcholine).
Example 2- Effect of patatin on the growth of Diabrotica larvae 0.03 ml of purified patatin solution (in 25 mM
sodium phosphate buffer, pH 7.2) was applied to the surface of 0.25 ml artificial diet (adapted from Rose and McCabe (1973), J. Econ. Entomol., 66:398-400) in 24 well plates and allowed to air dry in a laminar flow hood. The wells were then infested with single, neonate 3 southern corn rootworm (SCR, Diabrotica u~decimp~nctata howardi) hatched from sterilized eggs or with single, preweighed second instar SCR or western corn rootworm (WCR, Diabrotica vzrgifera uirgifera) . The plates were then placed in sterilized, sealed plastic containers and put in a humidified growth chamber maintained at 25C for 6 38,424-F -30- ~-2~9~2 - ~
-31- ~:

days (SCR) or 3.5 days (second in~tar SCR and WCR) prior to final weighing.
. ~, . , A. Effect on neonate SCR larvae ~:
Increasing concentrations of purified patatin isolated from five potato cultivars (see Example 1) were used in feeding studies as described above. In all cases neonate SCR showed a dose dependent inhibition of growth upon ingestion of these patatins (Table 1). The maximal and 50% growth inhibition were similar for all patatins tested (66-84% inhibition of growth and 0.0625-0.125 mg/g diet, respectively).

38,424-F -31 2~aS2 -32- ~:
'' ~ '~"'.

3 o~ ~ ~D _ _ _ . ...
O ~ ~ ~ 'C ~ N r1 ~a . o C~ o o o o ~3 ~
o 8 +1 +1 +, ~, +1 +, o :~
~ ~ o~ ~ ~ ~ o s ~ ,i , ~ ,i ~ .
n~ _ . _ _ . _ ., .~ a) o o o o o o o D
o ~ +l ~1 +1 ~1 ~1 +1 O V3 ~ ~ c N O O
_ ~ ri _i r1 _~ .~

(lS 1~ ~- N N t`~ N ~e 0 . . . . .
~ ~ E~ ,~ O C:l o o o ~o~ ~ .~ +l +l +l +l +l a~
O O N O ~ O ~` C~
~ 3 ~ ~ ~ _i ,~ o ~ .
~ o .... _ _ __ _ _ a,~

~ N It~ _~ cr~
~n ~t~ o o o o O
oO ~ r~ ~ O~ ~D ~
~ O ~ N ~i _ O O ~ ~ ~

~ u ~q u~ a~ ~r ~
~1 ~ I _~ N ~ _I ~1 _~ C) o~ c o o o o o o ~a\ ~:'':~
O _1 ~1 +1 +1 +1 +1 +1 ,C ~ ', --,,cc ~0 n ~ 1-~ G~ ~` ~ID ,,' -,,-, ~1 ~11~ N t`S _~ O O )~
~ o _ _ _ _ _ ~ e .. ~ a~ 0~u ~
~, ~ ~_, Ln Q) 0 D~O N N Ul ~i IU

~, E~ ~O o o ~I N O P ~S
E--;` _ C_? O O O O O ~t 38,424-F -32-~0~0~2 ~s ~33-These data demonstrate the ability of patatins from different cultivars to inhibit the growth of neonate SCR larvae. ~-~

B. Effect on second instar WCR and SCR larvae Neonate WCR larvae cannot be readily bioa~sayed due to their inability to develop on artificial diet.
However, second instar larvae will develop on artificial diet and feeding assays were conducted as described above. Patatin from the Hilat cultivar caused substantial growth inhibition at the dose tested (Table 2) and was greater than that seen with neonate SCR (53%
vs 67% inhibition, respectively).

Table 2~ Effect of patatin from the ~ ~
potato cultivar Hilat on the growth of -second instar western corn rootworm -. ~
larvae. ;;`
:'"' ' ' ~ ~ ' TREATMENT WEIGHT INCREASE INHIBITION ~;

Control* 6.72 + 0.50** __ Patatin 1.17 + 0.48 83 -~
(0O25)*
Mean startin 3 weights, contro WCR = 2.58 m~, Patatin WCR = 2.71 mg ** Values are the mean + SEM for 24 3 observations ~' ~.- .

38,424-F -33-_34_ 2~9 ~ 2 Similar experiments with second instar SCR
indicate that patatin is about half as effective at this developmental stage as compared to WCR.
Table 3: Effect of patatin from the potato cultivar Hilat on the growth of second instar southern corn rootworm larvae . ~
TREATMENT WEIGHT INCREASE INHIB%ITION
"
Control* 14.39 + 0.90 --..... . __ Patatin 8.58 + 0.6 40 ~-(0.25~* - `
Mean starting weights, control SCR = 2.49 mg; Patatin SCR = 2.61 mg These data demonstrate that growth of WCR
larvae is reduced upon ingestion of patatin and that WCR
are more sensitive to patatin than SCR. -Example 4: Effect of an isolated isoform of patatin on neonate SCR larvae A single isoform of patatin from the eultivar ~esiree was obtained by fractionating the purified multi-isoform material over a Pharmacia Mono Q~u anion exchange column equilibrated in 20 mM Tris-HCl, pH 8.5.
Proteins were eluted using a NaCl gradient from 0-500 mM
over 1 ~our. Each fraction of patatin was then examined by isoelectric focusing. The fractions containing the most basic isoform (pl = 6.5) were combined, dialyzed ~against 25 mM sodium phosphate buffer and concentrated.
~his single isoform, designated Desiree-B, was then used in neonate SC~ feeding studies (Table 4). A similar 38,424-F -34-. ~. ~ , . .. , ~ . , . . . - . . . - ... . . ....

~ 2~9~2 : ~

.:

degree of growth inhibition was seen with the single isoform (Desiree-B) sample of patatin as with the multiple isoforms.
Table 4: Effect of multiple vs single isoforms of TREATMENT LARVAL WEIGHT
(mg/g diet) ~mg) Control*3.98 ~ 0.16*
Desiree (0.25) 1.97 + 0.22 -~
. . . _ _ .
Desiree-B1.39 + 0.12 ~0.25) -* - Values are he mean + SEM
for two separate experiments patatin from the potato cultivar Desiree on growth of neonate southern corn rootworm larvae ;~
These data indicate that a single isoform of patatin is capable of producing growth inhibition of Diabro~ica larvae, and that a complex mixture of isoforms is not essential for qrowth inhibition.
Example 5: Effect of patatin inactivated with di- -25 isopropyl fluorophosphate on neonate SCR -- ~ ~
Inspection of the amino acid sequence of several patatins reveal~ that the serine hydrolase -~
active site motif Gly-Xxx-Ser-Xxx-Gly is present in all the sequences, centered around Ser 77. Patatin therefore appears to be a member of the serine hydrolase class of enzymes. Conqistent with this classification, patatin is completely inactivated by treatment with di-sopropyl fluorophosphate (DFP), the specific active site titrant of serine hydrolases. To establish whether 38,424-F -35-r~ ~ 0 ~ 2 the enzymatis activity of patatin is necessary for the effect on insect larval growth, patatin (17 mg~ from the cultivar Atlantic was inactivated by treatment with a 10-fold molar excess of DFP. The mixture was placed on an orbital shaker at room temperature for 1 hour after ~-~
which the excess DFP was removed by chromatography over a Pharmacia Fast~ desalting column equilibrated in 25 mM sodium phosphate buffer, pH 7Ø The resulting modified protein was concentrated, quantified and tested for esterase and phospholipase activity as described in Example 1. No esterase activity was apparent in patatin ~ -~
after treatment with DFP, whereas the unmodified protein had a specific activity of 21.5 mmOD/min/mg protein.
The phospholipase activity of DFP-treated patatin was 19.8 (i 5.0) nmols free fatty acid/min/mg protein compared to 2420 (i 350) nmols free fatty acid/min/mg protein for untreated patatin.
The effect of DFP-treated patatin on the growth of neonate SCR was then determined. The DFP-treated patatin had little or no effect on Diabrotica larval growth at both 0.25 and 0.5 mg patatin/g diet (Table 5).

38,424-~ -36-r~ 2090~52 Table 5:Effect of DPP-treated patatin on neonate southern corn rootworm larvae Experiment-A

TREATMENTLARVAL WEIGHT
(mg/g diet)(mg) Control 3.07 + 0.31* :.;-~
Patatin ~0.5)0.62 + 0.06 _ . .. . .. __ DFP-treated 3.81 + 0.31 ::~
Patatin ~ .
; * - Values are the I .eans ~ SEM . ~ ','- ~ :
Experiment-B

TREATMENTLARVAL WEIGHT .
(mg/g diet)(mg) ... . .
~: Control 4.28 + 0.16 .
Patatin (0.25)1.52 + 0.26 DFP-treated 3.43 + 0.33 Patatin : ~ . -* - Values are the means ~ SEM
:. ' ,,~
These data indicate that the enzymatic activity ~::
of patatin is required for inhibition of Diabrotica larval ..
qrowth. .:
Example 6: Protective effect of patatin coated on plant .~
30 leaves :
Leaf coating experiments were performed using the method of Wolfson and Murdock (1987), supraO Lea~ ~ :
s~egments of 3 week old corn seedling~ were dipped in a 20 mg/ml patatin solution in 5~ gelatin maintained at : ~:

38,424-F -37- ~

.:

~ 2090~52 ~3~-33C, then allowed to air-dry. Control qolutions contained no patatin. The leaves were then placed in a petri dish on moist filter paper and infested with 1Q
second instar western spotted cucumber beetle (WSCB7 Diabrotica undecimpunctata undecimpu-nlctata) larvae (mean initial weight; 3.3 mg). Each treatment wa~ replicated 3 or 4 time~. After 3 day~, larval feeding damage of the leaves was estimated using the following rating:

5. ~50~ of the leaf con~umed, heavy damage 10 4. ~20% of the leaf conqumed, significant damags 3. <20~ of the leaf consumed, many area~ show continued feeding with large holes.
2. Smaller hole~, slower or interrupted feeding damage, 1-2 areas per leaf with damage.
1. Little feeding damage.
Result~ are shown in Table 6.

