WO2007120362A2 - Adipogenic adenoviruses as a biomarker for disease - Google Patents
Adipogenic adenoviruses as a biomarker for disease Download PDFInfo
- Publication number
- WO2007120362A2 WO2007120362A2 PCT/US2006/062632 US2006062632W WO2007120362A2 WO 2007120362 A2 WO2007120362 A2 WO 2007120362A2 US 2006062632 W US2006062632 W US 2006062632W WO 2007120362 A2 WO2007120362 A2 WO 2007120362A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- adenovirus
- adipogenic
- cancer
- subject
- sample
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/235—Adenoviridae
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
- A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K39/12—Viral antigens
- A61K39/23—Parvoviridae, e.g. feline panleukopenia virus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P3/00—Drugs for disorders of the metabolism
- A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
- A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/20—Antivirals for DNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/04—Immunostimulants
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/38—Drugs for disorders of the endocrine system of the suprarenal hormones
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P5/00—Drugs for disorders of the endocrine system
- A61P5/48—Drugs for disorders of the endocrine system of the pancreatic hormones
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/005—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from viruses
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N7/00—Viruses; Bacteriophages; Compositions thereof; Preparation or purification thereof
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/70—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving virus or bacteriophage
- C12Q1/701—Specific hybridization probes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/575—Immunoassay; Biospecific binding assay; Materials therefor for cancer
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10022—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2710/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA dsDNA viruses
- C12N2710/00011—Details
- C12N2710/10011—Adenoviridae
- C12N2710/10311—Mastadenovirus, e.g. human or simian adenoviruses
- C12N2710/10322—New viral proteins or individual genes, new structural or functional aspects of known viral proteins or genes
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N2333/00—Assays involving biological materials from specific organisms or of a specific nature
- G01N2333/005—Assays involving biological materials from specific organisms or of a specific nature from viruses
- G01N2333/01—DNA viruses
- G01N2333/075—Adenoviridae
Definitions
- This invention relates to the relationship between infection with adipogenic adenoviruses, such as, for example, adenovirus-36 (Ad-36), and the etiologies of obesity and obesity-related cancers and other diseases. More specifically, the invention relates to methodology for predicting whether a subject is predisposed to developing breast cancer or prostate cancer. Additionally, the invention relates to assaying a subject for Ad-36 status and using Ad-36 status as a marker for the presence of cancer, to predict the future risk of developing such cancer, and/or to predict the aggressiveness and prognosis of cancer.
- Ad-36 adenovirus-36
- Another possibility for the link between obesity and cancer is the decreased immune function seen in obese individuals.
- Obese people have a lower antibody response to vaccination with hepatitis B than vaccine people who are not obese.
- the immune system is critical in inhibiting the growth of neoplasms, so it would not be surprising if this were the mechanism of increased cancers of many types in obesity.
- adenoviruses are well known to decrease immune function as a way to enhance their replication within the host, including human hosts. More relevant, the SMAM-I avian adenovirus, which has been reported to cause obesity, had a major impact by decreasing immune function of chickens. Thus, there is a direct link between an adenovirus that causes obesity and that also impairs immune function. The inventor has reported that SMAM-I is associated with obesity in humans, adding a link from adenovirus to human obesity.
- Adenovirus serotypes are known to be oncogenic, and induce tumors in rats or hamsters.
- Adenovirus serotypes are divided by Groups. Group A adenoviruses (e.g., Ad- 12, Ad- 18) are highly oncogenic, producing tumors in most animals within 4 months; group B adenoviruses (e.g., Ad-3, Ad-7) are weakly oncogenic, inducing tumors in most animals within 4 to 18 months; group D viruses are thought to be less oncogenic, but serotype-9 efficiently induces mammary tumors within 3 to 5 months. There has been extensive work on adenovirus-induced cancer, but to date, there has been no evidence that adenoviruses cause human cancer.
- adenoviruses cause human cancers, it is likely that they do so by altering expression of genes in the host that allow unregulated cell growth to occur. Many such tumor markers have been identified. Some are due to genetic variants. Hereditary breast cancer has been linked to germline mutations in one allele of high penetrance susceptibility genes such as BRCAl, BRCA2, CHEK 2, TP53 or PTEN. It is possible that adenovirus infections facilitate cancer in these genetically susceptible individuals. However, adenoviruses may contribute to spontaneous oncogenesis by inducing expression of various oncogenes or suppressing expression of tumor suppressor genes of the host.
- adenoviruses that are thought to contribute to cancer are changes in DNA-dependent protein kinase, fatty acid binding protein, mTOR, pl6, p53, PDZ protein, phosphatidylinositol 3-kinase, PML, thymidine kinase, and Zip kinase.
- DNA-dependent protein kinase fatty acid binding protein
- mTOR fatty acid binding protein
- pl6, p53 PDZ protein
- phosphatidylinositol 3-kinase phosphatidylinositol 3-kinase
- PML thymidine kinase
- Zip kinase Zip kinase.
- tumor related factors that are altered by the adenovirus E4 region, and specifically the E4orfl gene.
- the E4 oncogenes include DNA-dependent protein kinase, p53, PDZ protein, phosphatidylinositol 3-kinase, PML, thymidine kinase, and Zip kinase.
- the Ad-36 E4orfl gene has been shown to be involved in producing obesity by a direct effect on adipocyte metabolism.
- the E4orfl region of human adenovirus-5 has been shown to be an oncogene, and a recent paper reported that Ad-5 produces obesity in mice.
- One aspect of the invention relates to a method for predicting whether a subject is predisposed to developing an adipogenic adenovirus related disease.
- the methodology includes obtaining a sample from the subject and determining whether the subject is infected with the adipogenic adenovirus by screening for the presence of antibodies specific to the adipogenic adenovirus in the sample and determining the presence of antibodies specific to the adipogenic adenovirus in the sample.
- the antibodies may be specific to one or more peptide encoded by the nucleic acid sequences SEQ ID NO.:5, SEQ ID NO.:6, and SEQ ID NO.:7.
- the screening step may be performed by using a method selected from the group consisting of serum neutralization assay and ELISA.
- the adipogenic adenovirus may include adenovirus type 5, adenovirus type 36, and adenovirus type 37.
- the adipogenic adenovirus related disease may include cancer, prostrate cancer, breast cancer, pancreatic dysfunction, pancreatic disease, diabetes, pulmonary disease, brain and nervous system dysfunction, and adrenal dysfunction.
- the subject may be a human or an animal.
- the sample may be a biological sample, such as body fluid, a tissue sample, an organ sample, feces, blood, salvia, and any combination thereof.
- Another aspect of the invention relates to a method of preventing adipogenic adenovirus related disease in a subject by administering an anti-adipogenic adenovirus vaccine to the subject.
- the anti-adipogenic adenovirus vaccine may include an effective dose of an active ingredient such as a killed adenovirus type 36, an inactivated adenovirus type 36, a protein or peptide sequence encoding an adenovirus 36 coat protein or fragment thereof, an nucleic acid sequence encoding an adenovirus type 36 coat protein or a fragment thereof, an adenovirus type 36 El A protein, a genetically modified non-pathogenic virus, and a nonpathogenic virus.
- an active ingredient such as a killed adenovirus type 36, an inactivated adenovirus type 36, a protein or peptide sequence encoding an adenovirus 36 coat protein or fragment thereof, an nucleic acid sequence encoding an adenovirus type 36 coat protein or a fragment thereof
- the vaccine may be administered to the subject intranasally, orally, intravenously, intramuscularly, subcutaneously and/or peritoneally.
- the subject may be a human or an animal.
- the adipogenic disease may include cancer, prostrate cancer, breast cancer, pancreatic dysfunction, pancreatic disease, diabetes, pulmonary disease, brain and nervous system dysfunction, and adrenal dysfunction.
- Another aspect of the invention relates to a method for determining cancer aggressiveness in a subject.
- the methodology includes obtaining a sample from the subject and determining whether the subject is infected with the adipogenic adenovirus by screening for the presence of antibodies specific to the adipogenic adenovirus in the sample and determining the presence of antibodies specific to the adipogenic adenovirus in the sample such that the presence of the adipogenic adenovirus correlates with an aggressive cancer.
- the antibodies may be specific to one or more peptides encoded by the nucleic acid sequences SEQ ID NO.:5, SEQ ID NO.:6, and SEQ ID NO.:7.
- the screening step may be performed by using a method selected from the group consisting of serum neutralization assay and ELISA.
- the adipogenic adenovirus may include adenovirus type 5, adenovirus type 35, and adenovirus type 37.
- the cancer may include breast, prostate, uterus, ovary, colon, kidney, pancreas, and lung.
- the subject may be a human or an animal.
- the sample may be a biological sample, such as body fluid, a tissue sample, an organ sample, feces, blood, salvia, and any combination thereof.
- FIGURE 1 is a BODIPY staining of 3T3-L1 cells 5 days post MDI treatment. This figure shows triglycerides in 3T3-L1 cells infected with Ad-36 versus uninfected in vitro. Control cells show a moderate BODIPY fat stain whereas Ad-36 infected cells have about twice as much triglyceride, showing adipocyte biochemistry has changed.
