WO2007095185A2 - Variants in complement regulatory genes predict age-related macular degeneration - Google Patents

Variants in complement regulatory genes predict age-related macular degeneration Download PDF

Info

Publication number
WO2007095185A2
WO2007095185A2 PCT/US2007/003696 US2007003696W WO2007095185A2 WO 2007095185 A2 WO2007095185 A2 WO 2007095185A2 US 2007003696 W US2007003696 W US 2007003696W WO 2007095185 A2 WO2007095185 A2 WO 2007095185A2
Authority
WO
WIPO (PCT)
Prior art keywords
subject
gene
cfh
polymorphism
protein
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2007/003696
Other languages
English (en)
French (fr)
Other versions
WO2007095185A3 (en
Inventor
Rando L. Allikmets
Gregory S. Hageman
Michael C. Dean
Albert M. Gold
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
University of Iowa Research Foundation UIRF
Columbia University in the City of New York
National Institutes of Health NIH
Original Assignee
University of Iowa Research Foundation UIRF
Columbia University in the City of New York
National Institutes of Health NIH
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by University of Iowa Research Foundation UIRF, Columbia University in the City of New York, National Institutes of Health NIH filed Critical University of Iowa Research Foundation UIRF
Priority to AU2007215218A priority Critical patent/AU2007215218B2/en
Priority to CA002638916A priority patent/CA2638916A1/en
Priority to JP2008554415A priority patent/JP5290772B2/ja
Priority to EP07750527A priority patent/EP1989319A4/en
Priority to NZ570431A priority patent/NZ570431A/en
Publication of WO2007095185A2 publication Critical patent/WO2007095185A2/en
Priority to IL193396A priority patent/IL193396A/en
Anticipated expiration legal-status Critical
Publication of WO2007095185A3 publication Critical patent/WO2007095185A3/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/112Disease subtyping, staging or classification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/118Prognosis of disease development
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/156Polymorphic or mutational markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/158Expression markers
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12QMEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00Oligonucleotides characterized by their use
    • C12Q2600/172Haplotypes

Definitions

  • This application relates to methods of predicting an individual's genetic susceptibility to age-related macular degeneration.
  • Age-related macular degeneration is a degenerative eye disease that affects the macula, which is a photoreceptor-rich area of the central retina that provides detailed vision. AMD results in a sudden worsening of central vision that usually only leaves peripheral vision intact. AMD is the most common form of irreversible blindness in developed countries. The disease typically presents with a decrease in central vision in one eye, followed within months or years by a similar loss of central vision in the other eye. Clinical signs of the disease include the presence of deposits (drusen) in the macula.
  • variants in the FBLN6, ABCA4, and APOE genes have been implicated as risk factors.
  • CCFH complement factor H gene
  • a variant in the complement factor H gene (CFH) which encodes a major inhibitor of the alternative complement pathway, is associated with increased risk of developing AMD (Haines et al. (2005) Science 308:419-21 ; Klein et al. (2005) Science 308:385-9; Edwards el al. (2005) Science 308:421-4; Hageman et al. (2005) Proc. Natl. Acad. ScL U.S.A. 102:7227-32).
  • Polymorphisms and genotypes that are protective for age-related macular degeneration have been identified.
  • Methods are provided for identifying a subject at increased risk for developing AMD. These methods include, but are not limited to, analyzing the subject's factor B (BF) and/or complement component 2 (C2) genes, and determining whether the subject has at least one protective polymorphism.
  • protective polymorphisms include (a) R32Q in BF (rs641153); (b) L9H in BF (rs4151667); (c) IVS 10 in C2 (rs547154); and (d) E318D in C2 (rs9332739).
  • the method may be implemented by detecting a protein variant in the subject. If the subject does not have at least one protective polymorphism, the subject is at increased risk for developing AMD. In one embodiment of this aspect, further analysis of the subject's CFH gene is performed. In some embodiments, the subject's genotype may be analyzed at the CFH locus to determine if the subject has at least one protective genotype. In one embodiment the subject's genotype may be analyzed at either the BF or C2 locus and at the CFH locus to determine if the subject has at least one protective genotype. As disclosed hereafter, in several instances, it will be informative to learn whether the subject is homozygous or heterozygous for the polymorphism.
  • Examples of protective genotypes include: (a) heterozygous for the R32Q polymorphism in Z?F (rs641 153); (b) heterozygous for the L9H polymorphism in BF (rs4151667); (c) heterozygous for the IVS 10 polymorphism in C2 (rs547154); (d) heterozygous for the E318D polymorphism in C2 (rs9332739); (e) homozygous for the deITT polymorphism in CFH; (f) homozygous for the R 150R polymorphism in BF (rs 1048709); and (g) homozygous for Y402 in CFH.
