WO2007107789A2 - Treatment of cns conditions - Google Patents
Treatment of cns conditions Download PDFInfo
- Publication number
- WO2007107789A2 WO2007107789A2 PCT/GB2007/050128 GB2007050128W WO2007107789A2 WO 2007107789 A2 WO2007107789 A2 WO 2007107789A2 GB 2007050128 W GB2007050128 W GB 2007050128W WO 2007107789 A2 WO2007107789 A2 WO 2007107789A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- target gene
- sina
- cns
- compound
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K48/00—Medicinal preparations containing genetic material which is inserted into cells of the living body to treat genetic diseases; Gene therapy
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/54—Medicinal preparations containing antigens or antibodies characterised by the route of administration
- A61K2039/541—Mucosal route
- A61K2039/543—Mucosal route intranasal
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/30—Special therapeutic applications
- C12N2320/32—Special delivery means, e.g. tissue-specific
Definitions
- the present invention relates to methods and compositions for the treatment of pathologic conditions of the central nervous system (CNS) by means of intranasal administration of a composition that modulates, by means of RNA interference, the expression and/or activity of genes involved in above-mentioned conditions.
- the compositions of the invention comprise short interfering nucleic acid molecules (siNA) and related compounds including, but not limited to, small-interfering RNAs (siRNA).
- intranasally delivered siNA molecules targeting tau, huntingtin, acetylcholinesterase, as well as mutated alleles of these or other genes of the CNS are useful in the preparation of a medicament for the treatment of diseases of the CNS such as dementia, Alzheimer's, Huntington's and/or Parkinson's diseases, as well as congenital diseases associated with mutations of genes of the CNS amongst others.
- RNAi as a tool to modulate gene expression
- RNA interference refers to the process of sequence-specific post-trans criptional gene silencing mediated by double-stranded RNA (dsRNA).
- dsRNA double-stranded RNA
- Andy Fire and Craig Mello demonstrated that dsRNA specifically and selectively inhibited gene expression in an extremely efficient manner in Caenorhabditis elegans (Fire et ah, 1998).
- the sequence of the first strand (sense RNA) coincided with that of the corresponding region of the target messenger RNA (mRNA).
- the second strand (antisense RNA) was complementary to the mRNA.
- the resulting dsRNA turned out to be several orders of magnitude more efficient than the corresponding single-stranded RNA molecules (in particular, antisense RNA).
- RNAi The process of RNAi begins when the enzyme DICER encounters dsRNA and chops it into pieces called small-interfering RNAs or siRNA.
- This protein belongs to the RNase III nuclease family. A complex of proteins gathers up these RNA remains and uses their code as a guide to search out and destroy any RNAs in the cell with a matching sequence, such as target mRNA (see Bosher & Labouesse, 2000; and Akashi et al., 2001).
- RNAi for gene knockdown
- mammalian cells have developed various protective mechanisms against viral infections that could impede the use of this approach. Indeed, the presence of extremely low levels of viral dsRNA triggers an interferon response, resulting in a global non-specific suppression of translation, which in turn triggers apoptosis (Williams, 1997, Gil & Esteban, 2000).
- dsRNA was reported to specifically inhibit three genes in the mouse oocyte and early embryo. Translational arrest, and thus a PKR response, was not observed as the embryos continued to develop (Wianny & Zernicka-Goetz, 2000).
- Research at Ribopharma AG demonstrated the functionality of RNAi in mammalian cells, using short (20-24 base pairs) dsRNAs to switch off genes in human cells without initiating the acute-phase response. Similar experiments carried out by other research groups confirmed these results (Elbashir et al., 2001; Caplen et ah, 2001).
- RNAs short hairpin RNAs
- siRNAs small RNAs
- stRNAs small temporally regulated RNAs
- RNAi has rapidly become a well recognized tool for validating (identifying and assigning) gene functions.
- RNAi employing short dsRNA oligonucleotides will yield an understanding of the function of genes being only partially sequenced.
- 'antagomirs' can effectively silence the action of microRNAs (miRNAs), non-coding pieces of RNA that regulate gene expression (Krutzfeldt et al., 2005).
- nucleic acids for intranasal delivery have been suggested as including dsDNA, dsRNA, ssDNA, ssRNA, short interfering RNA, micro-RNA, and antisense RNA (see US2005/0265927, and WO2005/115358).
- RNAi-inducing agents into the lung include cationic polymers, modified cationic polymers, lipids, and surfactants suitable for introduction
- acetylcholinesterase inhibitors such as galantamine and various salts and derivatives of galantamine
- treatment of neurodegenerative disorders by means of discharging small interfering RNA into the CNS has previously been obtained by surgically implanting a catheter (see for example WO2005/116212).
- WO02/086105 describes methods for delivery of oligonucleotides to the CNS via neural pathways originating in the nasal cavity. The use of antisense oligonucleotides is discussed, but no reference to RNA interference is made.
- BACE beta-secretase
- APP amyloid precursor protein
- PS-I presenilin 1
- PS-2 presenilin 2
- siNA both in cell culture as well as in vivo by means of strategies including intrathecal and intracerebroventricular administration, implantation of catheters and pumps, by chemical or osmotic opening of the blood-brain barrier, or by direct injection or perfusion into the brain arterial system (i. e.: into the striatum, cortex) - see for example WO2005/003350, US2005/042646, and GB2415961).
- AD Alzheimer's disease
- AP beta-amyloid
- APP amyloid precursor protein
- APP amyloid precursor protein
- Tau the major component of neurofibrillary tangles, likewise plays a significant role in AD pathogenesis (Lee et al., 2001). Mutations in tau cause a similar dominantly inherited neurodegenerative disease, frontotemporal dementia with parkinsonism linked to chromosome 17 (FTDP- 17). In FTDP- 17, tau mutations either alter the tau protein sequence or lead to aberrant splicing (Lee et al., 2001; Lewis et al., 2001; Oddo et al., 2003). Abnormalities of tau expression also contribute to several other important neurodegenerative disorders, including progressive supranuclear palsy and cortical- basal ganglionic degeneration (Houlden et al., 2001). Thus, efforts to reduce tau expression, either generally or in an allele-specific manner, may prove to be therapeutically useful in FTDP- 17, AD or other tau-related diseases.
- the present invention provides methods and compositions for the treatment of pathologies of the central nervous system (CNS) by means of intranasal administration of compounds which cause RNA interference,
- compositions of the invention comprise short interfering nucleic acid molecules (siNA) and related compounds including, but not limited to, small interfering RNA (siRNA), double-stranded RNA (dsRNA), short hairpin RNA (shRNA), micro-RNA (miRNA), antagomirs, and molecules capable of mediating RNA interference.
- siNA small interfering nucleic acid molecules
- dsRNA double-stranded RNA
- shRNA short hairpin RNA
- miRNA micro-RNA
- antagomirs molecules capable of mediating RNA interference.
- the methods of the invention comprise the administration to a patient in the need thereof of an effective amount of one or more siNA of the invention for the treatment of a CNS pathological condition,
- the methods of the invention comprise intranasal administration of the therapeutic siNA.
- the compositions of the invention can be used in the preparation of a medicament for the treatment of CNS pathologies including dementia, Alzheimer's, Huntington's and/or Parkinson's diseases, as well as congenital diseases associated with mutations of genes of the CNS amongst others.
- Pathologies and diseases which may be treated according to the methods of the invention preferably include those affecting the hippocampus, the cortex, and/or the striatum.
- the present invention relates to siNA or similar chemically synthesized entities, that are directed at interfering with the mRNA expression of tau, huntingtin or acetylcholinesterase genes, as well as of mutated alleles of these or other genes of the CNS that ultimately modulate the amount of protein produced.
- compositions of the present invention are intranasally administered for specifically targeting the abnormal version of the gene of interest within the CNS.
- Figure 1 GFP expression levels after intranasal administration to mice of 0.9 % NaCl (Control), 1 nmol/ ul siRNA-GFP (Mouse 1), 2 nmol/ ul siRNA-GFP (Mouse 2), and 2 nmol/ ul siRNA-GFP + TransIT-TKO (Mouse 3). Analysis of cortex, hippocampus, striatum and bulb of the CNS were carried out.
- siRNA reduces levels of GFP protein.
- siRNA designed against GFP was intranasally administered in transgenic GFP mice. Animals were sacrificed at different times and tissues collected were analyzed by Western Blot. Saline control was administered in mice CI, CII and CIII as control. The values show the GFP protein expression levels normalized to the GFP protein of control mice.
- siRNA reduces levels of GFP mRNA levels.
- siRNA designed against GFP was intranasally administered in transgenic GFP mice. Animals were sacrificed at different times and mRNA from different tissues collected. In this figure GFP mRNA expression of Striatum and Cortex was analyzed by quantitative PCR.
- siRNA reduces levels of MAPT gene transcript with different mutations.
- siRNAs designed to different mutations were analyzed Seq ID 159 (P301L mutation) and Seq ID 160 (R406W mutation).
- RNA was prepared from cells treated with the specific siRNAs for 48 h. The samples were analysed by quantitative PCR using specific primers for MAPT (described in the text). The values show the mean expression levels of different transcripts normalized to 18S relative to mock transfected cells as control.
- siRNA reduces levels of MAPT gene transcript.
- RNA was prepared from MDA-MB-435 cells treated with different siRNAs for 24, 48 h and 72h. The samples were analyzed by real time PCR using specific primers, described in the text. The values show the mean expression levels of different transcripts normalized to 18S relative to mock transfected control.
- siRNA Seq ID 160 designed to R406W mutation reduces MAPT protein levels in vivo.
- siRNA Seq ID 160 was intranasally administered in transgenic MAPT mice. Animals were sacrificed at seven days upon siRNA administration and hippocampus tissue was analyzed by Western Blot.
- Figure 8 Sequence listing of regions of MAPT targeted by siNA of the invention, and of siNA duplexes targeting these regions.
- the present invention relates to methods and compositions for the treatment of CNS pathologies by means of intranasal administration of compounds which cause RNAi
- the compositions of the invention comprise short interfering nucleic acid molecules (siNA) that modulate the expression of target genes associated with abnormal conditions of the CNS.