- FIGURE 2 is a graph showing the effects of spontaneous infection with Ad-36 in ad libitum fed rhesus monkeys. As compared to the period before a monkey became infected, once infection was noted (designated T) there was a steady rise in body weight that was still rising at about 18 months.
- FIGURE 3 is a graph showing an increase in body weight in monkeys infected with Ad-36. As compared to uninfected monkeys, infected monkeys gained about four times as much weight in about seven months.
- FIGURE 4 is a graph showing a decrease in serum cholesterol in Ad-36 infected marmoset monkeys. Serum cholesterol began dropping immediately after infection and by about 10 weeks. This is significantly different than baseline in infected monkeys. There is no change in uninfected monkeys.
- FIGURE 5 is a gel showing the presence of Ad-36 DNA in adipose tissue of infected marmosets using a nested PCR assay.
- Lane 1 is Ad-36 DNA
- lanes 2-4 show no Ad- 36 DNA in fat of uninfected monkeys
- lanes 5-7 shows the presence of Ad-36 DNA in all infected monkeys.
- FIGURE 6 is gel showing Ad- 36 DNA in liver (upper lanes) and muscle tissue (lower lanes) of infected marmosets using nested PCR assay.
- Ad-36 DNA from infected monkeys is seen in lanes 7-9 of liver tissue and muscle tissue and is not present in lanes 4-6 from uninfected monkeys.
- Lane 2 is Ad-36 from culture, lane 3 is marker.
- FIGURE 7 is a gel showing Ad-36 DNA in brain and muscle tissue of infected animals by nested PCR assay. Upper lanes are brain tissue from marmosets, lower lanes are muscle tissue. Ad-36 DNA from infected marmosets is seen clearly in lanes 8-9 and more faintly in lane 7. Ad-36 DNA is not present in lanes 4-6 from non-infected marmosets. Lane 2 is positive control from Ad-36 culture. [0026] FIGURE 8 is a gel showing Ad-36 DNA in adipose tissue of humans using nested PCR assay (bottom lanes).
- This gel shows Ad-36 DNA in adipose tissue of marmosets in the upper lanes (repeat of data in Figure 5: lanes 4-6 negative from control marmosets, lanes 7-9 Ad-36 DNA from infected marmosets), hi bottom lanes Ad-36 DNA is seen in 2 of 6 samples of human visceral adipose tissue obtained from cadavers at autopsy (lane 2 is positive control, lanes 6-7 are Ad-36 positive, lanes 4,5,8,9 are negative).
- FIGURE 9 is a chart showing the effects of multiple human adenoviruses on total body fat in chickens. Ad-2 and Ad-31 did not increase body fat, but Ad-37 had a marked effect.
- FIGURE 10 is a chart showing the effects of multiple human adenoviruses on visceral fat in chickens. Ad-2 and Ad-31 did not increase visceral fat, but Ad-37 had a marked effect.
- FIGURE 11 is a chart showing food intake in animals exposed to multiple human adenoviruses. There were no differences in cumulative food intake among groups, yet individuals infected with Ad-37 became obese while individuals infected with Ad-2 or Ad-31 were not.
- FIGURE 12 is a table showing human Ad-5 produced obesity in mice. Also, body fat increased by almost 3 fold.
- FIGURE 13 is a table showing the presence of serum antibodies to human Ad- 36 in people from three US cities. An average of about 30% of obese people were infected with As-36 versus about 11% of non-obese who were not infected with Ad-36.
- FIGURE 14 is a chart showing body mass index in 502 individuals from three US cities according to status of infection with Ad-36. Overall, BMI was about 9 units higher in infected versus uninfected people (p ⁇ .0001). Infected individuals of both obese and non- obese groups were significantly heavier than the uninfected in each group.
- FIGURE 15 is a table showing a comparison of twin pairs discordant for infection with Ad-36. Out of 89 twin pairs, 26 were discordant. The twins infected with Ad- 36 were heavier and fatter than their uninfected co-twins.
- FIGURE 16 is a gel showing the presence of Ad-36 DNA in prostate cancer tissue.
- FIGURE 17 is a gel showing the presence of Ad-36 DNA in monkeys. DETAILED DESCRIPTION OF THE INVENTION
- any numerical values recited herein include all values from the lower value to the upper value in increments of one unit provided that there is a separation of at least two units between any lower value and any higher value.
- concentration of a component or value of a process variable such as, for example, dosage, dilution, and the like, is, for example, from 1 to 90, specifically from 20 to 80, more specifically from 30 to 70, it is intended that values such as 15 to 85, 22 to 68, 43 to 51, 30 to 32 etc., are expressly enumerated in this specification.
- one unit is considered to be 0.0001, 0.001, 0.01 or 0.1 as appropriate.
- Ad-2 is adenovirus type 2
- Ad-5 is adenovirus type 5
- Ad-31 is adenovirus type 31
- Ad-36 is adenovirus type 36
- Ad-37 is adenovirus type 37
- BMI body mass index
- FAS is fatty acid synthetase
- PPAR peroxisome proliferator activated receptors
- CEBP is CCAAT-enhancer binding protein
- adipogenic adenovirus generally refers to adenoviruses that are capable of stimulating increase lipid production in cells, tissues, and/or organs by turning on the cellular machinery in infected hosts to turn on the host's production of lipogenic enzymes which then produce excess fatty acids and promote fat storage with the infected cells.
- the adipogenic adenoviruses include without limitation Ad-5, Ad-36, and Ad- 37.
- BMI generally refers to a statistical measure of the weight of a person scaled according to height. BMI may be defined as the individual's body weight divided by the square of the height and may be expressed in the unit kg/m 2 . BMI may be used as a screening tool to identify possible weight problems for adults and children. However, in order to determine if excess weight is a health risk, a healthcare provider may need to perform further assessments, such as skinfold thickness measurements, evaluations of dies, physical activity, family history, hip to waist ratio, infection with a adipogenic adenovirus, and other appropriate health screenings.
- BMI For adults 20 years old and older, BMI may be interpreted using standard weight status categories that are the same for all ages and for both men and women. Alternatively, for children and teens, the interpretation of BMI is both age- and sex-specific. For example, an adult having a (i) a BMI less than about 18.5 percent mat be considered underweight, (ii) a BMI is the range of about 18.5 to about 24.9 may be considered normal weight, (iii) a BMI in the range of about 25 to about 29.9 may be considered overweight, and (iv) a BMI greater than about 30.0 may be considered obese.
- hip to waist ratio refers to a measurement that may be used to help determine obesity.
- the distribution of fat is evaluated by dividing the waist size by the hip size. For example, an individual with about a 30 inch waist and about a 40 inch hip size would have a ratio of about 0.75 and an individual with about a 41 inch waist size and about a 39 inch hip size would have a ratio of about 1.05. The higher the ratio, the higher the risk of heart disease and other obesity-related disorders.
- a "biological sample” refers to a sample of tissue or fluid from a human or animal including, but not limited to plasma, serum, spinal fluid, lymph fluid, the external sections of the skin, respiratory, intestinal and genitourinary tracts, tears, saliva, blood cells, tumors, organs, tissue and sample of in vitro cell culture constituents.
- nucleic acid e.g., DNA, RNA, or a mixed polymer
- nucleic acid is one which is substantially separated from other cellular components which naturally accompany a native human or animal sequence or protein, e.g., ribosomes, polymerases, many other human or animal genome sequences and proteins.
- the term embraces a nucleic acid sequence or protein which has been removed from its naturally occurring environment, and includes recombinant or cloned DNA isolates and chemically synthesized analogs or analogs biologically synthesized by heterologous systems.
- immunogenic generally refers to an anti-obesity vaccine that has the capability to provoke in an immunized animal, an immune response that yields neutralizing antibodies against an obesity-causing, live virus that might infect the person after administration of the vaccine.
- antibody refers to antibodies, digestion fragments, specified portions and variants thereof, including antibody mimetics or comprising portions of antibodies that mimic the structure and/or function of an antibody or specified fragment or portion thereof, including single chain antibodies and fragments thereof.
- the invention encompasses antibodies and antibody fragments capable of binding to a biological molecule (such as an antigen or receptor), such as the fiber coat protein of adenoviruses, and specifically, Ad-36, or portions thereof.
- nucleic acid sequence includes an oligonucleotide, nucleotide, or polynucleotide, and fragments thereof, and to DNA or RNA of genomic or synthetic origin which may be single- or double-stranded, and represent the sense or antisense strand, to peptide nucleic acid (PNA), or to any DNA-like or RNA-like material, natural or synthetic in origin.
- PNA peptide nucleic acid
- Fragments include any portion of a heterologous peptide or nucleic acid sequence. Heterologous peptide fragments retain at least one structural or functional characteristic of the subject heterologous polypeptides. Nucleic acid sequence fragments are greater than about 60 nucleotides in length, and most preferably includes fragments that are at least about 100 nucleotides, at least about 1000 nucleotides, and at least about 10,000 nucleotides in length.
