WO2007127347A2 - An isolated dna fragment of the sparc human promoter and its use - Google Patents
An isolated dna fragment of the sparc human promoter and its use Download PDFInfo
- Publication number
- WO2007127347A2 WO2007127347A2 PCT/US2007/010196 US2007010196W WO2007127347A2 WO 2007127347 A2 WO2007127347 A2 WO 2007127347A2 US 2007010196 W US2007010196 W US 2007010196W WO 2007127347 A2 WO2007127347 A2 WO 2007127347A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- sequence
- promoter
- gene
- cells
- sparc
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/4748—Tumour specific antigens; Tumour rejection antigen precursors [TRAP], e.g. MAGE
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
Definitions
- the present invention refers to the field of gene therapy.
- the present invention refers to an isolated DNA sequence having promoter activity, capable of driving the expression of a gene of interest, particularly in a tumor cell.
- the present invention refers to vectors containing a DNA fragment isolated from the SPARC promoter associated to a gene of interest, to pharmaceutical compositions and its use in cancer therapy.
- the SPARC protein secreted protein, acidic and cystein- rich protein also known as osteonectin or BM40, is a secreted glycoprotein, highly distributed in human and non- human tissue, which functions and effects . are wide and various. It has been found that it interacts with extracellular matrix components, with growth factors, with cytokines and with the expression of matrix metalloproteinases .
- the SPARC protein has been initially described by Ledda M. F. et. al . (Ledda, M. F., Adris, S., Bravo, A.I., Kairiyama, C, Bover, L-, Chernajovsky, Y., Mordoh, J., and Podhajcer, O.L., Suppression of SPARC expression by antisense RNA abrogates the tumorigenicity of human melanoma cells. Nat Med, 3: 171-176, 1997) as having a central role in the malignity of human melanoma. Subsequent studies showed that SPARC over-expression is associated to the malignant progression of various tumor types (Porte, H., Triboulet, J.
- Human SPARC promoters (Hafner, M., Zimmermann, K., Pottgiesser, J., Krieg, T., and Nischt, R. A purine-rich sequence in the human BM-40 gene promoter region is a prerequisite for maximum transcription.
- murine SPARC promoters (McVey, J. H., Nomura, S-, Kelly, P., Mason, I.J., and Hogan, B.L. Characterization of the mouse SPARC/osteonectin gene. Intron/exon organization and an unusual promoter region. J Biol Chem, 263: 11111-11116, 1988) and bovine SPARC promoters (Young, M.
- the structure of the human SPARC promoter is shown in Figure 1, wherein the first exon, the GGAl and GGA2 boxes, the 10 nucleotide Inter-CGA region separating them and the TATA non-consensus sequence are depicted.
- the human SPARC promoter lacks a TATA consensus box (Breathnach, R. et al., Organization and expression of eucaryotic split genes coding for proteins, Annu Rev Bio ⁇ hem, 50: 349-383, 1981) but contains a so-called TATA-like element that shares some bases with the conventional sequence.
- the promoter has two GCAl and GCA2 boxes, of which the GCAl box exhibits a great similarity between the human and bovine species.
- Hafner et al. observed that the GCAl box is necessary and sufficient for obtaining a maximum transcriptional activity, while the spacing element separating the two CGA boxes has a negative effect on its expression (Hafner M. et al., 1995). It is important to note that this group has demonstrated that, in humans, the promoter region containing only the CGA boxes is not sufficient by itself to confer expression specificity in different cell lines. Dominguez et . al . described the region between bases -504 to +11 of the bovine promoter as a positive element for SPARC transcription in fetal bovine cells.
- This fragment also confers specific expression, showing higher activity in cells with a higher expression level of SPARC mRNA (Dominguez, P., Ibaraki , K., Robey, P.G-, Hefferan, T. E., Termine, J.D-, and Young, M.F. Expression of the osteonectin gene potentially controlled by multiple cis- and trans-acting factors in cultured bone cells. J Bone Miner Res, 6: 1127-1136, 1991) . They also observed that only the GC box (which is a common element in many promoter regions and their consensus sequence is GGGCGG, may be present in more than one copy.
- the first generation adenovirus are defective in ElA protein, hence they do not replicate.
- the early ElA protein is the first protein that produces the viral DNA inside the cell.
- ElA has many functions such as helping other viral proteins to be produced and stimulating the cell growth by bonding Rb and releasing E2F, facilitating viral transcription and replication.
- ElA protein defective adenovirus were successfully used as vectors in cancer preclinical models, the same results were not achieved when used in clinical trials, being its low in vivo transduction capacity one of the major problems (Vile, R. Cancer gene therapy-new approaches to tumo'ur cell killing. J Gene Med, 2: 141-143, 2000) .
- CRAd Conditionally Replicative Adenovirus or Oncolytic adenovirus
- CRAds are constructed by modifying the adenoviral genome in order to regulate the expression of ElA protein with a promoter that is specifically active in the required tissue or cell type, in such a way to prevent damage to surrounding tissues.
- several research groups have devoted to the recombinant adenovirus construction. This way, some of the viral genes that had been removed in the past are being re-inserted again given that they enhance viral replication. That is the case of the E3 region.
- E3 is a viral DNA fragment encoding 9 proteins, the main function of which is the inhibition of cell death induced by the host immune response.
- ADP Addenoviral Death Protein
- E3 mates have a contradictory function when compared to their E3 mates, because it promotes the late cell lysis in the viral infection cycle to allow for the release of mature virions to the cell microenvironraent .
- Cells infected with an non-expressing ADP adenovirus have been shown to remain viable for a longer time than cells infected with the wild type adenovirus (ToIlefson, A. E. et al.
- the E3-11.6-kDa adenovirus death protein (ADP) is required for efficient cell death: characterization of cells infected with adp mutants, Virology, 220: 152-162, 1996,- Tollefson, A.E efc al.,
- the adenovirus death protein (E3-11.6K) is required at very late stages of infection for efficient cell lysis and release of adenovirus from infected cells, J Virol, 70: 2296-2306, 1996; Kruyt, F.A. et al. , A new generation of conditionally replicating adenoviruses: pairing tumor selectivity with maximal oncolysis, Hum Gene Ther, 13: 485-495, 2002.).
- HSV/TK Herpes simplex virus thymidine kinase
- HSV/TK Herpes simplex virus thymidine kinase
- acyclovir/ganciclovir commonly used antiviral for viral infections
- a guanosine analogue In its phosphorilated form, the anti-herpetic agent is incorporated to the DNA molecule, avoiding its duplication and causing cell death (Moolten, F.
- a tumor is formed by tumor cells, fibroblasts and endothelial cells. This is why an effective therapy with viral vectors requires the virus to be able to replicate in these three cell types, which are responsible of tumor progression.
- SPARC is over-expressed in all these cell types, it represents a good candidate for the construction of a CRAd, such that the SPARC promoter drives the gene of interest, such as an ElA gene and eventually another therapeutic gene. In this sense, the tumor cells would be eliminated by the replication of the virus itself or by the action of the toxic drug produced in the tumor environment .
- the present invention provides an isolated fragment, from the human SPARC gene promoter, capable of driving the expression of a gene of interest, particularly in a tumor cell. More particularly, the invention provides an isolated DNA sequence comprising the polynucleotide sequence SEQ ID NO 1 that corresponds to a region of the human SPARC promoter from base pair -513 to base pair +35 or a fragment or variant of said polynucleotide sequence that has been modified by insertion, substitution or deletion of one or more nucleotides, and which has a substantially equivalent function.
- an isolated DNA recombinant expression construct that comprises the promoter sequence of the invention operably linked to a gene of interest.
- polynucleotide sequence SEQ ID NO 1, that corresponds to a region of the human promoter of the SPARC gene according to the present invention may also be associated to any other promoter/regulating sequence, such as sequences responsive to radiation, hypoxia, free-radicals, etc.