3o 38,~24-F -38-2 0 9 0 ~ ~ 2 Table 6: Effect of Patatin o~ WSCB Larval Feedîng . :: .:
Treatment (~ ~tandard error) _ __ Control 4 ('0.6) ~-~
_ : :
Patatin 2 (+0.4) -: - .

Damage on Corn Leaves The leaves coated with patatin showed significantly less damage than control leaves (p<0.05).
This example shows that plant tis~ue is protected from Diabrotica feeding damage by patatin.
Example 7s Effect of patatin on Colorado potato beetle --~
larval growth Potato leaflets were dipped in la mg/ml patatin in 5% gelatin maintained at 33C and allowed to air dry.
The leaflets were placed in a petri dish containing moist filter paper and infested with 4 Colorado potato beetle (Leptinotarsadecemlineata) larvae (mean initial ~-25 weight; 20.3 mg). Each treatment was replicated 3 ~-times. After 3 days, the larvae were weighed and the -~
results are shown in Table 7.

'~

38,424-F -39-^ 209~2 Table 7: Inhibition o~ Colorado Potato Beetle Larval Growth by Patatin ..__ TreatmentMean weight gain, mg (+ standard error) . . _ . . . _ _ Control33.7 (~4.1) . ~
Patatin15.0 (+7.2) The Colorado potato beetle larvae grew significantly less on the patatin coated leaves (p<0.05). This example show~ that another Coleopteran pest, Colorado potato beetle i~ also deleteriously affected by patatin.
Example 8: Effect of patatin on growth of Spodoptera larvae 0.5 ml of 1 mg~ml patatin or 1 mg/ml bovine serum albumin (BSA) dissolved in water was mixed into 2 ml artificial diet dispensed in 24 well plates. Control wells were mixed with 0.5 ml water. The wells were each infested with one second-instar beet armyworm (Spodoptera exigua) larva (mean initial weight; 2 mg~. A~ter 5 days, the larvae were weighed. Results are shown in Table 8.

: , :: ' 38,424-F -40~

Table 8: Inhibition of Beet Armyworm Larval Growth by Patatin .
Treatment n Mean weight gain, mg 5Control 11 223 (+16.33 + BSA 12 222 (~16.0) _ + Patatin 22 176 (+13.0) . . .' :.

The beet armyworm larvae on the patatin-treated diet were significantly smaller (21% inhibition oP
growth) than the larvae on the control diet and the diet treated with BSA (p<0.05).
Example 9: Con~truction of a cDNA library from potato tuber skin tissue ~-A. RNA Purification The skin and outer cortex tissue from 4 cm potato tubers (Solanum tuberosum cv . Superior) was harvested and immediately frozen in liquid nitrogen. - -~
Frozen tissue was ground in a mortar to a fine powder under liquid nitrogen. Five grams of tissue were extracted with a volume of 50 mM Tris-HCl pH ~.0, 4 para-amino salicylic acid, l~ triisopropylnapthalene- ~
sulfonic acid, lO mM dithrothreitol, and lO mM sodium -metabisulfite. The homogenate was then extracted with an equal volume of phenol containing 0.1% 8 -hydroxyquinoline. After centrifugation the aqueous ~ ;~
layer was extracted with an equal volume of phenol containing chloroform:isoamylalcohol (24:1), followed by èxtraction with chloroform:octanol (24:1).
;. ; . :

~8,424-F -41- ~
~ ' ' .: :~ ~ .
: ' "

~ 2 ~

Subsequently, 7.5 M ammonium acetate was added to a final concentration of 2.5 M. The RNA wa~ precipitated overnight at -20C, collected by centriEugation, reprecipitated with 2.5 M ammonium acetate and washed with 70~ ethanol. The dried RNA was resuspended in water and stored at -80C~ Poly Af RNA was isolated using Hybond mAPT~ messenger affinity paper (Amersham).
B. cDNA Construction and Screening cDNA was synthesized using 5 ~g of Poly A+ RNA
and a ZAP-cDNA~ synthesis kit (Stratagene). Size-selected CDNA was li~ated to 2 ~g of UniZap XR~ vector arms (Stratagene), and packaged into phage particles with Gigapack GoldT~ packaging extract (Stratagene).
About 4.2 x lO~ putative clones were obtained after packa~in~. The plate amplified library contained approximately 5.0 x lOlO plaque forming units per milliliter (pfu/ml) when titered using E.coli PLK-F'~
2~ cells (stratagene) as the host strain.
Example lO - Construction of plant expression plasmids The plasmid pDAB219~ represents a dual purpose vector containing two genes, each under the control of a ~ -promoter expressed in callu~ tissue. The first gene, a screenable marker9 is a modified beta-glucuronidase (gus) gene from Escherichiacoli under the translational control of the Cauliflower Mosaic Virus 35S promoter. 1 Plant transcription9 termination and polyadenylation addition signals are supplied by sequences derived from the nopaline synthase gene. The second gene, bar, is a ! selectable marker which codes for phosphinothricine ac~etyl transferase and is derived from Streptomyces hyg`roscopicus. This gene is also under the regulation of 38,424-F -42-~ . .

9 ~

~' the Cauliflower Mosaic Viru~ 35S promoter and nopaline synthase tran~cription termination polyadenylation ~equences. The gus gene allow~ for the rapid analyqis of expre~sion using commercially available fluorometric or hi~tochemical aq~ay3. The expression of the bar gene confers resi~tance to the herbicide Basta~U (Hoech3t), thu~, imparting a ~qelective advantage to tranqformed cell~ under selection pressure. The sequences derived ~B
from Cauliflower Mosaic Virus (CaMV) represent the Cabb S strain. They are available as the MCASTRAS sequence of GenBank, and published by Franck etal. (1980), Cell9 21:285-294. A flow diagram showing the construction of plasmid pDAB2l9~ is presented in Figure 4.
., A. Plasmids utilizing the 35S promoter and the ;-~
Agrobacterium Nos Poly A sequences -The starting material is plasmid pBI221, ~-purchased from CLONTECH (Palo Alto, CA). This plasmid contains a modified copy of the CaMV 35S promoter, as described in Bevan etal (1985), EMB0 J., 4:1921-1926; -Baulcombe etal. ( 1986), Nature, 321:446-449; Jefferson et al. ( 1987), EMB0 J., 6:3901-3907; and Jefferson (1987), Plant Molec. Biol. Reporter, 5:387-40. Beginning at the 3' end of the PstI site of pUC l9 (Yanisch-Perron etal.
(1985), Gene, 33:l03-ll9), and reading on the same strand as that which encodes the Lac Z gene of pUC l9, the promoter sequence is comprised of the linker nucleotides GTCCCC, followed by CaMV nucleotides 6605 to 7439, followed by the linker sequence GGGGACTCTAGAGGATCCCCGGGTGGTCAGTCCCTT, wherein the underlined bases represent the BamHI recognition sequence. These bases are then followed by 1809 base pai~s (bp) comprising the coding sequence of the Escherichia coli uidA gene, which encodes the b-glucu-38,424-F 43-ronidase ~GUS) protein, and 44 bp of 3' flanking base~
that are derived from the E.coli genome ~Jefferson, etal.
(1986), Proc. Natl. Acad. Sci., 83:8447-8451), followed by the SstI linker sequence GAGCTC, which is then followed by the linker sequence GAATTTCCCC. These bases are followed by the RNA transcription termination/polyadenylation signal sequences derived from the Agrobacterium t~mefaciens nopaline synthase (Nos) : -gene, and comprise the 256 bp SaU3AI fragment -~
corresponding to nucleotides 1298 to 1554 of DePicker et al. (1982), (J. Molec. Appl. Genet., 1:561 573), followed by two C residues, the ECORI recognition sequence GAATTC, and the rest of pUC l9.
l. pBI221 DNA was digested with ECORI and BamHI, and the 3506 bp fragment was separated from the 2163 bp small fragment by agarose gel electrophoresis, and then purified by standard methods. pRAJ275 (CLONTECH, Jefferson (1987), supra~ DNA was digested with ECORI and SalI~ and the 1862 bp fragment was purified from an agarose gel. These two fragments were mixed together, and complementary synthetic oligonucleotides having the -~
sequence GATCCGGATCCG and TCGACGGATCCG were added. The fragments were ligated together and the ligation reaction was transformed into competent E. coli cells. A `~
transformant harboring a plasmid having the appropriate DNA structure was identified by restriction enzyme site mapping. This plasmid was named pKA881.
3 2. pKA881 DNA was digested with BalI and ECORI~ and the 4148 bp large fragment was purified from an agarose gel.
DNA of pBI221 was similarly digested, and the 1517 bp ~ .