- Complementary or complementarity include the natural binding of polynucleotides under permissive salt and temperature conditions by base-pairing.
- sequence "A-G-T” binds to the complementary sequence "T-C-A.”
- Complementarity between two single-stranded molecules may be "partial,” in which only some of the nucleic acids bind, or it may be complete when total complementarity exists between the single stranded molecules.
- the degree of complementarity between nucleic acid strands has significant effects on the efficiency and strength of hybridization between nucleic acid strands. This is of particular importance in amplification reactions, which depend upon binding between nucleic acids strands and in the design and use of molecules.
- Functional equivalent a protein or nucleic acid molecule that possesses functional or structural characteristics that are substantially similar to a heterologous protein, polypeptide, enzyme, or nucleic acid.
- a functional equivalent of a protein may contain modifications depending on the necessity of such modifications for the performance of a specific function.
- the term “functional equivalent” is intended to include the "fragments,” “mutants,” “hybrids,” “variants,” “analogs,” or “chemical derivatives” of a molecule.
- Protein purification broadly defined, any process by which proteins are separated from other elements or compounds on the basis of charge, molecular size, or binding affinity.
- Substantially purified includes nucleic or amino acid sequences that are removed from their natural environment, isolated or separated, and are at least 60% free, preferably at least 75% free, and most preferably at least 90% free from other components with which they are naturally associated.
- Inhibition refers to a reduction in the parameter being measured, whether it be adenovirus type 36 growth or viability. The amount of such reduction is measured relative to a standard (control). "Reduction” is defined herein as a decrease of at least around 25% relative to control, preferably at least around 50%, and most preferably of at least around 75%.
- the anti-adipogenic adenovirus vaccines of the invention wherein the immunogenic component is live, inactivated virus, killed virus, coat protein per se, epitope- comprising coat protein segment, or coat protein (or epitope-comprising segment thereof) provided with use of a non-pathogenic, genetically modified carrier virus such as a vaccinia virus or a fowl pox virus, are prepared using methods well known in the art.
- the vaccines will include carriers, excipients, adjuvants, antimicrobials, preservatives and the like as well understood in the art.
- the vaccines will have suitable compositions, usually aqueous buffers, such as phosphate-buffered saline or the like, in which the active ingredient will be suspended along with, optionally, any of various immune-system stimulating adjuvants used in human vaccine preparations, antimicrobial compositions, and other compositions to stabilize the preparations. All compositions included with the vaccine preparation will be suitable for administration to humans.
- the vaccine preparation may be stored in lyophilized form and then combined with solution soon before administration.
- the vaccine preparation may be in solution, tablet or pill form optionally with an enteric coating as understood in the art.
- the concentration of active (immunogenic or immunogen-providing) component in solution with which it is administered typically will be between about 1 ng and about 1 mg/ml.
- the anti- adipogenic adenovirus vaccines of the invention will be administered intranasally, orally, or by injection intravenously, intramuscularly, subcutaneously or peritoneally. Administration of the vaccines of the invention is to be under the guidance of a physician.
- the anti- adipogenic adenovirus vaccine is well within the skill of medical practitioners and will depend on a number of factors including the age of the person being treated, the urgency of the person's developing protective immunity, the status of the person's immune system, and other factors known to the skilled.
- the vaccine typically will be administered in several steps in order to cause and maintain protective immunity against obesity-causing virus in the person being vaccinated. Thus, after the primary vaccination, there typically will be between one and about ten booster vaccinations separated by periods between about 1 week and 10 years.
- a single dose of an anti-obesity vaccine of the invention (in solution form) will have a volume of between about 0.1 ml and 10 ml and, in any form, will have between about 1 ng and 10 mg of killed or inactivated adipogenic virus, between about 1 ng and 10 mg of genetically modified, non-pathogenic virus, or between about 1 ng and 10 mg of coat protein (e.g., fiber protein) or 6-30 amino acid peptide (in its form as modified to be immunogenic).
- coat protein e.g., fiber protein
- 6-30 amino acid peptide in its form as modified to be immunogenic.
- An anti- adipogenic adenovirus vaccine of the invention wherein the active ingredient is nucleic acid, will also be a standard preparation for vaccines of that type.
- the nucleic acid is not the immunogen but is expressed in vivo after administration of the vaccine as a peptide or protein which in turn is immunogenic.
- Vaccines of this type will be administered by techniques known in the art for such vaccines (e.g., intramuscular injection). Dosing will also be according to procedures known in the art to cause and maintain protective immunity against viral obesity in the vaccinated individual.
- an anti- adipogenic adenovirus vaccine according to the invention may include active ingredients based on more than one adipogenic virus (or the coat protein (e.g. fiber protein) or epitopic segments of the coat protein thereof).
- the invention is a method of preventing adipogenic adenovirus related disease caused by a virus in a human susceptible thereto which comprises administering to the human an amount of an anti- adipogenic adenovirus vaccine of the invention that is effective to raise and maintain a protective immune response against an adipogenic adenovirus.
- This invention generally relates to the relationship between infection with human adipogenic adenoviruses, such as Ad-5, Ad-36, and Ad-37, the etiologies of obesity, and the dysfunction of cells, tissues and/or organs, such as cancers, dysfunction of the pancreas, dysfunction of skeletal and cardiovascular muscle, pulmonary dysfunction, dysfunction of the brain and nervous system, and adrenal disease and dysfunction.
- the invention relates to utilizing adipogenic adenovirus status as a predictor for disease status, prognosis, treatment outcome, and prevention of infection and disease.
- the main mechanism of adipogenic adenovirus-related disease is the production of lipids within cells.
- the adipogenic adenoviruses are capable of changing the cellular machinery in infected subjects to turn on the host's production of lipogenic enzymes. As a result, the lipogenic enzymes make excess fatty acids and promote fat storage within the cells of multiple organs.
- Fatty acid synthetase is one of the most important lipogenic enzymes and is expressed in a number of adult and fetal cells, which suggests that these tissues are capable of producing fatty acids.
- FAS is expressed in adult cells such as epithelial cells of the duodenum and stomach, hemopoietic cells, appendix, ganglion cells of alimentary tract, hepatocytes, mast cells, seminal vesicle, umbrella cells of urinary bladder, adrenal zona fasciculate cells, adipocytes, anterior pituitary cells, basket cells of cerebellum, cerebral cortical neurons, deciduas, decidualized stromal cells of endometrium, epithelial cells of apocrine gland, duct and acinus of breast, prostate, and sebaceous gland, letein cells, and Type II alveolar cells of lung.
- FAS is also expressed in fetal cells such as anterior pituitary cells, chondrocytes of tracheobronchial wall, endothelium of blood vessels and heart, epithelial cells of bronchus, esphagogastrointestinal tract, lung, pancreas, prostate, thyroid, tongue, trachea, proximal tubules of kidney, fibroblasts, nodal lymphocytes, neuroblasts in adrenal medulla, thymocytes, striated myocytes of tongue, epithelial cells of salivary glans and tracheobronchial glands, hemopoietic cells, heptocytes, Lanhans cells of chorionic villi, osteoblasts, perivertebral fibroblastic cells, Schwann cells of sympathetic ganglion and Auerbach plexus, subcapsular cells of adrenal, adipocytes, Lomme cells of testis, mast cells, uroepithelium of urinary tract,
- fatty acids are critical to the intracellular milieu for many biochemical processes, excess fatty acids within the cells profoundly alter cellular biochemistry. Excess fatty acids within cells may lead to abnormal functioning of a number of intracellular processes. For example, excess fatty acids in pancreatic tissue reduce insulin secretion, and fatty acids in cancer cells provide the major source of energy for cancer growth. Moreover, fatty acids within the lung cells stimulate attraction of macrophages to the area and are associated with asthma and emphysema. Therefore, adverse results occur when cells are exposed to excess to fatty acids.
- adipogenic adenoviruses may be a mechanism by which excess fatty acids and triglycerides are produced in cells and tissues.
- adipogenic adenoviruses can alter lipogenic enzymes in adipose tissue and in liver.
- Ad-36 adipogenic adenovirus
- infection with the adipogenic adenovirus, Ad-36 stimulates the rapid appearance of differentiation factors including glycerol-3-phospodehydrogenase, PPAR- gamma, CEBP-alpha and beta, and lipoprotein lipase in 3T3-L1 cells. Since multiple tissues accumulate adipogenic adenoviral DNA, excess lipogenic enzymes maybe present in all infected tissues that are capable of producing these enzymes.
- adipogenic adenovirus infection may be used to determine the presence of an obesity-related cancer.
- adipogenic adenovirus infection may be used to determine whether a subject is predisposed to developing an obesity-related cancer.
- cancers include without limitation breast, prostate, uterus, ovary, colon, kidney, pancreas and lung.
- Hepatocellular cancer may also be linked to obesity and the metabolic syndrome.
- obesity may be linked to the aggressiveness of some types of cancer and to a poorer prognosis. For example, obesity may be associated with a higher grade of prostate cancer and higher recurrence rates after radical prostatectomy.