- siNA short interfering nucleic acid molecules
- the methods of the invention comprise the administration to a patient in need thereof of an effective amount of one or more siNA of the invention.
- a gene is "targeted" by siNA according to the invention when, for example, the siNA selectively decrease or inhibit the expression of the gene or of an allele of the gene involved in a pathological condition.
- siNA target a gene when the siNA hybridize under stringent conditions to the gene transcript.
- siNA can be tested either in vitro or in vivo for the ability to target a gene.
- a short fragment of the target gene sequence (e.g., 19-40 nucleotides in length) is chosen as the sequence of the siNA of the invention.
- the variable region of the allele of interest is selected as target of the siNA compounds, hi one embodiment, the siNA is siRNA. hi such embodiments, the short fragment of target gene sequence is a fragment of the target gene mRNA.
- the criteria for choosing a sequence fragment from the target gene mRNA to be a candidate siRNA molecule include: 1) a sequence from the target gene mRNA that is at least 50- 100 nucleotides from the 5' or 3' end of the native mRNA molecule; 2) a sequence from the target gene mRNA that has a G/C content of between 30% and 70%, most preferably around 50%; 3) a sequence from the target gene mRNA that does not contain repetitive sequences (e.g., AAA, CCC, GGG, TTT, AAAA, CCCC, GGGG, TTTT); 4) a sequence from the target gene mRNA that is accessible in the mRNA; and 5) a sequence from the target gene mRNA that is unique to the target gene.
- the sequence fragment from the target gene mRNA may meet one or more of the above-mentioned identified criteria.
- the siRNA has a G/C content below 60% and/or lacks repetitive sequences.
- the gene of interest is introduced as a nucleotide sequence in a prediction program that takes into account all the variables described above for the design of optimal oligonucleotides.
- This program scans any mRNA nucleotide sequence for regions susceptible to be targeted by siRNA.
- the output of this analysis is a score of possible siRNA oligonucleotides.
- the highest scores are used to design double stranded RNA oligonucleotides (typically 21 bp long, although other lengths are also possible) that are typically made by chemical synthesis.
- Candidate oligonucleotides can further be filtered for interspecies sequence conservation in order to facilitate the transition from animal to human clinical studies.
- siNA molecules may be used to target homologous regions.
- WO2005/045037 describes the design of siNA molecules to target such homologous sequences, for example by incorporating non-canonical base pairs, for example mismatches and/or wobble base pairs, that can provide additional target sequences, hi instances where mismatches are identified, non-canonical base pairs (for example, mismatches and/or wobble bases) can be used to generate siNA molecules that target more than one gene sequence.
- non-canonical base pairs such as UU and CC base pairs are used to generate siNA molecules that are capable of targeting sequences for differing targets that share sequence homology.
- siNAs of the invention are designed to include nucleic acid sequence that is complementary to the nucleotide sequence that is conserved between homologous genes.
- a single siNA can be used to inhibit expression of more than one gene instead of using more than one siNA molecule to target different genes.
- Sequence identity may be calculated by sequence comparison and alignment algorithms known in the art (see Gribskov and Devereux, Sequence Analysis Primer, Stockton Press, 1991, and references cited therein) and calculating the percent difference between the nucleotide sequences by, for example, the Smith-Waterman algorithm as implemented in the BESTFIT software program using default parameters (e.g., University of Wisconsin Genetic Computing Group). Greater than 90%, 95%, or 99% sequence identity between the siNA and the portion of the target gene is preferred.
- the complementarity between the siNA and native RNA molecule may be defined functionally by hybridisation as well as functionally by its ability to decrease or inhibit the expression of a target gene.
- siNA molecules of the invention are double stranded.
- double stranded siNA molecules comprise blunt ends.
- double stranded siNA molecules comprise overhanging nucleotides (e.g., 1-5 nucleotide overhangs, preferably 2 nucleotide overhangs).
- the overhanging nucleotides are 3' overhangs.
- the overhanging nucleotides are 5' overhangs. Any type of nucleotide can be a part of the overhang.
- the overhanging nucleotide or nucleotides are ribonucleic acids. In another embodiment, the overhanging nucleotide or nucleotides are deoxyribonucleic acids, hi a preferred embodiment, the overhanging nucleotide or nucleotides are thymidine nucleotides. In another embodiment, the overhanging nucleotide or nucleotides are modified or non- classical nucleotides. The overhanging nucleotide or nucleotides may have non-classical internucleotide bonds (e.g., other than phosphodiester bond).
- siNA can be synthesized by any method known in the art.
- RNAs are preferably chemically synthesized using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer.
- siRNA can be obtained from commercial RNA oligo synthesis suppliers, including, but not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cmachem (Glasgow, UK), Qiagen (Germany) Ambion (USA) and rnvitrogen (Scotland).
- siNA molecules of the invention can be expressed in cells by transfecting the cells with vectors containing the reverse complement siNA sequence under the control of a promoter. Once expressed, the siNA can be isolated from the cell using techniques well known in the art.
- RNA oligo 50 ⁇ M solution 30 ⁇ l of each RNA oligo 50 ⁇ M solution are to be combined in 100 mM potassium acetate, 30 mM HEPES-KOH pH 7.4, 2 mM magnesium acetate. The solution is then incubated for 1 minute at 90 0 C, centrifuged for 15 seconds, and incubated for 1 hour at 37°C.
- the siRNA is a short hairpin RNA (shRNA)
- the two strands of the siRNA molecule may be connected by a linker region (e.g., a nucleotide linker or a non-nucleotide linker).
- the siNAs of the invention may contain one or more modified nucleotides and/or non- phosphodiester linkages. Chemical modifications well known in the art are capable of increasing stability, availability, and/or cell uptake of the siNA. The skilled person will be aware of other types of chemical modification which may be incorporated into RNA molecules (see International Publications WO03/070744 and WO2005/045037 for an overview of types of modifications).
- modifications can be used to provide improved resistance to degradation or improved uptake.
- modifications include phosphorothioate intemucleotide linkages, 2'-O-methyl ribonucleotides (especially on the sense strand of a double stranded siRNA), 2'-deoxy-fluoro ribonucleotides, 2'-deoxy ribonucleotides, "universal base” nucleotides, 5-C-methyl nucleotides, and inverted deoxyabasic residue incorporation (see generally GB2406568).
- modifications can be used to enhance the stability of the siRNA or to increase targeting efficiency.
- Modifications include chemical cross linking between the two complementary strands of an siRNA, chemical modification of a 3' or 5' terminus of a strand of an siRNA, sugar modifications, nucleobase modifications and/or backbone modifications, 2'-fluoro modified ribonucleotides and 2'-deoxy ribonucleotides (see generally International Publication WO2004/029212).
- modifications can be used to increase or decrease affinity for the complementary nucleotides in the target mRNA and/or in the complementary siNA strand (see generally International Publication WO2005/044976).
- an unmodified pyrimidine nucleotide can be substituted for a 2-thio, 5-alkynyl, 5 -methyl, or 5-propynyl pyrimidine.
- an unmodified purine can be substituted with a 7-deza, 7-alkyl, or 7-alkenyl purine.
- the siNA when the siNA is a double-stranded siRNA, the 3 '-terminal nucleotide overhanging nucleotides are replaced by deoxyribonucleotides (see generally Elbashir et al., 2001).
- the invention features a double-stranded short interfering nucleic acid (siNA) molecule that down-regulates expression of a target gene, preferably a gene expressed in the CNS, more preferably a MAPT gene, wherein the siNA molecule is assembled from two separate oligonucleotide fragments wherein one fragment comprises the sense region and the second fragment comprises the antisense region of the siNA molecule.
- siNA short interfering nucleic acid
- each of the two 3' terminal nucleotides of each fragment of the siNA molecule is a 2'-deoxy-pyrimidine nucleotide, such as a 2'-deoxy-thymidine.
- all 21 nucleotides of each fragment of the siNA molecule are base-paired to the complementary nucleotides of the other fragment of the siNA molecule.
- about 19 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene.
- about 21 nucleotides of the antisense region are base-paired to the nucleotide sequence or a portion thereof of the RNA encoded by the target gene.
- the 5'-end of the fragment comprising said antisense region can optionally include a phosphate group.
- the invention features a siNA molecule, wherein either or both of the sense or antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, preferably from 1 to 5, phosphorothioate internucleotide linkages, and/or one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more), preferably from 1 to 5, 2'-deoxy, 2 1 -O-methyl, 2'-deoxy-2'-fluoro, and/or about one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more), preferably from 1 to 5, universal base modified nucleotides, and optionally a terminal cap molecule at the 3'-end, the 5'-end, or both of the 3'- and 5'-ends of either or both of the sense or antisense strand.
- the sense or antisense strand comprises one or more, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, preferably from 1 to
- one or more, for example about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, preferably from 1 to 5, pyrimidine nucleotides of the sense and/or antisense siNA strand are chemically-modified with 2'-deoxy, 2'-O-methyl and/or 2'-deoxy-2'-fluoro nucleotides, optionally with one or more, for example about I 3 2, 3, 4, 5, 6, 7, 8, 9, 10, or more, preferably from 1 to 5, phosphorothioate internucleotide linkages and/or a terminal cap molecule at the 3'-end, the 5 '-end, or both of the 3'- and 5 '-ends, being present in the same or different strand.
- the invention features a chemically-modified short interfering nucleic acid (siNA) molecule having about 1 to about 5 or more (specifically about 1, 2, 3, 4, 5 or more) phosphorothioate internucleotide linkages in each strand of the siNA molecule.
- siNA short interfering nucleic acid
- the invention features a siNA molecule comprising 2'-5' internucleotide linkages.
- the 2'-5' internucleotide linkage(s) can be at the 3'-end, the 5'- end, or both of the 3'- and 5'-ends of one or both siNA sequence strands, hi addition, the 2'-5' internucleotide linkage(s) can be present at various other positions within one or both siNA sequence strands, for example, about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a pyrimidine nucleotide in one or both strands of the siNA molecule can comprise a 2'-5 r internucleotide linkage, or about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more including every internucleotide linkage of a purine nucleotide in one or both strands of the siNA molecule can comprise a 2'-5' internucleotide linkage.
- a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) locked nucleic acid (LNA) nucleotides, for example, at the 5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination thereof, of the siNA molecule.