38, 424-F -44--- 2~9~2 EcoRI/BalI fragment was gel purified and ligated to the above pKA881 fragment 9 to generate plasmid pKA882.
3. pKA882 DNA was digested with SstI, the protruding ends were made blunt by treatment with T4 polymerase, and the fragment was ligated to synthetic BamHI linkers having the sequence CGGATCCG. An E.coli transformant that harbored a plasmid having BamHI fragments of 3784 and 1885 bp was identified and named pKA882B.
4. pKA882 DNA was digested with PstI, and the linear fragments were ligated to synthetic adaptors having the sequence CAGATCTGTGCA. An E. CQIi transformant was -~
identified that harbored a plasmid that was not cleaved by PstI~ and that had a new, unique BglII site. This 5 plasmid was named pKA882-Bg. --~
5. pKA882-Bg DNA was digested with ECORI, and the linear fragments were ligated to synthetic adaptors having the sequence AATTGAGATCTC. An E. coli transformant was identified that harbored a plasmid that was not cleaved by ECORI, and that generated BglII fragments of 3027 and 2658 bp. This plasmid was named pKA882-2xBg.

6. pKA882B DNA was digested with BamHI and the mixture of fragments was ligated. An E.col~ transformant harboring a plasmid that generated a single 3783 bp fragment upon digestion with Bam~I was identified and named p35S/Nos. This plasmid has the essential DNA
structure of pBI221, except that the coding sequences of the GUS gene have been deleted. Therefore, CaMV
nucleotides 6605 to 7439 are followed by the linker sequence GGGGACTCTAGAGGATCCCGAATTTCCCC

38, 424-F -45-~` 2~9~2 , which is followed by the NOS polyadenylation sequences and the rest of pBI221.

7. p35S/Nos DNA was digested with ECORV and PstI~ and the 3037 bp fragment was purified and ligated to the 534 5 bp fragment obtained from digestion of p35S/En2 DNA (see ~.
Example 10, Section C.5~ with ECORV and PstI. An E.coli transformant was identified that harbored a plasmid that generated fragments of 3031 and 534 bp upon digestion with ECORV and PstI, and the plasmid was named p35S
En2/Nos. This plasmid contains the duplicated 35S
promoter enhancer region described for p35S En2 in Example 10, Section C.5. The promoter sequences were separated from the NOS polyadenylation sequences by 15 linker sequences that include a unique BamHI site. ~ : :
B. Plasmids utilizing the 35S promoter and the Agrobacterium ORF 25/26 Poly A sequences The starting material is plasmid pIC 35. This ~ ~
plasmid contains the 845 bp SmaI/HindIII fragment from - --pUC 13 35S (-343) [see Example 10, Section C], ligated ..
into the NruI and HindIII sites of pIC l9R (Marsh, etal.
(1984), Gene, 32:481-485), in the orientation such that the HindIII recognition site is maintained. The source of the A. tumefaciens ORF25/26 sequences is plasmid pIC1925. This plasmid contains the 713 bp HincII
fragment comprising nucleotides 21728 to 22440 of A.
tumefaciens pTi 15955 T-DNA (Barker etal., Plant Molec.
Biol., 2:335-350), ligated into the SmaI site of pIC
l9H (Marsh, etal. ~1984), supra), in the orientation such that the BamHI site of pIC l9H is adjacent to the ORF
25 end of the T-DNA fragment.

38,424-F -46-~ 2~9~5~

l. DNA of plasmid pIC 35 was digested with BamHI~ and ligated to a 738 bp fragment prepared by digestion of pICl925 DNA with BamHI and Bg~ An E. coli trans~ormant was identified that harbored a plasmid in which a BamHI
site was positioned between the 35S promoter fragment and the ORF 25/26 Poly A fragment. This plasmid was named pIC l9R35/A.
2. pIC l9R35/A DNA was digestecl with SmaI at its unique site, and the DNA was ligated to BgzII linkers having the sequence CAGATCTG. The tandomization of these BglII linkers generates, besides BglII recognition sites, also PstI recognition sites, CTGCAG. An E.coli :
transformant was identified that had at least two copies of the linkers (and new BglII and PstI sites] at the position of the former SmaI site. This plasmid was named pIC35/A.
3. DNA of plasmid pIC 20R (Marsh, etal. ( 1984), Gene, 2C 32:481-485l4) was digested with NruI and Sm~I, and the blunt ends of the large fragment were ligated together.
An E.coli transformant was identified that harbored a plasmid that lacked NruIt SmaI, HindIII~ SphI, PstI, SalI, XbaI, and BamHI sites. This plasmid was called 2~ pIC 20RD.
4. pIC 20RD DNA was digested with Bg~ and was ligated to the 1625 bp BglII fragment of pIC35/A. An E.
coli transfor~ant was identified that harbored a plasmid that contained the 35S promoter/ORF 25 poly A sequences.
Restriction enzyme site mapping revealed these sequences to be in the orientation such that the unique KpnI and XhoI sites of pIC 20RD are positioned at the 3' end of 38,424-F -47-. , .

~ 9~2 ::
-48~

the ORF 25 Poly A sequence~ This plasmid was named pSG
Bgl 3525 (Pst).
5. DNA of pSG BglII 3525 (Pst) was digested with Bg under conditions in which only one of the two BglII
sites of ~he molecule were cleaved. The 4301 bp linear fragments were ligated to synthetic adapter oligonucleotides having the sequence GATCÇTGATCAC, where the underlined bases represent the BCII recognition sequence. An E.~oli transfoxmant was identi~ied that had a BCII site at the position of the former BglII site positioned 5' to the 35S promoter. This plasmid was named pSG 3525 a ( Pst ) .
C. Construction of a doubly-enhanced CaMV 35S Promoter The starting material is plasmid pUCl3/35S
(-343) as described by Odell etal. ( (1985)~ Nature, 313:810-812). This plasmid comprises, starting at the 3' end of the Sm~I site of pUC 13 (Messing, J. ~1983) ~ -in "Method~ in Enzymology" (Wu, R. etal., Eds) 101:20- ~ -78), and reading on the strand contiguous to the ~ ;
noncoding strand of the Lac Z gene of pUC 13, nucleotides 6495 to 6972 of CaMV, followed by the linker sequence CATCGATG (which encodes a ClaI recognition site), followed by CaMV nucleotides 7089 to 7443, followed by the linker sequence CAAGCTTG, the latter sequence including the recognition sequence for HindIIIt which is then followed by the remainder of the pUC 13 `
plasmid DNA.
l. pUC 13/35S (-343) DNA was digested with ClaI/ and the protruding ends were made flush by treatment with T4 poly~merase. The blunt-ended DNA was then ligated to synthetic oligonucleotide linkers having the sequence 38,424-F ~48- ;~

CCCATGGG, which includes an NCOI recognition site. An E.coli transformant was identified containing a plasmid (named pOO#l) having an NCOI site positioned at the former ClaI site.
2. pOO#l DNA was digested with NCOI and the compatible ends of the large fragment were religated, resulting in the deletion of 70 bp from pOO#l, to generate plasmid ;
pOO#l Nco~.
3. pOO#l Nco~ DNA was digested with ECORV, and the blunt ends were ligated to ClaI linkers having the sequence CATCGATG. An E. coli transformant harboring a plasmid having a new ClaI site at the position of the previous ECORV site was identified, and the plasmid was named pOO#l NCO~RV/CIa .
4. pOo~l Nco~ RV/Cla DNA was digested with ClaI and NCOI, and the small (268 bp) fragment was purified from an agarose gel. This fragment was then ligated to the 3429 bp ClaI/NcoI fragment of pUC 13/35S (-343~ prepared by isolation from an agarose gel, and an ~. coli transformant was identified that harbored a plasmid having ClaI/NcoI fragments 3429 and 268 bp. This plasmid was named pUC 13/35S En.
5. pUC 13/35S En DNA was digested with ~coI, and the protruding ends were made blunt by treatment with T4 polymerase. The treated DNA was then cut with SmaI, and was ligated to BglII linkers having the sequence CAGATCTG. An E.coli transformant was identified that harbored a plasmid in which the 416 bp SmaI/NcoI
fragment had been replaced with at least two copies of the ~glII linkers and named p35S En2.
~ .
~' 38,424-F -49-2~9~2 ~:
-50~