- a viral recombinant expression vector containing the previously defined DNA promoter sequence of the invention and/or the previously defined construct of the invention, wherein the DNA promoter sequence is operably linked to a therapeutic gene of interest .
- the invention also provides a method for expressing foreign DNA in a host cell that comprises introducing in the host cell a DNA recombinant expression construct or a viral recombinant expression vector of the invention comprising the promoter DNA molecule of polynucleotide sequence SEQ ID NO 1 operably linked to a foreign DNA encoding a desired polypeptide or RNA, wherein said foreign DNA is expressed.
- the invention also provides a method for treating a tumor in a patient suffering therefrom, that comprises administering to the patient an effective amount of a pharmaceutical composition comprising a DNA recombinant expression construct or a viral recombinant expression vector, comprising the promoter sequence of the invention, capable of driving the viral replication and/or the expression of a therapeutic gene of interest, operably linked thereto.
- Figure 1 shows a structure scheme of the human SPARC promoter, HSBM40DNA (Genbank # X88259)
- Figure 2 shows a comparative assessment of the expression levels of SPARC mRNA in different tumor and normal lines.
- Figure 3 shows two schemes of the SPARC promoter region where the different fragments derive from.
- Figure 4A shows the promoter activity of Il fragments of the SPARC promoter by measuring the enzymatic activity of the Luciferase reporter gene in A375N (melanoma) , HeLa (cervix) and T-47D (breast) cell lines.
- Figure 4B compares the promoter activity of the fragments -513/+35 (F512) and -1175/+71 ⁇ 10 (Spdel) of the SPARC promoter by measuring the enzymatic activity of the Luciferase reporter gene in various normal and tumor cell lines:
- Figure 5A shows schemes of Ad-F512, Ad(I) -F512-TK and Ad(I) -F512 (E3) adenoviruses, constructed according to the present invention.
- Figure 5B shows the restriction profile of Ad-F512, Ad(I)- F512-TK and Ad( I) -F512 (E3) adenoviruses of the present invention with HindIII enzyme.
- Figure 6 shows the monolayer cytopathic effect in different tumor lines of Ad-F512, Ad (I) -F512-TK and Ad (I) -F512 (E3) adenoviruses, constructed according to the present invention, using Ad5-wt as a control.
- Figures 7A, 7B , 7C and 7D show the monolayer lytic effect (MTT assay) of Ad-F512 and Ad (I) -F512 (E3) adenoviruses of the present invention, at different MOIs 10 days after infection; A- Melanoma, SB2 cells; B- Melanoma, MeI-J cells; C- Colon cells; D- Breast cells.
- Figure 8 shows the production of Ad-F512 and Ad (I) -F512 (E3) adenoviruses of the present invention in different human tumor lines .
- Figure 9 shows the cooperative effect of the ElA gene given by Ad-F5l2 on the replication of the Ad- ⁇ -gal adenovirus.
- Figures 1OA to 1OF show the in vivo assay results.
- Figure 1OA shows the tumor growth curve for the ' assay with Ad (I) F512-TK.
- Figure 1OB shows the tumor growth curve of the animals in the first assay with Ad-F512.
- Figure 1OC shows tumors treated with " Ad- ⁇ -gal and with Ad-F512.
- Figure 1OD shows histological photographs of the regions shown in 1OC, 14 days after.
- Figure 1OE shows Kaplan-Meier curve for assay B.
- Figure 1OF shows Kaplan-Meier curve for the second assay with Ad-F512.
- Figure 11 shows the cytopathic effect in monolayer of Ad- F512, Ad(I) -F512-TK and Ad (I) -F512 (E3 ) CRAdS of the invention.
- the lytic effect staining with violet crystal) of the CRAds in cell monolayers at different concentrations after 10 days post-infection is shown.
- Figures 12A to 12E show the cytopathic effect of Ad-F512, Ad(I) -F512-TK and AD (I) -F512 (E3) CRAds of the invention, in normal cells,- Figure 12A shows CRAds photographs taken after 10 days post-infection in normal melanocytes; photographs of AD-wt and no-treatment (PBS) controls are included; Figure 12B shows the cytopathic effect on normal CCD841 colon cells ,- Figure 12C shows the cytopathic effect on normal MCF12A breast cells,- Figure 12D shows the lytic effect on microendothelial cells; Figure 12E shows the viral effect on keratino ⁇ ytes and fibroblasts (CCD1140 and Malme-3) .
- Figures 13A to 13C show the monolayer cytopathic effect of Ad(I) -F512-TK,- the lytic effect (staining with violet crystal or survival measured by MTT) of Ad (I) -F512-TK on monolayers of cells at different viral concentrations after 10 days post-infection in the presence or absence of GCV prodrug;
- Figure 13A shows the assay with SB2 melanoma cells;
- Figure 13B shows the survival of hMEC-1 cells in the presence of GCV and GCV + virus,-
- Figure 13C shows the cytopathic effect on BAEC cells.
- Figures 14A to 14D show in vivo assays with melanoma tumors;
- Figure 14A shows assays with SB2/WI-38/hMEC-l tumors treated with Ad-F512;
- Figure 14B shows assays with SB2/WI-38 tumors treated with Ad-F512;
- Figure 14C shows SB2/hMEC-l tumors treated with Ad-F512;
- the present invention provides in a main aspect, a DNA isolated sequence comprising the polynucleotide sequence SEQ ID NO 1, which corresponds to a region of the human SPARC gene promoter from base pair -513 to base pair +35 or a fragment or variant of said polynucleotide sequence, which has been modified by insertion, substitution or deletion of one or more nucleotides, and which has a substantially equivalent function .
- isolated means substantially separated or purified with respect to contaminant sequences in the cell or organism in which the nucleic acid is naturally present and includes nucleic acids purified by standard purification techniques as well as nucleic acids prepared either by recombinant technique or chemical synthesis .
- variant refers to a DNA molecule wherein the nucleotide sequence is substantially identical to the sequence established as SEQ ID NO 1.
- the variant may be achieved by means of modifications such as insertion, substitution or deletion of one or more nucleotides, provided that those modifications are neutral mutations and they do not affect the performance of the DNA molecule.
- a "fragment" of nucleic acid sequence according to the present invention is a nucleic acid sequence portion that is shorter in length than the complete sequence and comprises at least a minimum length capable of getting specifically hybridized with the nucleic acid sequence of the present invention under astringent conditions, said fragment keeping the biological conditions required in the present invention.
- the present invention also provides a recombinant expression construct effective in driving transcription of a selected codifying sequence that comprises: (a) a DNA sequence corresponding to the human SPARC promoter; and ⁇ b) a sequence codifying for a gene of interest, operably linked to the promoter in (a) in such a way that the sequence of the gene of interest may be transcripted and translated in a host cell.
- the preferred DNA sequence corresponding to the human SPARC promoter goes from base pair -513 base pair to +35 according to sequence shown in SEQ ID NO 1 of the Sequence Listing.
- heterologous gene as used herein, means a DNA sequence encoding an amino acid or protein sequence of interest, in association with another DNA sequence, such that said association is not present in nature.
- a therapeutic gene means a DNA sequence encoding an amino acid or protein sequence, capable of eliciting a therapeutic effect on the host cells.
- the host cells are tumor cells, more particularly, the tumor cells are melanoma cells, breast cells, colon cells, cervix cells.
- the gene of interest may be selected from: the ElA gene, a suicide gene such as the hsv-TK gene, the adenoviral genomic region called E3 , the gene of an interleukin such as IL-IO, IL-12 or IL-23, etc .