  • the invention provides a method for assessing the risk of development of, or likely progression of, macular degeneration or other complement mediated disease in a human subject. Underlying the methods are discoveries made through genetic association studies relating certain genetic features to risk or protective phenotypes of complement related disease, in this case, age related macular degeneration.
  • the methods of the invention include the steps of obtaining a biological sample from a human subject, and analyzing the sample by any validated technique known in the art to determine whether the subject carries one or more of:
  • lhe sample is analyzed to determine whether the subject carries one or more of:
  • the sample is an accessible body fluid, such as blood or a blood component, or urine.
  • cellular material will be required to enable detection of a genotype from a cell of the subject.
  • the subject may have been diagnosed with a condition including AMD, early AMD, choroidal neovascularization (CNV), or geographic atrophy (GA).
  • the subject has symptoms of disease, e.g., early stage macular degeneration symptoms such as the development of drusen. Some of the subjects may present with drusen development.
  • the subject may be asymptomatic of macular degeneration or other complement related disease, in which case, the analysis essentially provides a screening procedure which can be done on the population generally or on some segment that is thought to be at increased risk, such as individuals with a family history of complement related disease. Yet additional subjects may be at high risk for acquiring AMD.
  • the subject has the Y402H SNP.
  • the invention provides a kit for assessing the risk of development of, or likely progression of, macular degeneration or other complement mediated disease in a human subject.
  • the kit includes a collection of reagents for detecting in a sample from the subject one or more, preferably two or more of the polymorphisms or allelic variants listed above. It may comprise oligonucleotides, typically labeled oligonucleotides, designed to detect a variant using any number of methods known to the art.
  • the kit may include, for example, PCR primers for amplifying a target polynucleotide sequence when the target is a polymorphism, or a specific binding protein, e.g., a monoclonal antibody, that recognizes and binds specifically to an allelic variant of a target protein as a basis for obtaining the relevant genetic/proteomic information from the sample.
  • the kit contains oligonucleotides immobilized on a solid support.
  • the components in a kit for identifying a subject at increased risk for developing age-related macular degeneration will include one or more reagents for detecting at least one protective polymorphism in the subject.
  • Such reagents allow detection of at least one protective polymorphism including: (a) R32Q in _3F (rs641 153); (b) L9H in BF (rs4151667); (c) IVS 10 in C2 (rs547154); and (d) E318D in C2 (rs9332739).
  • the reagents in such kits may include one or more oligonucleotides that detect the protective polymorphism.
  • kit components can include one or more reagents for amplifying a target sequence, where the target sequence encompasses one or more of the protective polymorphisms.
  • the one or more oligonucleotides arc immobilized on a solid support.
  • the invention provides microa ⁇ ays for identifying a subject at increased risk for developing AMD.
  • this invention provides microarrays containing oligonucleotide probes capable of hybridizing under stringent conditions to one or more nucleic acid molecules having a protective polymorphism.
  • Such microarrays can further contain oligonucleotide probes capable of hybridizing under stringent conditions to one or more additional nucleic acid molecules having a polymorphism that includes, for example, (a) the deITT polymorphism in CFH; (b) the R 150R polymorphism in BF; and (c) the Y402 ⁇ polymorphism in CFH.
  • nucleic and amino acid sequences listed in are shown using standard letter abbreviations for nucleotide bases, and three leiter code for amino acids, as defined in 37 C.F.R. 1.822. Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand. All sequence database accession numbers referenced herein are understood to refer to the version of the sequence identified by that accession number as it was available on the designated date. In the accompanying sequence listing:
  • SEQ ID NO: 1 is based on the SNP with rcfSNP !D:rs641 153 as available through NCBI on January 30, 2006 (revised January 5, 2006).
  • This SNP has an A or a G at nucleotide position 22, generating an R32Q variant (glutamine instead of arginine at amino acid position 32) in the BF gene.
  • SEQ ID NO:2 shows the SNP with refSNP ID:rs4151667 as available through NCBI on January 30, 2006 (revised January 5, 2006).
  • This SNP has an A or a T at nucleotide position 26, generating an L9H variant (histidine instead of leucine at amino acid position 9) in the BF gene.
  • SEQ BD NO:3 is based on the SNP with refSNP ID:rs547154 as available through NCBI on January 30, 2006 (revised January 5, 2006). This SNP has a G or a T at nucleotide position 23 in intron 10 of the C2 gene.
  • the sequence provided for rs547154 is
  • SEQ ID NO:4 shows the SNP with refSNP ID:rs9332739 as available through NCBI on January 30, 2006 (revised January 5, 2006).
  • This SNP has a C or a G at nucleotide position 26, generating an E318D variant (aspartic acid instead of glutamic acid at amino acid position 318) in the C2 gene.
