WO2007100305A1 - Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding rps27l protein - Google Patents

Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding rps27l protein Download PDF

Info

Publication number
WO2007100305A1
WO2007100305A1 PCT/SG2007/000058 SG2007000058W WO2007100305A1 WO 2007100305 A1 WO2007100305 A1 WO 2007100305A1 SG 2007000058 W SG2007000058 W SG 2007000058W WO 2007100305 A1 WO2007100305 A1 WO 2007100305A1
Authority
WO
WIPO (PCT)
Prior art keywords
cell
rps27l
cells
nucleic acid
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/SG2007/000058
Other languages
English (en)
French (fr)
Inventor
Qiang Yu
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Agency for Science Technology and Research Singapore
Original Assignee
Agency for Science Technology and Research Singapore
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Agency for Science Technology and Research Singapore filed Critical Agency for Science Technology and Research Singapore
Priority to EP07716150A priority Critical patent/EP1996206A4/en
Priority to JP2008557241A priority patent/JP2009528346A/ja
Priority to US12/281,423 priority patent/US20090137517A1/en
Priority to AU2007221503A priority patent/AU2007221503A1/en
Publication of WO2007100305A1 publication Critical patent/WO2007100305A1/en
Anticipated expiration legal-status Critical
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P35/00Antineoplastic agents
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/50Physical structure
    • C12N2310/53Physical structure partially self-complementary or closed