- the polynucleotide sequence SEQ ID NO 1 that corresponds to a region of the human SPARC gene promoter may drive genes by itself or may be associated with sequences responsive to radiation, hypoxia, free- radicals, etc. These are defined DNA sequences, which are usually located upstream of said promoter.
- One characteristic example of this kind of combinations is the use therein of the hypoxia responsive element (HRE) which has already been used for potentiating the transcriptional activity of a promoter or responsive element under low oxygen pressure conditions.
- HRE hypoxia responsive element
- hypoxia responsive elements HRE
- estrogen responsive elements EEE
- Said responsive elements have been combined with radiation responsive elements (Greco O. et al., Novel chimeric gene promoters responsive to hypoxia and ionizing radiation. Gene Ther 2002; 9: 1403-1411).
- a method for expressing foreign DNA in a host cell which comprises introducing in the host cell a DNA recombinant expression construct or a viral recombinant expression vector of the invention, comprising the promoter molecule of polynucleotide sequence SEQ ID NO 1 operably linked to a foreign DNA encoding a desired polypeptide or RNA, wherein said foreign DNA is expressed.
- DNA in the host cells may be carried out by means of any construct and includes plasmids, DNA virus, retrovirus, as well as isolated nucleotide molecules. Liposome mediated transfer may also be used.
- Adenovirus are an example of said DNA virus that may be used in the present invention. More than 40 different serotypes of human adenovirus are well known, being the Ad5 adenovirus especially preferred as a viral vector in the present invention; however, modified capsid and/or fiber Ad5 adenovirus, such as with the adenovirus 3 capsid or the fiber modification with a RGD motif, are not discarded.
- the construction of suitable vectors containing the promoter sequence and the sequence of the desired therapeutic gene may be performed by standard linking and restriction techniques, which are well known in the art. The DNA cleavages in a specific site were performed by treatment with the appropriate restriction enzymes, under conditions indicated by the manufacturer, for approximately 3-16 hs . In general, the restriction results may be verified by electrophoretic separation in agarose gels
- Marker systems are known that in general comprise a gene the expression of which confers an identifiable phenotype to the transformed cells when the cells are grown in an appropriate media.
- the ⁇ -galactosidase gene is for instance a detectable gene in clones exhibiting a blue phenotype in plaques with X-gal.
- This invention involves driving a gene of interest towards a tumor cell so that the protein encoded by the gene is expressed and said protein directly or indirectly enhances the patient state.
- a CRAd or oncolytic vector (Conditionally Replicative or Oncolytic Adenovirus) is prepared upon the basis of an adenovirus, comprising a gene of the ElA protein, under the regulation of a DNA sequence fragment of the SPARC promoter.
- the CRAds of the invention drive the expression of ElA in different types of tumor cells (melanoma, breast, colon, cervix) causing their lysis and elimination through the replication of the virus itself.
- the CRAds of the invention containing the ElA gene have attenuated lytic activity in normal cells (mesenchymal, endothelial and fibroblasts) given that its expression is driven by a promoter that expresses mainly in tumor cells.
- CRAd vectors further comprising a suicide gene such as, e.g., Herpes simplex virus thimidine kinase (hsv-TK) codifying for an enzyme capable of phosphorilating the prodrugs acyclovir/ganciclovir.
- hsv-TK Herpes simplex virus thimidine kinase
- the anti-herpetic agent is incorporated to the DNA molecule, avoiding its duplication and causing cell death.
- the CRADs prepared according to this particular embodiment drive hsv- TK expression in different tumor cell types, completing the lytic action and at the same time having an attenuated lytic activity in normal cells given that its expression is driven by a promoter that expresses mainly in tumor cells
- CRAd vectors further comprising a genome adenoviral region called E3 codifying for 9 proteins, is prepared.
- the ADP Addenoviral Death Protein
- the CRAds containing the E3 region potentiate the lytic activity of ElA, . at the same time it has an attenuated lytic activity in normal cells given that its expression is driven by a promoter that expresses mainly in tumor cells.
- constructs or vectors of the present invention may be administered to a patient in need thereof, by injection, oral or topic administration, vehiculized in a suitable carrier.
- suitable carriers may be aqueous, lipidic, liposomal, etc.
- Example 1 Evaluation of the expression of SPARC mRNA in different tumor and normal lines The levels of produced messenger RNA (mRNA) from the SPARC protein were assessed by Real-Time PCR in tumor cell lines and normal cell lines .
- mRNA messenger RNA
- the human lines HeLa (cervix cancer, ATCC No. CCL-2), T-47D (breast cancer, ATCC No. HTB-133) , WI-38 (fetal pulmonary fibroblasts, ATCC No. CCL-75) , WI-38 VA (transformed fetal pulmonary fibroblasts, ATCC No. CCL-75.1) , HFL-I (fibroblasts, ATCC No. CCL-153) , 293 (embryo kidney, ATCC No. CRL-1573), LoVo (colon cancer, ATCC No. CCL-229) , HCT- 116 (colon cancer, ATCC No. CCL-247) , CaCO2 (colon cancer, ATCC No.
- HTB-37 HTB-37
- HT-29 colon cancer, ATCC No. HTB-38
- T84 colon cancer, ATCC No. CCL-248
- aortic endothelial cells Bovine Aortic Endothelial Cells, BAEC ATCC No. CRL1395
- ATCC American Tissue Culture Collection, Rockville, MD, USA
- the human melanoma cell lines IIB-MEL-LES and IIB-MEL-J-N were previously described by Ledda et. al. , 1997; the human melanoma lines SB2, A375N and MEL-888 were kindly provided by Dr. Estela Medrano (Houston, Texas) .
- All of the cells were cultured in the recommended medium supplemented with 10% bovine fetal serum (provided by Natocor, Carlos Paz, Argentina), 2.5 U/ml de penicillin (sigma-Aldrich Corp., St. Louis, MO) and 2.5 ⁇ g/ml streptomycin (Sigma-Aldrich Corp., St. Louis, MO) and kept at 37 0 C in an atmosphere with 5% CO 2 .
- BAEC cells were supplemented with 5% BFS.
- Tri Reagent Sigma-Aldrich Co., St. Louis, MO
- 5 ⁇ g of RNA were retro-transcripted with 200U Superscript II Reverse Transcriptase (Invitrogen, Carlsbad, CA) using 500 ng Oligo(dT) primers.
- the cDNA Real-Time PCR reaction was performed in an iCycler iQ System (Bio-Rad Laboratories, Hercules, CA, USA) thermocycler .
- reaction was carried out in a 25 ⁇ l volume containing 1 Platinum ® Taq DNA polymerase (Invitrogen) unit, IX PCR Reaction Buffer (20 mM Tris-HCl, pH 8.4, and 50 mM KCl), 1.5 mM Mg 2 Cl, 2.5 ⁇ g BSA, 0.01% glycerol, 0.4 ⁇ M of each specific primer: SPARC (SRTse; AACCGAAGAGGAGGTGGTG, SEQ ID NO 2 /SRTaS; GCAAAGAAGTGGCAGGAAGA, SEQ ID NO 3) and ⁇ -actin (Acse; AGAAAATCTGGCACCACACC, SEQ ID NO 4 /Acas; CAGAGGCGTACAGGGATAGC, SEQ ID NO 5) 200 ⁇ M dNTPs and 0.3 X SYBR Green solution.
- SPARC SRTse; AACCGAAGAGGAGGTGGTG, SEQ ID NO 2 /SRTaS; GCAAAGAAGTGG
- reaction conditions were: 90 seconds at 94°C and then 30 cycles of 30 seconds at 94 0 C, 30 seconds at 60 0 C and 30 seconds at 72°C.
- Each reaction was performed in triplicate and the results obtained for SPARC were normalized with the results obtained simultaneously for ⁇ -actin.
- Example 2. Cloning of 11 fragments of the human SPARC promoter in the pGEM and TOFO plasmids .