  • the sequence provided for rs9332739 is ACGACAACTCCCGGGATATGACTGARGTGATCAGCAGCCTGGAAAATGCC
  • R is C or G (SEQ ID NO:4).
  • SEQ ID NO:5 shows the SNP with refSNP ID:rs 1048709 as available through NCBI on January 30, 2006 (revised January 5, 2006).
  • This SNP has an A or a G at nucleotide position 26 in the BF gene.
  • This SNP does not cause an amino acid change al position 150 (R 150R).
  • the sequence provided for rs 1048709 is
  • R is A or G (SEQ ID NO:5).
  • SEQ ID NOS :6 and 7 show the deITT polymorphism sequences.
  • the delTT polymorphism is a 2bp insertion/deletion polymorphism.
  • the sequences are as follows:
  • SEQ ID NO:8 shows the SNP with refSNP ID:rsl O61 170 as available through NCBI on January 30, 2006 (revised January 5, 2006). This SNP has a C or a T at nucleotide 1277 in exon 9 (nucleotide 26 in the below sequence), generating a Y402H variant (histidine instead of tyrosine at amino acid position 402) in the CFH gene.
  • SEQ ID NO:9 shows the entire BF amino acid sequence with 9H & 32R) mgsnlspqhc lmpfilglls ggvtttpwsl arpqgscsle gveikggsfr llqegqaley vcpsgfypyp vqtrtcrstg swstlktqdq ktvrkaecra ihcprphdfe ngeywprspy ynvsdeisfh cydgytlrgs anrtcqvngr wsgqtaicdn gagycsnpgi pigtrkvgsq yrledsv
  • SEQ ID NO:13 shows the 9 BF amino acid sequence with 32Q: wslaqpqgs
  • SEQ ID NO: 14 shows the 9 BF amino acid sequence with 9H: lspqhclmp
  • SEQ ID NO: 15 shows the 7 C2 amino acid sequence with 318D: dmtdvis
  • Figure 1 is a diagram and haplotype analysis of the SNPs in BF and C2.
  • the SNPs used in the study are shown along with the predicted haplotypes, odds ratios (OR), P values (P) and frequencies in the combined cases (CAS) and controls (CON).
  • the 95% confidence interval for H7 is (0.33-0.61) and for H 10 is (0.23-0.56).
  • the ancestral (chimpanzee) haplotype is designated as Anc. Examples of haplotype H2 (NCBI Accession No. AL662S49, as available on February 8, 2006), H5 (NCBI Accession No. AL645922 and NCBl Accession No. NG_004658, as available on February 8, 2006) and H7 (NCBI Accession No. NG_000013, as available on February 8, 2006) have been sequenced and no additional non-synonymous variants in either the C2 or BF genes are present (Stewart et al. (2004) Genome Res. 14:1 176- 87).
  • Figure 2 shows combined complement gene analyses. Individual SNP analyses revealed several possible combinations of SNPs that protect an individual from developing AMD. To test these, an empirical model was first applied. Fig. 2A shows a model graphic, interpreted as giving four possible combinations of genotypes that would protect from AMD.
  • rs641 153 is G/A and rslO61170 (Y402H) is C/T; (2) rs547154 is G/A and rslO61170 is C/C; (3) rs4151667 (L9H) is T/A and rslO61170 is C/T; (4) rs4151667 is T/A and rslO61170 is C/C.
  • Application of this model resulted in the distributions shown in Fig. 2B for the Iowa, Columbia, and combined cohorts, respectively.
  • This model describes four possible individual or combinations of genotypes that protect from AMD; i.e., combinations resulting in the model being "true.” These genotypes are: (1) rs 1048709 (R 150R) is G/G and rs 1061 170 is C/C; or (2) rs547154 is G/A; or (3) rs4151667 is T/A; or (4) CFH intron 1 variant is delTT.
  • FIG. 3 shows immunolocalization of Z?F (Fig. 3A); Ba (a fragment of the full-length factor B) (Fig. 3B); and C3 (Fig. 3C) along the retinal pigment epithelium (RPE)-choroid (CH) complex in sections from an unfixed eye of a 72 year old donor with early stage AMD.
  • AnXl-BF antibody (Quidel; reaction product is red) labels drusen (D), particularly along their rims, Bruch's membrane, and the choroidal stroma.
  • Anti-Ba antibody Quidel; reaction product is purple) labels Bruch's membrane and RPE-associated patches. Note that the distribution of BF is similar to that of C3. Brown coloration in the RPE cytoplasm and choroid is due to melanin.
  • sequence polymorphisms that were discovered to confer a protective effect against age-related macular degeneration (AMD). These polymorphisms include those found in the factor B (BF) and complement component 2 (CI) genes. Protective polymorphisms also include the delTT polymorphism in the CFH gene. Identifying subjects with these polymorphisms, as well as subjects with the recently discovered risk haplotype (Y402H in the complement factor H (CFH) gene), will aid in diagnosing those subjects at genetic risk for AMD. Terms
  • mutations or polymorphisms or “one or more mutations or polymorphisms” means a mutation, a polymorphism, or combinations thereof, wherein “a” can refer to more than one.