The DNA structure of p35S En2 is as follows: ~-beginning with the nucleotide that follows the third C
residue of the SmaI site on the strand contiguous to the noncoding strand of the Lac Z gene of pUC 13; the linker sequence CAGATCTGCAGATCTGCATGGGCGATG, followed by a CaMV nucleotides 7090 to 7344v followed by a ClaI
linker sequence CATCGATG, followed by CaMV nucleotides 7089 to 7443, followed by the HindIII linker sequence CAAGCTT, followed by the rest oi pUC 13 sequence. This structure has the feature that l:he enhancer sequences of the CaMY 35S promoter, which lie in the region upstream of the ECORV site in the viral genom~ (nucleotides 7090 to 7344), have been duplicated. This promoter construct incorporates the native 35S transcription start site, which lies ll nucleotides upstream of the first A
residue of the HindIII site.
D. Construction of a synthetic untranslated leader A DNA fragment was constructed that includes sequences which comprise the 5' untranslated leader portion of the major rightward transcript of the Maize -Streak Virus (MSV) genome. The MSV genomic sequence was published by Mullineaux etal., ( 1984), EMB0 J., 3s3063~
3068, and ~3iowell ~1984), Nucl. Aeid~ ~e~., 12:7359-7375, and the transcript was described by Fenoll etal. (1988), EMB0 J., 7:1589-1596. ~he entire sequence, comprising 154 bp, was constructed in three stages by assembling blocks (A, B, and C) of synthetic oligonucleotides.
l. The A Block: Complementary oligonucleotides having ~ -~
the sequence GATCCAGCTGAAGGCTCGACAAGGCAGATCCACGGAGGAGCTGA ~;~
TATT~GGTGGACA and AGCTTGTCCACCAAATATCAGCTCCTCCGTGGATC

., ~ ':
38,424-F -50-.~ :

209~552 TGCCTTGTCGAGCCTTCAGCTG were synth sized and purified by standard procedures. Annealing of these nucleotides into double-stranded structures leaves 4-base sticky ends that are compatible with those generated by BamHI
on one end of the molecule (GATC), and with H~ndIII-generated single stranded ends on the other end of themolecule (AGCT~ Such annealed molecules were ligated into plasmid pBluescript SK(-) [Stratagene Cloning Systems, La Jolla, CA], that had been digested with BamHI and HindIII. An E.coli transformant harboring a plasmid containing the oligonucleotide sequence was identified by BamHI and HindIII restriction enzyme analysis, and the plasmid was named pMSV A.
2. The B Block: Complementary oligonucleotides having the sequences AGCTGTGGATAGGAGCAACCCTATCCCTAATATACCAGCACCA
CCAAGTCAGGGCAATCCCGGG and TCGACCCGGGATTGCCCTGACTTGGTGG
TGCTGGTATATTAGGGATAGGGTTGCTCCTATCCAC were synthesized and purified by standard procedures. The underlined bases represent the recognition sequence for restriction ~ ;
enzymes SmaI and XmaI. Annealing of these nucleotides into double-stranded structures leaves 4-base sticky ends that are compatible with those generated by HindIII
on one end of the molecule (AGCT), and with SalI-generated sticky ends on the other end of the molecule -(TCGA~
DNA of pMSV A was digested with HindIII and SalI, and was li~ated to the above annealed oligonucleotides. An E.coli transformant harboring a plasmid containing the new oligonucleotides was 38,424-F -51-9~2 identified by restriction enzyme site mapping, and was named pMSV AB.
The G Block: Complementary oligonucleotides having the sequences CCGGGCCATTTGTTCCAGGCACGGGATAAGCATTCAG
CCATGGG ATATCAAGCTTGGATCCC and TCGAGGGATCCAAGCTTGATATCCCATGGCTGAATGCTTATCCCGTGCCTGG~ACA
AATGGC were synthesized and purified by standard procedures. These oligonucleotides incorporate bases that comprise recognition sites (underlined) for NCOI
(CCATGG~, ECORV IGAT~TC)~ HindIII (AAGCTT), and BamHI
(GGATCC). Annealin~ of these nucleotides into double-stranded structures leaves 4-base sticky ends that are compatible with those generated by XmaI on one end of the molecule (CCGG), and with XhoI-generated sticky ends on the other end of the molecule (TCGA). Such annealed molecules were ligated into pMSV AB DNA that had been digested with XmaI and XhoI. An E. coli transformant harboring a plasmid containing the oligonucleotide sequence was identified by restriction enzyme site analysis, and DNA structure was verified by sequence analysis. The plasmid was named pMSV CPL; it contains the A, B and C blocks of nucleotides in sequential order ABC. Together, these comprise the 5' untranslated 25 leader sequence ("L") of the MSV coat protein ("CP") -~
gene. These correspond to nucleotides 167 to 185, and nucleotides 188 to 317 of the MSV sequence of Mullineaux etal., tl984), supra, and are flanked on the 5' end by the 30 BamHI linker sequence GGATCCAG, and on the 3' end by the linker sequence ÇATATCAAGCTTGGATCCC. An A residue corresponding to base 187 of the wild type MSV sequence ~-was inadvertently deleted during cloning.

~ :
:~
~ ' :
38, 424-F -52-53 2~5~ 2 4. BglII Site Insertion pMSV CPL DNA was digested at the SmaI site corresponding to base 277 of the MSV genomie sequence (Mullineaux, etal. ( 1984), supra), and the DNA was ligated to BglII linkers having the sequence CAGATCTG. An E. coli transformant harboring a plasmid having a unique BglII
site at the position o the former SmaI site was identified and verified by DNA sequence analysis, and the plasmid was named pCPL-Bgl.
tO
E. Construction of a deleted version of the maize alcohol dehydrogenase l (Adhl) intron l The starting material is plasmid pVWll9. This plasmid contains the DNA sequence of the maize Adh l.5 gene intron l from nucleotides ll9 to 672, and was described in Callis etal. (1987), Gene~ and Devel., 1-1183-1200. The sequence following base 672 of Dennis etal. ( (1984~, Nucl. Acids Re~., 12:3983-4000) is GACGGATCC r where the underlined bases represent a BamHI
recognition site. The entire intron l sequence, including 14 bp of exon l, and 9 bp of exon 2, was obtained from this plasmid on a 5S6 bp fra~ment following digestion with BCII and BamHI.
l. Plasmid pSG 3525 a (Pst) DNA (see Example lO, Section B.5~ was digested with BamHI and BCII~ and the 3430 bp fragment was purified from an agarose gel.
pVWll9 DNA was digested with BamHI and BcZI, and the gel purified fragment of 556 bp was ligated to the above 3430 bp fragment. An E coli transformant was identified that harbored a plasmid that generated fragments of 3430 a~ 556 bp upon digestion with BamHI and BCII. This plàsmid was named pSG Adh Al~

38,424-F -53-2090~2 _51~_ 2. pSG Adh Al DNA was digested with HindIII~ [which cuts between bases 209 and 2lO of the Dennis et al.
((1984), isupra) sequence, bottom strand], and with StuI, which cuts between bases 554 ancl 555. The ends were made flush by T4 polymerase treatment, and then ligated.
An E. coli transformant harboring a plasmid lacking HindIII and StuI sites was identified, and the DNA
structure was verified by sequence analysis. The plasmid was named pSG Adh AlD. In this construct, 344 bp of DNA have been deleted from the interior of the intron l. The functional intron sequences is obtained on a 213 bp fragment following digestion with BCII and BamHI.
3. pCPL-Bgl DNA (see Example lO, section D.4), was digested with BglII, and the linearized DNA was ligated to the 213 bp BCII/Bam~I fragment containing the deleted version of the Adh l.S intron l sequences from pSG Adh AlD. An E. coli transformant was identified by --20 restriction enzyme site mapping that harbored a plasmid ;
containing the intron sequences ligated into the BglII ~-~
site, in the orientation such that the BglII/BclI
juncture was nearest the 5' end of the MSV CPL leader -~
sequence, and the BglII/ BamHI juncture was nearest the 3. end of the CPL. This orientation was confirmed by DNA sequence analysis. The plasmid was named pCPL
AlIlD. The MSV leader/intron sequences is obtained from this plasmid by digestion with BamHI and NCOI, and purification of the 373 bp fragment~
F. Construction of plant expression vectors based on the enhanced 35S promoter, the MSV CPL, and the deleted -version of the Adh l lntron l `:

38,424-F -54-~ ~09~52 1~. DNA of plasmid p35S En2/Nos (see Example 10, Section A.7~ was digested with BamHI, and the 3562 bp linear fragment was ligated to a 171 bp fragment prepared from pMSV CPL DNA digested with BamHI. This fragment contains the entire MSV CPL sequence described in Section D.3. An E.coli transformant was identified by restriction enzyme site mapping that harbored a plasmid that contained these sequences in an orientation such -~
that the NCOI site was positioned near the Nos Poly A
sequences. This plasmid was named p35S En2 CpL/Nos. It contains the enhanced version of the 35S promoter directly contiguous to the MSV leader sequences, such that the derived transcript will include the MSV
sequences in its 5' untranslated portion.
2. DNA of plasmid pKA882 (see Example 10, Section A.2) was digested with HindIII and NCOI, and the large 4778 bp frayment was ligated to an 802 bp HindIII~NcoI
fragment containing the enhanced 35S promoter sequences and MSV leader sequences from p35S En2 CPL/Nos . An E.
coli transformant harboring a plasmid that contained fragments of 4778 and 802 bp following digestion with HindIII and NCOI was identified, and named pDAB 310. In this plasmid, the enhanced version of the 35S promoter is used to control expression of the GUS gene. The 5' untranslated leader portion of the transcript contains the leader sequence of the MSV coat protein gene.
3. DNA of plasmid pDAB 310 was digested with NCOI and 3 SstI. The large 3717 bp fragment was purified from an agarose gel and ligated to complementary synthetic oligonucleotides having the sequences CGGTACCTCGAGTTAAC
and CATGGTTAACTCGAGGTACCGAGCT. These oligonucleotides, when annealed into double stranded structures, generate molecules having 38,424-F -55-r~

sticky ends compatible with those left by SStI (AGCT) ~
on one end of the molecule, and with NCOI (CATG) on the other end of the molecule. An E. COIi transformant was identified that harbored a plasmid containing sites for enzymes SstI (AGCT), NCOI (CATG), KPnI (GGTACC), XhOI
(CTCGAG) 9 and HpaI ~GTTAAC), and the DNA structure was: :
verified by sequence analysis. This plasmid was named : :-pDAB 1148.