- a sequence analysis of the human SPARC promoter performed by the present inventors revealed a DPE sequence (Downstream Promoter Elements) present between the bases +29/+33 as well as the 2 possible transcription initiation sites which had already been described, INRl and INR2 (see above cited Figure 1) .
- the DPE sequence was described in Drosophila promoters and is considered to have a role in the transcriptosome assembly in those promoters not containing TATA sequences (Kadonaga, J.T.
- the DPE a core promoter element for transcription by RNA polymerase II. Exp MoI Med, 34: 259-264, 2002) .
- FIG. 1 shows two schemes of the SPARC promoter where the different fragments are derived from. The locations of the GGA boxes, the TATA-like sequence of the possible transcription initiation sites (INR) and the DPB sequence are indicated. Different limits are indicated that were used for constructing the SPARC promoter fragments.
- the 5' end was cloned up to the bases -1175, -513 and -120,- while from the 3' end the bases were cloned up to +24, +28, +35 and +71.
- the deleted region between the GGA boxes is also indicated, this deletion gives origin to the fragment -1175/+71 ⁇ 10.
- a fragment of 1246 bp from the human SPARC promoter region was amplified by PCR (-1175 to +71 bp relative to the transcription initiation site) from genomic DNA of human lymphocytes with the Spfse and SPP3 ' 2 oligonucleotides (see Table 1) .
- This PCR product, -1175/+71 was cloned in the pGEM-T-easy vector (Promega Corp., Madison, WI) for obtaining pGEM (-1175/+71) .
- This plasmid was used as a template of the promoter variants, the fragments of which were in turn amplified by PCR using the primers as detailed in the following Table 1.
- the amplification cycle corresponds to an initial denaturalization at 94 °C for 3 minutes, followed by 35 amplification cycles: 94°C, 1 minute, annealing T (variable, depending on each product, Table 1) , 1 minute and 72 0 C 2 minutes, followed by a final extension at 72 0 C for 10 minutes.
- the PCRs were performed in the PTC-200 thermocycler (MJ Research Inc., Whaltam, MA ) .
- PCR products were firstly cloned in the pGEM-t-easy vector (Promega Corp., Madison, WI) or TOPO-pCR4 vector (Invitrogen Corp., Carlsbad, CA) thus obtaining the vectors : a- pGEM (-1175/+71) , (SEQ ID NO 17), complete promoter.
- the sequence +1/+70 includes the first exon, not translated.
- b- pGEM (-1175/+71 ⁇ 10) SEQ ID NO 18).
- This promoter is a modification of the complete SPARC promoter -1175/+71, wherein a sequence of 10 bp considered to inhibit transcription was deleted, located between the two GGA boxes (Hafner, M. et al., 1995).
- PCR-SOE splicing by overlap extension PCR
- f- TOPO (-513/+35) includes the DPE sequence g- TOPO (-513/+28) , (SEQ ID NO. 22), excludes the DPE sequence h- TOPO (-513/+24) , (SEQ ID NO 23), includes up to the
- Example 3A Selection of a fragment: of the human SPARC promoter
- the promoters obtained according to Example 2 were subcloned in the ⁇ Tlul/Bglll, Mlul/Xhol or Nhel/Xhol sites of the pGI_3-Basic plasmid (Promega Corp., Madison, WI, USA) upstream of the luciferase reporter gene.
- the pGL3 -Basic plasmid contains the modified Firefly luciferase reporter gene (luc+) for preventing the binding of genie regulatory factors, removing the restriction sites, preventing the protein transport to peroxisomes and it contains a Kozak sequence in the 5' end of the luciferase gene for optimizing the translation efficiency.
- luc+ modified Firefly luciferase reporter gene
- the presence of the luciferase reporter gene allowed for the quantification of SPARC promoter activity in the 11 fragments obtained in Example 2, by measuring the luciferase enzymatic activity.
- the assay was performed in three cell lines, using the (melanoma) A375N line as a model since it expresses high SPARC levels and the (cervix) HeLa and (breast) T-47D lines, not expressing SPARC, according to the teachings of Example 1 above.
- the cells were seeded in 24-well plates with a density of 4 x 10 4 cells/well . After 24 hours they were transfected using Lipofectamine2000 (Invitrogen Corp. , Carlsbad, CA) according to the conditions indicated by the manufacturer. Each treatment was carried out at least in duplicate for each cell line, incubating 0.8 ⁇ g of treatment plasmid with 0.1 ⁇ g of pRL-CMV plasmid for 5 minutes with 50 ⁇ l DMEM medium without antibiotic and simultaneously, 1 ⁇ l Lipofectamine2000 with 50 ⁇ l of the same medium. These two preparations were mixed and incubated for 20 minutes at room temperature.
- Lipofectamine2000 Invitrogen Corp. , Carlsbad, CA
- the medium with cell serum was removed, washed with PBS and 200 ⁇ l high glucose DMEM was added without serum and without antibiotics; subsequently, 100 ⁇ l medium containing the lipofection mixture was added and 800 ⁇ l of culture medium corresponding to each cell line, supplemented with BFS, was added 4 hours later.
- the cells used were kept in a stove for 46 hours at 37 0 C with 5% CO 2 .
- the Dual Luciferase Reporter Assay System kit (Promega Corp., Madison, WI) was used for the luciferase assay.
- This system implies the simultaneous expression of two individual reporter enzymes in the same system, allowing for the evaluation of the activity produced by the luciferase enzymes from the Firefly glow-worm (Photinus pyralis) and the Renilla coelenterate (Renilla reniformis) in only one sequential assay (Sherf, B.A. et al., Dual Luciferase Reporter Assay: An Advanced Co- Reporter Technology Integrating Firefly and Renilla Luciferase Assays. Promega Notes Magazine; 2-9, 1996) . The data were normalized in the following way:
- the data are expressed as induction amount relative to the activity obtained with the pGL3-Basic control plasmid (without promoter) .
- the results are shown in Figure 4A.
- the pGl3-promoter plasmid (pGL3-prom, Promega Corp., Madison, WI) wherein the viral promoter from SV40 drives the expression of the luciferase enzyme, was used as a transfection control.
- the lower promoter activity in melanoma lines was observed with the complete SPARC promoter (-1175/+71) .
- the higher unspecificity was observed with the fragment -120/+71 and the fragment showing the higher specificity and higher activity in the line expressing SPARC turned out to be the fragment -513/+35 ( Figure 4A) .
- the promoter -513/+35, from now onwards F512, was selected through this analysis in order to continue with its characterization in comparison to the promoter -1175/+71 ⁇ 10, called Spdel given that it had the same activity than F512, in the A375N melanoma line .
- Example 3B Selection of a fragment from the human SPARC promoter
- the results are shown in Figure 4B.
- the F512 promoter turned out to be active in the melanoma lines and in the endothelium BAEC line having the higher SPARC expression.
- the SB2 line has the lower promoter activity, approximately 1/3 of the activity observed in A375N, this result being coincident with the SPARC mRNA expression ratio ( Figures 2 and 4B) .
- the activity in two melanoma lines, Mel888 and MeIJ is 3.5- to 4-fold higher than for A375N.
- F512 presents lower activity in those lines with little or null SPARC expression such as colon (T84, LoVo) , glioma (U87) or cervix (HeLa) ( Figure 4B) .
- this activity is not negligible but, quite on the contrary, in a few cases like T84, it reaches half the activity observed for the melanoma lines .
- the promoter is also active in the fibroblast line used (WI-38 VA) .
- Example 4 Construction of a shuttle plasmid containing F512 upstream of ElA gene.