- LNA locked nucleic acid
- a siNA molecule of the invention comprises one or more (e.g., about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, or more) acyclic nucleotides, for example, at the 5'-end, the 3'-end, both of the 5' and 3'-ends, or any combination thereof, of the siNA molecule
- the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein any (e.g., one or more or all) pyrimidine nucleotides present in either or both the sense or antisense region are T- deoxy-2'-fluoro pyrimidine nucleotides, and wherein any (e.g., one or more or all) purine nucleotides present in either or both the sense or the antisense region are T- deoxy purine nucleotides.
- the invention features a chemically-modified short interfering nucleic acid (siNA) molecule of the invention, wherein any (e.g., one or more or all) pyrimidine nucleotides present in either or both the sense or antisense region are T- deoxy-2'-fluoro pyrimidine nucleotides, and wherein any (e.g., one or more or all) purine nucleotides present in either or both the sense or antisense region are 2'-O- methyl purine nucleotides.
- any nucleotides comprising a 3 '-terminal nucleotide overhang that are present in said sense or antisense region are 2'-deoxy nucleotides.
- the invention features a chemically synthesized double stranded RNA molecule that directs cleavage of a target RNA, preferably an RNA expressed in the CNS, more preferably a MAPT RNA, via RNA interference, wherein each strand of said RNA molecule is about 21 to about 23 nucleotides in length; one strand of the RNA molecule comprises nucleotide sequence having sufficient complementarity to the target RNA for the RNA molecule to direct cleavage of the target RNA via RNA interference; and wherein at least one strand of the RNA molecule comprises one or more chemically modified nucleotides described herein, such as deoxynucleotides, T- O-methyl nucleotides, 2'-deoxy-2'-fluoro nucloetides, 2 r -O-metlioxyethyl nucleotides etc.
- the invention features a medicament comprising a siNA molecule of the invention. In one embodiment, the invention features an active ingredient comprising a siNA molecule of the invention.
- the invention features the use of a double-stranded short interfering nucleic acid (siNA) molecule to down-regulate expression of a target gene, preferably a gene expressed in the CNS, more preferably a MAPT gene, wherein the siNA molecule comprises one or more chemical modifications and each strand of the double- stranded siNA is about 18 to about 28 or more (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, or 28 or more) nucleotides long.
- siNA short interfering nucleic acid
- the invention features a double-stranded short interfering nucleic acid (siNA) molecule that inhibits expression of a target gene, preferably a gene expressed in the CNS, more preferably a MAPT gene, wherein one of the strands of the double-stranded siNA molecule is an antisense strand which comprises nucleotide sequence that is complementary to nucleotide sequence of target RNA or a portion thereof, the other strand is a sense strand which comprises nucleotide sequence that is complementary to a nucleotide sequence of the antisense strand and wherein a majority of the pyrimidine nucleotides present in the double-stranded siNA molecule comprises a sugar modification.
- siNA short interfering nucleic acid
- the target RNA or portion thereof encodes a protein or portion thereof.
- the 5' end of the antisense strand includes a phosphate group.
- the nucleotide sequence or a portion thereof of the antisense strand may be complementary to a nucleotide sequence of the untranslated region or a portion thereof of the target RNA.
- each strand of the siNA molecule comprises about 18 to about 29 or more (e.g., about 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 or more) nucleotides, wherein each strand comprises at least about 18 nucleotides that are complementary to the nucleotides of the other strand.
- the siNA molecule is assembled from two oligonucleotide fragments, wherein one fragment comprises the nucleotide sequence of the antisense strand of the siNA molecule and a second fragment comprises nucleotide sequence of the sense region of the siNA molecule, hi one embodiment, the sense strand is connected to the antisense strand via a linker molecule, such as a polynucleotide linker or a non-nucleotide linker, hi a further embodiment, the pyrimidine nucleotides present in the sense strand are 2'-deoxy- 2'fLuoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2'-deoxy purine nucleotides.
- a linker molecule such as a polynucleotide linker or a non-nucleotide linker
- the pyrimidine nucleotides present in the sense strand are 2'-deoxy- 2'
- the pyrimidine nucleotides present in the sense strand are 2'-deoxy-2'fluoro pyrimidine nucleotides and the purine nucleotides present in the sense region are 2'-O-methyl purine nucleotides.
- the pyrimidine nucleotides present in the antisense strand are T- deoxy-2'-fluoro pyrimidine nucleotides and any purine nucleotides present in the antisense strand are 2'-deoxy purine nucleotides.
- the antisense strand comprises one or more 2'-deoxy-2'-fluoro pyrimidine nucleotides and one or more 2'-O-methyl purine nucleotides.
- the pyrimidine nucleotides present in the antisense strand are 2 r -deoxy-2'-fluoro pyrimidine nucleotides and any purine nucleotides present in the antisense strand are 2'-O-methyl purine nucleotides.
- the sense strand comprises a 3'-end and a 5'-end, wherein a terminal cap moiety (e.g., an inverted deoxy abasic moiety or inverted deoxy nucleotide moiety such as inverted thymidine) is present at the 5 '-end, the 3 '-end, or both of the 5 r and 3 1 ends of the sense strand.
- the antisense strand comprises a phosphorothioate internucleotide linkage at the 3' end of the antisense strand.
- the antisense strand comprises a glyceryl modification at the 3' end.
- the 5'-end of the antisense strand optionally includes a phosphate group.
- each of the two strands of the siNA molecule can comprise about 21 nucleotides.
- each of the two 3' terminal nucleotides of each fragment of the siNA molecule is a 2'-deoxy-pyrimidine, such as 2'-deoxy-thymidine.
- each strand of the siNA molecule is base-paired to the complementary nucleotides of the other strand of the siNA molecule. In one embodiment, about 19 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the target RNA or a portion thereof. In one embodiment, about 21 nucleotides of the antisense strand are base-paired to the nucleotide sequence of the target RNA or a portion thereof.
- the invention features a composition comprising a siNA molecule of the invention in a pharmaceutically acceptable carrier or diluent.
- the introduction of chemically-modified nucleotides into nucleic acid molecules provides a powerful tool in overcoming potential limitations of in vivo stability and bioavailability inherent to native RNA molecules that are delivered exogenously.
- the use of chemically-modified nucleic acid molecules can enable a lower dose of a particular nucleic acid molecule for a given therapeutic effect since chemically-modified nucleic acid molecules tend to have a longer half-life in serum.
- certain chemical modifications can improve the bioavailability of nucleic acid molecules by targeting particular cells or tissues and/or improving cellular uptake of the nucleic acid molecule.
- the overall activity of the modified nucleic acid molecule can be greater than that of the native molecule due to improved stability and/or delivery of the molecule.
- chemically-modified siNA can also minimize the possibility of activating interferon activity in humans.
- the antisense region of a siNA molecule of the invention can comprise a phosphorothioate internucleotide linkage at the 3'-end of said antisense region.
- the antisense region can comprise about one to about five phosphorothioate intemucleotide linkages at the 5'-end of said antisense region, hi any of the embodiments of siNA molecules described herein, the 3'-terminal nucleotide overhangs of a siNA molecule of the invention can comprise ribonucleotides or deoxyribonucleotides that are chemically-modified at a nucleic acid sugar, base, or backbone.
- the 3'- terminal nucleotide overhangs can comprise one or more universal base ribonucleotides, In any of the embodiments of siNA molecules described herein, the 3'-terminal nucleotide overhangs can comprise one or more acyclic nucleotides.
- siNA molecules have blunt ends.
- the invention encompasses siNA molecules that are 40 nucleotides or less and comprise a nucleotide sequence of any of SEQ ID NOS: 1-160 of Figure 8.
- the siNA is 21-30 nucleotides long and comprises any one of SEQ ID NOS:161"318 of Figure 8.
- the invention features a method of modulating the expression of a target gene, preferably a gene expressed in the CNS, more preferably a MAPT gene in a subject or organism comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the target gene; and (b) introducing the siNA molecule into the subject or organism under conditions suitable to modulate the expression of the target gene in the subject or organism.
- the level of target protein or RNA can be determined using various methods well-known in the art.
- the invention features a method of modulating the expression of more than one target gene, preferably genes expressed in the CNS, more preferably including at least one MAPT gene in a subject or organism comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein one of the siNA strands comprises a sequence complementary to RNA of the target genes; and (b) introducing the siNA molecules into the subject or organism under conditions suitable to modulate the expression of the target genes in the subject or organism.
- the level of target protein or RNA can be determined as is known in the art.
- the invention features a method for modulating the expression of a target gene, preferably a gene expressed in the CNS, more preferably a MAPT gene within a cell comprising: (a) synthesizing a siNA molecule of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the target gene; and (b) introducing the siNA molecule into a cell under conditions suitable to modulate the expression of the target gene in the cell.
- the invention features a method for modulating the expression of more than one target gene, preferably genes expressed in the CNS, more preferably including at least one MAPT gene within a cell comprising: (a) synthesizing siNA molecules of the invention, which can be chemically-modified, wherein the siNA comprises a single stranded sequence having complementarity to RNA of the target gene; and (b) contacting the cell in vitro or in vivo with the siNA molecule under conditions suitable to modulate the expression of the target genes in the cell.
- preliminary testing can be carried out in cell cultures expressing target genes.
- the cells are incubated with the corresponding siRNA duplexes, followed by analysis of gene expression levels.
- siRNA knockdown to specific phenotypes in cultured cells
- mRNA levels of the target gene can be quantitated by real time PCR (RT-PCR).
- RT-PCR real time PCR
- protein levels can be determined in a variety of ways well known in the art, such as Western blot analysis with specific antibodies to the different targets allow direct monitoring of the reduction of targeted protein.
- siRNA are introduced into cells by means of any transfection technique well known in the art.
- a single transfection of siRNA duplex can be performed, for instance, by using a cationic lipid, such as Lipofectamine 2000 Reagent (Invitrogen), followed by an assay of silencing efficiency 24, 48 and 72 hours after transfection.
- the efficiency of transfection may depend on the cell type, but also on the passage number and the confluency of the cells.
- the time and the manner of formation of siRNA-liposome complexes are also critical. Low transfection efficiencies are the most frequent cause of unsuccessful silencing. Good transfection is a non-trivial issue and needs to be carefully examined for each new cell line to be used.