Definitions

  • the present invention refers to a method of sensitizing a cell to cancer treatment comprising administering to a cell a compound (capable of) modulating the activity of a nucleic acid which encodes the RPS27L protein.
  • Compounds capable of such modulation include oligonucleotides which can for example, be RNAi agents or antisense nucleotide molecules.
  • Such oligonucleotides disclosed in the present invention can be used in combination with at least one cytostatic drug for, e.g., chemotherapy.
  • the present invention further refers in exemplary embodiments to an expression vector comprising an oligonucleotide used in the present invention as well as to a pharmaceutical composition comprising such oligonucleotides together with at least one chemotherapeutic agent of the present invention.
  • Cancer is pathological disorder in which a group of cells (usually derived from a single cell) have lost their normal growth control mechanisms and thus show unregulated growth.
  • Cancerous (malignant) cells can develop from any tissue within any organ. As cancerous cells grow and multiply, they form a mass of cancerous tissue - called a tumor — that invades and destroys normal adjacent tissues.
  • the term "tumor” refers to an abnormal growth or mass; tumors can be cancerous or noncancerous. Cancerous cells from the primary (initial) site can spread (metastasize) throughout the body. Cancer is a major cause of death worldwide, being the second-leading cause of death in developed countries and even the number one cause of death in e.g. Australia, Japan, Korea, Singapore and the male population of the UK and Spain. The number of people who develop cancer each year is continuously increasing.
  • Apoptosis is a distinct mode of cell death that is responsible for deletion of cells in normal tissues; it also occurs in specific pathologic contexts. Morphologically, it involves rapid condensation and budding of the cell, with the formation of membrane-enclosed apoptotic bodies containing well-preserved organelles, which are phagocytosed and digested by nearby resident cells. There is no associated inflammation.
  • a characteristic biochemical feature of the process is double-strand cleavage of nuclear DNA at the linker regions between nucleosomes leading to the production of oligonucleosomal fragments.
  • apoptosis occurs spontaneously in malignant tumors, often markedly retarding their growth, and it is increased in tumors responding to irradiation, cytotoxic chemotherapy, heating and hormone ablation.
  • much of the current interest in the process stems from the discovery that it can be regulated by certain proto-oncogenes and the p53 tumor suppressor gene.
  • the p53 tumor suppressor is required for efficient execution of the death program.
  • the present invention relates to a method of sensitizing a cell to cancer treatment comprising administering to a cell a compound modulating the activity of a nucleic acid which encodes the RPS27L protein or the RPS27L protein itself.
  • modulating the activity of the nucleic acid which encodes the RPS27L protein comprises administering to a subject a compound such as a nucleic acid molecule.
  • suitable nucleic acid molecules that are able to modulate the activity of a nucleic acid molecule comprise an oligonucleotide such as a RNAi agent or an antisense nucleotide molecule.
  • this method further comprises administering at least one chemotherapeutic agent.
  • the present invention also relates to an expression vector comprising at least one oligonucleotide used in the method of the present invention.
  • the present invention relates to a pharmaceutical preparation comprising at least one chemotherapeutic agent used in the method of the present invention together with at least one compound, for example at least one RNAi agent or/and at least one antisense nucleotide molecule used in the method of the present invention.
  • Figure 1 shows that RPS27L is a direct transcriptional target of p53
  • Fig. IA shows a microarray analysis demonstrating that the expression of RPS27L was induced by the DNA damaging agents adriamycin (ADR) and 5-flurouracil (5-FU) in p53 wild-type HCTl 16 cells.
  • ADR DNA damaging agents
  • 5-flurouracil 5-flurouracil
  • Fig. IA depicts a cluster diagram of microarray data showing genes upregulated by the genotoxic agents 5-flurouracil (5FU) and adriamycin (ADR) in a p53-dependent manner.
  • Fig. IB shows treatment of p53 +/+ and p53-/- HCTl 16 cells with ADR (l ⁇ M) or 5-FU (375 ⁇ M) for the indicated times.
  • RPS27L levels were determined by RT-PCR. GAPDH was used as loading control.
  • Figure IB shows that RPS27L mRNA was induced following ADR or 5-FU treatment only in p53 wild- type HCTl 16 cells but not in cells which are p53 negative. These results demonstrate that there is a connection between the expression of RPS27L and the activation and expression of p53.
  • Fig. 1C demonstrates that p53 binds to the first intron of the RPS27L gene. Genome- wide p53 binding targets in HCTl 16 cells have previously been performed using ChIP-PET technology (Wei, C.L., Wu, Q., et al., (2006) "A global map of p53 transcription-factor binding sites in the human genome" Cell, vol.
  • FIG. 2 shows Western Blot analysis demonstrating that RPS27L protein is differentially expressed in response to distinct stress signals (for further details see Example 2).
  • FIG. 2 A shows the results of the treatment of ⁇ 53 +/+ and p53-/- HCTl 16 cells with ADR (l ⁇ M), 5-FU (375 ⁇ M) and nutlin-3 (10 ⁇ M) for the indicated times.
  • p53, RPS27L and p21 protein levels were determined by Western blot analysis.
  • Tubulin was examined as a loading control. It can be taken from Fig. 2A that the protein levels of RPS27L increased when the cells were treated with ADR and nutlin-3.
  • Fig. 2 A shows the results of the treatment of ⁇ 53 +/+ and p53-/- HCTl 16 cells with ADR (l ⁇ M), 5-FU (375 ⁇ M) and nutlin-3 (10 ⁇ M) for the indicated times.
  • p53, RPS27L and p21 protein levels were determined by Western
  • FIG. 2B shows the result of treatment of U2OS, Saos-2 and SH-S Y5Y cells with etoposide phosphate (VP 16 ® ) (10 ⁇ M), ADR (1 ⁇ M) or 5-FU (375 ⁇ M) for the indicated times.
  • etoposide phosphate VP 16 ®
  • ADR 1 ⁇ M
  • 5-FU 375 ⁇ M
  • p53, p21 and RPS27L protein levels were determined by Western blot analysis. Tubulin was examined as a loading control. Again, RPS27L protein levels increased upon treatment of the cells with ADR and etoposide phosphate (VP 16 ® ).
  • FIG. 3 demonstrates that RPS27L expression modulates p53-dependent apoptosis (for further details see Example 3).
  • FIG. 3A shows cell cycle and apoptosis analysis in HCTl 16 cells (p53 +/+ and p53-/-), as measured by flow cytometry. Cells were treated with ADR (1 ⁇ M) or 5-FU (375 ⁇ M) for 48 h.
  • Fig. 3A demonstrates that the DNA damaging agent ADR induces p53-dependent cell cycle arrest (increased number of hyperploid cells (4N)), whereas 5-FU treatment triggers p53-dependent apoptosis.
  • Fig. 3A shows that the DNA damaging agent ADR induces p53-dependent cell cycle arrest (increased number of hyperploid cells (4N)), whereas 5-FU treatment triggers p53-dependent apoptosis.
  • FIG. 3B shows the results of transfection of HCTl 16 cells with RPS27L siRNA or a control siRNA, followed by etoposide phosphate (VP 16 ® ) (10 ⁇ M) treatment for indicated times.
  • RPS27L, RPS27 and GAPDH mRNA levels were determined by RT-PCR.
  • Fig. 3B shows that the targeted sequence for siRNA was efficient and specific as it nearly completely ablated RPS27L expression and prevented its induction after DNA damage, while having no effect on closely-related RPS27.
  • Fig. 3C shows treatment of HCTl 16 cells, which stably express the RPS27L shRNA or a control shRNA, with ADR (l ⁇ M) for 48 hours.
  • apoptosis was measured by cells with sub-Gl DNA content.
  • the bar graph shows the averaged results of three independent experiments with standard deviation (s.d). indicated.
  • ADR treatment for 48 h resulted primarily in a growth arrest response, while RPS27L-depleted cells also receiving ADR underwent marked cell death.
  • Fig. 3D shows the result of transfection of HCTl 16 cells with RPS27L siRNA, followed by etoposide phosphate (VP 16 ® ) (10 ⁇ M) or ADR (1 ⁇ M) treatment for 24 hours.
  • Cell death was measured by cells with sub-Gl DNA content.
  • Each bar represents the mean ⁇ s.d. of three independent experiments.
  • Fig. 3D shows that knockdown of RPS27L through transient siRNA transfection also induced a marked increase in cell death upon ADR or etoposide phosphate (VP 16 ® ) treatment in HCTl 16 cells but not in p53 null counterparts.
  • Fig. 3E shows cells which have been treated as the cells depicted in Fig. 1C, followed by JC-I staining and flow cytometry analysis. Mitochondrial impairment was represented as the percentage of cells with lower membrane potential ( ⁇ m). The bar graph shows the results of three independent experiments.