- breast tumor size correlates with obesity. Specifically, this is most notable for the highest quartile of waist circumference where the odds ration is 2.76.
- fatty acids are the substrate for energy expenditure in cancer cells and that blocking FAS can block cancer growth. Moreover, it has been shown that FAS is increased in many obesity-related cancers and that FAS favors tumor growth. Adipogenic adenovirus infection in cancer cells may stimulate fatty acids in cell thereby promoting cancer growth by providing an energy source for the cancer cells.
- FAS expression has been detected in various tumors and associated with histological subtype, histopathological grade and tumor aggressiveness. Studies have demonstrated that FAS is highly expressed in human neoplasm such as breast, prostate, ovarian, colorectal, and endometrial cancers. It has been determined that FAS (OA-519) was a predictor of prostate cancer. It was observed that OA-519 immunoreactivity was seen in 56 (57%) of the 99 primary prostate cancers examined. OA-519 cancers were more likely to progress than the non-OA-519 cancers.
- Ad-36 was confirmed in 61% of human prostate cancer tissues and it was observed that 50% and 51% of breast and prostate cancer patients, respectively, have antibodies to Ad-36 in comparison to 13.8% of the normal population.
- the prevalence of Ad-36 infection may be statistically higher in patients with breast and prostate cancer than in individuals without cancer.
- Ad-36 status may serve as a marker for breast and prostate cancer.
- Yet a further embodiment relates to patients with breast or prostate cancer who have Ad-36 DNA in their tissues will have more aggressive cancer and/or a poorer prognosis than those without Ad-36 DNA.
- adipogenic adenovirus infection may be used as a predictor for disease prognosis, treatment prognosis, or as a predictor of tumor aggressiveness.
- high levels of FAS are often associated with poor prognosis.
- the association between FAS expression and tumor size or a marker of proliferative activity of tumor cells may suggest that FAS is related to growth and proliferation of these malignant tumors.
- FAS is associated with colon cancer and with its severity. Studies have shown that only 2 (5%) of 43 adenomas with low-grade dysplasia showed reactivity for FAS. However, positive FAS immunostaining was seen in 7 (17%) of 40 cases of adenomas with moderate-grade dysplasia, in 9 (53%) of 17 cases of adenomas with high-grade dysplasia, and in 81% of adenocarcinomas (pO.OOOl).
- one embodiment of the invention is directed to a diagnostic screening test for the presence of adipogenic adenovirus infection in a subject. If the subject tests positive for adipogenic adenovirus, FAS expression may be increased in cancer cells resulting in a more aggressive cancer and/or a poorer prognosis.
- Other information linking Ad-36 and cancer is the finding of unique sequences of Ad-36 DNA in obesity-related cancers, such as prostate cancer tissue by polymerase chain reaction test (PCR).
- PCR polymerase chain reaction test
- the unique sequences of DNA from Ad-36 fiber protein which are described in Assignee's previous U.S. Patent Nos. 6,664,050 and 6,127,113 were detected in 11 of 18 samples of prostate cancer tissue. Exemplary screening techniques are described below.
- the adipogenic adenovirus test will be useful in two ways. If a subject with a breast lump or an enlarged prostate has a positive adipogenic adenovirus test (tested by, for example, either a positive serum test or a positive PCR tissue test), there is a higher risk that the subject has cancer and tests should be done to evaluate for cancer (e.g.., biopsy) rather than "watchful waiting.” Conversely, if a person has a positive adipogenic adenovirus test, then the subject should be screened for cancer at more regular intervals than a person with a negative Ad-36 test.
- a positive adipogenic adenovirus test tested by, for example, either a positive serum test or a positive PCR tissue test
- the subject should be screened for cancer at more regular intervals than a person with a negative Ad-36 test.
- a vaccine against Ad-36 has been developed in rabbits using killed virus. Serum from the rabbits contains antibodies that prevent Ad-36 growth in tissue culture in up to 17 serial dilutions (a dilution of 1 : 131 ,072 of the original concentration). It is known that the only effective antibodies against adenovirus growth are directed against segments of fiber protein of the various adenoviruses (neutralizing antibodies). Ad-36 antibodies do not cross react with any other adenoviruses, so unique DNA sequences in Ad-36 fiber protein are responsible for this specificity. Three sequences in Ad-36 fiber protein that are unique to Ad- 36 have been identified.
- peptides from these sequences will be used to make a highly purified vaccine that should have minimal allergic reactions.
- the peptides will be bound to adjuvants commonly used in vaccines to enhance effectiveness. These techniques are known by those of skill in the art.
- a vaccine against adipogenic adenoviruses such as Ad-36 to prevent cancer may be made. Since adipogenic adenoviruses are associated with cancer, a vaccine against adipogenic adenoviruses may be used to prevent cancer. For example, a vaccine against Ad-36 using unique DNA sequences contained in the fiber protein DNA to make peptides may be developed. This technology is known by those of skill in the art.
- a novel concept of sequencing the fiber protein DNA from all of the adipogenic adenoviruses to determine their structures may be performed. Following sequencing, the DNA sequences that are present in many or all of the fiber proteins will be identified using DNA comparison databases commonly used in the field. This may be accomplished by, for example, employing GenBank to identify the unique sequences in Ad- 36 fiber protein DNA. DNA sequences of about 30-75 base pairs that code for peptides of about 10-25 amino acids are then selected. It is known that peptides in the knob portion of the fiber protein are effective, so these sequences will be examined. Following identification, the peptides may be coupled with adjuvants to make a vaccine that will prevent infection from any of the human adenoviruses.
- the usefulness of a common vaccine for the adipogenic adenoviruses will be to prevent obesity, cancer, and other human diseases that are due to adipogenic adenoviruses. For example, a significant percentage of military recruits contract adenovirus infections during basic training. Also, many of the mild illnesses associated with fever, cough, diarrhea, or conjunctivitis in the first two years of life are due to adenoviruses.
- adipogenic adenovirus infection may be used as a predictor of the development of obesity and diseases due to the complications of obesity and the outcome of regimens that affect body weight.
- Complications of obesity may include, inter alia, diabetes mellitus, hypertension, hyperlipoproteinemia, cardiac disease such as atherosclerotic disease and congestive heart failure, pulmonary diseases such as sleep apnea and asthma, cerebrovascular accidents, cancers such as breast, uterus colon and prostate cancer, gall bladder disease such as stones and infection, toxemia during pregnancy, risks during surgery, gout, decreased fertility, degenerative arthritis, and early mortality.
- Ad-36 DNA was observed in multiple tissues of the monkey, such as brain, liver, lung, muscle and adipocyte tissue seven months following initial infection and was no longer able to grow the virus from the blood or feces of the infected monkeys after two months (FIGURES 5-7). Ad-36 DNA has also been observed in human adipocyte tissue as seen in FIGURE 8.
- Another embodiment of the invention includes using adipogenic adenoviruses to predict diabetes and other pancreatic dysfunction. Additionally, another embodiment is directed to a vaccine against adenoviruses that may prevent pancreatic disease, including some cases of diabetes.
- Pancreatic beta cells make lipids and lipid metabolism in the beta-cell is critical for the regulation of insulin secretion. Enzymes that are associated with lipid synthesis or oxidation cause a decrease in the amount of insulin produced and secreted.
- SREBP-I is a direct precursor of FAS and has been found to be increased by adenovirus infection in vitro and in vivo in hepatocytes.
- Other studies have demonstrated that carbohydrate responsive element-binding protein (ChREBP) binding to fatty acid synthase and L-type pyruvate kinase genes is stimulated by glucose in pancreatic beta-cells.
- ChREBP carbohydrate responsive element-binding protein
- CPT I Higher carnitine palmitoyltransferase I (CPT I) protein levels in beta cells causes a decrease in secretion of insulin in response to glucose.
- Adipogenic adenoviruses may cause diabetes because they increase obesity and produce insulin resistance, but the changes in lipogenic enzymes due to virus infection of the pancreas also may play a role.
- An additional embodiment of the invention is for using adipogenic adenoviruses status to predict liver disease, cirrhosis, and other liver dysfunction. Also, a vaccine against adenoviruses may be used to prevent liver diseases due to adipogenic adenoviruses.
- Obesity is associated with liver disease.
- the spectrum of liver disease with obesity starts with fat infiltration of the liver, progresses to steatohepatitis (non-alcoholic steatohepatitis - NASH), and a sizeable percentage of patients with NASH go on to develop cryptogenic cirrhosis.
- the frequency and severity of fatty infiltration of the liver goes up with increasing body weight and is present in the vast majority of patients with morbid obesity. It has been reported that obesity is present in about 30% to about 100% of the cases of nonalcoholic fatty liver disease (NAFLD).
- NAFLD nonalcoholic fatty liver disease
- Other studies have demonstrated that greater than about 95% of subjects with severe obesity had various degrees of fatty infiltration of the liver and about 65% had NASH.