- Transfection efficiency may be tested transfecting reporter genes, for example a CMV-driven EGFP-expression plasmid (e.g. from Clontech) or a B-GaI expression plasmid, and then assessed by phase contrast and/or fluorescence microscopy the next day.
- CMV-driven EGFP-expression plasmid e.g. from Clontech
- B-GaI expression plasmid e.g. from Clontech
- a knock-down phenotype may become apparent after 1 to 3 days, or even later.
- depletion of the protein may be observed by immunofluorescence or Western blotting.
- the present invention may comprise the administration of one or more species of siNA molecule simultaneously. These species may be selected to target one or more target genes.
- a single type of siNA is administered in the therapeutic methods of the invention.
- a siNA of the invention is administered in combination with another siNA of the invention and/or with one or more other non- siNA therapeutic agents useful in the treatment, prevention or management of a disease condition of the CNS.
- the term "in combination with” is not limited to the administration of therapeutic agents at exactly the same time, but rather it is meant that the siNAs of the invention and the other agent are administered to a patient in a sequence and within a time interval such that the benefit of the combination is greater than the benefit if they were administered otherwise.
- each therapeutic agent may be administered at the same time or sequentially in any order at different points in time; however, if not administered at the same time, they should be administered sufficiently close in time so as to provide the desired therapeutic effect.
- Each therapeutic agent can be administered separately, in any appropriate form and by any suitable route.
- siNAs of the invention may be formulated into pharmaceutical compositions by any of the conventional techniques known in the art (see for example, Alfonso, G. et al., 1995, in: The Science and Practice of Pharmacy, Mack Publishing, Easton PA, 19th ed.).
- Formulations comprising one or more siNAs for use in the methods of the invention may be in numerous forms, and may depend on the various factors specific for each patient (e.g., the type and severity of disorder, type of siNA administered, age, body weight, response, and the past medical history of the patient), the number and type of siNAs in the formulation, the form of the composition (e.g., in liquid, semi-liquid or solid form) and/or the therapeutic regime (e.g. whether the therapeutic agent is administered over time as a slow infusion, a single bolus, once daily, several times a day or once every few days).
- the therapeutic regime e.g. whether the therapeutic agent is administered over time as a slow infusion, a single bolus, once daily
- siNA molecules of the invention and formulations or compositions thereof may be administered directly or topically as is generally known in the art.
- a siNA molecule can comprise a delivery vehicle, including liposomes, for administration to a subject.
- Carriers and diluents and their salts can be present in pharmaceutically acceptable formulations.
- Nucleic acid molecules can be administered to cells by a variety of methods known to those of skill in the art, including, but not restricted to, encapsulation in liposomes, by iontophoresis, or by incorporation into other vehicles, such as biodegradable polymers, hydrogels, cyclodextrins poly (lactic-co-glycolic) acid
- nucleic acid molecules of the invention can also be formulated or complexed with polyethyleneimine and derivatives thereof, such as polyethyleneimine- polyethyleneglycol-N- acetylgalactosamine (PEI-PEG-GAL) or polyethyleneimine- polyethyleneglycol-tri-N- acetylgalactosamine (PEI-PEG-triGAL) derivatives.
- polyethyleneimine- polyethyleneglycol-N- acetylgalactosamine PEI-PEG-GAL
- PEI-PEG-triGAL polyethyleneimine- polyethyleneglycol-tri-N- acetylgalactosamine
- a siNA molecule of the invention may be complexed with membrane disruptive agents and/or a cationic lipid or helper lipid molecule.
- Delivery systems which may be used with the invention include, for example, aqueous and non aqueous gels, creams, multiple emulsions, microemulsions, liposomes, ointments, aqueous and non aqueous solutions, lotions, aerosols, hydrocarbon bases and powders, and can contain excipients such as solubilizers, permeation enhancers (e, g,, fatty acids, fatty acid esters, fatty alcohols and amino acids), and hydrophilic polymers (e. g. , polycarbophil and polyvinylpyrolidone).
- the pharmaceutically acceptable carrier is a liposome or a transdermal enhancer.
- a pharmaceutical formulation of the invention is in a form suitable for administration, e.g., systemic or local administration, into a cell or subject, including for example a human. Suitable forms, in part, depend upon the use or the route of entry, for example oral, transdermal, or by injection. Other factors are known in the art, and include considerations such as toxicity and forms that prevent the composition or formulation from exerting its effect.
- compositions prepared for storage or administration that include a pharmaceutically effective amount of the desired compounds in a pharmaceutically acceptable carrier or diluent.
- Acceptable carriers or diluents for therapeutic use are well known in the pharmaceutical art.
- preservatives, stabilizers, dyes and flavouring agents can be provided. These include sodium benzoate, sorbic acid and esters of p-hydroxybenzoic acid.
- antioxidants and suspending agents can be used.
- a pharmaceutically effective dose is that dose required to prevent, inhibit the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state.
- the pharmaceutically effective dose depends on the type of disease, the composition used, the route of administration, the type of mammal being treated, the physical characteristics of the specific mammal under consideration, concurrent medication, and other factors that those skilled in the medical arts will recognize.
- formulations of the invention can be administered in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants and/or vehicles.
- Formulations for oral use can also be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example peanut oil, liquid paraffin or olive oil.
- Aqueous suspensions contain the active materials in a mixture with excipients suitable for the manufacture of aqueous suspensions.
- excipients are suspending agents, for example sodium carboxymethylcellulose, methylcellulose, hydropropyl- methylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents can be a naturally-occurring phosphatide, for example, lecithin, or condensation products of an alkylene oxide with fatty acids, for example polyoxyethylene stearate, or condensation products of ethylene oxide with long chain aliphatic alcohols, for example heptadecaethyleneoxycetanol, or condensation products of ethylene oxide with partial esters derived from fatty acids and a hexitol such as polyoxyethylene sorbitol monooleate, or condensation products of ethylene oxide with partial esters derived from fatty acids and hexitol anhydrides, for example polyethylene sorbitan monoole
- the aqueous suspensions can also contain one or more preservatives, for example ethyl, or n-propyl p-hydroxybenzoate, one or more colouring agents, one or more flavouring agents, and one or more sweetening agents, such as sucrose or saccharin.
- preservatives for example ethyl, or n-propyl p-hydroxybenzoate
- colouring agents for example ethyl, or n-propyl p-hydroxybenzoate
- flavouring agents such as sucrose or saccharin.
- sweetening agents such as sucrose or saccharin.
- Oily suspensions can be formulated by suspending the active ingredients in a vegetable oil, for example arachis oil, olive oil, sesame oil or coconut oil, or in a mineral oil such as liquid paraffin.
- the oily suspensions can contain a thickening agent, for example beeswax, hard paraffin or cetyl alcohol. These compositions can be preserved by the addition of an anti-oxidant such as ascorbic acid.
- Dispersible powders and granules suitable for preparation of an aqueous suspension by the addition of water provide the active ingredient in admixture with a dispersing or wetting agent, suspending agent and one or more preservatives.
- a dispersing or wetting agent exemplified by those already mentioned above.
- Additional excipients for example sweetening, flavouring and colouring agents, can also be present.
- compositions of the invention can also be in the form of oil-in- water enmlsions.
- the oily phase can be a vegetable oil or a mineral oil or mixtures of these.
- Suitable emulsifying agents can be naturally-occurring gums, for example gum acacia or gum tragacanth, naturally- occurring phosphatides, for example soy bean, lecithin, and esters or partial esters derived from fatty acids and hexitol, anhydrides, for example sorbitan monooleate, and condensation products of the said partial esters with ethylene oxide, for example polyoxyethylene sorbitan monooleate.
- the emulsions can also contain sweetening and flavouring agents.
- This suspension can be formulated according to the known art using those suitable dispersing or wetting agents and suspending agents that have been mentioned above.
- a sterile injectable preparation can also be a sterile injectable solution or suspension in a non-toxic parentally acceptable diluent or solvent, for example as a solution in 1,3- butanediol.
- a non-toxic parentally acceptable diluent or solvent for example as a solution in 1,3- butanediol.
- acceptable vehicles and solvents that can be employed are water, Ringer's solution and isotonic sodium chloride solution, hi addition, sterile, fixed oils are conventionally employed as a solvent or suspending medium.
- any bland fixed oil can be employed including synthetic mono-or diglycerides.
- fatty acids such as oleic acid find use in the preparation of i ⁇ jectables.
- nucleic acid molecules of the present invention can also be administered to a subject in combination with other therapeutic compounds to increase the overall therapeutic effect.
- the use of multiple compounds to treat an indication can increase the beneficial effects while reducing the presence of side effects.
- siNA molecules of the invention can be expressed within cells from eukaryotic promoters.
- Recombinant vectors capable of expressing the siNA molecules can be delivered and persist in target cells.
- vectors can be used that provide for transient expression of nucleic acid molecules. Such vectors can be repeatedly administered as necessary.
- the siNA molecule interacts with the target mRNA and generates an RNAi response. Delivery of siNA molecule expressing vectors can be systemic, such as by intravenous or intra-muscular administration, by administration to target cells ex-planted from a subject followed by reintroduction into the subject, or by any other means that would allow for introduction into the desired target cell.
- GFP C57BL/6-TG mice This transgenic mouse line was bought from "The Jackson Laboratory”. Transgenic mice have been used because homozygous mice for this transgene die within the first two weeks following birth.
- the transgenic mouse line with an "enhanced" GFP (EGFP) cDNA under the control of a chicken beta-actin promoter and cytomegalovirus enhancer makes all of the tissues, with the exception of erythrocytes and hair, appear green under excitation light.
- This strain was generated in C57BL/6 mice.
- the strain cDNA encoding enhanced green fluorescent protein (EGFP) was adjoined to the chicken beta actin promoter and cytomegalovirus enhancer.
- a bovine globin polyadenylation signal was also included in the construct.
- the EcoRI sites included in the PCR primers were used to introduce the amplified EGFP cDNA into a pCAGGS expression vector containing the chicken beta-actin promoter and cytomegalovirus enhancer, beta-actin intron and bovine globin poly-adenylation signal.