- a shuttle plasmid containing the genes of interest was carried out starting from pADPSY shuttle vector, containing the human adenovirus type 5 whose genes in regions El (necessary for its replication) and E3 , had been deleted. Then, Rous sarcoma virus (RSV) promoter and the polyadenilation signal of SV40 (Mariano J. Alvarez, Federico Prada, Edgardo Salvatierra, Alicia I. Bravo, Viviana P. Lutzky, Cecilia Carbone, Fernando J. Pitossi, H. Eduardo Chuluyan and Osvaldo L.
- RSV Rous sarcoma virus
- MCS multiple cloning site
- the adenovirus type 5 ElA enhancer contains two functionally distinct domains: one is specific for ElA and the other modulates all early units in cis . Cell, 45: 229-236, 1986.).
- This problem can be partially avoided by the use of insulators, i.e. sequences that isolate the promoter activity and allow it to develop its specificity (Steinwaerder, D. S. et al . , 2000; Martin-_Duque, P., Jezzard, S., Kaftansis, L., and Vassaux, G. Direct comparison of the insulating properties of two genetic elements in an adenoviral vector containing two different expression cassettes. Hum Gene Ther, 15: 995- 1002, 2004.).
- an insulator sequence (the stop signal of the bovine growth hormone) (Martin-Duque, P. et al . , 2004)) yielding new PAd(I)-Xp shuttle vector (SEQ. ID. NO 33).
- the insulator sequence was amplified by PCR using the INSU-F-Spel (CCACTAGTGCTAGAGCTCGCTGATCAGC; SEQ. ID. NO 34) and INSU-R- Kpnl (CGGTACCATCCCCAGCATGCCTGC; SEQ. ID. NO 35) primers.
- the cDNA of ElA protein was cloned by PCR starting from the genomic DNA of 293 human embryo kidney cells (ATCC No. CRL-1573) that constitutively express it. A fragment corresponding to 560-1632 nucleotides of the virus genome was amplified by PCR. This fragment was cloned in TOPO- pCR4 (SEQ ID NO 36 and SEQ ID NO 37) vector and sequenced in order to verify the identity of the sequence. The constructs were subcloned in pcDNA3 expression vector and expressed in HeLa cells. A Western Blot of proteins from the complete lysate was carried out and they could be identified with anti-ElA antibody (BD Pharmigen, #554155) .
- ElA protein gene was cloned in pAd(I)-Xp and pAd-Xp vectors.
- the ElA protein cDNA was extracted from TOPO-pCR4-ElA vector (SEQ IND NO 36) with BglII and BamHl enzymes and was inserted in BgIII site of pAd(I)-Xp and pAd-Xp yielding pAd(I) -Xp-ElA (SEQ. ID. NO 38) and pAd-Xp-ElA (SEQ. ID. NO 39) .
- F512 was extracted from pGL3 (-513/+35) with MIuI and BglII and it was cloned in WIuI and BglII sites of pAd(I)- Xp-ElA and pAdrXp-ElA, leaving the ElA protein cDNA downstream of F512.
- pAd(I)-F512 SEQ. ID. NO 40
- ⁇ Ad-F512 SEQ. ID. NO 41
- Example 5 Construction of a shuttle plasinid containing F512 upstream of hsv-TK suicide gene.
- cDNA coding for hsv-TK was amplified by PCR using as template the DNA of pAGO plasmid (Berenstein, M., Adris, S., Ledda, F., Wolftnann, C, Medina, J., Bravo, A., Mordoh, J-, Chernajovsky, Y., and Podhajcer, O. L.
- pAGO plasmid Bosetnann
- C Medina
- J. Bravo
- A. Mordoh, J-, Chernajovsky, Y., and Podhajcer, O. L.
- the cDNA of hsv-TK enzyme was extracted from TK-TOPO-pCR4 plastnid (SEQ ID NO 45) by enzymatic digestion with Ncol and Sail.
- This Ncol-TK-Sail fragment was cloned in pCITE vector (Invitrogen, Carlsbad, CA) downstream of a internal ribosomal entry site (IRES) allowing for a greater translation efficiency without capping.
- the resulting pCITE-TK vector was confirmed by digestion with restriction enzymes.
- the IRES-TK fragment of the pCITE-TK vector was extracted by digesting with EcoRI and Sail enzymes .
- EccRI site was filled with Klenow enzyme and the IRES-TK-SaII fragment was sub ⁇ loned in pAd(I)-F512 vector obtained in Example 4, previously digested with EcoRV and Sail enzymes.
- the obtaining of the resulting vector from said cloning, pAd(I) -F512-TK was confirmed by digestion with restriction enzymes and sequenciation with pAd-sense (TGTTTTTCTCAGGTGTTTTCCG; SEQ. ID. NO 42) and pAd-antisense (CACAAATTTCACAAATAAAGCATTT; SEQ. ID. N° 48) primers.
- Example 6 Construction of a shuttle plasmid containing F512 upstream of the gene coding for EGFP green protein.
- the EGFP protein cDNA linked to an IRES sequence at its 5' end was extracted from pDC315-iGFP plasmid (modified plasmid from pDC315 commercial plasmid from Microbix Biosystems Inc., Toronto, Ontario, Canada) by digestion with EcoRI and Sail enzymes.
- the EcoRI site was filled with Klenow enzyme and the IRES-EGFP- Sail fragment was subcloned in the pAd(I)-F512 vector obtained according to what is disclosed in Example 4, previously digested with EcoRV and Sail enzymes.
- pAd(I) -F512-EGFP (SEQ ID NO 49 and SEQ ID NO 50) was confirmed by digestion with restriction enzymes and sequenciation with pAd-sense (TGTTTTTCTCAGGTGTTTTCCG; SEQ ID NO 42) and pAd-antisense (CACAAATTTCACAAATAAAGCATTT; SBQ ID NO 48) primers.
- Example 7 Obtaining of Ad-F512 recombinant: virus.
- Ad-F512 recombinant adenovirus was cloned and a stock purification was made by means of a cesium chloride double gradient (Lieber, A., He, C. Y., Kirillova, I . , and Kay, M. A. Recombinant adenoviruses with large deletions generated by Cre-mediated .excision exhibit different biological properties compared with first-generation vectors in vitro and in vivo. J Virol, 70: . 8944-8960, 1996).
- the adenovirus preparation was titrated by means of DICT50 ⁇ Lieber, A. et al . , 1996) in 293 cells obtaining 10 12 vp/tnl for Ad-F512.
- Ad5 -wt was included, as a positive replication control in the assay, obtaining a preparation therefrom the title of which was 6, 8 x 10 lx vp/ml.
- a viral DNA preparation was made, which was used to be digested with restriction enzymes and to be sequenciated using pAd-sense (TGTTTTTCTCAGGTGTTTTCCG; SEQ ID NO 42) and pAd-antisense (CACAAATTTCACAAATAAAGCATTT; SEQ ID NO 48) internal primers, (See Figure 5B) .
- the pAd(I)- F512-TK (SEQ ID NO 46 and SEQ ID NO 47) plasmid obtained in Example 5 was linearized with Fsp ⁇ enzyme and cotransfected together with a Ad5 fragment, previously restricted with CIaI enzyme, including from mu 2,6 to ⁇ vu 100, with deletion in region E3.
- Cotransfection was carried on in 293 cells by means of the calcium phosphate method (Ferrari, CC. et al . ; 2004) and according to Nevins ' protocol in 293 cells (Nevins, J.R. ; 1980).
- the Ad(I) -F512-TK (SEQ ID NO 53 and SEQ ID NO 54) recombinant adenovirus was obtained.
- a scheme thereof is shown in Figure 5A.
- the Ad(I) -F512-TK adenovirus was cloned and a stock purification was made by. means of a cesium chloride double gradient (Lieber, A. et al.; 1996) .
- the adenovirus preparation was titrated by means of DICT50 (Lieber, A. et al . , 1996) in 293 cells yielding a titer of 10 12 vp/ml.