- Adipogenic adenoviruses produce increased levels of lipogenic enzymes and an accumulation of fat in the liver. As noted above, fatty infiltration of the liver may lead to cirrhosis. There are a number of causes of fatty infiltration of the liver, and additional insults to the liver may increase the chance that cirrhosis will occur. Individuals with risk factors for liver disease or with abnormal liver function tests should be tested for adipogenic adenoviruses as they may need special attention to prevent progression of fatty liver to cirrhosis. A vaccine against adipogenic adenoviruses may reduce or prevent many cases of fatty liver and cirrhosis.
- Yet another embodiment of the invention includes using adipogenic adenoviruses to predict muscle dysfunction. Also, a vaccine against adenoviruses may be used to prevent muscle dysfunction.
- Muscles are known to have lipogenic enzymes present and to store intracellular lipids. Obesity is associated with abnormal lipid metabolism and accumulation of intramuscular lipid. Studies have shown that a lipogenic gene, stearoyl-CoA desaturase 1 (SCDl), is up-regulated in skeletal muscle from extremely obese humans. High intramuscular fat is related to poor muscle function in obese people and is related to insulin resistance and diabetes. Other studies have showed that insulin resistance and type 2 diabetes result from the accumulation of lipids in tissues not suited for fat storage, such as skeletal muscle and the liver. FFAs stimulated the de novo synthesis of ceramide and sphingosine, two sphingolipids shown previously to inhibit insulin action. The inability to transition from fat to glucose as the primary source of fuel may be associated with insulin resistance, metabolic dysregulation, and cardiovascular risk. Since leptin has been shown to go down in adipocytes infected with Ad-36, this might produce insulin resistance.
- SCDl stearoyl-CoA des
- Obese people complain of pain with exercise. The reasons for this are not clear, but obese individuals have more intramuscular lipids and a lower exercise capacity.
- the intramuscular lipids alter the substrate utilization of skeletal muscles.
- Increased intramuscular lipids due to adipogenic adenoviruses may limit exercise capacity, increase pain, and alter substrate utilization. This would be particularly important in animals used for performance or endurance, such as race horses or racing dogs.
- An animal (or person) infected with an adipogenic adenovirus may not be able to achieve as good a performance as an uninfected, so testing for adipogenic adenoviruses may be used as a predictor of performance quality.
- a further embodiment of the invention is related to using adipogenic adenoviruses status to predict pulmonary dysfunction. Also, a vaccine against adenoviruses will prevent pulmonary dysfunction.
- An embodiment of the invention is using adipogenic adenovirus status to predict brain and nervous system dysfunction. Also, a vaccine against adenoviruses may be used to prevent brain and nervous system dysfunction.
- Adipogenic viruses infect brain tissue. It is well known that the nerves and brain make FAS. Obesity is linked to adverse neurocognitive outcome, including reduced cognitive functioning and Alzheimer's disease. Studies have demonstrated that BMI was inversely related to performance on all cognitive tests and there was no evidence of a BMI x age interaction. There is an increased prevalence of Alzheimer's disease in obesity. Abeta42, a type of amyloid that is deposited in Alzheimer's patients, correlated with BMI. Obese people may have about a 74% higher chance of dementia. Other studies have demonstrated that an Ad-5 vector that has been used in gene therapy caused inflammation of the brain.
- Wild type Ad-5 has been reported to cause obesity and we have noted that an Ad-5 vector that is used for gene transfer retains its ability to stimulate SREBP-I and FAS synthesis in hepatocytes. Accordingly, these data support the concept that adipogenic adenoviruses may increase lipogenic enzymes in the brain and nerves, produce excess fatty acid and triglycerides, and result in dysfunction.
- An aspect of the invention is that testing for adipogenic adenoviruses may be used to predict adrenal dysfunction. Also, a vaccine against adenoviruses may be used to prevent adrenal dysfunction.
- Obesity is known to significantly affect adrenal gland function. There is an increased secretion of aldosterone, but without renin, which may be associated with hypertension. Studies have demonstrated that adrenal function was not normal in obese women, but differed with abdominal fat distribution. Adrenal hormones use cholesterol as a substrate for production, and with the changes of adipogenic adenoviruses in both intracellular fatty acids and cholesterol metabolism, the use of a test to detect adipogenic adenoviruses may be a predictor of adrenal dysfunction.
- Exemplary screening immunoanalytical techniques include without limitation, standard virus neutralization assay techniques or enzyme immunoassay techniques well known in the art. Techniques for raising and purifying antibodies against these viruses or fragments thereof (e.g., fiber protein or fragments thereof), or proteins (or fragments thereof) from these viruses for use in these immunoassay techniques may be prepared by conventional techniques are well known in the art. hi a specific embodiment of the invention, antibodies will immunoprecipitate adenovirus virus or adenovirus proteins from solution as well as react with these proteins on Western or immunoblots or polyacrylamide gels. In another specific embodiment, antibodies will detect the presence of adenovirus or adenovirus proteins in frozen tissue sections, using immunocytochemical techniques.
- ELISA enzyme linked immunosorbent assays
- RIA radioimmunoassay
- IRMA immunoradiometric assays
- IEMA immunoenzymatic assays
- nucleic acid probe hybridization assay techniques used in these methods of the invention will be standard techniques (optionally after amplification of DNA or RNA extracted from a sample of blood, other body fluid, feces, tissue or organ) using nucleic acid probes (and primers if amplification is employed) made available by the obesity- causing viruses identified and made available by the present invention.
- the sequences of nucleic acids characteristic of these viruses can be determined by standard techniques once the viruses are conventionally isolated, and probes and primers that are specific for the viruses and that provide the basis for nucleic acid probes and primers that can be used in nucleic acid based assays for the viruses are prepared using conventional techniques on the basis of the sequences.
- a biological sample such as blood is prepared and analyzed for the presence or absence of adenovirus proteins, such as the Ad-36 fiber coat protein sequences. Results of these tests and interpretive information are returned to the health care provider for communication to the tested individual.
- adenovirus proteins such as the Ad-36 fiber coat protein sequences.
- screening involves amplification of the relevant adenovirus sequences.
- the screening method involves a non-PCR based strategy.
- Such screening methods include two-step label amplification methodologies that are well known in the art. Both PCR and non-PCR based screening strategies can detect target sequences with a high level of sensitivity.
- One embodiment of the invention relates to target amplification.
- the target nucleic acid sequence is amplified with polymerase.
- polymerase chain reaction PCR
- the polymerase chain reaction and other polymerase-driven amplification assays can achieve over a million- fold increase in copy number through the use of polymerase-driven amplification cycles.
- the resulting nucleic acid can be sequenced or used as a substrate for DNA probes.
- the biological sample to be analyzed such as blood or serum
- the sample nucleic acid may be prepared in various ways to facilitate detection of the target sequence, e.g., denaturation, restriction digestion, electrophoresis or dot blotting.
- the targeted region of the analyte nucleic acid usually must be at least partially single-stranded to form hybrids with the targeting sequence of the probe. If the sequence is naturally single-stranded, denaturation will not be required. However, if the sequence is double-stranded, the sequence will probably need to be denatured. Denaturation can be carried out by various techniques well known in the art.
- Analyte nucleic acid and probe are incubated under conditions which promote stable hybrid formation of the target sequence in the analyte.
- the region of the probes which is used to bind to the analyte can be made completely complementary to the targeted region of the adenovirus of interest, and in particular the fiber coat protein. Therefore, high stringency conditions are desirable in order to prevent false positives. However, conditions of hig stringency are used only if the probes are complementary to regions of the adenovirus.
- the stringency of hybridization is determined by a number of factors during hybridization and during the washing procedure, including temperature, ionic strength, base composition, probe length, and concentration of formamide.
- Detection, if any, of the resulting hybrid is usually accomplished by the use of labeled probes.
- the probe may be unlabeled, but may be detectable by specific binding with a ligand which is labeled, either directly or indirectly.
- Suitable labels, and method for labeling probes and ligands are well known in the art, and include, for example, radioactive labels which may be incorporated by known methods (e.g., nick translation, random priming or kinasing), biotin, fluorescent groups, chemiluminescent groups (e.g., dioxetanes) enzymes, antibodies, gold nanoparticles and the like. Variations of this basic scheme are known in the art, and include those variations that facilitate separation of the hybrids to be detected from extraneous materials and/or that amplify the signal from the labeled moiety.
- non-PCR based screening assays are also contemplated by this invention.
- This procedure hybridizes a nucleic acid probe (or analog such as a methyl phosphonate backbone replacing the normal phosphodiester) to the low level DNA target.
- This probe may have an enzyme covalently linked to the probe, such that the covalent linkage does not interfere with the specificity of the hybridization.
- the enzyme-probe-conjugate- target nucleic acid complex can then be isolated away from the free probe conjugate and a substrate is added for enzyme detection. Enzymatic activity is observed as a change in color development or luminescent output resulting in about a 10 3 to about a 10 6 increase in sensitivity.
- Two-step label amplification methodologies are known in the art. These assays work on the principle that a small ligand (such as digioxigenin, biotin, or the like) is attached to a nucleic acid probe capable of specific binding the adenovirus sequence region of interest.