- the entire insert with the promoter and coding sequence was excised with Bam-HI and Sail and gel-purified.
- siRNA used to downregulate EGFP mRNA expression targeted the following sequence in EGFP mRNA (SEQ ID 319): 5'-GGC UAC GUC CAG GAG CGC Aces'.
- the sense strand of the siRNA duplex was 5'-P GGC UAC GUC CAG CGC Aces' and the antisense strand was 5'-P U GCG CUC CUG GAC GUA GCC UU-3' (SEQ ID 320).
- siRNA duplex used in the experiments described below had two 2 thymidine nucleotide 3' overhang.
- mice For the intranasal delivery experiments C57BL/6-TG (ACTB-EGFP) male mice (8 week old) were used. Mice intranasally instilled with siRNA diluted in NaCl 0.9% were compared with control mice instilled with the vehicle (NaCl 0.9%). Animals were anesthetized with isofluorane and 20 ⁇ l of each solution were dropped into each nostril.
- siRNA vs EGFP mRNA (-/+ transfection lipid) were administered intranasally in a final volume of 20 ⁇ l. Control animals were treated with the vehicle alone. In all cases animals were sacrificed over a range of days after the administration of the drug in order to find the optimal time for interference.
- mice were sacrificed with CO 2 and brains were quickly dissected out onto an ice-cold plate. One half was processed for Western-blotting, while the other half was processed for immunohistochemistry.
- sample tissues were collected from different cerebral areas and analyzed by Western blot and real-time PCR. GFP expression in the different treatment conditions was measured with the assistance of an Adobe Photoshop program. Inhibition levels were obtained after normalization with respect to the beta-actin gene, which is constitutively expressed in the different tissues.
- mice treated intranasally with one dose of 530 ug (40 nanomols) of the naked siRNA for GFP were named as mice 1 , 2 and 3 and sacrificed at 3 and 5 days after inoculation of siRNA.
- Another experimental group (numbered as 4, 5, 6, 7, 8 and 9) consisted of animals treated with two doses of 265 ug (20 nanomols) of stabilized siRNA and sacrificed at 3, 5 and 8 days (Table 1).
- sample tissues were collected by two methods: one in protein buffer lysis medium and the other in RNAlater (Ambion). Afterwards small pieces of tissue were included in OCT in order to analyze the immunofluorescence signal of GFP protein in the tissue. All samples were stored at -8O 0 C until data processing.
- Table 1 Schematic distribution of experimental conditions for intranasal siRNA delivery. Doses of siRNA are indicated in the table.
- Extracts for Western blot analysis were prepared by homogenizing the brain areas in ice-cold extraction buffer consisting of 2OmM HEPES, pH 7.4, 100 mM NaCl, 20 mM NaF, 1% Triton X-100, 1 mM sodium orthovanadate, 5 mM EDTA, 1 ⁇ M okadaic acid and protease inhibitors (2 mM PMSF, 10 ⁇ g/ml aprotinin, 10 ⁇ g/ml leupeptin, and 10 ⁇ g/ml pepstatin). The samples were homogenized and centrifuged at 15,000 X g for 20 min at 4°C. Protein contained in the supernatant was determined by Bradford.
- Brains for immunohistochemistry were fixed in 4% paraformaldehyde in Sorensen's buffer overnight and cryoprotected in 30% sucrose solution. Brains were cut in thirty- micrometer sagittal sections on a freezing microtome (Leica, Nussloch, Germany) and collected in a cryoprotecting solution consisting of 30% ethylene glycol, 26% glycerol and phosphate buffer, pH 7.2. Next, brain sections were analyzed by fluorescence microscopy.
- RNAlater Tissues isolated in RNAlater were stored at -8O 0 C. RNAlater was removed before RNA extraction because of its density. RNA is isolated with the Trizol Reagent (hivitrogen) according to the manufacturer protocol, DNAse treatment is done before measurement of GFP expression by quantitative PCR.
- the siRNA application is made in order to determine whether siRNA delivery to the brain takes place. Since the goal is to determine the downregulation of GFP gene transcript, levels of fluorescence were measured following siRNA application. No secondary effects were observed in the animals along the experimental protocols.
- the siRNA application was made in order to determine the proper intranasal siRNA delivery in the Central Nervous System (CNS). Mice treated with 20 ⁇ l of NaCl (0.9%) (control), or with 20 ⁇ l siRNA at a concentration of 1 nmol/ ⁇ l (Mouse 1), 2 nmol/ ⁇ l (Mouse 2), or 2 nmol/ ⁇ l + Transfection Lipid TransIT-TKO (Mouse 3), were sacrificed 48 h after treatment. No secondary effects were observed in the animals during the experimental protocols.
- CNS Central Nervous System
- Samples of different regions of the CNS cortex, hippocampus, striatum or bulb), as well as of different tissues (trachea, lung, nasal epithelium, esophagus) were extracted, and further analysed by Western blot with antibodies that specifically recognize GFP and immunoflurescence as described above.
- antibodies vs beta- actin were used as a loading control.
- mice treated with 20 ⁇ l of NaCl (0.9%) (control), or with 20 ⁇ l siRNA at a concentration of 40 nmol or 20 nmol, were sacrificed at 3, 5, and 8 days after treatment. No secondary effects were observed in the animals during the experimental protocols.
- Samples of different regions of the CNS were extracted, and further analysed by means of Western blot and immunofluorescence with antibodies that specifically recognize GFP.
- antibodies vs beta-actin were used as a loading control.
- MAPT microtubule associated protein tau
- siRNA transfection consist of a single transfection of siRNA duplex using a cationic lipid, such as Lipofectamine 2000 Reagent (Invitrogen) and making a read out for silencing 24, 48 and 72 hours after transfection.
- a cationic lipid such as Lipofectamine 2000 Reagent (Invitrogen)
- a typical transfection protocol can be performed as follows: For one well of a 6-well plate, we transfect using 10OnM for human MD A-MB -435 cells as final concentration of siRNA. Following Lipofectamine 2000 Reagent protocol, the day before transfection, we seed 2-4 x 10 5 cells per well in 3ml of an appropriate growth medium, containing DMEM, 10% serum, antibiotics and glutamine, and incubate cells under normal growth conditions (37°C and 5% CO 2 ). On the day of transfection, cells have to be at 30-50% confluence.
- the efficiency of transfection may depend on the cell type, but also on the passage number and the confluency of the cells.
- the time and the manner of formation of siRNA-liposome complexes are also critical. Low transfection efficiencies are the most frequent cause of unsuccessful silencing. Good transfection is a non-trivial issue and needs to be carefully examined for each new cell line to be used.
- Transfection efficiency may be tested transfecting reporter genes, for example a CMV-driven EGFP-expression plasmid (e.g. from Clontech) or a B-GaI expression plasmid, and then assessed by phase contrast and/or fluorescence microscopy the next day.
- a knock-down phenotype may become apparent after 1 to 3 days, or even later.
- depletion of the protein may be observed by immunofluorescence or Western blotting.
- RNA fractions extracted from cells were pre-treated with DNase I and used for reverse transcription using a random primer.
- PCR-amplified with a specific primer pair covering at least one exon-exon junction in order to control for amplification of pre-mRNAs.
- RT/PCR of a non-targeted mRNA is also needed as control. Effective depletion of the mRNA yet undetectable reduction of target protein may indicate that a large reservoir of stable protein may exist in the cell.
- Real-time PCR amplification can be used to test in a more precise way the mRNA decrease or disappearance.
- Quantitative PCR monitors the fluorescence emitted during the reaction as an indicator of amplicon production during each PCR cycle.
- This signal increases in direct proportion to the amount of PCR product in a reaction.
- qRT-PCR was performed according to the manufacturer protocol (Applied Biosystems). Reaction conditions were established for the Applied Biosystems 7300 and one step RT-PCR reaction was realized. Reaction volume of 25 ul consists of 2X SyBr green, MultiscribeTM reverse transcriptase 6.25U, RNase inhibitor and 5OnM of forward and reverse primers mixed with lOOng of the template RNA. Specific primers to MAPT were designed and 18S was analyzed as housekeeping gene. The forward primer had the sequence: AAGAGCCGCCTGCAGACA (SEQ ID NO 321) while the reverse primer had the sequence GAGCCGATCTTGGACTTGACA (SEQ ID NO 322).
- Reverse transcription was carried out with an initial step of 30' at 48 0 C.
- Thermal cycling parameters were, 95 0 C for 10 min, 40 cycles of 95 0 C for 15 sec and 6O 0 C for 1 min.
- Dissociation curves were also analyzed to checked the amplification specificity.
- Threshold cycle (Ct) values of each sample were compared to the control 24h sample to determine the percentage of downregulation of each gene after siRNA transfection.
- the first step was to perform experiments in MDA-MB -435 cell cultures. These assays were performed in two parts. First, siRNAs designed against the MAPT mutations described in Figure 7 were transfected. Afterwards, siRNAs against MAPT wild type were designed and the downregulation of MAPT after transfection was analysed.
- Figure 4 shows representative results of quantitative PCR experiments for some of the mutations of MAPT previously described in Figure 7.
- Figure 8 shows the target sequences in MAPT (SEQ ID NO 1-160) against which siNA were designed. The siNA duplexes are given as SEQ ID NO 161-318.
- siRNAs designed against the mutations MAPT P301L (target region given as Seq ID 159) and MAPT R406W (target region given as Seq ID 160) to downregulate the levels of MAPT mRNA were analyzed.
- the values shown in Figure 4 represent the mean of the percentage of siRNA interference over gene expression once normalized with the control cells and their standard deviations.
- the level of the MAPT transcript at 48h was reduced in a 20% after the siRNA Seq ID 159 treatment (specific to MAPT P301L).
- the reduction of MAPT upon siRNA Seq ED 160 (specific to MAPT R406W) transfection reached up to 40% over the control levels.
- different siRNAs directed to MAPT wt were designed.
- siRNA corresponding to Seq ID 128, reduced the MAPT transcript in a 70% being this reduction very sustained along 48h and 72 h.
- siRNA Seq ID 129 also reached a very good level of downregulation of MAPT about 60% compared to the mock transfected cells.
- MAPT involved in fronto -temporal dementia was downregulated in an appropriate MAPT Transgenic mouse model.