- Ad5-wt was included as a positive replication control in the assay, obtaining a preparation therefrom the title of which was 6,8 x 10 11 vp/ml.
- a viral DNA preparation was made, which was used to be digested with restriction enzymes and to be sequenciated using pAd-sense (TGTTTTTCTCAGGTGTTTTCCG; SEQ ID NO 42) and pAd-antisense (CACAAATTTCACAAATAAAGCATTT,- SEQ ID NO 48) internal primers, (See Figure 5B).
- Example 9 Obtaining of the Ad (I) -F512 ⁇ E3) recombinant virus .
- the cotransfection was carried out in 293 cells by means of calcium phosphate method (Ferrari, CC. et al.; 2004) and according to the Nevins' protocol in 293 cells (Nevins, J.R. ; 1980) .
- the Ad (I) -F512 (E3) (SEQ ID NO 55 and SEQ ID NO 56) recombinant adenovirus was obtained, the scheme of which is shown in Figure 5A, and that contains the E3 region of the original virus (Ad5) .
- the recombinant adenovirus containing the E3 region was cloned and the stock was purified by means of a double cesium chloride gradient (Lieber, A. et al . , 1996) .
- the adenovirus preparation was titrated by means of DICT50 (Lieber, A. et al .
- AdS-wt was included, obtaining a preparation therefrom the title of which was 6,8 x 10 11 vp/ml.
- a viral DNA preparation was carried out, which was used to be digested with restriction enzymes and to be sequenciated using pAd-sense (TGTTTTTCTCAGGTGTTTTCCG; SEQ ID NO 42) and pAd-antisense (CACAAATTTCACAAATAAAGCATTT; SEQ ID NO 48) , internal primers (see Figure 5B) .
- Example 10 Xn v ⁇ txo assays with Ad-F512, Ad(I) -F512-TK and Ad(I) -F512 (E3) adenoviruses for the determination of cell infectivity.
- Example 7 For in 4 vitro assays the adenoviruses obtained in Examples 7, 8 and 9 were used. The cell lines used have already been disclosed in Example 1.
- the viruses used in the present invention are based on • Ad5, the entrance via of which is through CAR receptor. (coxsackie-adenovirus receptor) and integrins (Kanerva, A. and Hemminki, A. Adenoviruses for treatment of cancer. Ann Med, 37: 33-43, 2005) .
- CAR receptor coxsackie-adenovirus receptor
- integrins Kerva, A. and Hemminki, A. Adenoviruses for treatment of cancer. Ann Med, 37: 33-43, 2005
- CAR expression is heterogeneous
- translation assays were made in different cell lines with a non-replicative adenovirus expressing ⁇ - galactosidase enzyme (Ad- ⁇ -gal) .
- Ad- ⁇ -gal non-replicative adenovirus expressing ⁇ - galactosidase enzyme
- the different tumor and normal lines were infected at different multiplicities of infection (MOI) with Ad- ⁇
- Example 11 In v ⁇ txro assays with Ad-F512 , Ad(I) -F512-TK and Ad(I) -F512 (E3) adenovirus for the assessment of oncolytic capability.
- CRAds adenovirus
- the different tumor lines were infected with Ad- F512 (SEQ ID NO 51 and SEQ ID NO 52), Ad (I) -F512 -TK (SEQ ID NO 53 and SEQ ID NO 54), Ad- (I) F512 (E3) (SEQ ID NO 55 and SEQ ID NO 56) and Ad5-wt adenoviruses.
- Ad- F512 SEQ ID NO 51 and SEQ ID NO 52
- Ad (I) -F512 -TK SEQ ID NO 53 and SEQ ID NO 54
- Ad- (I) F512 (E3) SEQ ID NO 55 and SEQ ID NO 56
- Ad5-wt adenoviruses Ad5-wt adenoviruses.
- the adenoviruses lytic effect was assessed by staining with violet crystal the cells that remained attached to the plate after the experiment and through the quantification of the metabolic activity by means of the MTT assay.
- the lytic effect of adenoviruses was assessed by staining with violet crystal ;
- the monolayer infection proceeding for the study of the cytopathic effect is as follows: the cells were seeded in 24-well plates at a density of 1 x 10 4 cells/well. The following day they were infected in 200 ⁇ l of high glucose DMEM 2% BFS during 3 hours at different multiplicities of infection (MOIs) . After the infection 800 ⁇ l of the corresponding medium for each cell line were added. Ten days later the cells were stained with -violet crystal (solution 0.75% in 40% methanol) or stained with ⁇ - galactosidase, and in this last case two or more fields were counted in order to register the infection percentage .
- Figure 6 shows a photograph of the assay of staining with violet crystal in plate, for the different cell lines employed.
- the lytic effect of the adenoviruses was assessed through quantification of metabolic activity by means of MTT assay:
- the MTT assay (cell viability) is based on the cleavage of the yellow tetrazolium salt in a purple compound (formazan) . This reaction only takes place in metabolically active cells having succinate-tetrazolium reductase enzyme present in the mitochondria respiratory chain.
- the lytic effect measured as a function of metabolic activity (MTT assay) is shown in Figure 7. In this assay 96 -well plates were seeded at a density of 5 x 10 3 cells/well and the following day they were infected during 2 hours in 25 ⁇ l (high glucose DMEM 2%) .
- the viability assays with MTT are shown in Figure 7. Generally, a lytic activity is noted for the various cell types similar to the one shown through violet crystal; but in this case a greater viability was noted for each MOI than those of the corresponding staining with violet crystal.
- three lines of breast cancer (578T, MCF7 and T-47D) were included, all of them with very low SPARC expression, and in the case of T-47D with low F512 activity.
- two lines (MCF7 and T- 47D) turned out to be susceptible to the CRAds at a MOI of 100. Surprisingly, all of the tumor cells were lysed by the CRAds.
- the lytic activity of the CRAds in the tumor cells turned out to be independent of the SPARC mARN expression degree or of the promoter activity in the cell line.
- all of the viruses resulted more effective in SB2 than in MeU or A375N. This result is coincident with the cell infectivity but not with the promoter activity or with the SPARC expression.
- the comparison between the different viruses was made mainly within the same cell line.
- SB2 is lysed more effectively with Ad (I) -F512 (E3) > Ad-F512 - Ad(I) -F512-TK ⁇ GCV, while in MeIJ (wherein the promoter showed a much higher activity) Ad (I) -F512 (E3) - Ad-F512 > Ad(I) -F512-TK ⁇ GCV.
- Ad-F512 was capable of lysing the WI-38 fibroblasts (which express SPARC protein in a moderate way) , at a MOI of 500, while the two viruses having an insulator sequence between the virus ITR and the promoter, turned out to be lytic at a MOI of 1000.
- GCV slightly increases the lytic capability of Ad(I) -F512-TK.
- Ad-F512 virus Two additional fibroblast lines -WI-38VA " and HFL-I- analyzed with Ad-F512 virus were poorly lysed at a MOI of 1000. In the three fibroblast lines, Ad5-wt was capable of lysing at a MOI of 1. The endothelial cells were not susceptible to Ad-F512, independently of their high SPARC expression. Primary mesenchymal cells derived from the marrow bone were not affected by Ad-F512 but by Ad5-wt, at a MOI of 100.
- F512 within three adenovectors turns out to be lytic in the most part of tumor lines, while it does not affect normal cells like mesenchymal and endothelial cells and some fibroblasts.
- Example 12 Virus yield in different cell lines
- the adenovirus yield in the different lines is expressed as viral particles per ml (vp/ml) , and each bar represents the average of at least two independent assays .
- the adenovirus yield is independent of the SPARC mRNA expression.