  • Fig. 3 E illustrates that ADR treatment of RPS27L shRNA cells resulted in a marked decrease in ⁇ m compared to the control cells (33.5 % versus 13.5%), indicating an apoptotic cell death involving mitochondrial dysfunction.
  • FIG. 4 demonstrates that RPS27L is a nuclear protein that forms
  • FIG. 4A shows HCTl 16 cells transfected with a Myc-tagged RPS27L expression vector. The transfected cells were fixed and stained with anti-Myc antibody and FITC-conjugated anti-mouse Ig (green), followed by confocal microscopy examination. Nuclei were stained with DRAQ5 (blue). Rodamine-Phalloiadin was used for counter-staining of the actin cytoskeleton (red).
  • Fig. 4B shows HCTl 16 control and RPS27L-depleted cells treated with VP 16 (20 ⁇ M) for 16 hours.
  • FIG. 5 shows that RPS27L deficiency results in defective cell cycle checkpoint and DNA repair, i.e. loss of RPS27L leads to chromosome instability (for further details see Example 5).
  • FIG. 5A shows HCTl 16 control and RPS27L-depleted cells treated with ADR (1 ⁇ M) for 24 hours. Cells were labeled with BrdU for 30 min and stained with FITC-conjugated anti-BrdU and 7-AA-D. Incorporation of BrdU (y axis) and total DNA content (x axis) were analyzed by flow cytometry. The representative histogram indicates the percentages of cells in S-phase. The bar graphs show the results of three independent experiments. Fig.
  • FIG. 5B shows HCTl 16 control and RPS27L-depleted cells treated with etoposide phosphate (VP 16 ® ) (20 ⁇ M) for 3 hours. Thereafter, etoposide phosphate (VP 16 ® ) was removed by replacing with fresh medium and cells were harvested at 0, 3, 6 and 16 hours for anti- ⁇ H2AX staining. Stained cells were examined by confocal microscopy. Nuclei were stained with DRAQ5.
  • Fig. 5C shows DNA damage as measured by the comet assay in HCTl 16 control and RPS27L-depleted cells after 24 h of ADR treatment. The damage distribution, measured as tail moment (product of tail length and fraction of DNA), differed between the two cell lines.
  • FIG. 5D show the numbers of micronuclei (percentage) measured by the CBMN assay after a 24 h ADR treatment. Data shown is for ADR treatment (l ⁇ M) of HCTl 16 control and RPS27L-depleted cells in comparison with the untreated samples. A total of 1000 binucleated cells were scored.
  • Figure 6 depicts Western Blot analysis showing hat RPS27L depletion impairs p21 accumulation upon DNA damage (for further details see Example 6).
  • Fig. 6 A shows Western Blot analysis of expression levels of p53 and its target genes p21, Puma and MDM2 in HCTl 16 control and RPS27L-de ⁇ leted cells treated with ADR (l ⁇ M) for 24 and 48 hours. Tubulin was used as a loading control.
  • Fig. 6B shows analysis of U2OS cells transfected with RPS27L siRNA or the control siRNA. The transfected cells were treated with ADR (l ⁇ M) for 24 hours. The expression levels of p53 and its target genes are shown as in Fig. 6A.
  • Fig. 6 A shows Western Blot analysis of expression levels of p53 and its target genes p21, Puma and MDM2 in HCTl 16 control and RPS27L-de ⁇ leted cells treated with ADR (l ⁇ M) for 24 and 48 hours. Tubulin was used
  • FIG. 6C shows RT-PCR analysis of RPS27L and p21 mRNA levels in HCTl 16 control and RPS27L-depleted cells treated with ADR as indicated.
  • Fig. 6D shows results of protein analysis of HCTl 16 cells transfected with p21 and increasing amounts of RPS27L. p21 and RPS27L protein expression was examined by Western blot analysis. Actin was used a loading control.
  • Figure 7 demonstrates that p21 depletion is sufficient to induce a cell cycle checkpoint defect and increased apoptosis in response to DNA damage (for further details see Example 6).
  • Fig. 7A shows Western Blot analysis for HCTl 16 control and p21- depleted cells treated with ADR for 24 h and for cell lysates prepared for Western blot analysis of p53, p21 and Puma.
  • Fig. 7B shows HCTl 16 control and p21-depleted cells treated with ADR for 24 h and stained with BrdU and 7-AA-D for DNA synthesis and DNA content, respectively. Stained cells were analyzed by FACS. Histograms indicate the percentages of cells in S-phase and cell population with DNA content >4N.
  • Fig. 7C shows cells treated as the cells depicted in Fig. 7A and cell death was assessed as cells with sub-Gl content.
  • Fig. 7D shows a model of RPS27L function in DNA damage response. Induction of RPS27L by p53 protects against DNA damage through p21 -dependent and independent mechanisms.
  • to administer ⁇ r “administration” refer to the delivery of compounds/molecules referred to in the present invention, such as a therapeutically active nucleic oligonucleotides or chemotherapeutic agents, or of a pharmaceutical composition containing the molecules referred to in the present invention to an organism for the purpose of prevention or treatment of cancer or other disorders which can be influenced by modulating the expression of RPS27L.
  • transfection means the introduction of a nucleic acid, e.g., an expression vector, into a recipient cell by nucleic acid-mediated gene transfer.
  • vector refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
  • a genomic integrated vector or "integrated vector” which can become integrated into the chromosomal DNA of the host cell.
  • an episomal vector i.e., a nucleic acid capable of extra-chromosomal replication in an appropriate host, e.g., a eukaryotic or prokaryotic host cell.
  • vectors capable of directing the expression of genes to which they are operatively linked are referred to herein as "expression vectors".
  • expression vectors In the present specification, "plasmid” and “vector” are used interchangeably unless otherwise clear from the context.
  • nucleic acid refers to polynucleotides such as deoxyribonucleic acid (DNA), and ribonucleic acid (RNA).
  • DNA deoxyribonucleic acid
  • RNA ribonucleic acid
  • the term should also be understood to include, as applicable to the embodiment being described, single-stranded (such as sense or antisense) and double-stranded polynucleotides.
  • single-stranded such as sense or antisense
  • double-stranded polynucleotides such as sense or antisense
  • sugar groups of the nucleotide subunits may be also modified derivatives thereof such as 2'-O-methyl ribose.
  • nucleotide subunits of an oligonucleotide may be joined by phosphodiester linkages, phosphorothioate linkages, methyl phosphonate linkages or by other rare or non-naturally-occurring linkages that do not prevent hybridization of the oligonucleotide.
  • an oligonucleotide may have uncommon nucleotides or non-nucleotide moieties.
  • nucleic acid hybridization is meant the process by which two nucleic acid strands having completely or partially complementary nucleotide sequences come together under predetermined reaction conditions to form a stable, double- stranded hybrid with specific hydrogen bonds.
  • Either nucleic acid strand may be a deoxyribonucleic acid (DNA), a ribonucleic acid (RNA), or an analog of one of these nucleic acids; thus hybridization can involve RNA:RNA hybrids, DNA:DNA hybrids, or RNA:DNA hybrids.
  • nucleotide sequences of similar regions of two single-stranded nucleic acids, or to different regions of the same single- stranded nucleic acid have a nucleotide base composition that allow the single strands to hybridize together in a stable double-stranded hydrogen-bonded region.
  • a contiguous sequence of nucleotides of one single-stranded region is able to form a series of "canonical" hydrogen-bonded base pairs with an analogous sequence of nucleotides of the other single- stranded region, such that A is paired with U or T and C is paired with G, the nucleotides sequences are "perfectly" complementary.
  • a "protein coding sequence” or a sequence that "encodes” a particular polypeptide or peptide is a nucleic acid sequence that is transcribed (in the case of DNA) and is translated (in the case of mRNA) into a polypeptide in vitro or in vivo when placed under the control of appropriate regulatory sequences.
  • the boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus.
  • a coding sequence can include, but is not limited to cDNA from eukaryotic mRNA, genomic DNA sequences from eukaryotic DNA, and even synthetic DNA sequences.
  • a transcription termination sequence will usually be located 3' to the coding sequence.
  • Cells or "host cells” are terms used interchangeably herein. It is understood that such terms refer not only to the particular subject cell but to the progeny or potential progeny of such a cell.
  • sensitizing describes that a cell subjected to the method of the present invention is more susceptible to a certain treatment than before.
  • a therapeutic method for the treatment of cancer using chemotherapeutic agents described herein, wherein the chemotherapeutic agent had no effect or only at higher dosages, could be used or used at lower doses after "sensitizing" the cell using the method of the present invention.
  • modulating the activity of a nucleic acid is meant altering or modulating, for example decreasing or increasing the transcription level and/or translation (expression) level of a coding sequence, e.g., genomic DNA, mRNA etc., into a polypeptide, for example protein, product.