- a plasmid pSGT42 (Montejo de Garcini et al., 1994) which encodes a human 4-repeat tau isoform with two N-terminal exons was used as a template to introduce the FTDP- 17 mutations G272V and P301L separately with the Quikchange (Stratagene) procedure.
- a triple mutant tau cDNA was then assembled by ligation of the restriction fragments SacII/Asel (containing the G272Vmutation) and Asel/Hindlll (containing the P301L mutation) into the plasmid ⁇ SGTR406W (Perez, M., Lim, F., Arrasate, M., and Avila, J.
- the FTDP-17- linked mutation R406W abolishes the interaction of phosphorylated tau with microtubules. J. Neurochem. 74: 2583-2589) previously cut with SacII/HindiTI to give rise to the plasmid pSGTVLW.
- the mutant tau open reading frame was excised from pSGTVLW as a BamHI/Bglll fragment and ligated into the BamHI site of PBKCMV (Stratagene) in the forward orientation with respect to the CMV promoter to produce pBKVLW.
- the Sall/Xhol fragment of pB KVLW was then ligated into the Xhol site of pTSC21k (Luthi et al., 1997) in the forward orientation with respect to the thyl promoter.
- the resulting plasmid pTTVLW was confirmed to encode the three specific amino acid changes G272V, P301L, and R406W by sequencing of the SacII-Hindlll region.
- Vector sequences were eliminated by Notl digestion and gel purification of the large fragment, which was then introduced by pronuclear injection into single- cell CBA 3C57BL/6 embryos. Founder mice were identified by PCR and crossed with wild-type C57BL/6 mice. All transgenic mice analyzed were heterozygotes.
- mice were housed four per cage with food and water available ad libitum and maintained in a temperature- controlled environment on a 12/12 h light-dark cycle, with light onset at 07:00 h.
- PCR screening was performed on tail DNA using the oligonucleotides TTl, 5'- CTCTGCCCTCTGTTCTCTGG-3' (SEQ ID 323, in exon 2 of the murine thyl gene); TT2, S'-CCTGTCCCCCAACCCGTACG-S' (SEQ ID 324; at the 59 end of the human tau cDNA); and THY, S'-CGCTGATGGCTGGGTTCATG-S' (SEQ ID 325; in intron 2 of the murine thyl gene).
- TTl and TT2 were used to amplify a 470-bp product specifically from the transgene and not from endogenous murine DNA, while as an internal control for DNA, TTl and THY were used to amplify a 450-bp product specifically from murine genomic DNA but not from the transgene.
- the transgenes were predominantly expressed in hippocampus and fronto temporal cortex.
- mice were treated with 20 ⁇ l of NaCl (0.9%) (control), or with 20 ⁇ l siRNA at a concentration of 20 nmol.
- mice were treated intranasally with one or two doses of the siRNA for MAPT (Seq ID 160) and sacrificed at different times after inoculations of siRNA.
- Table 2 Schematic distribution of experimental conditions for intranasal siRNA delivery. Doses of siRNA are indicated in the table.
- Samples of different regions of the CNS were extracted, and further analysed by Western blot, immunofluorescence and quantitative PCR.
- Antibody that specifically recognize the mutated human MAPT were employed.
- As a loading control antibodies vs beta-actin were used.
- MAPT expression in the different treatment conditions was measured with the assistance of an Adobe Photoshop program. Inhibition levels were obtained after normalization with respect to the beta-actin gene, which is constitutively expressed in the different tissues.
- Bosher JM Labouesse M. RNA interference: genetic wand and genetic watchdog. Nat Cell Biol, 200O 5 2(2):E31-6.
- RNA interference is mediated by 21- and 22- nucleotide RNAs. Genes Dev, 2001, 15(2): 188-200.
- Tau is a candidate gene for chromosome 17 frontotemporal dementia.
- Wianny F Zernicka-Goetz M. Specific interference with gene function by double- stranded RNA in early mouse development. Nat Cell Biol., 2000, 2(2):70-5.
Landscapes
- Health & Medical Sciences (AREA)
- Engineering & Computer Science (AREA)
- Life Sciences & Earth Sciences (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Molecular Biology (AREA)
- Biotechnology (AREA)
- General Engineering & Computer Science (AREA)
- Wood Science & Technology (AREA)
- Zoology (AREA)
- Neurology (AREA)
- Neurosurgery (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Biochemistry (AREA)
- Plant Pathology (AREA)
- Psychology (AREA)
- Hospice & Palliative Care (AREA)
- Psychiatry (AREA)
- Epidemiology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicinal Preparation (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US12/293,230 US8871729B2 (en) | 2006-03-17 | 2007-03-16 | Treatment of CNS conditions |
| CA2645120A CA2645120C (en) | 2006-03-17 | 2007-03-16 | Treatment of cns conditions |
| HK09105618.2A HK1126812B (en) | 2006-03-17 | 2007-03-16 | Treatment of cns conditions |
| EP07733553.7A EP2004823B1 (en) | 2006-03-17 | 2007-03-16 | Treatment of cns conditions |
| CN200780017978.7A CN101448944B (zh) | 2006-03-17 | 2007-03-16 | Cns病症的治疗 |
| ES07733553.7T ES2582649T3 (es) | 2006-03-17 | 2007-03-16 | Tratamiento de afecciones del SNC |
| AU2007228570A AU2007228570B2 (en) | 2006-03-17 | 2007-03-16 | Treatment of CNS conditions |
| JP2008558913A JP5781722B2 (ja) | 2006-03-17 | 2007-03-16 | Cns状態の治療 |
| MX2008011731A MX2008011731A (es) | 2006-03-17 | 2007-03-16 | Tratamiento de condiciones del snc. |
| KR1020147013792A KR101605144B1 (ko) | 2006-03-17 | 2007-03-16 | Cns 질환의 치료 |
| KR1020087025174A KR101669944B1 (ko) | 2006-03-17 | 2007-03-16 | Cns 질환의 치료 |
| IL194114A IL194114A (en) | 2006-03-17 | 2008-09-15 | Use of RNA compound interferes with the preparation of drugs for the treatment of central nervous system disorder, medicinal preparations for intraperitoneal administration containing one or more SINAs directed to the gene expressed in the central nervous system. |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| GBGB0605337.5A GB0605337D0 (en) | 2006-03-17 | 2006-03-17 | Treatment of CNS conditions |
| GB0605337.5 | 2006-03-17 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2007107789A2 true WO2007107789A2 (en) | 2007-09-27 |
| WO2007107789A3 WO2007107789A3 (en) | 2008-05-08 |
Family
ID=36292900
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/GB2007/050128 Ceased WO2007107789A2 (en) | 2006-03-17 | 2007-03-16 | Treatment of cns conditions |
Country Status (13)
| Country | Link |
|---|---|
| US (1) | US8871729B2 (https=) |
| EP (1) | EP2004823B1 (https=) |
| JP (2) | JP5781722B2 (https=) |
| KR (2) | KR101669944B1 (https=) |
| CN (1) | CN101448944B (https=) |
| AU (1) | AU2007228570B2 (https=) |
| CA (1) | CA2645120C (https=) |
| ES (1) | ES2582649T3 (https=) |
| GB (1) | GB0605337D0 (https=) |
| IL (1) | IL194114A (https=) |
| MX (1) | MX2008011731A (https=) |
| RU (1) | RU2426544C2 (https=) |
| WO (1) | WO2007107789A2 (https=) |
Cited By (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010080452A2 (en) | 2008-12-18 | 2010-07-15 | Quark Pharmaceuticals, Inc. | siRNA COMPOUNDS AND METHODS OF USE THEREOF |
| WO2011066475A1 (en) | 2009-11-26 | 2011-06-03 | Quark Pharmaceuticals, Inc. | Sirna compounds comprising terminal substitutions |
| US20110135613A1 (en) * | 2009-12-03 | 2011-06-09 | The J. David Gladstone Institutes | Methods for treating apolipoprotein e4-associated disorders |
| WO2011072091A1 (en) | 2009-12-09 | 2011-06-16 | Quark Pharmaceuticals, Inc. | Methods and compositions for treating diseases, disorders or injury of the cns |
| EP2380595A1 (en) | 2010-04-19 | 2011-10-26 | Nlife Therapeutics S.L. | Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types |
| WO2012078536A2 (en) | 2010-12-06 | 2012-06-14 | Quark Pharmaceuticals, Inc. | Double stranded oligonucleotide compounds comprising positional modifications |
| WO2014043291A1 (en) | 2012-09-12 | 2014-03-20 | Quark Pharmaceuticals, Inc. | Double-stranded nucleic acid compounds |
| WO2014064257A1 (en) | 2012-10-26 | 2014-05-01 | Nlife Therapeutics, S.L. | Compositions and methods for the treatment of parkinson disease by the selective delivery of oligonucleotide molecules to specific neuron types |
| WO2015015498A1 (en) | 2013-07-31 | 2015-02-05 | Qbi Enterprises Ltd. | Methods of use of sphingolipid polyalkylamine oligonucleotide compounds |
| EP2831232A4 (en) * | 2012-03-30 | 2015-11-04 | Univ Washington | METHOD FOR MODULATING TAU EXPRESSION TO REDUCE PROBLEMS AND MODIFY A NEURODEGENERATIVE SYNDROME |
| US9193969B2 (en) | 2010-04-19 | 2015-11-24 | Nlife Therapeutics, S.L. | Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types |
| WO2016151523A1 (en) * | 2015-03-25 | 2016-09-29 | Università Degli Studi Di Trento | Rna interference mediated therapy for neurodegenerative diseases |
| EP3019175A4 (en) * | 2013-07-11 | 2017-03-08 | The Trustees of Columbia University in the City of New York | Micrornas that silence tau expression |
| US9644207B2 (en) | 2013-03-14 | 2017-05-09 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating Tau expression |
| US9683235B2 (en) | 2013-07-19 | 2017-06-20 | Ionis Pharmaceuticals, Inc. | Compositions for modulating Tau expression |