- all of the lines show greater Ad(I) -F512 (E3 ) replication than that of Ad-F512 virus.
- the Ad5-wt adenovirus yield differs among the different lines in a ratio of up to 10 5 (e.g., comparing 578T to LoVo), what in part can be due to the low infectivity of some lines.
- the lines producing greater amounts of CRAds are those having greater susceptibility to CRAds (colon lines) .
- Example 13 Study on the cooperative effect between non- replxcative viruses and replicative viruses
- a non-replicative adenovirus requires the provision of the ElA protein in trans, so as to initiate replication.
- an non-replicative adenovirus is amplified, they are used 293 cells that have been modified in order to constitutively express the ElA protein, but this protein can also be provided by a replicative adenovirus.
- Ad- ⁇ -gal non-replicative adenovirus
- T84 colon cells were infected with a constant amount of Ad- ⁇ -gal (MOI 10) and increasing amounts of Ad-F512.
- Ad- F512 is capable of complementing the non-replicative adenovirus, allowing its replication and distribution through neighbour cells, since as the Ad-F512 increases, an increase in the blue-stained cells is observed, denoting a local increase in Ad- ⁇ -gal virus.
- Figure 9 shows the staining of ⁇ gal for the different assayed MOIs in T84 colon cells.
- Example 14 In vivo assays using Ad-F512 and Ad(I) -F512- TK CRAds
- the animals were subcutaneously injected with an inoculum of 4 x 10 s SB2 melanoma cells.
- tumors reached a mean volume of 100 mm 3 (about 20 days after injection)
- the intratumoral injection of adenovirus started at 10 10 vp/30 ⁇ l per dose.
- Each animal received three doses on days 0, 2 and 8 counting from the beginning of the treatment.
- the treatment with adenovirus was alternated with the injection of ganciclovir prodrug (GCV, Cytovene , Rotang) , according to what is shown in Figure 1OA, wherein the arrows indicate CRAd injections as well as the treatment with GCV.
- GCV ganciclovir prodrug
- the control group received injections of an non- replicative adenovirus (Ad- ⁇ -gal) , also expressing a non- therapeutic gene, instead of one of the two CRAds used in the present assay.
- Ad- ⁇ -gal non- replicative adenovirus
- Figure 1OA shows the tumor growth curves in the assay using Ad-F512-TK. CRAd, wherein the administered CRAd injections and the ganciclovir administration are also indicated.
- Figure 1OB shows the curves of tumor growth in the mice used in the assay with Ad-F512.
- Figure 1OC is a photograph of the tumoral zone in a control mouse (injected with Ad- ⁇ -gal) and in one treated with Ad-F512 CRAd.
- Figure 1OD shows photographs of histological cuts made on some animals after 14 days from the beginning of the treatment.
- Figures 1OE and 1OF are Kaplan- Meier curves (survival %) for both assays realized with Ad-F512.
- Example 15 In vitro assays using Ad-P512, Ad(I) -F512-TK and Ad(I)-F512(E3) CRAds
- Example 11 the previous analysis carried out as described in Example 11 was extended by testing other tumor lines of melanoma, colon, breast and pancreas cancers.
- the cytopathic effect of viruses on the cells was analyzed by staining with violet crystal the cells that remained attached to the well after 10 days post-infection with the adenovirus.
- the results are shown in Figure 11.
- the Mel888 melanoma cells (kindly provided by Dr. Estela Medrano, Houston, TX) were lysed by the adenoviruses at same viral concentrations than for the assays with SB2 and IIB-Mel-J cells (the former kindly provided by Dr.
- CRL- 1420 is sensitive to a 5 x 10 7 vp/ml adenovirus concentration, while the four analyzed 578T breast lines (ATCC No. HTB-126) , T-47D (ATCC No. HTB-133), MCF-7 (ATCC No. HTB-22) and MDA-231 (ATCC No. HTB-26) are not affected by CRAds, (see Figure 11) .
- the wild type virus (AD5-wt) is capable of eliminating all tumor cells.
- an oncolytic adenovirus in a clinical assay is that it should be active in tumor cells and inactive in normal cells.
- their activity was analyzed in a panel of said cells. Normal melanocyte, colon and breast cell lines were included as well as fibroblasts, keratinocytes and human mi ⁇ roendothelial cells.
- Ad(I) -F512-TK or Ad (I) -F512 (E3) the viability of melanocytes was greater than 95% while 100% of cells were lysed by the Ad-wt (see Figure 12A) . It was shown (see Figure 12B) that the oncolytic viruses also had no effect on normal CCD841 colon cells (ATCC No. CRL-1790) and normal MCF-12A breast cells (ATCC No. CRL-10782) (see Figure 12C) . These lines have no SPARC expression (see Table 3 below) .
- b.MEC-1 human microendothelial cells were also analyzed (kindly provided by renowned Fidler, Houston, TX) with SPARC expression and it was noted that they are lysed by the adenoviruses at a high MOI (see Figure 12D) . Subsequently other cell components present in the skin, like keratinocytes or fibroblasts were analyzed. The former do not produce SPARC while the latter have an intermediate SPARC expression when compared to A375N tumor cell line (see Table 3 below) .
- the viral effect on keratinocytes HaCaT, kindly provided by Craveri Laboratory
- CCD1140 fibroblast cells ATCC No. CRL- 2714
- Malme-3 ATCC No. HTB-102
- CRAds do not lyse normal cells which do not express SPARC (colon, breast, melanocytes, keratinocytes,), lysing, instead, hMEC-1 microendothelial cells which do express SPARC.
- Table 3 Relative SPARC expression of the cell lines used in the study. The average SPARC mRNA expression is shown in relation to the A375N tumoral line expression. SD: Standard deviation.
- Example 16 In vivo assays using Ad-F512 and Ad(I) -F512- TK CRAds
- In vivo assays were carried out in animals (6-8 week-old athymic male mice N:NIH(S) -nu) , that were injected with mixed melanoma tumors comprising tumoral and stromal cells. Subsequently, these tumors were treated with the CRAds obtained according to the present invention, using the same protocol than that for tumors of only melanoma cells.
- Figure 14A shows the results of an assay in which animals carried SB2/hMEC-l/WI-38 mixed tumors and were treated with Ad-F512. It was noted that treatment with the adenovirus produces a relevant delay in growth tumor, even when the malignant cells were co-injected with endothelial cells (hMEC-l) and fibroblasts (WI-38) , showing that this virus can be effective, in a similar situation occurring in a tumor.
- hMEC-l endothelial cells
- WI-38 fibroblasts
- Mia- PaCa-2 (ATCC No. CRL-1420) (malignant, pancreas) /hMEC-1 mixed tumors were treated with Ad-F512 and Ad(I) -F512- TK+GCV, showing, surprisingly, that these tumors are completely eliminated (Figure 15C) .