- the small ligand attached to the nucleic acid probe is specifically recognized by an antibody- enzyme conjugate.
- digioexigenin is attached to the nucleic acid probe.
- Hybridization is detected by an antibody- alkaline phosphatase conjugate which turns over a chemiluminescent substrate.
- the small ligand is recognized by a second ligand-enzyme conjugate that is capable of specifically complexing to the first ligand.
- a well known embodiment of this example is the biotin-avidin type interactions.
- nucleic acid probe assays of this invention will employ a cocktail of nucleic acid probes capable of detecting various species of adenoviruses.
- ad- 36, ad-37 and/or ad-5 for example, in a biological sample
- more than one probe complementary of the targeted regions of interest in the various types of adenovirus may be employed.
- kits may be assembled to facilitate carrying out the methods for a particular virus or a plurality of them.
- the antibody positive were observed to be about 9 BMI units heavier (i.e., greater than about 50 pounds)(p ⁇ .001) (FIGURE 14).
- FIGURE 16 shows a PCR gel demonstrating the presence of Ad-36 DNA in prostate cancer tissues.
- Ad-36 DNA in multiple tissues of experimental animals was found, particularly in adipose tissue using nested PCR with primers made from unique DNA sequences in the Ad-36 fiber protein genome.
- FIGURE 17 shows a PCR gel from DNA extracted from adipose tissue of monkeys infected with Ad-36. All three of the infected monkeys, but none of the controls, have viral DNA present.
- This example shows the use of Ad-36 lab test as a marker to identify individuals at risk of developing cancer: People with cancer have a much higher prevalence of a positive Ad-36 lab test than do non-cancer patients. We tested 128 women with breast cancer and 37 men with prostate cancer and compared the results to 502 non-cancer patients. Of the total of 165 cancer patients, 83 (50%) had a positive Ad-36 test (50% of the breast cancer patients and 51% of the prostate cancer patients). Based on the prevalence of obesity in the US population, the data of the 502 non-cancer subjects showed that 17% of the non- cancer subjects had a positive Ad-36 test.
- Adipose tissue from 9 humans at autopsy at the University of Wisconsin Hospital was obtained and assayed for Ad-36 DNA. Seven of the 9 had Ad-36 DNA in the adipose tissue. These data demonstrate that Ad-36 DNA may isolated from human and animal adipose tissue and more importantly, that the presence of Ad-36 DNA in tissues is a marker for post Ad-36 infection. Since the Ad-36 DNA appeared in multiple tissues of infected animals, it seems clear that the initial viremia results in infection of most of the tissues of the body. Therefore, as described in the methods Section as described in Specific Example 6, below, cancer tissues or adipose tissue from cancer may be obtained from patients to test for the presence of Ad-36 DNA.
- Samples are assayed for Ad-36 DNA in samples of breast and prostate tissue from cancer patients and non-cancer patients to determine if the prevalence of infection with Ad-36 is greater in cancer patients.
- Ad-36 status may be correlated with the presence of cancer and may be correlated with stage of cancer, presence of metastases, and prognosis of cancer victims.
- a vaccine against Ad-36 may prevent Ad-36 induced cancers.
- samples of breast cancer tissue or adipose tissue near the breast from 100 women with cancer are compared with breast tissue or adipose tissue from 50 women undergoing breast surgery who do not have cancer.
- breast cancer tissue is not available, adipose tissue from near the breast is acceptable.
- Actual breast tissue is not critical as Ad-36 DNA appears in all tissues after infection, so adipose tissue is suitable.
- samples of prostate cancer from 100 men is compared to prostate tissue from men undergoing surgery for benign prostatic hypertrophy (BPH).
- BPH benign prostatic hypertrophy
- Both NCI tissue banks have information on age, menopausal status of female patients, height, weight, family history of breast or prostate cancer, type and stage of cancer, presence of metastases, and in some cases, survival time. Because breast cancer associated with obesity is more prevalent in postmenopausal women, non-cancer subjects are matched as well as possible for age. It may be expected that prostate cancer patients from whom we obtain samples will be in the older age group (>50 years) because this is the population in which prostate cancer and BPH occurs. It may be very unlikely that we will have any tissues from pediatric patients as breast and prostate cancers are so rare in them.
- A549 human bronchial carcinoma cells are obtained from American Type Culture Collection (ATCC, Rockville, MD). Minimum Essential Media Eagle (MEM) (Cat # M-0643, Sigma Chemicals) with non-essential amino acids, Earle's salts and L-glutamine are used for growing A549 cells. Work stocks are grown in A549 cells using MEM with 10% fetal bovine serum (FBS) and 2.9% NaHCO 3 (v/v) at pH 7.4.
- MEM Minimum Essential Media Eagle
- FBS fetal bovine serum
- NaHCO 3 v/v
- Plaque forming units assay Titers of Ad-36 virus are determined using A549 cells by this assay. Starting with 100 ⁇ l of virus suspension and 900 ul of media, serial 10 fold dilutions are made. A549 cells are grown to confluence in 6 well plates and 3 wells are used for each dilution. Three wells are used as the blank control and are not infected with the virus suspension. Media is removed from each cell and 100 ul of the serially diluted virus suspension are pipetted out in the wells. The plates are incubated at 37 0 C, shaking gently every 15 min. After 1 h of incubation, the viral suspension from the wells is removed and discarded.
- the wells are overlaid with about 3 ml of 1% agar in media per well, with Ix antibiotic-antimycotic solution.
- the plates are inverted and incubated at 37 0 C for 8 days until plaques appear. After 8 days, wells are stained overnight with about 1 ml of crystal violet per well. The next day, the number of plaques formed is counted after removing the agar. The number of plaques formed x dilution of viral suspension used gives PFU/100 uL of inoculum used. This is multiplied by 10 to express PFU/mL.
- Tissue culture infectivity dose (TCID50)(66-72): The titer of the work stocks that cause a cytopathic effect (CPE) in 50% of the wells containing A549 cells are calculated and expressed as tissue culture infectivity dose (TCID-50) units per ml.
- TCID-50 of the work stocks are determined using serial ten fold dilutions of the virus work stock.
- TCID50 is calculated by serially diluting the virus stock solution and inoculating cells with the dilutions to find out the reciprocal of the highest dilution of virus which causes cytopathic effect (CPE) in 50% of the cells inoculated. Titers are calculated after the cells inoculated with the virus dilutions are incubated at 37 0 C for 8 days.
- outer forward primer S'-GTCTGGAAAACTGAGTGTGGATA
- inner forward primer 5 ⁇ TTAACTGGAAAAGGAATAGGTA
- DNA is isolated from human breast and prostate tissues using a QIAamp Tissue Kit (Qiagen, Valencia, CA, USA; Cat # 29304). Negative PCR controls are water and DNA from A549 cells. Positive PCR control is DNA from Ad-36 infected A-549 cells. DNA is denatured for 2 min at 95 0 C and subjected to 35 cycles of PCR (94 0 C for 1 min, 55° C for 1 min, 72 0 C for 2 min) followed by incubation at 72 0 C for 5 min. PCR products are visualized on a 1% agarose gel with a size marker.
- This assay was developed at the University of Wisconsin and at that time the conditions were optimized for temperature, magnesium concentration, and number of cycles in samples consisting of animal and human tissues, and of 3T3-L1 cells.
- Samples of the PCR products are extracted from the gels and are sent to the University of Wisconsin Biotech Center for sequencing to insure that the amplified DNA sequences were from the targeted regions. The Biotech Center confirmed their accuracy. These quality control procedures are repeated to conform to CLIA specifications and good laboratory practice. DNA sequencing of two positive samples each of breast cancer and of prostate cancer and the A549 positive control DNA samples are performed to insure accuracy of the amplifications.
- the prevalence of Ad-36 in cancer patients is almost fourfold higher.
- About 50% of both breast and prostate cancer patients may be expected to be Ad-36 antibody positive based on the preliminary data.
- the Ad-36 prevalence may be lower in the banked samples from the NCI tissue banks (or Asterand tissue bank), and this would affect the power significantly. Therefore, 100 cancer subjects and 50 non-cancer subjects may be certain to have sufficient power.
- SEQ ID NO: 5 5'-AGTTGAAACAGCAAGAGACTCAAAG
- SEQ ID NO: 6 5'-GGTACTGGATCAAGTGCACATGGAG
- SEQ ID NO: 7 5 '-TTGAAACAGCAAGAGACTCAAAGCTAAC
- the assay involved direct detection and was by capillary electrophoresis using laser-induced fluorescence for detection. More particularly, a replaceable polyacrylamide matrix was employed in the electrophoretic separation and detection employed a dual system with 5'-labeling of the oligo and thiazole orange intercalator in the buffer system.
- probes, and primers when amplification is also used are advantageously employed to provide suitable specificity and sensitivity.