  • a coding sequence e.g., genomic DNA, mRNA etc.
  • mammalian cells will activate a protection system to enable repair in order to continue the normal life cycle, or they may, as previously already mentioned, activate the apoptotic machinery in the face of excessive and irreparable damage (Zhou, B.B. and Elledge, SlJ. (2000) "The DNA damage response: putting checkpoints in perspective" Nature, vol. 408, p.433-439).
  • the tumor suppressor p53 is believed to play important roles in DNA damage response.
  • p53 binds to as many as 300 target genes in the human genome (Wei, C.L., Wu, Q. et al.
  • p53 induces apoptosis through transcriptional activation of apoptotic target genes, such as PUMA, BAX, NOXA, BID, PIGS, CD95, DR5 or p53AIPl (Vogelstein, B., Lane, D. and LeVine, AJ. (2000), supra; Vousden, K.H. and Lu, X. (2002) "Live or let die: the cell's response to p53" Nat Rev Cancer, vol. 2, p.594-604).
  • apoptotic target genes such as PUMA, BAX, NOXA, BID, PIGS, CD95, DR5 or p53AIPl
  • RPS27L which encodes the ribosomal protein S27- like (RPS27L) with a previously unknown function
  • RPS27L ribosomal protein S27- like
  • one aspect of the present invention provides a method of sensitizing a cell to cancer treatment comprising modulating the activity of a nucleic acid which encodes the RPS27L protein or the RPS27 protein itself by means of a respective compound that is able to modulate the gene activity of a RPS27L encoding nucleic acid or that is able to modulate the RPS27L protein.
  • the cell to be subjected to the sensitizing can be any given cell and is typically a mammalian cell.
  • the mammalian cell can, for example, be from a human, a mouse, a rat, a dog, a cat, a pig or cow, meaning that for example, a human patient or a mouse or any other mammalian can be treated using the sensitization method of the present invention.
  • Example 3 the inventors have demonstrated that decreasing the level of RPS27L protein converts p53-dependent DNA damage response from growth arrest to cell death. Accordingly, the method of the present invention can, for example, be used to induce apoptosis in a malignant cell by modulating the activity of the nucleic acid which encodes the RPS27L protein.
  • cells can be sensitized, i.e. they are rendered more susceptible, to a treatment with, for example, one or more chemotherapeutic anti-cancer drugs, when the level of RPS27L protein and also RPS27L mRNA coding for RPS27L protein is decreased.
  • chemotherapeutic anti-cancer drugs when the level of RPS27L protein and also RPS27L mRNA coding for RPS27L protein is decreased.
  • Sensitization of a malignant cell by use of the method of the present invention avoids the use of high doses of chemotherapeutic anticancer drugs because the pathway to cell repair will be obstructed by decreasing the level of RPS27 protein level in the malignant cell. Accordingly, already low amounts of anti-cancer drugs provide effective treatment of tumors. The use of lower amounts of anti-cancer drugs evidently result in less severe or even no side effects which can normally be observed with the drugs usually used in anti-cancer chemotherapy.
  • a compound capable of modulating the activity of the nucleic acid which encodes the RPS27L protein may be a nucleic acid molecule that is able to influence the activity of the coding nucleic acid.
  • the method of the present invention includes modulating the activity of the nucleic acid which encodes the RPS27L protein by administering a suitable nucleic acid such as an oligonucleotide.
  • This oligonucleotide has the effect that upon administering it to a cell, preferably a malignant cell, of eukaryotic or even more precise a mammal cell, like a human malignant cell, will cause a modulation of the activity of the nucleic acid which encodes RPS27L protein.
  • the modulation of the activity of the nucleic acid encoding RPS27L protein means decreasing or increasing the level of this nucleic acid.
  • Nucleic acid molecules such as oligonucleotides that are able to modulate the activity of the nucleic acid encoding RPS27L protein can, for example, be an RNAi agent or an antisense nucleotide molecule. Introducing and transcribing an antisense nucleotide molecule into the cell leads to synthesis of a RNA molecule which is complementary to the mRNA molecule coding for RPS27L. This RNA molecule (i.e. antisense RNA) then provides a genetic tool that can be used for inhibiting the expression of the mRNA coding for RPS27L.
  • the antisense molecule does of course not have to be able to provide a RNA molecule that is complementary to the entire RNA molecule coding for RPS27L but it is also sufficient to provide fragments of the antisense RNA to inhibit the expression of the mRNA coding for RPS27L.
  • Antisense technology has become an established methodology (see for example, Weiss, B. (ed.): Antisense Oligodeoxynucleotides and Antisense RNA : Novel Pharmacological and Therapeutic Agents, CRC Press, Boca Raton, FL, 1997, or Crooke, S.T. Progress in Antisense Technology, Annual Review of Medicine, February 2004, Vol. 55: Page 61 - 95), and the design of respective antisense nucleotide molecules is within the skill of the person of average knowledge in the art.
  • RNAi agent i.e., an interfering ribonucleic acid
  • RNAi agent can also be used as compound that modulates the activity of a nucleic acid encoding the RPS27L protein.
  • interfering ribonucleic acids such as interfering RNAs, short hairpin RNAs and micro RNAs has become a powerful tool to "knock down" specific genes.
  • RNAi methodology makes use of gene silencing or gene suppression through RNA interference (RNAi), which occurs at the posttranscriptional level and involves mRNA degradation.
  • RNA interference represents a cellular mechanism that protects the genome.
  • siRNA and miRNA molecules mediate the degradation of their complementary RNA by association of the siRNA with a multiple enzyme complex to form what is called the RNA-induced silencing Complex (RISC).
  • RISC RNA-induced silencing Complex
  • the siRNA or miRNA becomes part of RISC and is targeted to the complementary RNA species which is then cleaved.
  • siRNAs are perfectly base paired to the corresponding complementary strand, while miRNA duplexes are imperfectly paired.
  • Activation of RISC leads to the loss of expression of the respective gene (for a brief overview see Zamore, P.D. and Haley, B. (2005) "Ribo-gnome: The Big World of Small RNAs" Science, vol. 309, p. 1519-1524).
  • Interfering ribonucleic acids may not exceed about 100 nt in length, and typically does not exceed about 75 nt length.
  • the interfering ribonucleic acid is a duplex structure of two distinct ribonucleic acids hybridized to each other, e.g., a siRNA
  • the length of the duplex structure typically ranges from about 15 to 30 bp, usually from about 15 to 29 bp.
  • the RNAi agent is a duplex structure of a single ribonucleic acid that is present in a hairpin formation, i.e., a shRNA
  • the length of the hybridized portion of the hairpin is typically the same as that provided above for the siRNA type of agent or longer by 4-8 nucleotides.
  • the agents used in the method of the present invention can be used in therapy for the treatment or prevention of cancer.
  • the oligonucleotide that is used in the method of the present invention can be administered to the mammalian host using any convenient protocol which is known to a person skilled in the art.
  • the following discussion provides a review of representative nucleic acid administration protocols that may be employed.
  • the nucleic acids may be introduced into tissues or host cells by any number of routes, including viral infection, microinjection, or fusion of vesicles.
  • Jet injection may also be used for intra-muscular administration, as described by Furth, P.A., Shamay, A., et al. (1992) "Gene transfer into somatic tissues by jet injection” Anal Biochem, vol. 205, p.365-368.
  • the nucleic acid may be coated onto gold microparticles and delivered intradermally by a particle bombardment device or "gene gun” as described in the literature (see, for example, Tang, D. C, De Vit, M., et al., (1992) "Genetic immunization is a simple method for eliciting an immune response” Nature, vol. 356, p.152- 154), where gold microparticles are coated with the DNA, then bombarded into skin cells.
  • nanoparticles for delivering siRNA is another suitable approach for cell-specific targeting. This method has been described for example by Weissleder, R., Kelly, K., et al. (2005) "Cell-specific targeting of nanoparticles by multivalent attachment of small molecules” Nature Biotech, vol. 23, p. 1418-1423.
  • Another illustrative example of delivering an oligonucleotide used in the method of the present invention into selected cells in vivo is its non-covalent binding to a fusion protein of a heavy-chain antibody fragment (F ab ) and the nucleic acid binding protein protamin (Song, E., Zhu, P., et al. (2005) "Antibody mediated in vivo delivery of small interfering RNAs via cell-surface receptors" Nature Biotech, vol. 23, p. 709-717).