4 DNA of plasmid pDA~ 1148 was digested with BamHI
10 and NCOI, the large 3577 bp fragment was purified from :~
an agarose gel and ligated to a 373 bp fragment purified from pCPL AlIlD (See Example 10, Section E.3) following ~
di~estion with BamHI and NCOI. An E.coli transformant ~ ~ :
was identified that harbored a plasmid that generated : fragments of 3577 and 373 bp following digestion with :::~
BamHI and NCOI, and the plasmid was named pDAB 303. A
partial plasmid map of pDAB303 is set forth in Figure 5.
This includes a promoter, shown in Figure 6, comprising ~ :
the doubly-enhanced CaMV 35S sequence (bases 19-656), ~ :
and the deleted ADHl sequence (bases 769-989) inserted ~:
into the MSV leader sequence (bases 657-768 and 990-1026)o This plasmid has the following DNA structure~
beginning with the base after final G residue of the PstI site of pUC 19 (base 435, see Messing, J. ~1983) in :~
Methods in Enzymoloqy, Wu, R. etal. (eds) 101:20-78), and reading on the strand contiguous to the coding strand of the Lac Z gene, the linker sequence ATCTGCATGGGTG, nucleotides 7093 to 7344 of CaMV DNA, the linker sequence CATCGATG, nucleotides 7093 to 7439 of CaMV, the : .
~ linker sequence GGGGACTCTAGAGGATCCAG, nucleotides 167 to -:
186 of MSV, nucleotides 18~ to 277 of MSV, a C residue ~-followed by nucleotides 269 to 359 of Adh lS intron 1, nuc~eotides 704 to 821 of :
~ , 38,424-F -56- ~ :

~ 2090~2 maize Adh S intron l, the linker sequence GACGGATCTG, nucleotides 278 to 317 of MSV, the linker sequence GTTAACTCGAGGTACCGAGCTCGAATTTCCCC, nucleotides l298 to 1554 of NOS, and a G residue followed by the rest of the pUC l9 sequence (including the ECORI site).
G. Construction of plant transformation vectors containing the bar gene of Streptomyces hygroscopicus The starting material is plasmid pIJ4104 (White, etal. ( 1990), Nucl. Acids Re~., 18:1062~, which contains the coding region of the bar gene of S.
hygroscopicus, which encodes the enzyme phosphinothricin acetyl transferase (PAT).
1. DNA of plasmid pIJ4104 was digested with SmaI, and the 569 bp fragment was purified from an agarose gel.
DNA of plasmid pSG 3525 a (Pst) (see Example l0, Section B.5) was linearized by digestion at the unique HincII
that lies between the 35S promoter and ORF 25 poly A
sequences, and the linear fragment was ligated to the 569 bp bar gene fragment. An E. coli transformant was identified by restriction enzyme site mapping that harbored a plasmid containing the ~ar gene in the orientation such that BglII digestion generated fragments of 4118 and 764 bp. This plasmid was named pDAB 218.
2. DNA of plasmid pDAB 218 was digested with BCII, and the linear fragment of 4682 bp was ligated to a 3133 bp BglII fragment prepared from DNA of pKA882-2xBg (see : Example l0, Section A. 5). The latter fragment contains the GUS coding region, under the transcriptional control of ~the 35S promoter, w.ith the Nos Poly A transcription " ~:

38,424-F -57 -58- 2090~2 :
~'' ',;:
termination signals. An E coli transformant was identified that contained the GUS and PAT codin~
regions, and restriction enzyme recognition site mapping revealed that both coding regions were encoded by the same DNA strand. This plasmid was named pDAB 219.
3. DNA of plasmid pDA3 219 was used as the template for the polymerase chain reaction (Saiki etal., ~1988), i Science, 239:487-491) using as ]primers the synthetic oligonucleotides: i) CTCGAGATCTAGATATCGATGAATTCCCI and ii) TATGGATCCTGTGATAACCGACATATGCCCCGGTTTCGTTGo Primer i) represents nucleotides 419 to 446 of pDAB 219, and includes bases corresponding to the recognition sites of XhoI ( CTCGAG)~ BglII (AGATCT)~ XbaI (TCTAGA)~ ECORV

(GATATC)~ ClaI (ATCGAT)~ and ECORI (GAATTC)~ The single underlined bases in primer ii) represent the recognition sequence of BamHI, and the double underlined bases represent nucleotides 1138 to 1159 of pDAB 219, and correspond to nucleotides 21728 to 21749 of the ORF 25 Poly A fragment (see, Example 5, Section B). PCR
amplification generated a product of 760 bp.
.~ .
4. DNA of plasmid pDAB 219 was digested with BglII, the ` 7252 bp fragment was purified from an agarose gel, and ligated to the 747 bp fragment generated by digestion of the above PCR product by BglII and BamHI. An E. coli transformant was identified that harbored a plasmid containing a unique BglII site positioned at the 3' end of the ORF 25 Poly A fragment. The DNA structure of the 3 3' end of the PAT coding sequence was confirmed by DNA
sequence analysis. This plasmid was named pDAB 219~.
' ` ' :
'~

38,424-F -58-, ~. .

r~
2~9~5~2 The DNA sequence of pDAB 219~ is as follows:
Beginning with the base following the last A residue of the XbaI site on the Lac Z coding strand of pIC 20R
(Marsh, etal. ( 1984), Gene, 32:481-485), the linker TCCTGATCTGTGCAGGTCCCC, followed by CaMV nucleotides 6605 to 7439, followed by the linker sequence GGGGACTCTAGAGGATCCGGATCCGTCGACATGGTC, followed by the rest of the coding region of GUS with 44 bp of 3' flanking E.coli genomic DNA (nucleotides 306 to 2152 of Jefferson etal. (1986), Proc. Natl. Acad. Sci., 83:8447-8451). The underlined bases represent the codons for the first two amino acids of the GUS protein, the second of which was changed from leucine in the original E. coli uidA gene ~Jefferson etal. (1986), supra) to valine in pRAJ275 (Jefferson, (1987), supra). These bases are followed by the linker sequence GGGGAATTGGAGAGCTCGAATTTCCCC, then by bases 1298 to 1554 of the Nos Poly A sequence (DePicker, etal. ( 1982), J.
Molec. Appl. Genet., 1:561-57363. The linker sequence GGGAATTGAGATCAGGATCTCGAGCTCGGG is followed by bases 495 to 6972 of CaMV, the lin~er CATCGATG, and CaMV bases ~ -7090 to 7443. These bases are followed by the linker CAAGCTTGGCTGCAGGTC, then by bases corresponding to nucleotides 20 to 579 of the bar clone in pIJ4104 (White, ~tal. (l990), supra), the linker CTGTGATAACC, ORF
25/26 poly A nucleotides 21728 to 22440 (Barker, etal.
(1983), Plant Molec. Biol. 9 2:335-3501), the linker -GGGAATTCATCGATATCTAGATCTCGAGCTCGGGGTACCGAGCTCGAATTC, and 30 the rest of pIC 20R. The BglII recognition site - ~
(underlined) represents a unique site into which other ~1;
genes may be introduced. A partial restriction map of pDAB 219~ is appended (see Figure 7).

: -:
~..
,l 38,424-F -59- ~
;',~
, ~.: .
~, .