| US10407680B2 (en) | 2016-09-29 | 2019-09-10 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing Tau expression |
| WO2019175260A3 (en) * | 2018-03-13 | 2019-11-14 | Janssen Pharmaceutica Nv | Modified oligonucleotides for use in treatment of tauopathies |
| US11473083B2 (en) | 2015-12-21 | 2022-10-18 | Novartis Ag | Compositions and methods for decreasing tau expression |
| WO2023220349A1 (en) * | 2022-05-12 | 2023-11-16 | Dicerna Pharmaceuticals, Inc. | Compositions and methods for inhibiting mapt expression |
| US11993790B2 (en) | 2017-10-03 | 2024-05-28 | Prevail Therapeutics, Inc. | Gene therapies for lysosomal disorders |
| US12049626B2 (en) | 2017-10-03 | 2024-07-30 | Prevail Therapeutics, Inc. | Gene therapy for neurodegenerative disorders |
| EP4121537A4 (en) * | 2020-03-18 | 2024-07-31 | University Of Massachusetts | OLIGONUCLEOTIDES FOR MAPT MODULATION |
| WO2024145474A3 (en) * | 2022-12-29 | 2024-08-22 | Voyager Therapeutics, Inc. | Compositions and methods for regulating mapt |
| EP4126230A4 (en) * | 2020-03-30 | 2025-07-30 | Alnylam Pharmaceuticals Inc | MICROTUBULE-ASSOCIATED PROTEIN TAU (MAPT) RNAI AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
| EP4405484A4 (en) * | 2021-09-24 | 2026-03-04 | Alnylam Pharmaceuticals Inc | ARNI AGENT COMPOSITIONS TARGETING MICROTUBULE-ASSOCIATED TAU PROTEIN (MAPT) AND THEIR METHODS OF USE |
Families Citing this family (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2145014B1 (en) * | 2007-04-05 | 2012-12-12 | The J. David Gladstone Institutes | Agents that reduce neuronal overexcitation |
| NZ714887A (en) * | 2009-09-11 | 2019-07-26 | Ionis Pharmaceuticals Inc | Modulation of huntingtin expression |
| WO2011106104A2 (en) * | 2010-02-26 | 2011-09-01 | Memorial Sloan-Kettering Cancer Center | Methods and compositions for the detection and treatment of cancer involving mirnas and mirna inhibitors and targets |
| WO2012058210A1 (en) * | 2010-10-29 | 2012-05-03 | Merck Sharp & Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA) |
| WO2012123819A1 (en) * | 2011-03-15 | 2012-09-20 | Optinose As Et Al | Nasal delivery |
| US9486540B2 (en) * | 2012-03-09 | 2016-11-08 | Northeastern University | Methods for delivery to the central nervous system of nucleic acid nanoparticles to treat central nervous system disorders |
| US20140302510A1 (en) * | 2012-04-06 | 2014-10-09 | Centre National De La Recherche Scientifique | Method of diagnosis, prognostic or treatment of neurodegenerative diseases |
| WO2015089375A1 (en) * | 2013-12-13 | 2015-06-18 | The General Hospital Corporation | Soluble high molecular weight (hmw) tau species and applications thereof |
| CN113817728A (zh) * | 2020-06-19 | 2021-12-21 | 四川大学华西医院 | 一种有效干扰Tau蛋白表达的重组慢病毒及其应用 |
Family Cites Families (25)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CA2116460A1 (en) | 1993-03-02 | 1994-09-03 | Mitsubishi Chemical Corporation | Preventive or therapeutic agents for alzheimer's disease, a screening method of alzheimer's disease and tau-protein kinase i originated from human being |
| US6410046B1 (en) * | 1996-11-19 | 2002-06-25 | Intrabrain International Nv | Administering pharmaceuticals to the mammalian central nervous system |
| WO2002086105A1 (en) | 2001-04-20 | 2002-10-31 | Chiron Corporation | Delivery of polynucleotide agents to the central nervous sysstem |
| US20050159376A1 (en) * | 2002-02-20 | 2005-07-21 | Slrna Therapeutics, Inc. | RNA interference mediated inhibition 5-alpha reductase and androgen receptor gene expression using short interfering nucleic acid (siNA) |
| IL143379A (en) | 2001-05-24 | 2013-11-28 | Yissum Res Dev Co | Oligonucleotide against human ache isoform r and its uses |
| EP1432724A4 (en) | 2002-02-20 | 2006-02-01 | Sirna Therapeutics Inc | RNA inhibition mediated inhibition of MAP KINASE GENES |
| GB2406568B (en) | 2002-02-20 | 2005-09-28 | Sirna Therapeutics Inc | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) |
| EP1495120B1 (en) | 2002-04-18 | 2012-10-10 | Acuity Pharmaceuticals, Inc | Means and methods for the specific modulation of target genes in the eye |
| US20030225031A1 (en) | 2002-05-21 | 2003-12-04 | Quay Steven C. | Administration of acetylcholinesterase inhibitors to the cerebral spinal fluid |
| US20040254146A1 (en) | 2002-05-21 | 2004-12-16 | Nastech Pharmaceutical Company Inc. | Carboxylate salts of galantamine and their pharmaceutical use |
| US20050042646A1 (en) | 2002-08-05 | 2005-02-24 | Davidson Beverly L. | RNA interference suppresion of neurodegenerative diseases and methods of use thereof |
| US20040241854A1 (en) | 2002-08-05 | 2004-12-02 | Davidson Beverly L. | siRNA-mediated gene silencing |
| US20050106731A1 (en) | 2002-08-05 | 2005-05-19 | Davidson Beverly L. | siRNA-mediated gene silencing with viral vectors |
| CA2881743A1 (en) | 2002-09-25 | 2004-04-08 | University Of Massachusetts | In vivo gene silencing by chemically modified and stable sirna |
| US20050008617A1 (en) | 2002-09-28 | 2005-01-13 | Massachusetts Institute Of Technology | Compositions and methods for delivery of short interfering RNA and short hairpin RNA |
| AU2003290586B2 (en) * | 2002-11-04 | 2009-07-02 | University Of Massachusetts | Allele-specific RNA interference |
| US7829694B2 (en) | 2002-11-26 | 2010-11-09 | Medtronic, Inc. | Treatment of neurodegenerative disease through intracranial delivery of siRNA |
| WO2005004794A2 (en) * | 2003-06-09 | 2005-01-20 | Alnylam Pharmaceuticals Inc. | Method of treating neurodegenerative disease |
| EP1636342A4 (en) | 2003-06-20 | 2008-10-08 | Isis Pharmaceuticals Inc | OLIGOMER COMPOUNDS FOR USE IN THE MODULATION OF GENES |
| CA2528963A1 (en) | 2003-06-27 | 2005-01-13 | Sirna Therapeutics, Inc. | Rna interference mediated treatment of alzheimer's disease using short interfering nucleic acid (sina) |
| US20070185042A1 (en) | 2003-08-08 | 2007-08-09 | The Brigham And Women's Hospital, Inc. President And Fellows Of Harvard College | Sirna based methods for treating alzheimer's disease |
| WO2005045037A2 (en) | 2003-10-23 | 2005-05-19 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF 5-ALPHA REDUCTASE AND ANDROGEN RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| WO2005105995A2 (en) | 2004-04-14 | 2005-11-10 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED TREATMENT OF POLYGLUTAMINE (POLYQ) REPEAT EXPANSION DISEASES USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| US20050265927A1 (en) | 2004-05-17 | 2005-12-01 | Yale University | Intranasal delivery of nucleic acid molecules |
| WO2006041922A2 (en) | 2004-10-08 | 2006-04-20 | Dara Biosciences, Inc. | Agents and methods for administration to the central nervous system |
-
2006
- 2006-03-17 GB GBGB0605337.5A patent/GB0605337D0/en not_active Ceased
-
2007
- 2007-03-16 WO PCT/GB2007/050128 patent/WO2007107789A2/en not_active Ceased
- 2007-03-16 CN CN200780017978.7A patent/CN101448944B/zh active Active
- 2007-03-16 EP EP07733553.7A patent/EP2004823B1/en active Active
- 2007-03-16 CA CA2645120A patent/CA2645120C/en active Active
- 2007-03-16 US US12/293,230 patent/US8871729B2/en active Active
- 2007-03-16 AU AU2007228570A patent/AU2007228570B2/en active Active
- 2007-03-16 ES ES07733553.7T patent/ES2582649T3/es active Active
- 2007-03-16 MX MX2008011731A patent/MX2008011731A/es active IP Right Grant
- 2007-03-16 KR KR1020087025174A patent/KR101669944B1/ko active Active
- 2007-03-16 RU RU2008141162/15A patent/RU2426544C2/ru active
- 2007-03-16 KR KR1020147013792A patent/KR101605144B1/ko active Active
- 2007-03-16 JP JP2008558913A patent/JP5781722B2/ja active Active
-
2008
- 2008-09-15 IL IL194114A patent/IL194114A/en active IP Right Grant
-
2013
- 2013-08-02 JP JP2013161765A patent/JP5923466B2/ja active Active
Cited By (46)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010080452A2 (en) | 2008-12-18 | 2010-07-15 | Quark Pharmaceuticals, Inc. | siRNA COMPOUNDS AND METHODS OF USE THEREOF |
| WO2011066475A1 (en) | 2009-11-26 | 2011-06-03 | Quark Pharmaceuticals, Inc. | Sirna compounds comprising terminal substitutions |
| US9701960B2 (en) | 2009-11-26 | 2017-07-11 | Quark Pharmaceuticals, Inc. | siRNA compounds comprising terminal substitutions |
| US8796239B2 (en) | 2009-11-26 | 2014-08-05 | Quark Pharmaceuticals, Inc. | Sirna compounds comprising terminal substitutions |
| US10494631B2 (en) | 2009-11-26 | 2019-12-03 | Quark Pharmaceuticals, Inc. | siRNA compounds comprising terminal substitutions |
| US20110135613A1 (en) * | 2009-12-03 | 2011-06-09 | The J. David Gladstone Institutes | Methods for treating apolipoprotein e4-associated disorders |
| US9885039B2 (en) | 2009-12-03 | 2018-02-06 | The J. David Gladstone Institutes | Methods for treating apolipoprotein E4-associated disorders |
| US11959079B2 (en) | 2009-12-03 | 2024-04-16 | The J. David Gladstone Institutes, a testamentary trust established under the of Will of J. David Gladstone | Methods for treating apolipoprotein E4-associated disorders |