  • Another illustrative example of delivering a siRNA molecule into selected cells in vivo is its encapsulation into a liposome. Morrissey, D., Lockridge, J., et al.
  • RNAi agent to a selected malignant target cell
  • a biological vehicle such as a bacterium or a virus (e.g. adenovirus) that includes the respective nucleic acid molecule.
  • a biological vehicle such as a bacterium or a virus (e.g. adenovirus) that includes the respective nucleic acid molecule.
  • a virus e.g. adenovirus
  • Xiang, S., Fruehauf, J., et al. (2006) "Short hairpin RNA-expressing bacteria elicit RNA interference in mammals" Nature Biotech, vol. 24, p. 697-702 have for instance used this approach by administering the bacterium E. coli, which transcribed from a plasmid inter alia both shRNA and invasin, thus permitting entry into mammalian cells and subsequent gene silencing therein.
  • Expression vectors may be used to introduce an oligonucleotide used in the method of the present invention into the desired cells, hi addition, the oligonucleotide used in the method of the present invention can be fed directly to, injected into, the host organism containing the target gene, i.e. RPS27L.
  • the oligonucleotide may be directly introduced into the cell (i.e., intracellularly); or introduced extracellularly into a cavity, interstitial space, into the circulation of an organism, introduced orally, etc.
  • Methods for oral introduction include direct mixing of RNA with food of the organism.
  • Physical methods of introducing nucleic acids include injection directly into the cell or extracellular injection into the organism of an RNA solution.
  • the agent may be introduced in an amount which allows delivery of at least one copy per cell. Higher doses (e.g., at least 5, 10, 100, 500 or 1000 copies per cell) of the agent may yield more effective inhibition; lower doses may also be useful for specific applications.
  • the cancer treatment referred to in the method of the present invention can be chemotherapy in which a chemotherapeutic agent is used.
  • the chemotherapeutic agent used in the method of the present invention include, but is not limited to, an alkylating agent, an antimetabolite, an antimitotic, a topoisomerase inhibitor, a platinum containing compound, hormons, signalling inhibitor, a monoclonal antibody, a biologic response modifier or an differentiating agent.
  • chemotherapeutic agents act on different biochemical processes in certain phases of the cell cycle.
  • antimetabolites like 5-fluorouracil and folic acid antagonists, primarily block the DNA-synthesis and thus act in the S-phase of the cell.
  • Colchicin and vincristin inhibit mitosis in the M-phase of the cell.
  • Other chemotherapeutic agents act in different phases of the cell cycle.
  • Examples for alkylating agents comprise cyclophosphamide, chlorambucil and melphalan. These compounds form chemical bonds with the DNA and cause breaks in DNA and errors in the replication of the DNA.
  • Examples for antimetabolites comprise methotrexate, cytarabine, fludarabine, 6-mercaptopurine and 5-fluorouracil (5-FU). These compounds block the synthesis of DNA.
  • Examples for antimitotics include vincristine, colchicin, paclitaxel and vinorelbine. These compounds block the division of cancer cells.
  • topoisomerase inhibitors include, but are not limited to, doxorubicin (adriamycin, ADR), etoposide phosphate (VP 16 ® ) and irinotecan. These compounds prevent DNA synthesis and repair through blockage of enzymes called topoisomerases. Examples for platinum containing compounds/derivatives include cisplating and carboplatin. Such compounds form bonds with DNA causing breaks. Examples for compounds that are used for hormonal cancer therapy include, but are not limited to, tamoxifen and bicalutamide. For example, tamoxifen blocks the action of estrogen (in breast cancer) whereas bicalutamide blocks androgen action (in prostate cancer).
  • An example of a signalling inhibitor is the compound imatinib. hnatinib blocks signal for cell division in chronic myeolytic leukemia.
  • Illustrative examples of monoclonal antibodies include rituximab, trastuzumab and gemtuzumab ozogamicin.
  • Rituximab causes cell death through binding to cell surface receptor on lymphocyte-derived tumors.
  • Trastuzumab blocks the growth factor receptor on breast cancer cells and gemtuzumab ozogamicin contains a specific antibody that attaches to a receptor found on leukemic cells and then delivers a toxic dose of its chemotherapeutic component to the leukemic cells.
  • An example for a biological response modifier is interferon- alpha which exact biochemical function in this regard is still unknown.
  • An example for a differentiating agent is tretinoin which induces differentiation and death of leukemic cells.
  • the chemotherapeutic agent may be adriamycine (doxorubicine), nutlin-3, etoposide phosphate (VP 16 ® ) or 5-fluorouracile. It is of course also possible to use combinations of different chemotherapeutic agents together with a compound described here capable of modulating the activity of the nucleic acid which encodes the RPS27L protein.
  • chemotherapeutic agents directly or indirectly, cause DNA damage which again might affect the cell death by apoptosis. Due to the activation of the apoptotic pathway of the cell, modulating the activity of the nucleic acid encoding RPS27L can influence the cell fate. In case of a tumor, the desired approach would be to modulate the activity of RPS27L in a way that the malignant cell enters the apoptotic pathway rather then cell arrest or senescence.
  • RNAi agent or antisense nucleotide molecule referred to in the method of the present invention depends not on a direct interaction of the chemotherapeutic agent with these oligonucleotides but rather on their influence on the same biochemical pathway activated upon cell damage, e.g. DNA damage.
  • chemotherapeutic agent e.g. DNA damage
  • present method of the invention preferentially induces apoptosis in malignant cells.
  • RPS27L does indeed play a role in the p53-dependent biological pathway following DNA damaging is demonstrated by the results described in Example 4 to 6.
  • the results described in this example further describe that RPS27L is a nuclear protein participating in DNA damage response and is recruited to a subset of DNA double-strand breaks.
  • the present invention is directed to a pharmaceutical preparation including at least one chemotherapeutic agent as described above alone or together with for example, at least one oligonucleotide (for example, an RNAi agent and/or antisense nucleotide molecule) used in the method of the present invention.
  • at least one chemotherapeutic agent as described above alone or together with for example, at least one oligonucleotide (for example, an RNAi agent and/or antisense nucleotide molecule) used in the method of the present invention.
  • the pharmaceutical preparation can be administered in a variety of formulations for therapeutic administration. More particularly, the pharmaceutical preparations of the present invention can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutical acceptable carriers or diluents, and may be formulated into preparations in solid, semi-solid, liquid or gaseous forms, such as tablets, capsules, powders, granules, ointments, solutions, suppositories, injections, inhalants and aerosols. As such, administration of the pharmaceutical preparation can be achieved in various ways, including oral, buccal, rectal, parenteral, intraperitoneal, intradermal, transdermal, intracheal, etc., administration.
  • the pharmaceutical preparation of the present invention may be administered alone or in appropriate association, as well as in combination, with other pharmaceutical active compounds.
  • the following methods and excipients are merely exemplary and are in no way limiting.
  • the pharmaceutical preparations can be used alone or in combination with appropriate additives to make tablets, powders, granules or capsules, for example, with conventional additives, such as lactose, mannitol, corn starch or potato starch; with binders, such as crystalline cellulose, cellulose derivatives, acacia, corn starch or gelatins; with disintegrators, such as corn starch, potato starch or sodium carboxymethylcellulose; with lubricants, such as talc or magnesium stearate; and if desired, with diluents, buffering agents, moistening agents, preservatives and flavoring agents.
  • the pharmaceutical preparations can be formulated for injection by dissolving, suspending or emulsifying them in an aqueous or non-aqueous solvent, such as vegetable or other similar oils, synthetic aliphatic acid glycerides, esters of higher aliphatic acids or propylene glycol; and if desired, with conventional additives such as solubilizers, isotonic agents, suspending agents, emulsifying agents, stabilizers and preservatives.