- Amplification methods using PCR and variations thereof maybe employed, as well known in the art.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Organic Chemistry (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Virology (AREA)
- Veterinary Medicine (AREA)
- Molecular Biology (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Microbiology (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biomedical Technology (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Genetics & Genomics (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Hematology (AREA)
- Physics & Mathematics (AREA)
- Urology & Nephrology (AREA)
- Analytical Chemistry (AREA)
- Diabetes (AREA)
- General Engineering & Computer Science (AREA)
- Biophysics (AREA)
- Pathology (AREA)
- Cell Biology (AREA)
- General Physics & Mathematics (AREA)
- Endocrinology (AREA)
- Food Science & Technology (AREA)
- Mycology (AREA)
- Epidemiology (AREA)
Priority Applications (7)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2008548837A JP2009521707A (ja) | 2005-12-27 | 2006-12-27 | 疾患のバイオマーカーとしての脂肪生成アデノウイルス |
| MX2008008453A MX2008008453A (es) | 2005-12-27 | 2006-12-27 | Adenovirus adipogenicos como biomarcadores para enfermedades. |
| BRPI0620755-3A BRPI0620755A2 (pt) | 2005-12-27 | 2006-12-27 | adenovìrus adipogênicos como um biomarcardor para doenças |
| CA002635269A CA2635269A1 (en) | 2005-12-27 | 2006-12-27 | Adipogenic adenoviruses as a biomarker for disease |
| AU2006342053A AU2006342053A1 (en) | 2005-12-27 | 2006-12-27 | Adipogenic adenoviruses as a biomarker for disease |
| EP06851054.4A EP1977009B1 (en) | 2005-12-27 | 2006-12-27 | Adipogenic adenoviruses as a biomarker for disease |
| CN200680053371.XA CN101389768B (zh) | 2005-12-27 | 2006-12-27 | 作为疾病的生物标志的生脂腺病毒 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US75340205P | 2005-12-27 | 2005-12-27 | |
| US60/753,402 | 2005-12-27 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007120362A2 true WO2007120362A2 (en) | 2007-10-25 |
| WO2007120362A3 WO2007120362A3 (en) | 2008-08-14 |
Family
ID=38610014
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2006/062632 Ceased WO2007120362A2 (en) | 2005-12-27 | 2006-12-27 | Adipogenic adenoviruses as a biomarker for disease |
Country Status (11)
| Country | Link |
|---|---|
| US (5) | US7442511B2 (cg-RX-API-DMAC7.html) |
| EP (2) | EP1977009B1 (cg-RX-API-DMAC7.html) |
| JP (1) | JP2009521707A (cg-RX-API-DMAC7.html) |
| KR (1) | KR20080114683A (cg-RX-API-DMAC7.html) |
| CN (1) | CN101389768B (cg-RX-API-DMAC7.html) |
| AU (1) | AU2006342053A1 (cg-RX-API-DMAC7.html) |
| BR (1) | BRPI0620755A2 (cg-RX-API-DMAC7.html) |
| CA (1) | CA2635269A1 (cg-RX-API-DMAC7.html) |
| MX (1) | MX2008008453A (cg-RX-API-DMAC7.html) |
| RU (1) | RU2008130893A (cg-RX-API-DMAC7.html) |
| WO (1) | WO2007120362A2 (cg-RX-API-DMAC7.html) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009111337A1 (en) | 2008-03-03 | 2009-09-11 | Irm Llc | Compounds and compositions as tlr activity modulators |
| WO2010011440A3 (en) * | 2008-06-16 | 2010-04-15 | Obetech Llc | Diagnosis and treatment of lipogenic adenovirus infection associated with adipose tissue hypertrophy |
| WO2010144734A1 (en) | 2009-06-10 | 2010-12-16 | Novartis Ag | Benzonaphthyridine-containing vaccines |
| WO2011027222A2 (en) | 2009-09-02 | 2011-03-10 | Novartis Ag | Immunogenic compositions including tlr activity modulators |
| WO2011049677A1 (en) | 2009-09-02 | 2011-04-28 | Irm Llc | Compounds and compositions as tlr activity modulators |
| WO2011057148A1 (en) | 2009-11-05 | 2011-05-12 | Irm Llc | Compounds and compositions as tlr-7 activity modulators |
| WO2011084549A1 (en) | 2009-12-15 | 2011-07-14 | Novartis Ag | Homogeneous suspension of immunopotentiating compounds and uses thereof |
| WO2011119759A1 (en) | 2010-03-23 | 2011-09-29 | Irm Llc | Compounds (cystein based lipopeptides) and compositions as tlr2 agonists used for treating infections, inflammations, respiratory diseases etc. |
| WO2012006359A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Delivery of self-replicating rna using biodegradable polymer particles |
| WO2012083302A2 (en) | 2010-12-17 | 2012-06-21 | Globeimmune, Inc. | Compositions and methods for the treatment or prevention of human adenovirus-36 infection |
| WO2014118305A1 (en) | 2013-02-01 | 2014-08-07 | Novartis Ag | Intradermal delivery of immunological compositions comprising toll-like receptor agonists |
| WO2019157509A1 (en) | 2018-02-12 | 2019-08-15 | Inimmune Corporation | Toll-like receptor ligands |
| WO2022096590A1 (en) | 2020-11-04 | 2022-05-12 | Eligo Bioscience | Phage-derived particles for in situ delivery of dna payload into c. acnes population |
Families Citing this family (11)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US7507418B2 (en) * | 2005-09-09 | 2009-03-24 | Obetech, Llc | Adenovirus status as a predictor of body composition change, disease status, and treatment outcomes |
| US7442511B2 (en) * | 2005-12-27 | 2008-10-28 | Obetech, Llc | Adipogenic adenoviruses as a biomarker for disease |
| US20120082659A1 (en) * | 2007-10-02 | 2012-04-05 | Hartmut Land | Methods And Compositions Related To Synergistic Responses To Oncogenic Mutations |
| JP2009156254A (ja) * | 2007-12-05 | 2009-07-16 | Ibiden Co Ltd | 排気ガス処理体の保持シール部材及び排気ガス処理装置 |
| WO2011050299A2 (en) * | 2009-10-22 | 2011-04-28 | Obetech Llc | Adenovirus infection in animals |
| US8591412B2 (en) * | 2009-11-18 | 2013-11-26 | Nohands, Llc | Method and system for preventing virus-related obesity and obesity related diseases |
| WO2011119915A2 (en) * | 2010-03-25 | 2011-09-29 | Obetech Llc | Method for detecting lipogenic adenovirus |
| US8951980B2 (en) * | 2010-07-08 | 2015-02-10 | Board Of Supervisors Of Louisiana State University And Agricultural And Mechanical College | Adenovirus Ad36 E4 orf1 protein for prevention and treatment of non-alcoholic fatty liver disease |
| WO2012006550A2 (en) * | 2010-07-09 | 2012-01-12 | Obetech Llc | Methods and compositions for treatment of lipogenic virus related conditions |
| US9925254B2 (en) | 2014-11-05 | 2018-03-27 | The United States Of America As Represented By The Secretary Of The Navy | Synthetic antigen constructs against Campylobacter jejuni |
| AU2019352906B2 (en) * | 2018-10-05 | 2026-01-22 | Minomic International Ltd. | Biomarker combinations for determining aggressive prostate cancer |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998044946A1 (en) | 1997-04-04 | 1998-10-15 | Obetech, Llc | Viral obesity methods and compositions |
Family Cites Families (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| AU692152B2 (en) * | 1993-03-17 | 1998-06-04 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Immunogenic chimeras comprising nucleic acid sequences encoding endoplasmic reticulum signal sequence peptides and at least one other peptide, and their uses in vaccines and disease treatments |
| JP2000072800A (ja) * | 1998-08-26 | 2000-03-07 | Toagosei Co Ltd | 抗アデノウイルス37型モノクローナル抗体及びその用途 |
| CA2632013C (en) * | 2005-11-30 | 2013-02-26 | Wayne State University | Adenovirus 36 e4 orf 1 gene and protein and their uses |
| US7442511B2 (en) * | 2005-12-27 | 2008-10-28 | Obetech, Llc | Adipogenic adenoviruses as a biomarker for disease |
-
2006
- 2006-12-27 US US11/616,799 patent/US7442511B2/en not_active Expired - Fee Related
- 2006-12-27 MX MX2008008453A patent/MX2008008453A/es active IP Right Grant
- 2006-12-27 BR BRPI0620755-3A patent/BRPI0620755A2/pt not_active Application Discontinuation
- 2006-12-27 CN CN200680053371.XA patent/CN101389768B/zh not_active Expired - Fee Related
- 2006-12-27 CA CA002635269A patent/CA2635269A1/en not_active Abandoned
- 2006-12-27 EP EP06851054.4A patent/EP1977009B1/en active Active