~ 2~9~ 2 -60~ -Example 11 - Isolation of a gene coding for prepatatin Amplified potato tuber cDNA libraries were plated on E. coli PLK-F', as described in Stratagene's Uni-Zap~ phage manual. Only a low density, of about 3000 phage per plate (80 mm dia~, were used because a high proportion of hybridizing plaques was antiripated.
The plaques were transferred to NytranTU filters (Schleicher & Schuell, Keene, NEI) and fixed by W
irradiation in a Stratalinker7~ apparatus (Stratagene).
0 The filters were probed with a 35-base oligonucleotide, which was complementary to positions 96-131 from the start of the patatin coding sequence:
GGAATGATTCCTTAATTCCACCTCCATCAATACT. This region is highly conserved in eight published sequences of patatin cDNAs or genes (Bevan, etal. (1986), Nucl Acid Res, 14:4625~4638 Mignery, etal. (1984), Nucl Acid Res, 12-7987-8000 and Twell and Ooms (1988), supra) . The probe was 3'-end labeled with digoxygenin-ll-dUTP using terminal transferase (Boehringer-Mannheim, Indianapolis, IN). Filters were hybridized according to the manufacturer's protocols, with stringent washes in 2xSSC, 0.1% SDS at 65C (Tm-8C). Binding was detected with anti-digoxygenin antibody coupled to alkaline phosphatase (Boehringer-Mannheim). Approximately 2% of the library plaques hybridized to the patatin oligonucleotide. Four plaques were purified by 2 or 3 cycles of plating at low density and reprobing. The cDNAs were then excised as phagemids, by co-infecting with the phage and a helper phage (R408), as described in the Stratagene Uni-Zap~ Manual. An extra step of retransformation at low density was necessary to elim~inate helper from the phagemids. Samples of phagèmid DNA were prepared from XLl-BlueT~ cells 38,424-F 60-r~ .
' 2090~2 -61~

(Stra~agene) by the method of Holmes and Quigley (1981), Anal Biochem, 114:193-197, and sequenced using a Sequenase~U kit (US Biochemical, Cleveland, OH).
The complete DNA sequence of the insert in 5 clone pDAB1008 was determined (see Figure 1) and the amino acid sequence thereof is set forth in Figure 3.
It is homologous to published patatin cDNAs (e.g.
Mignery etal. ~1984)), supra, except that the first 5 codons are missing. An oligonucleotide coding for the 0 first 22 amino acids for prepatatin was synthesized.
Its sequence was identical to that of pDAB1008, except that it included the 5 codons which are missing in the cDNA. These codons are identical to those in published patatin sequences (Bevan etal. (1986), supra; Mignery etal.
(1984), supra; Twell & Ooms tl988), supra). The initiator ATG was incorporated into a NCOI site, and ~-~
additional cloning sites were added downstream of the A~III site (underlined): ~
Z 20 CATGGCAACTACTAAATCTTTTTTAATTTTATTTTTTATGA -:
TATTAGCAACTACTAGTTCAACATGTTAACGGTACCCGGGCCATGGA. In order to use this A~III site for adding the rest of the patatin sequence, a vector lacking additional A~
sites was required. This was prepared from pKK233-2 5 (Pharmacia, Piscataway, NJ) by cutting with A~
filling-in the ends with Klenow fragment of DNA
~ polymerase I, and recircularizing the plasmid with T4 i DNA ligase. Enzymes were used according to the 30 manufacturer's protocols. The oligonucleotide and its Z complement (AGCTTCCATGGCCCGGGTACCGTTAACATGTTGAACTAG ~ ~-ii TAGTTGCTAATATCAAAAAATAAAATTAAAAAAGATTTAGTAGTTGC) were 1 then cloned into this derivative, between the NCOI and HindIII sites, to generate pDAB1079. The remainder of ~ the p~atatin coding sequence, with 3'-non-coding Z seque w es, was cloned into pDAB1079 on an A~III~KpnI

38,424-F -61-~ 209~2 fragment from pDAB1008. The resulting plasmid, pDAB1126, encodes a prepatatin with the amino-terminal sequence and is compared with the amino-terminal sequence of pDAB1008: ~
5 pDAB1126: MATTKSFLILFFMILATTSSTCAKLEEMVT............................... ~-cf.pDAB1008: ...... SFLILFFMILATTSSTCAKLEEMVT
It includes the 23 amino acid amino-terminal signal which, in plant cells, directs the nascent 10 polypeptide into the endoplasmic reticulum (ER) :
(Kirschner ~ ~ahn (1986), Planta, 168:386-389~. Mature patatin does not contain this signal, which is removed durin~ entry into the ER. :
The complete prepatatin sequence was transferred on a NCOI-~hOI fragment into the plant expression vector, pDAB303, which added a promoter, intron and transcription terminator for expression in corn cells. The resultant plasmid, pDABll99, was ~-2~ introduced into protoplasts of cultured corn cells, where it directed synthesis of the expected 40 kD
polypeptide which cross-reacted specifically with anti~
patatin antiserum. The unique ECORI site of pDABll99 ~e was converted to a BgIII site by the insertion of the oligonucleotide AATTGAGATCTC. The entire prepatatin gene (promoter, coding region and transcription ;~
terminator) was then cloned into another vector for plant transformation, pDAB219~, to generate pDAB1292.
Example 12 - Patatin expression in the cytosol of a plant cell , .
. Proteins which lack an amino-terminal signal for entry into the ER accumulate in the cytosol. The :':
38,424-F -62-20~05~

amount of protein accumulated in the cytosol may be higher (Denecke, etal (1990), Plant Cell, 2:51-59), or lower (Hiatt, e~al. (1989), Nature, 342, 76-78), than in other subcellular compartments. Cytosolic patatin has been produced in transformed tobacco plants, but its abundance was not reported (unpubl. res. of Sonnewald, cited in Sonnewald, etal. (1990~, Plant Cell, 2:345~355).
Proteins are glycosylated in ER, but not in the cytosol.
DNA coding for cytosolic patatin was produced 1 from pDAB1008 in PCR amplification (Perkin-Elmer, Norwalk, CT), using 25 cycles of 1 minute at 94C, 1 minute at 50C and 3 minutes at 72C. The 5' primer replaced the amino-terminal lysine of mature patatin with a dipeptide containing an initiator methionine and alanine. It also added a number of upstream restriction enzyme sites, including a NCOI site around the initiator ATG (underlined~
GCTCTAGAACTAGTGGATCCATGGCGTTGGAAGAAATGGTGCTG. The 3' 20 primer (CTTTTCCCAGTCACGAC) annealed to vector sequences ~ -downstream of the cloning site. Amplified DNA was cloned into pCR1000 (Invitrogen, San Diego, C~
,.. .
A gene for producing cytosolic patatin in -~
plants was then assembled by cloning a NCOI-XhOI
fragment into pDAB303, generating pDAB1194. This plasmid codes for a patatin with the amino-terminus and is compared with the amino-terminal sequence of ~-pDAB1008:

pDAB1194: MALEEMVTVLSIDGGGIKGIIPAT...
cf.pDAB1008: KLEEMVTVLSIDGGGIKGIIPAT.., 38,424-F -63-~ 2 ~ 9 ~

Example 13: A gene for a diverged patatin A second patatin cDNA~ coding for a different protein isoform, was isolated and modified for expression in corn. In addition to the clones described in Example 11, clones were selected from the tuber cDNA
library by their ability to produce protein which cross-reacted with anti-patatin serum. Antibody-binding to plaques on filters was detected with anti-rabbit antibody conjugated to alkaline phosphatase (Promega), according to the manufacturer's protocol.
Partial sequences at the 5' ends of these cDNAs were determined; pDAB1011 was most diverged from the sequence in pDAB1008 and was completely sequenced. The nucleotide and deduced amino acid sequences of the cDNA
in pDAB1011 are shown in Figures 2 and 3, respectively. ;
The coding seguences of these two clones are 95.5%
identical, but the differences translate into polypeptides which are only 88% identical. Both include most of an amino-terminal signal peptide, with the composition expected for ER entry (Chrispeels (1991), supra). As seen in Figures 2 and 3, the serine at amino acid 77 is presumed to be part of the lipid acyl hydrolase active site (by comparison with other hydrolases, Brady, etal. (1990), Nature, 343:767-770).
Not surprisingly, the region around this serine is highly conserved. On the other hand, potential glycosylation sites (NXS/T) were not well conserved.
3 The site at residue 115 is common to both, but pDAB1008 has a second site at position 382, whereas the second site is pDAB1011 is amino acid 203.
` DNA coding for a cytosolic patatin was produced from pDAB1011 by PCR amplification, as described in 38,424-F -64-~ .:

2090~S ~

Examplc ll. The NCOI-XhOI fragment was cloned into pDAB303, to generate pDABl260.
The ER signal in pDABl079 was completed by cloning the oli~onucleotides CATGTGCCATGG and ~ -AGCTTCCATGGCA (Oli~os etc.) between the A~III and HindIII. They add the last codon, followed by an NCOI
site containing an in~frame ATG codon. The complete ;~
signal, on an NCOI fragment, wa~s introduced ;n front of the patatin-codinq sequence in pDABl260, to produce pDABl274. The prepatatin encoded by this construct has the following amino-terminal sequence and is compared ~;n~
with the amino-terminal sequenoe of pDAB1011 . -:
pDABl274: MATTKSFLILFFMILATTSSTCAMALEEMVT...
cf.pDABl0ll: ....KSVLVLFFMILATTSSTCA-TLGEMVT...
Example 14: Development of a transgenic maize plant expressing a plant non-specifio lipid acyl hydrolase.
A. E~tablishment of Friable, Embryogenic Callus Culture~
Friable, embryogenic maize callus are initiated from immature embryos of the genotype B73 x A188. Seed of the dent corn inbred, B73, and the sweet-corn inbred, A188, are obtained from Holden's Foundation Seeds, Inc., I Williamsburg, IA and the Univer~ity of Minnesota, Crop ¦ Improvement Association, St. Paul, MN, respectively.
I Seed are sown individually in pots containing 3 approximately 18 kg of dry soil mix (Conrad Fafard, ' Inc., Springfield, MA) moistened and adjusted to pH 6Ø
The plants are maintained in a greenhouse under a 16/8 ` photoperiod~ Ambient daylight is supplemented with a 389424-F -65~