  • the pharmaceutical preparations can be utilized in aerosol formulation to be administered via inhalation.
  • the pharmaceutical preparations of the present invention can be formulated into pressurized acceptable propellants such as dichlorodifluoromethane, propane, nitrogen and the like.
  • a respective compound or pharmaceutical composition may be used in a targeted drug delivery system, for example, in a liposome coated with a tumour-specific antibody. Such liposomes may for example be targeted to and taken up selectively by a tumour.
  • the pharmaceutical preparations may also be formulated as a depot preparation. Such long acting formulations may be administered by implantation (for example subcutaneously or intramuscularly) or by intramuscular injection.
  • the pharmaceutical preparation may be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt.
  • Genomic analysis identifies RPS27L as a direct transcriptional target of p53
  • p53 exerts its tumor suppressor function predominately through transcriptional regulation on downstream targets (Vogelstein, B., Lane, D. and Levine, AJ. (2000), supra; Vousden, K.H. and Lu, X. (2002), supra).
  • RPS27L which encodes the ribosomal protein S27-like (RPS27L) with a previously unknown function, was potentially regulated by p53.
  • RPS27L is located on chromosome 15 of the human genome with the position 61235856 to 61237660.
  • Figure IA depcits the microarray analysis showing a set of genes whose expression was induced by the DNA damaging agents adriamycin (ADR) and 5- flurouracil (5-FU) in p53 wild-type HCTl 16 cells (human colorectal carcinoma cell line containing wild type p53) but not in the p53 null counterpart.
  • ADR DNA damaging agents
  • 5- flurouracil 5- flurouracil
  • Figure IB shows that RPS27L niRNA was induced following ADR or 5-FU treatment only in p53 wild-type HCTl 16 cells.
  • RPS27L depletion converts p53-dependent DNA damage response from growth arrest to cell death
  • the inventors silenced RPS27L expression using small interfering RNA (siRNA) of SEQ ID NO: 1.
  • siRNA small interfering RNA
  • the targeted sequence for siRNA was efficient and specific as it nearly completely ablated RPS27L expression and prevented its induction after DNA damage, while having no effect on closely-related RPS27 ( Figure 3B).
  • the inventors created a HCTl 16 cell line stably expressing either the short hairpin of SEQ ID NO: 1 to deplete RPS27L (RPS27L shRNA) or a non-specific control shRNA (control shRNA) in both p53 wild-type and null backgrounds and investigated their cellular responses to ADR.
  • the control shRNA was obtained from Dharmacon Inc, Lafeyette, Colorado, USA)
  • This experiment clearly demonstrates the usability of RPS27L as means for regulating the cell fate after DNA damaging. Modulating the activity of the nucleic acid encoding RPS27L by increasing or decreasing its transcription or translation allows to direct malignant cells into cell death when treating them with a chemotherapeutic agent as demonstrated in this example.
  • regulatory molecules i.e. oligonucleotides that are used in the method of the present invention, like RNAi agents or antisense nucleotide molecules
  • RPS27L is a nuclear protein that forms nuclear foci upon DNA damage
  • ⁇ -H2AX is a histone phosphorylated at sites of DNA double strand breaks (DSB) and is the hallmark of DSB (Rogakou, E.P., Pilch, D.R., et al., (1998) "DNA double-stranded breaks induce histone H2AX phosphorylation on serine 139" J Biol Chem, vol. 273, p. 5858-5868). Depletion of RPS27L expression abolished this co-localization, although it had no effect on ⁇ -HA2X foci formation. These data suggest that RPS27L is a nuclear protein participating in DNA damage response and is recruited to a subset of DNA double-strand breaks.
  • RPS27L-depleted HCTl 16 cells underwent a substantial accumulation of cells with a hyperploid DNA content (>47V) compared with the control cells (30% vs 10.5%).
  • a deficient DNA damage checkpoint is expected to increase DNA damage.
  • ⁇ -H2AX foci are considered to be sensitive indicators of double strand breaks (DSB).
  • VP 16 ® etoposide phosphate
  • Figure 5B shows that a one hour treatment with VP 16 induced prominent DSB foci, as evidenced by strong ⁇ -H2AX staining.
  • ⁇ -H2AX staining was decreased over time, and by 16 hours after VP 16 removal the ⁇ - H2AX staining was almost undetectable, suggesting a proficient DNA repair process in these cells.
  • RPS27L-depleted HCTl 16 cells displayed a sustained ⁇ -H2AX staining, pointing to the increased DNA damage in these cells.
  • the comet assay is a single cell gel electrophoresis assay in which damaged DNA migrates to form a "comet tail" that is proportional to the amount of DNA damage (Collins, A.R. (2004) “The comet assay for DNA damage and repair: principles, applications, and limitations” MoI Biotechnol, vol. 26, p. 249-261). Cells were incubated with ADR for 24 h and were harvested and processed for the comet assay. As shown in Figure 5C, ADR-induced DNA damage was significantly enhanced in RPS27L-depleted cells, which is consistent with a role for RPS27L in DNA repair.
  • MN micronuclei
  • p21-depleted cells resembled the apoptotic and cell cycle phenotype of RPS27L-depleted cells. Further knockdown of RPS27L in p21-depleted cells did not render additional effects on the level of cell death or Brdu staining in resposne to ADR (data not shown). These results suggest that the impaired p21 protein accumulation in response to DNA damage in RPS27L-deficient cells is sufficient to confer the defect in cell cycle arrest and hypersensitivity to DNA damage.
  • the human colon carcinoma cell line HCTl 16 and its p53 knock-out derivate cells were kindly provided by Dr. Bert Vogelstein.
  • HCTl 16 cells can also be purchased under the ATCC number: CCL 247.
  • the human osteosarcoma cell lines U2OS and Saos-2 can be purchased under the following ATCC numbers: U2OS, ATCC HTB-96; Saos- 2, ATCC HTB-85 and SH-SY5Y, ATCC CRL-2266.
  • Cells were grown in DMEM supplemented with 10% fetal bovine serum and penicillin-streptomycin (Invitrogen). Adriamycin, etoposide phosphate (VP 16 ® ) and 5-fluorouracil were purchased from Sigma- Aldrich.
  • siRNA oligo targeting RPS27L (SEQ ID NO: 1: ggttgctacaagattacta was purchased from Proligo, and transfection was conducted using Lipofectamine 2000 (Invitrogen) according to the manufacturer's information.
  • the siRNA sequences were cloned into the pSIREN-RetroQ retroviral expression vector (BD Bioscience) according to the manufacturer's instruction. Virally infected cells were selected in a medium containing 2 ⁇ g/ml puromycin and individual drug-resistant clones were collected, pooled and expanded.
  • the promoter elements of RPS27L were cloned into the pGL3- luciferase vector (Promega). HCTl 16 p53-/- cells were plated in 24-well cell culture plates and co-transfected with the p53 expression vectors and RPS27L promoter plasmids. Twenty- four hours after transfection, the luciferase activities were measured using the Dual Luciferase system (Promega) as described (Kho, P.S., Wang, Z., et al. (2004) " ⁇ 53 -regulated transcriptional program associated with genotoxic stress-induced apoptosis" J Biol Chem, vol. 279, p. 21183-21192).
  • the cells were seeded in 4-well or 8-well culture slides. After treatment, cells were fixed with 3.7% paraformaldehyde in PBS and permeablized with 0.2% Triton-XlOO. Cells were sequentially incubated with primary antibodies (see above under "Protein Analysis and Generation of Anti-RPS27L Antibody") and Alexa Fluor 488 or Alexa Fluor 546-conjugated secondary antibodies (Invitrogen) for 1 hour each and mounted in Fluorsave (Merck) mounting medium. DRAQ5 (Biostats, UK) was diluted in mounting medium for nuclear staining. The stained cells were examined by Zeiss LSM510 confocal microscopy.
  • pcDNA4/RPS27L-Myc was generated by RT-PCR using normal colon tissue total RNA (Ambion), PowerScript Reverse Transcriptase (Clontech) and Platium PCR SuperMix High Fidelity (Invitrogen) with the primers
  • GGTACCATGCCTTTGGCTAGAGATTT (Forward, SEQ ID NO: 3) and GAATTCTTAGTGTTGCTTTCTTCTAAATGA (Reverse, SEQ ID NO: 4).
  • the PCR product and empty vector were digested with Kpnl and EcoRI (N ⁇ B) and ligated with T4 ligase (N ⁇ B), followed by transformation and selection.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Genetics & Genomics (AREA)
  • Biomedical Technology (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • Zoology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • General Engineering & Computer Science (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Wood Science & Technology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Plant Pathology (AREA)
  • Physics & Mathematics (AREA)
  • Medicinal Chemistry (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Animal Behavior & Ethology (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
PCT/SG2007/000058 2006-03-02 2007-03-01 Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding rps27l protein Ceased WO2007100305A1 (en)