| EP2862929A1 (en) | 2009-12-09 | 2015-04-22 | Quark Pharmaceuticals, Inc. | Compositions and methods for treating diseases, disorders or injury of the CNS |
| WO2011072091A1 (en) | 2009-12-09 | 2011-06-16 | Quark Pharmaceuticals, Inc. | Methods and compositions for treating diseases, disorders or injury of the cns |
| EP2380595A1 (en) | 2010-04-19 | 2011-10-26 | Nlife Therapeutics S.L. | Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types |
| US9193969B2 (en) | 2010-04-19 | 2015-11-24 | Nlife Therapeutics, S.L. | Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types |
| US10071163B2 (en) | 2010-04-19 | 2018-09-11 | Nlife Therapeutics, S.L. | Compositions and methods for selective delivery of oligonucleotide molecules to specific neuron types |
| WO2012078536A2 (en) | 2010-12-06 | 2012-06-14 | Quark Pharmaceuticals, Inc. | Double stranded oligonucleotide compounds comprising positional modifications |
| US11781135B2 (en) | 2012-03-30 | 2023-10-10 | Washington University | Methods for treating Alzheimer's disease |
| EP2831232A4 (en) * | 2012-03-30 | 2015-11-04 | Univ Washington | METHOD FOR MODULATING TAU EXPRESSION TO REDUCE PROBLEMS AND MODIFY A NEURODEGENERATIVE SYNDROME |
| US10273474B2 (en) | 2012-03-30 | 2019-04-30 | Washington University | Methods for modulating Tau expression for reducing seizure and modifying a neurodegenerative syndrome |
| WO2014043291A1 (en) | 2012-09-12 | 2014-03-20 | Quark Pharmaceuticals, Inc. | Double-stranded nucleic acid compounds |
| US10125363B2 (en) | 2012-10-26 | 2018-11-13 | Nlife Therapeutics, S.L. | Compositions and methods for the treatment of parkinson disease by the selective delivery of oligonucleotide molecules to specific neuron types |
| WO2014064257A1 (en) | 2012-10-26 | 2014-05-01 | Nlife Therapeutics, S.L. | Compositions and methods for the treatment of parkinson disease by the selective delivery of oligonucleotide molecules to specific neuron types |
| US9084825B2 (en) | 2012-10-26 | 2015-07-21 | Nlife Therapeutics, S.L. | Compositions and methods for the treatment of parkinson disease by the selective delivery of oligonucleotide molecules to specific neuron types |
| US11155815B2 (en) | 2013-03-14 | 2021-10-26 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating Tau expression |
| US9644207B2 (en) | 2013-03-14 | 2017-05-09 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating Tau expression |
| EP3766974A1 (en) * | 2013-03-14 | 2021-01-20 | Ionis Pharmaceuticals, Inc. | Compositions and methods for modulating tau expression |
| EP3019175A4 (en) * | 2013-07-11 | 2017-03-08 | The Trustees of Columbia University in the City of New York | Micrornas that silence tau expression |
| US9951330B2 (en) | 2013-07-11 | 2018-04-24 | The Trustees Of Columbia University In The City Of New York | Micrornas that silence tau expression |
| US12091662B2 (en) | 2013-07-19 | 2024-09-17 | Biogen Ma Inc. | Compositions for modulating tau expression |
| US10793856B2 (en) | 2013-07-19 | 2020-10-06 | Biogen Ma Inc. | Compositions for modulating Tau expression |
| US11591595B2 (en) | 2013-07-19 | 2023-02-28 | Biogen Ma Inc. | Compositions for modulating Tau expression |
| US9683235B2 (en) | 2013-07-19 | 2017-06-20 | Ionis Pharmaceuticals, Inc. | Compositions for modulating Tau expression |
| WO2015015498A1 (en) | 2013-07-31 | 2015-02-05 | Qbi Enterprises Ltd. | Methods of use of sphingolipid polyalkylamine oligonucleotide compounds |
| WO2016151523A1 (en) * | 2015-03-25 | 2016-09-29 | Università Degli Studi Di Trento | Rna interference mediated therapy for neurodegenerative diseases |
| US10513701B2 (en) | 2015-03-25 | 2019-12-24 | Università Degli Studi Di Trento | RNA interference mediated therapy for neurodegenerative diseases |
| EP3394259B1 (en) * | 2015-12-21 | 2024-02-28 | Novartis AG | Compositions and methods for decreasing tau expression |
| US11473083B2 (en) | 2015-12-21 | 2022-10-18 | Novartis Ag | Compositions and methods for decreasing tau expression |
| US11053498B2 (en) | 2016-09-29 | 2021-07-06 | Biogen Ma Inc. | Compounds and methods for reducing Tau expression |
| US10407680B2 (en) | 2016-09-29 | 2019-09-10 | Ionis Pharmaceuticals, Inc. | Compounds and methods for reducing Tau expression |
| US11993790B2 (en) | 2017-10-03 | 2024-05-28 | Prevail Therapeutics, Inc. | Gene therapies for lysosomal disorders |
| US12049626B2 (en) | 2017-10-03 | 2024-07-30 | Prevail Therapeutics, Inc. | Gene therapy for neurodegenerative disorders |
| US11453881B2 (en) | 2018-03-13 | 2022-09-27 | Janssen Pharmaceutica Nv | Modified oligonucleotides for use in treatment of tauopathies |
| WO2019175260A3 (en) * | 2018-03-13 | 2019-11-14 | Janssen Pharmaceutica Nv | Modified oligonucleotides for use in treatment of tauopathies |
| EP4121537A4 (en) * | 2020-03-18 | 2024-07-31 | University Of Massachusetts | OLIGONUCLEOTIDES FOR MAPT MODULATION |
| EP4126230A4 (en) * | 2020-03-30 | 2025-07-30 | Alnylam Pharmaceuticals Inc | MICROTUBULE-ASSOCIATED PROTEIN TAU (MAPT) RNAI AGENT COMPOSITIONS AND METHODS OF USE THEREOF |
| EP4405484A4 (en) * | 2021-09-24 | 2026-03-04 | Alnylam Pharmaceuticals Inc | ARNI AGENT COMPOSITIONS TARGETING MICROTUBULE-ASSOCIATED TAU PROTEIN (MAPT) AND THEIR METHODS OF USE |
| WO2023220349A1 (en) * | 2022-05-12 | 2023-11-16 | Dicerna Pharmaceuticals, Inc. | Compositions and methods for inhibiting mapt expression |
| WO2024145474A3 (en) * | 2022-12-29 | 2024-08-22 | Voyager Therapeutics, Inc. | Compositions and methods for regulating mapt |
Also Published As
| Publication number | Publication date |
|---|---|
| GB0605337D0 (en) | 2006-04-26 |
| JP5923466B2 (ja) | 2016-05-24 |
| EP2004823A2 (en) | 2008-12-24 |
| JP5781722B2 (ja) | 2015-09-24 |
| ES2582649T3 (es) | 2016-09-14 |
| RU2008141162A (ru) | 2010-04-27 |
| IL194114A (en) | 2012-06-28 |
| KR20080111063A (ko) | 2008-12-22 |
| CA2645120A1 (en) | 2007-09-27 |
| MX2008011731A (es) | 2009-03-05 |
| AU2007228570A1 (en) | 2007-09-27 |
| KR20140076634A (ko) | 2014-06-20 |
| US20090176728A1 (en) | 2009-07-09 |
| CA2645120C (en) | 2015-02-24 |
| HK1126812A1 (zh) | 2009-09-11 |
| IL194114A0 (en) | 2011-08-01 |
| WO2007107789A3 (en) | 2008-05-08 |
| CN101448944B (zh) | 2014-02-12 |
| JP2013234197A (ja) | 2013-11-21 |
| JP2009530257A (ja) | 2009-08-27 |
| AU2007228570B2 (en) | 2013-09-19 |
| KR101605144B1 (ko) | 2016-03-21 |
| KR101669944B1 (ko) | 2016-10-28 |
| EP2004823B1 (en) | 2016-05-25 |
| AU2007228570A8 (en) | 2008-10-23 |
| CN101448944A (zh) | 2009-06-03 |
| RU2426544C2 (ru) | 2011-08-20 |
| US8871729B2 (en) | 2014-10-28 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| EP2004823B1 (en) | Treatment of cns conditions | |
| US11499155B2 (en) | Dynamin 2 inhibitor for the treatment of centronuclear myopathies | |
| CN113544267B (zh) | 使用CRISPR-Cas进行靶向核RNA裂解和聚腺苷酸化 | |
| EP2862929A1 (en) | Compositions and methods for treating diseases, disorders or injury of the CNS | |
| JP2022507283A (ja) | 脊髄小脳失調症3型の治療のためのアタキシン-3のrnai誘導低減 | |
| KR102353847B1 (ko) | 안구인두 근이영양증(opmd)의 치료용 시약 및 이의 용도 | |
| CA2599220C (en) | Treatment of intestinal conditions | |
| CA2594672C (en) | Methods and compositions to inhibit p2x7 receptor expression | |
| US20070243242A1 (en) | Compositions for treating hearing loss and methods of use thereof | |
| HK1126812B (en) | Treatment of cns conditions | |
| US20230203497A1 (en) | Dynamin 2 inhibitor for the treatment of centronuclear myopathies | |
| WO2025253282A1 (en) | Small interfering nucletides (sioligo) for the treatment of cole-carpenter syndrome (ccs) | |
| WO2025072604A1 (en) | Rna-editing gene therapy approaches for treating myotonic dystrophy type 1 (dm1) |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| WWE | Wipo information: entry into national phase |
Ref document number: 200780017978.7 Country of ref document: CN |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application |
Ref document number: 07733553 Country of ref document: EP Kind code of ref document: A2 |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2645120 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 4860/CHENP/2008 Country of ref document: IN Ref document number: MX/A/2008/011731 Country of ref document: MX Ref document number: 2007228570 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 194114 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008558913 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2007228570 Country of ref document: AU Date of ref document: 20070316 Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020087025174 Country of ref document: KR Ref document number: 2007733553 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2008141162 Country of ref document: RU Kind code of ref document: A |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 12293230 Country of ref document: US |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020147013792 Country of ref document: KR |