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Immunology (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Molecular Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Toxicology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Biophysics (AREA)
- Gastroenterology & Hepatology (AREA)
- Genetics & Genomics (AREA)
- Biochemistry (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| NZ572350A NZ572350A (en) | 2006-04-28 | 2007-04-26 | An isolated dna fragment of the sparc human promoter and its use |
| EP07776311A EP2048954B1 (en) | 2006-04-28 | 2007-04-26 | An isolated dna fragment of the sparc human promoter and its use |
| AU2007243252A AU2007243252B2 (en) | 2006-04-28 | 2007-04-26 | An isolated DNA fragment of the SPARC human promoter and its use |
| AT07776311T ATE550943T1 (de) | 2006-04-28 | 2007-04-26 | Isoliertes dna-fragment des menschlichen sparc- promoters und seine verwendung |
| ES07776311T ES2384736T3 (es) | 2006-04-28 | 2007-04-26 | Un fragmento aislado de ADN del promotor humano de SPARC y su uso |
| US12/298,743 US8436160B2 (en) | 2006-04-28 | 2007-04-26 | Isolated DNA fragment of the SPARC human promoter and its use for driving the expression of an heterologous gene in tumor cells |
| JP2009507816A JP5215290B2 (ja) | 2006-04-28 | 2007-04-26 | Sparcヒトプロモーターの単離されたdna断片及び腫瘍細胞において異種の遺伝子の発現を駆動するためのその使用 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ARP060101724 | 2006-04-28 | ||
| ARP060101724A AR053246A1 (es) | 2006-04-28 | 2006-04-28 | Un fragmento aislado de adn del promotor humano de sparc y su uso para dirigir la expresion de un gen heterologo en celulas tumorales |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007127347A2 true WO2007127347A2 (en) | 2007-11-08 |
| WO2007127347A3 WO2007127347A3 (en) | 2008-01-03 |
Family
ID=38006653
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2007/010196 Ceased WO2007127347A2 (en) | 2006-04-28 | 2007-04-26 | An isolated dna fragment of the sparc human promoter and its use |
Country Status (9)
| Country | Link |
|---|---|
| US (1) | US8436160B2 (https=) |
| EP (1) | EP2048954B1 (https=) |
| JP (1) | JP5215290B2 (https=) |
| AR (1) | AR053246A1 (https=) |
| AT (1) | ATE550943T1 (https=) |
| AU (1) | AU2007243252B2 (https=) |
| ES (1) | ES2384736T3 (https=) |
| NZ (1) | NZ572350A (https=) |
| WO (1) | WO2007127347A2 (https=) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130084263A1 (en) * | 2011-05-25 | 2013-04-04 | Osvaldo Podhajcer | Pharmaceutical kit and method for treating cancer |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| ES2304281B1 (es) * | 2006-02-01 | 2009-08-12 | Dnatrix Inc. | Adenovirus oncoliticos para el tratamiento del cancer. |
| EP3927833A4 (en) * | 2019-02-21 | 2022-11-30 | Unleash Immuno Oncolytics, Inc. | ONCOLYTIC ADENOVIRAL VECTOR AND METHODS OF USE |
| MX2023000005A (es) | 2020-06-26 | 2023-03-06 | Sorrento Therapeutics Inc | Virus del herpes simple (vhs) oncolíticos que expresan proteínas de fusión inmunomoduladoras. |
Family Cites Families (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5772993A (en) * | 1997-01-21 | 1998-06-30 | The University Of Virginia Patent Foundation | Osteocalcin promoter-based toxic gene therapy for the treatment of calcified tumors and tissues |
| WO2000072679A1 (en) | 1999-05-28 | 2000-12-07 | University Of Virginia Patent Foundation | Osteonectin based toxic gene therapy for the treatment of calcified tumors and tissues |
| US7563748B2 (en) | 2003-06-23 | 2009-07-21 | Cognis Ip Management Gmbh | Alcohol alkoxylate carriers for pesticide active ingredients |
| JP2007524393A (ja) * | 2003-06-24 | 2007-08-30 | ザ ジョンズ ホプキンス ユニバーシティ | 癌を検出するためのメチル化遺伝子バイオマーカー |
| KR101280096B1 (ko) | 2005-06-29 | 2013-06-28 | 컴퓨메딕스 리미티드 | 전도성 브리지를 포함하는 센서 어셈블리 |
-
2006
- 2006-04-28 AR ARP060101724A patent/AR053246A1/es active IP Right Grant
-
2007
- 2007-04-26 AU AU2007243252A patent/AU2007243252B2/en not_active Ceased
- 2007-04-26 ES ES07776311T patent/ES2384736T3/es active Active
- 2007-04-26 EP EP07776311A patent/EP2048954B1/en not_active Not-in-force
- 2007-04-26 US US12/298,743 patent/US8436160B2/en active Active - Reinstated
- 2007-04-26 AT AT07776311T patent/ATE550943T1/de active
- 2007-04-26 NZ NZ572350A patent/NZ572350A/en not_active IP Right Cessation
- 2007-04-26 WO PCT/US2007/010196 patent/WO2007127347A2/en not_active Ceased
- 2007-04-26 JP JP2009507816A patent/JP5215290B2/ja not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| See references of EP2048954A4 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20130084263A1 (en) * | 2011-05-25 | 2013-04-04 | Osvaldo Podhajcer | Pharmaceutical kit and method for treating cancer |
| US9056133B2 (en) * | 2011-05-25 | 2015-06-16 | Cti-S.A. | Pharmaceutical kit and method for treating cancer |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2007243252B2 (en) | 2013-06-20 |
| JP5215290B2 (ja) | 2013-06-19 |
| ES2384736T3 (es) | 2012-07-11 |
| NZ572350A (en) | 2011-12-22 |
| ATE550943T1 (de) | 2012-04-15 |
| US8436160B2 (en) | 2013-05-07 |
| AR053246A1 (es) | 2007-04-25 |
| EP2048954B1 (en) | 2012-03-28 |
| US20090312401A1 (en) | 2009-12-17 |
| EP2048954A2 (en) | 2009-04-22 |
| AU2007243252A1 (en) | 2007-11-08 |
| WO2007127347A3 (en) | 2008-01-03 |
| EP2048954A4 (en) | 2009-12-02 |
| JP2009535031A (ja) | 2009-10-01 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP6375273B2 (ja) | 腫瘍選択的e1aおよびe1b変異体 | |
| US5998205A (en) | Vectors for tissue-specific replication | |
| JP2017212995A (ja) | タンパク質を条件的に発現するベクター | |
| AU4504396A (en) | Vectors for tissue-specific replication | |
| WO1996017053A9 (en) | Vectors for tissue-specific replication | |
| US20220195463A1 (en) | Replicative oncolytic adenovirus for regulating lipid metabolism and use thereof | |
| JPWO2002010368A1 (ja) | 腫瘍特異的プロモーター | |
| AU2007243252B2 (en) | An isolated DNA fragment of the SPARC human promoter and its use | |
| US7491525B2 (en) | Specific proliferation in tumour cell which can express antioncogene with high efficiency and the use of it | |
| EP1601772B1 (en) | Modified tert promoter with enhanced tumor-specificity and strength and recombinant vector comprising the same | |
| Li et al. | Enhancement of antiangiogenic effects of human canstatin with a hypoxia-regulated transgene vector in lung cancer model | |
| US8034589B2 (en) | Method of preparing a proliferation-regulated recombinant adenoviral vector efficiently and kit for preparing the same | |
| US20050074430A1 (en) | Viruses targeted to hypoxic cells and tissues | |
| KR100969171B1 (ko) | 종양 특이적 발현이 개선된 유전자전달체 | |
| US8188252B2 (en) | Rad51 derived cancer cell specific promoters for targeted anti-cancer therapy | |
| JP6913930B2 (ja) | 扁平上皮癌に対する抗腫瘍剤 | |
| CN115651932A (zh) | 一种靶向消化道肿瘤双靶向溶瘤腺病毒的构建方法及其应用 | |
| JP5494916B2 (ja) | 腫瘍特異的プロモーターおよびその用途 | |
| JP2000143548A (ja) | レトロウイルスの感染性を増大させるための方法および組成物 | |
| Lee | hTERT or AFP promoter specific expression of HSV-tk induces apoptosis in tumor cells | |
| KR20020063452A (ko) | 임포틴 α유전자 및/또는 재조합 p53 유전자를포함하는 항암제 | |
| WO2004016652A2 (en) | Mammaglobin promoter |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07776311 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2009507816 Country of ref document: JP Ref document number: 2007243252 Country of ref document: AU Ref document number: 572350 Country of ref document: NZ |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007243252 Country of ref document: AU Date of ref document: 20070426 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007776311 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12298743 Country of ref document: US |