Priority Applications (4)

Application Number Priority Date Filing Date Title
EP07716150A EP1996206A4 (en) 2006-03-02 2007-03-01 SENSITIZING A CELL TO A CREATIVE TREATMENT BY MODULATING THE ACTIVITY OF A NUCLEIC ACID CODING RPS27L PROTEIN
JP2008557241A JP2009528346A (ja) 2006-03-02 2007-03-01 Rps27lタンパク質をコードする核酸の活性を調節することによる癌治療に対する細胞の感作
US12/281,423 US20090137517A1 (en) 2006-03-02 2007-03-01 Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding rps27l protein
AU2007221503A AU2007221503A1 (en) 2006-03-02 2007-03-01 Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding RPS27L protein

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US77851906P 2006-03-02 2006-03-02
US60/778,519 2006-03-02

Publications (1)

Publication Number Publication Date
WO2007100305A1 true WO2007100305A1 (en) 2007-09-07

Family

ID=38459335

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/SG2007/000058 Ceased WO2007100305A1 (en) 2006-03-02 2007-03-01 Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding rps27l protein

Country Status (6)

Country Link
US (1) US20090137517A1 (enExample)
EP (1) EP1996206A4 (enExample)
JP (1) JP2009528346A (enExample)
AU (1) AU2007221503A1 (enExample)
TW (1) TW200800236A (enExample)
WO (1) WO2007100305A1 (enExample)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007121582A1 (en) 2006-04-26 2007-11-01 Litens Automotive Partnership One-way isolator for high torque devices
JP2009207466A (ja) * 2008-03-06 2009-09-17 Olympus Corp 細胞周期計測方法