,: ;

~ 20~5~
-66- .

combination of high pres~ure sodium and metal hali de lamps such that the minimum light intensity 2 m abo~e pot level i9 1,500 ft-candles. Greenhouse temperature is maintained within 3C of 38C during the day and 22C
at night. The plants are irrigated as needed with a solution containing 400 mg~L of 20-20-20 ~ertilizer (W.R. Grace & Co., Fogelsville, PA) plus 8 mg/L chelated -iron (Ciba-Geigy, Greensboro, NC).
Approximately 50-60 days after planting, male influorescences (tassels) are shedding pollen and silk~
have emerged from female influorescences (ears). Pollen is collected by placing a paper bag over the tassel of a -plant of the inbred line A188. A female plant of the inbred line B73 is prepared for pollination on the day before pollen availability by cutting off the tip of the husks and silkq of an unfertilized ear shoot. The next day, after the silks have grown to form a thick "brush"
all the same length, pollen is carefully applied to the silks and the entire ear is covered with a paper bag.
When the developing hybrid embryos reach a length of approximately 1.5-2.0 mm (10-14 days after pollination), the ear i5 excised and surface sterilized by emersion in 70% v/v ethanol for 10 minutes followed j by soaking in 20% v/v commercial bleach (1% sodium hypochlorite) for 30 minutes. Following a sterile, I distilled water rinse, immature embryos are aseptically I isolated and placed onto a "callus" medium with the 3 embryo axi~ in contact with the medium (scutellar-side away from the medium). The "callus" medium consists of the following components: N6 basal salts and vitamins ~ (Chu etal., ( 1978) Proc. S~m~. Plant Tissue Cult., ! Science Press, Peking, pp 43-56) 20 g/L sucrose, 691 ¦ mg/L proline, lO0 mg/L casein hydrolysate, 1 mg/L 2,4-1 38,424-F -66-` ~ 2 0 ~ 2 ~67-dichloro-phenoxyacetic acid (2,4-D), and 2.5 g/L gelrite (Kelco, Inc., San Diego, CA) adjusted to pH 5.8.
The immature, hybrid embryos are incubated at ;~
28C in the dark for 10-30 days during which time callus tissue, displaying various types of morphology, proliferates from the scutellar region. The callus ~ -tissue produced during this time i3 classified into three di~tinct typess i) soft, granular, translucent callus lacking any apparent morphological organization (known as non-embryogenic); ii) compact, nodular, yellowish-to-white callus conclisting of groups of somatic embryoq (often fused) with distinct scutellar-and coleoptile-like structures (known as Type I); and iii) soft callus with numerous globular and elongated somatic embryos on suspensor-like structure3 (known a~
Type II). Type II callus is the most suitable for establishing friable, embryogenic cultures. Sometimes entire scutella will proliferate with this type of tissue or at times only small sectors exhibiting this morphology will develop. At this point, selective sub-culture is necessary whereby only tissue with well-defined globular and elongated somatic embryos along with some subtending undifferentiated, soft tissue iq transferred to fresh "callus" medium.
Every 10-14 days~ the callus is sub-cultured to fresh "callus" medium being careful to select only tissue of the correct morphology. For the first 8-lo 3 weeks, selection is for Type II callus only, to increase the amount of tissue and to select against non-embryogenic and Type I. At each sub-culture, less than 100 mg of tissue is typically selected from callus that - -~
has reached a size of 1 g. Thus, the amount of Type II ~ ~
callus will not increase to more than 1 g for the first -;

38,424-F -67-` ~ 2~905~2 ::

8-12 weeks due to the strict selection for tissue type.
During the fir~,t 3 month~, some lines (a line is defined as originating from a single hybrid embryo) will be discarded if they lose their Type II morphology. At about 8-16 weeks in well ei~,tablished Type II culturei3, selection of a different type of tissue can proceed.
This tissue (known as Type III) is different from Type II in that it is somewhat more homogeneou~ in morphology and relatively undifferentiated with no visible i~omatic embryos. The color will vary from light-to-bright yellow. Normally, it takes about 16-20 weekis to get this homogeneous, Type III tissue in sufficient amounts for routine experimentation (0.5-1.0 g).

During the 14-20 week period of Type III callus establishment, more lines are discarded if they revert to Type II or Type I after repeated selection. At 14-20 weeks of age, the cultures are checked for their ability to regenerate plants (see Example 14~ Section C). Lines that do not regenerate are discarded. Cultures capable of maintaining Type III morphology and regenerating plants are referred to as friable, embryogenic callus.
B. Transformation via Microparticle Propulsion Plasmid DNA i~ adsorbed onto the sur~ace of gold particles prior to use in transformation experiments,. The gold particles are spherical with diameters ranging from about 1.5-3.0 microns in diameter (Aldrich Chemical Co., Milwaukee, WI). Adsorption is accomplished by adding 74 ~L of 2.5 M calcium chloride and 30 ~L of 0.1 M spermidine to 300 ~L of DNA/gold suspension (70 ~g pDAB219~, 70 ~g pDAB1199, 0.01 M Tris buffer~ and 1 mM EDTA). The DNA~coated gold particles are vortexed immediately, then allowed to settle to the 38,424-F -68--- 20~52 , ~ ~ -69~
~ ' '.' bottom of an Eppendor~ tube and the requltant clear liquid is completely drawn o~f. The DNA-coated gold particles are then resuspended in 1 mL of 100~ ethanol.
The suspension is then diluted to 15 mg DNA/gold per mL
of ethanol for use in microparticle propulsion experiments.
Approximately 250 mg of friable, embryogenic callus tis~ue, 5-7 days following sub-culture, is arranged in a thin layer on a 1 cm diameter piece o~
0 filter paper (Schleicher and Schuell, Inc., Keene, NH) placed on the surface of "callus" medium~ The callus tissue is allowed to dry out slightly by allowing the plates to stand uncovered in a laminar flow hood for several minutes before use. In preparation for particle bombardment, the callus is covered with a 104 micron stainless steel screen. The DNA-coated gold particles are accelerated at the friable, embryogenic calluq tissue using the particle bombardment apparatus -described in European Patent Application EP 0 405 696 -~ -~
A1. Each callus tissue sample is bombarded 10-15 times with each bombardment delivering approximately 1 ~L of DNA-coated gold suspension.
III. Selection of Transformed Tissue and Plant Regeneration -After bombarding the sample, callus tissue is ~, allowed to incubate for 1-2 days under the conditions described previously ~see Example 14, Section I). After 1-2 days, each tissue sample is divided into approximately 60 equal pieces ~1-3 mm diameter) and -transferred to fresh "callus" medium containing 30 mg/L
Basta.~ Every three weeks, callus tissue is non-selectively transferred to fresh Basta-containing 38,424-F -69-'' ~ 2~90~2 .

"callus" medium. At this concentration of herbicide, very little growth is ob~erved. After 8-16 weeks, sectors proliferating from a background of growth inhibited ti~sue is observed. This tissue i~ isolated from the other callus and maintained separately on Basta-containing "callu~" medium and selectively sub-cultured every 10-14 day~. At this point, a histochemical assay for gu3 expreqsion is performed by placing small samples of callus ti~sue into 24-well microliter dishes (Corning, New York, NY) containing approximately 500 ~L of assay buffer (0.2 M sodium phosphate pH 8.0, 0.1 mM each of potassium ferricyanide and potassium ferrocyanide, 1.0 M sodium EDTA, and 1 mg/L 5-bromo-4-chloro-3-indolyl-beta-D-glucuronide).
Patatin gene e~pression is also a3sayed via immunoblot analysis with patatin antiserum.
Basta-resistant, gus- and patatin-positive callu~ is selectively sub-cultured to "induction" medium and incubated at 28C in low light (125 ft-candles) for ', one week followed by one week in high light (325 ft-candle3) provided by cool fluorescent lamps. The "induction" medium is composed of MS salts and vitamins ~j (Murashige and Skoog, 1962), 30 g/L sucrose, 100 mg/L
myo-ino~itol, 5 mg/L benzyl-amino purine, 0.025 mg/L
2,4-D, 2.5 g/L Gelrite adjusted to pH 5.7. Following this two week induction period, the callu3 iq then non-selectively transferred to "regeneration" medium and incubated in high light at 28C. The 'Iregeneration'' medium is composed of MS salts and vitamins, 30 g/L
l sucrose, and 2.5 g/L gelrite adju~ted to pH 5.7. Every ;~ 14-21 days the callus i~ subcultured to fresh "rege~e~ration" medium selecting ~or ti~ue which appear~
to be differentiating leaves and roots. Both , !
~ 38,424-F -70-~ 2~9~