- 2006-12-27 RU RU2008130893/13A patent/RU2008130893A/ru not_active Application Discontinuation
- 2006-12-27 AU AU2006342053A patent/AU2006342053A1/en not_active Abandoned
- 2006-12-27 KR KR1020087018439A patent/KR20080114683A/ko not_active Ceased
- 2006-12-27 EP EP11176754A patent/EP2390372A1/en not_active Withdrawn
- 2006-12-27 JP JP2008548837A patent/JP2009521707A/ja active Pending
- 2006-12-27 WO PCT/US2006/062632 patent/WO2007120362A2/en not_active Ceased
-
2008
- 2008-10-24 US US12/257,937 patent/US7745110B2/en not_active Expired - Fee Related
- 2008-10-24 US US12/257,967 patent/US7910310B2/en not_active Expired - Fee Related
-
2011
- 2011-02-07 US US13/022,219 patent/US20110189235A1/en not_active Abandoned
-
2013
- 2013-08-14 US US13/966,631 patent/US20130323273A1/en not_active Abandoned
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998044946A1 (en) | 1997-04-04 | 1998-10-15 | Obetech, Llc | Viral obesity methods and compositions |
| US6127113A (en) | 1997-04-04 | 2000-10-03 | Obetech, Llc | Viral obesity methods and compositions |
| US6664050B1 (en) | 1997-04-04 | 2003-12-16 | Obetech, Llc | Viral obesity methods and compositions |
Non-Patent Citations (2)
| Title |
|---|
| See also references of EP1977009A4 |
| WINTERS; YOUNG, J COMP PATHOL., vol. 90, no. 2, April 1980 (1980-04-01), pages 197 - 207 |
Cited By (18)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2009111337A1 (en) | 2008-03-03 | 2009-09-11 | Irm Llc | Compounds and compositions as tlr activity modulators |
| WO2010011440A3 (en) * | 2008-06-16 | 2010-04-15 | Obetech Llc | Diagnosis and treatment of lipogenic adenovirus infection associated with adipose tissue hypertrophy |
| WO2010144734A1 (en) | 2009-06-10 | 2010-12-16 | Novartis Ag | Benzonaphthyridine-containing vaccines |
| WO2011027222A2 (en) | 2009-09-02 | 2011-03-10 | Novartis Ag | Immunogenic compositions including tlr activity modulators |
| WO2011049677A1 (en) | 2009-09-02 | 2011-04-28 | Irm Llc | Compounds and compositions as tlr activity modulators |
| WO2011057148A1 (en) | 2009-11-05 | 2011-05-12 | Irm Llc | Compounds and compositions as tlr-7 activity modulators |
| US10046048B2 (en) | 2009-12-15 | 2018-08-14 | Glaxosmithkline Biologicals S.A. | Homogenous suspension of immunopotentiating compounds and uses thereof |
| US9408907B2 (en) | 2009-12-15 | 2016-08-09 | Glaxosmithkline Biologicals Sa | Homogenous suspension of immunopotentiating compounds and uses thereof |
| WO2011084549A1 (en) | 2009-12-15 | 2011-07-14 | Novartis Ag | Homogeneous suspension of immunopotentiating compounds and uses thereof |
| WO2011119759A1 (en) | 2010-03-23 | 2011-09-29 | Irm Llc | Compounds (cystein based lipopeptides) and compositions as tlr2 agonists used for treating infections, inflammations, respiratory diseases etc. |
| WO2012006359A1 (en) | 2010-07-06 | 2012-01-12 | Novartis Ag | Delivery of self-replicating rna using biodegradable polymer particles |
| EP3611269A1 (en) | 2010-07-06 | 2020-02-19 | GlaxoSmithKline Biologicals SA | Delivery of self-replicating rna using biodegradable polymer particles |
| WO2012083302A2 (en) | 2010-12-17 | 2012-06-21 | Globeimmune, Inc. | Compositions and methods for the treatment or prevention of human adenovirus-36 infection |
| WO2014118305A1 (en) | 2013-02-01 | 2014-08-07 | Novartis Ag | Intradermal delivery of immunological compositions comprising toll-like receptor agonists |
| WO2019157509A1 (en) | 2018-02-12 | 2019-08-15 | Inimmune Corporation | Toll-like receptor ligands |
| EP4410802A2 (en) | 2018-02-12 | 2024-08-07 | Inimmune Corporation | Toll-like receptor ligands |
| WO2022096590A1 (en) | 2020-11-04 | 2022-05-12 | Eligo Bioscience | Phage-derived particles for in situ delivery of dna payload into c. acnes population |
| WO2022096596A1 (en) | 2020-11-04 | 2022-05-12 | Eligo Bioscience | Cutibacterium acnes recombinant phages, method of production and uses thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| US7442511B2 (en) | 2008-10-28 |
| US7910310B2 (en) | 2011-03-22 |
| CN101389768A (zh) | 2009-03-18 |
| US7745110B2 (en) | 2010-06-29 |
| KR20080114683A (ko) | 2008-12-31 |
| EP1977009A2 (en) | 2008-10-08 |
| RU2008130893A (ru) | 2010-02-10 |
| WO2007120362A3 (en) | 2008-08-14 |
| BRPI0620755A2 (pt) | 2011-11-22 |
| US20070218081A1 (en) | 2007-09-20 |
| US20090087833A1 (en) | 2009-04-02 |
| US20090087455A1 (en) | 2009-04-02 |
| US20110189235A1 (en) | 2011-08-04 |
| EP1977009B1 (en) | 2016-08-17 |
| US20130323273A1 (en) | 2013-12-05 |
| AU2006342053A1 (en) | 2007-10-25 |
| JP2009521707A (ja) | 2009-06-04 |
| CA2635269A1 (en) | 2007-10-25 |
| EP1977009A4 (en) | 2009-06-03 |
| CN101389768B (zh) | 2015-11-25 |
| EP2390372A1 (en) | 2011-11-30 |
| MX2008008453A (es) | 2008-11-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7910310B2 (en) | Adipogenic adenoviruses as a biomarker for disease | |
| Khalilian et al. | Bovine leukemia virus detected in the breast tissue and blood of Iranian women | |
| USRE42129E1 (en) | Viral obesity methods and compositions | |
| EP0217919A1 (en) | DNA SEQUENCES AND PEPTIDES SPECIFIC TO PAPILLOMA VIRUS. | |
| CN106399555A (zh) | 一种实时荧光定量pcr检测方法及其标准品和检测试剂盒 | |
| CN112266983A (zh) | 一种用于检测人乳头瘤病毒hpv16和hpv18的探针组及其试剂盒 | |
| US20090220946A1 (en) | Adenovirus status as a predictor of body composition change, disease status, and treatment outcomes | |
| Xu et al. | KAT8 facilitates the proliferation of cancer cells through enhancing E7 function in HPV-associated cervical cancer: Role of KAT8 in HPV-associated cervical cancer | |
| Egg et al. | The Controversial Link Between Human Papillomavirus Infection and Esophageal Health: An Exploratory Translational Study | |
| WO2010011440A2 (en) | Diagnosis and treatment of lipogenic adenovirus infection associated with adipose tissue hypertrophy | |
| CN119220503A (zh) | Bag6基因在调节流感病毒复制中的应用 | |
| KR100785397B1 (ko) | 인체 파필로마 바이러스 유사 입자를 생산하는 재조합아데노바이러스 벡터 및 자궁경부암 생백신 | |
| CN108754030A (zh) | 一种人ki多瘤病毒的荧光定量pcr引物和探针及其应用 | |
| Sun et al. | Isolation and identification of lymphocytic and myelogenous leukemia-specific sequences in genomes of gibbon oncornaviruses | |
| Persuy et al. | Cells Transformed by Transfer of Isolated Chromosomes from Virus-Transformed or ‘Spontaneous’ Tumor Cells: I. Biological Properties and Transplantability in Nude Mice | |
| CN112301166A (zh) | 一种用于检测人乳头瘤病毒hpv51的探针及其试剂盒 | |
| CN112522439A (zh) | 一种用于检测5种人乳头瘤病毒hpv分型和整合的探针组及其试剂盒 | |
| CN113322320A (zh) | 一种长非编码rna及其在诊断及治疗神经胶质瘤中的应用 | |
| CN120485195A (zh) | 一种靶向igf-1r的核酸适配体及其应用 | |
| Farrell | Effects of hormone response elements on SV40 life cycle | |
| CN112195286A (zh) | 一种用于检测人乳头瘤病毒hpv26的探针及其试剂盒 | |
| CN113599523A (zh) | GPx8作为分子靶点在制备预防和/或治疗脂肪肝的药物中的应用 | |
| US20120244187A1 (en) | Adenovirus Infection In Animals |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 06851054 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006342053 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2635269 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: MX/a/2008/008453 Country of ref document: MX Ref document number: 2008548837 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2006342053 Country of ref document: AU Date of ref document: 20061227 Kind code of ref document: A |
|
| REEP | Request for entry into the european phase |
Ref document number: 2006851054 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020087018439 Country of ref document: KR Ref document number: 2006851054 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008130893 Country of ref document: RU Ref document number: 3951/CHENP/2008 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200680053371.X Country of ref document: CN |
|
| ENP | Entry into the national phase |
Ref document number: PI0620755 Country of ref document: BR Kind code of ref document: A2 Effective date: 20080627 |