Families Citing this family (25)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20110023151A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genome editing of abc transporters
US20110023149A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in tumor suppression in animals
US20110023154A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Silkworm genome editing with zinc finger nucleases
US20110016543A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Genomic editing of genes involved in inflammation
US20110023148A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genome editing of addiction-related genes in animals
US20110023141A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved with parkinson's disease
US20110016539A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Genome editing of neurotransmission-related genes in animals
US20110023158A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Bovine genome editing with zinc finger nucleases
US20110023146A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in secretase-associated disorders
US20110016546A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Porcine genome editing with zinc finger nucleases
US20110023150A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genome editing of genes associated with schizophrenia in animals
US20110023140A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Rabbit genome editing with zinc finger nucleases
US20110023144A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in amyotrophyic lateral sclerosis disease
US20110016540A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Genome editing of genes associated with trinucleotide repeat expansion disorders in animals
US20110023153A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in alzheimer's disease
US20110023143A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of neurodevelopmental genes in animals
US20110023152A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genome editing of cognition related genes in animals
US20110023147A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of prion disorder-related genes in animals
US20110023145A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in autism spectrum disorders
US20110023156A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Feline genome editing with zinc finger nucleases
US20110023139A1 (en) * 2008-12-04 2011-01-27 Sigma-Aldrich Co. Genomic editing of genes involved in cardiovascular disease
US20110030072A1 (en) * 2008-12-04 2011-02-03 Sigma-Aldrich Co. Genome editing of immunodeficiency genes in animals
US20110016541A1 (en) * 2008-12-04 2011-01-20 Sigma-Aldrich Co. Genome editing of sensory-related genes in animals
CA2821547A1 (en) * 2010-12-29 2012-07-05 Sigma-Aldrich Co. Llc Cells having disrupted expression of proteins involved in adme and toxicology processes
EP3564385A4 (en) * 2016-12-27 2020-08-12 Sumitomo Chemical Company, Limited ASSESSMENT AND SELECTION PROCEDURE FOR INDUCED PLURIPOTENT STEM CELLS, AND PROCESS FOR MANUFACTURING INDUCED PLURIPOTENT STEM CELLS

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP1756309A2 (en) * 2004-06-03 2007-02-28 Bayer HealthCare AG Methods for predicting and monitoring response to cancer therapy
WO2006006939A1 (en) * 2004-07-09 2006-01-19 Agency For Science, Technology And Research MODULATION OF GSK-3β AND METHOD OF TREATING PROLIFERATIVE DISORDERS

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
HE H. ET AL.: "Ribosomal protein S27L is a direct p53 target that regulates apoptosis", ONCOGENE, vol. 26, no. 19, 26 April 2007 (2007-04-26), pages 2707 - 2716, XP003024461 *
KHANNA N. ET AL.: "S29 ribosomal protein induces apoptosis in H520 cells and sensitizes them to chemotherapy", BIOCHEM. BIOPHYS. RES. COMMUN., vol. 304, no. 1, 25 April 2003 (2003-04-25), pages 26 - 35, XP003024462 *
LI J.-S. ET AL.: "Ribosomal protein S27-like (RPS27L) knock-down potentiates DNA damage cell death response in colorectal carcinoma HC116 cells", PROCEEDINGS OF THE AMERICAN ASSOCIATION FOR CANCER RESEARCH ANNUAL MEETING, vol. 47, April 2006 (2006-04-01), pages 1160 - 1161, XP008107301 *
WEI C.L. ET AL.: "A global map of p53 transcription-factor binding sites in the human genome", CELL, vol. 124, no. 1, 13 January 2006 (2006-01-13), pages 207 - 219, XP002596051 *

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2007121582A1 (en) 2006-04-26 2007-11-01 Litens Automotive Partnership One-way isolator for high torque devices
JP2009207466A (ja) * 2008-03-06 2009-09-17 Olympus Corp 細胞周期計測方法

Also Published As

Publication number Publication date
EP1996206A4 (en) 2010-09-22
AU2007221503A1 (en) 2007-09-07
JP2009528346A (ja) 2009-08-06
EP1996206A1 (en) 2008-12-03
US20090137517A1 (en) 2009-05-28
TW200800236A (en) 2008-01-01

Similar Documents

Publication Publication Date Title
US20090137517A1 (en) Sensitizing a cell to cancer treatment by modulating the activity of a nucleic acid encoding rps27l protein
JP5902138B2 (ja) 癌治療と幹細胞調節のための方法
US20110117627A1 (en) Regulation of apoptosis by neural specific splice variants of ig20
CN103561750A (zh) 通过microRNA-155(miR-155)诱导的增变活性使炎症与癌症关联
WO2021114137A1 (zh) 长非编码rna letn作为肿瘤标志物及治疗靶点
US20180251763A1 (en) Compositions and Methods for Inducing Senescence in Cancer Cells
JP7646359B2 (ja) miR-181阻害剤及びその使用
JP5341081B2 (ja) 肝細胞癌処置用医薬組成物および医薬キット
JP2017006137A (ja) 肺がんの腫瘍発生および化学療法耐性を低減するために有用なmiRNAならびに関連する組成物および方法
WO2007084954A2 (en) Selective inhibition of ig20 splice variants to treat cancers
US10697020B2 (en) MicroRNA-129 as a biomarker for colorectal cancer
WO2014110163A2 (en) Melk regulation for the treatment of breast cancer
JP2016196486A (ja) 脳腫瘍を治療するための分枝鎖アミノトランスフェラーゼ1(bcat1)の阻害剤
KR101525122B1 (ko) Ubb 넉­다운에 의한 암의 예방 또는 치료
WO2017143070A1 (en) Combination therapy
WO2010045526A1 (en) Geminin inhibitors as tumor treatment
KR102143701B1 (ko) nc886 및/또는 PKR 저해제를 포함하는 항암 보조제, 및 암 치료를 위한 약물의 정보 제공 방법
EP4430192A2 (en) Lncrna transcripts in melanomagenesis
WO2017160797A1 (en) Combination therapy with c-myc nucleic acid inhibitors and selective cdk7 inhibitors
WO2021150770A1 (en) Oncogenic trim37 is a targetable epigenetic driver of metastasis and links chemoresistance and metastatic fate in triple-negative breast cancer
US20250019700A1 (en) Treating chemoresistant forms of leukemia and other cancers that overexpress rna binding protein fxr1
JP2010529852A (ja) 癌治療のためのNuMAのRNAi媒介ノックダウン
KR20230045386A (ko) miR-4487를 유효성분으로 함유하는 항암제 민감성 증진용 조성물
Randvra Combination SiRNA Targeting Bcl-2 Antagonizes SiRNA Against Thymidylate Synthase (TS) in Human Tumor Cell Lines
JP2004350607A (ja) テロメレース阻害剤

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2007221503

Country of ref document: AU

WWE Wipo information: entry into national phase

Ref document number: 2008557241

Country of ref document: JP

NENP Non-entry into the national phase

Ref country code: DE

ENP Entry into the national phase

Ref document number: 2007221503

Country of ref document: AU

Date of ref document: 20070301

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 8272/DELNP/2008

Country of ref document: IN

WWE Wipo information: entry into national phase

Ref document number: 2007716150

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 12281423

Country of ref document: US