"induction" and "regeneration" media contain 30 mg/L
Basta. Plantlets are transferred to 10 cm pots containing approximately 1 kg of dry soil mix9 moistened thoroughly~ and covered with olear plastic cup~ ~or approximately 4 days. At the 3-5 leaf-stage, plants are transplanted to larger pots and grown to maturity as previously described tsee Example 14, Section A). Self-or sibling-pollination~ is performed on plants regenerated from the same culture. Crosses to non-transformed parental lines (i.e., B73 or A188) can al~o be performed in order to obtain transgenic progeny analysis.
D. Confirmation of Patatin Gene Integration -~

To confirm the presence of the patatin gene in regenerated plants and progeny, Southern blot analysis of genomic DNA is performed. DNA for each plant is prepared from lyophilized leaf tissue a~ follows. ~-Approximately 500 mg of tissue is placed into a 16 mL
polypropylene tube (Becton Dickenson, Lincoln Park, NJ) ~ ~1 into which i3 added 9 mL of CTAB extraction buffer (6.57 ~1 mL water, 0.9 mL o~ 1.0 M Tris pH7.5, 1.26 mL of 5 M
sodium chloride, 0.18 mL oP 0.5 M EDTA, 0.09 g mixed alkyl tri-methyl ammonium bromide9 and 0~09 mL beta~
mercaptoethanol) and immediately incubated in a 60C
water bath with occasional mixing. After about 60 minutes, 4.5 mL of 24:1 chloroform/octanol is added and ;
gently mixed for approximately 5 minutes. Following a 3 10 minute centrifuge at 900xg at room temperature, the -top aqueous layer is poured into a 16 mL polypropylene tube containing 6 mL of isopropanol where DNA
precipitation occurs.

', :
, 38,424-F -71- ;~
I

:`

!~ 2 0 9 0 ~ ~ ~

The precipitated DNA i~ removed with a glass hook and transferred to a 5 mL disposable tube containing 1-2 mL of 76% ethanol and 0.2 M sodium acetate for 20 minutes. The DNA i~ then rinsed on the hook briefly in a microfuge tube containing 1 mL 76%
ethanol and 10 mM ammonium acetate before being transferred to a microfuge tube containing 400 ~L of TE
buffer (10 mM Tri~ pH 8.0 and 1 mM EDTA) and placed on a rocker overnight at 4C. The next day9 undissolved solids is removed by centrifugation at hi~h speed for 10 minutes. The DNA-containing supernatant is then pipetted into a new microfuge tube and stored at 4C. ~`
The concentration of DNA in the sample is determined by measuring absorbance at 260 nm with a spectrophoto~eter. Approximately 8 ~g of DNA is digested with either of the restriction enzymes BamH1 or EcoR 1 as suggested by the manufacturer (Bethesda Research Laboratory, Gaithersburg, MD). This combination of enzymes cuts out the patatin gene intact.
The DNA is then fractionated on a 0.8~ agarose gel and transferred onto nylon membranes a~ suggested hy the manufacturer (Schleicher and Schuell, Inc., Keene, NH).
A patatin gene fragment from pDAB1199 is used as a probe. Probe DNA is prepared by random primer labeling with an Oligo Labeling Kit (Pharmacia LKB Biotechnology, Inc, Piscataway, NJ) as per the supplier's instructions with 50 microCurie~ 32-P-dCTP. Blots are then washed at 60C in 0.25 x SSC (30 mM sodium chloride, 3.0 mM sodium citrate) and 0.2~ sodium dodecyl sulfate for 45 minutes, blotted dry, and exposed to XXAR-5 film overnight with two intensifying screens.
~ To assess resistance to insect attack, transgenic plants expressing the maximal levels of 38,424-F -72-~ 209~.~)52 . ~ .

patatin are grown in 12'l pots in ~oil. The ~oil iq infested with D~abrotica uirgifera egg~ and the plant~
monitored for viability~ height, root ma~ and standability over the course of 4 week~. Plants expresQing patatin are significantly protected from the effect~ of D~abrotica larval damage. Alternatively, transgenic plants and populations of tran~genic plant~
expres3ing patatin are as~es~ed for Diabrotica resiqtance by the method~ detailed in "Method~ for the Study of Pest Diabrotica" ( 1986) eds., J. L. Kryqan and T. A.
Miller, Springer-Verlag, New York, pp 172-180.
Although the invention has been described in considerable detail, with reference to certain preferred embodiments thereof, it will be understood that -variations and modifications can be affected within the spirit and scope of the invention as described above and as defined in the appended claims.

.~
i 30 ,, , ;
.!
1 38,424-F -73-,1 .
.1

Claims (17)

THE EMBODIMENTS OF THE INVENTION IN WHICH AN EXCLUSIVE
PROPERTY OR PRIVILEGE IS CLAIMED ARE DEFINED AS
FOLLOWS:

1. A method of protecting a plant or a part thereof against insect infestation by comprising presenting to a loci wherein said insect(s) is to be controlled or combated with an insect controlling amount of a plant non-specific lipid acyl hydrolase.

2. The method of Claim 1, wherein the plant non-specific lipid acyl hydrolase is isolated from potato tuber and leaves, leaves of P.multiflora or P.
vulgaris, rice bran, barley endosperm, maize roots or alfalfa.

3. The method of Claim 2, wherein the plant non-specific lipid acyl hydrolase is a protein having the amino acid sequence of one of the patatin polypeptides set forth in Figure 3, or a functional derivative thereof.

4. The method of Claim 2, wherein the plant non-specific lipid acyl hydrolase is applied to a plant species other than the plant species from which the plant non-specific lipid acyl hydrolase was derived.

5. The method of Claim 1 of protecting a plant against insect infestation by corn rootworms, comprising inserting into the genome of the plant a sequence coding for a plant non-specific lipid acyl hydrolase with a promoter sequence active in the plant to cause expression of the plant non-specific lipid acyl hydrolase sequence at levels which provide an insect controlling amount of the plant non-specific lipid acyl hydrolase.

6. A method according to Claim 5 further comprising the steps of:
(a) culturing cells or tissues from the plant;
(b) introducing into the cells of the cell or tissue at least one copy of a gene coding for the plant non-specific lipid acyl hydrolase, (c) regenerating resistant whole plants from the cell or tissue culture.

7. The method according to Claim 6, which comprises the further step of sexually or clonally reproducing the whole plant in such a manner that at least one copy of the sequence coding for the plant non-specific lipid acyl hydrolase with a promoter sequences active in the plant is present in the cells of progeny of the reproduction.

8. The method according to Claim 7, further comprising the steps of:
(a) selecting a fertile, insect resistant plant prepared by the method of Claim 8;
(b) sexually crossing the insect resistant plant with a plant from the insect susceptible plants from the susceptible variety;

(c) recovering reproductive material from the progeny of the cross and (d) growing resistant plants from the reproductive material.

9. The method according to Claim 8, for imparting insect resistance to a substantially homozygous population of plants of a susceptible variety, which comprises the further steps of repetitively:
(a) backcrossing the insect resistant progeny with substantially homozygous, insect susceptible plants from the susceptible variety; and (b) selecting for expression of both insect resistance and the other characteristics of the susceptible variety among the progeny of the backcross, until the desired percentage of the characteristics of the susceptible variety are present in the progeny along with the insect resistance.

10. An agricultural composition containing a carrier and an insect controlling or combating amount of a substantially pure plant non-specific lipid acyl hydrolase as an active ingredient.

11. The agricultural composition of Claim 7, wherein the plant non-specific lipid acyl hydrolase is isolated from potato tuber and leaves, leaves of P.
mutliflora and P.vulgaris, rice bran, barley endosperm, maize roots or alfalfa.

12. The agricultural composition of Claim 7, wherein the plant non-specific lipid acyl hydrolase is a protein having the amino acid sequence of one of the patatin polypeptides set forth in Figure 3, or a functional derivative thereof.

13. A biologically functional expression vehicle containing a DNA sequence encoding a plant non-specific lipid acyl hydrolase, said vehicle being pDAB219.DELTA. and pDAB303.

14. The biologically functional expression vehicle of Claim 14, wherein the plant non-specific lipid acyl hydrolase is a protein having the amino acid sequence of one of the patatin polypeptides set forth in Figure 3, or a functional derivative thereof.

15. A transgenic maize plant and its sexual progeny resistant to attack by corn rootworms, said transgenic maize plant expressing an insect controlling amount of a plant non-specific lipid acyl hydrolase.

16. The transgenic maize plant and its sexual progeny of Claim 15, wherein the plant comprises a DNA
sequence stably incorporated into its genome, said DNA
sequence having a coding region capable of encoding a plant non-specific lipid acyl hydrolase with a promoter sequence active in the plant to regulate transcription of the plant non-specific lipid acyl hydrolase sequence at levels which provide an insect controlling amount of the plant non-specific lipid acyl hydrolase.

17. The transgenic maize plant of Claim 16, wherein the plant non-specific lipid acyl hydrolase is a protein having the amino acid sequence of one of the patatin polypeptides set forth in Figure 3, or a functional derivative thereof.