  • suitable methods and materials are described below. The materials, methods, and examples are illustrative only and not intended to be limiting.
  • Age-related macular degeneration A medical condition wherein the light sensing cells in the macula malfunction and over time cease to work. In macular degeneration the final form or the disease results in missing or blurred vision in the central, reading part of vision. The outer, peripheral part of the vision remains intact. AMD is further divided into a "dry,” or nonexudative, form and a "wet,” or exudative, form. Eighty five to ninety percent of cases are categorized as "dry" macular degeneration where fatty tissue, known as drusen, will slowly build up behind the retina. The classic lesion in dry macular degeneration is geographic atrophy. Ten to fifteen percent of cases involve the growth of abnormal blood vessels under the retina.
  • wet macular degeneration due to the leakage of blood and other fluid from behind the retina into the eye.
  • Wet macular degeneration usually begins as the dry form. If allowed to continue without treatment it usually completely destroys the macular structure and function.
  • Choroidal neovascularization is the development of abnormal blood vessels beneath the retinal pigment epithelium (RPE) layer of the retina.
  • Risk factors for AMD include aging, smoking, family history, exposure to sunlight especially blue light, hypertension, cardiovascular risk factors such as high cholesterol and obesity, high fat intake, oxidative stress, and race.
  • AMD is an example of a disease characterized by alternative complement cascade disregulation, which also includes membrane proliferative glomerulonephritis (MPGN) and a predisposition to develop aortic aneurism.
  • MPGN membrane proliferative glomerulonephritis
  • Methods described herein for detection or increased risk of developing AMD may also be used to detect increased risk for other diseases characterized by alternative complement cascade disregulation (e.g., MPGN).
  • Allele Any one of a number of viable DNA codings of the same gene (sometimes the term refers to a non-gene sequence) occupying a given locus (position) on a chromosome.
  • An individual's genotype for that gene will be the set of alleles it happens to possess.
  • two alleles make up the individual's genotype.
  • a diploid organism which has two different alleles of the gene is said to be heterozygous.
  • the process of "detecting alleles" may be referred to as “genotyping, determining or identifying an allele or polymorphism,” or' any similar phrase.
  • the allele actually detected will be manifest in the genomic DNA of a subject, but may also be detectable from RNA or protein sequences transcribed or translated from this region.
  • f0044j Amplification The use of a technique that increases the number of copies of a nucleic acid molecule in a sample.
  • PCR polymerase chain reaction
  • a biological sample obtained from a subject is contacted with a pair of oligonucleotide primers, under conditions that allow for hybridization of the primers to a nucleic acid molecule in the sample.
  • the primers are extended under suitable conditions, dissociated from the template, and then re-annealed, extended, and dissociated to amplify the number of copies of the nucleic acid molecule.
  • the product of amplification can be characterized by such techniques as electrophoresis, restriction endonuclease cleavage patterns, oligonucleotide hybridization or ligation, and/or nucleic acid sequencing.
  • amplification methods include strand displacement amplification, as disclosed in U.S. Patent No. 5,744,31 1 ; transcription-free isothermal amplification, as disclosed in U.S. Patent No. 6,033,881 ; repair chain reaction amplification, as disclosed in PCT Publication No. WO 90/01069; ligase chain reaction amplification, as disclosed in EP-A-320,308; gap filling ligase chain reaction amplification, as disclosed in U.S. Patent No. 5,427,930; and NASBATM RNA transcription-free amplification, as disclosed in U.S. Patent No. 6,025,134.
  • Array An arrangement of molecules, particularly biological macromolecules (such as polypeptides or nucleic acids) or cell or tissue samples, in addressable locations on or in a substrate.
  • a "microarray” is an array that is miniaturized so as to require or be aided by microscopic examination for evaluation or analysis. These arrays are sometimes called DNA chips, or - generally - biochips; though more formally they are referred to as microarrays, and the process of testing the gene patterns of an individual is sometimes called microarray profiling.
  • DNA array fabrication chemistry and structure is varied, typically made up of 400,000 different features, each holding DNA from a different human gene, but some employing a solid-state chemistry to pattern as many as 780,000 individual features.
  • the array of molecules makes it possible to carry out a very large number of analyses on a sample at one time.
  • one or more molecules such as an oligonucleotide probe
  • will occur on the array a plurality of times such as twice, for instance to provide internal controls.
  • an array includes nucleic acid molecules, such as oligonucleotide sequences that are at least 15 nucleotides in length, such as about 15-40 nucleotides in length, such as at least 18 nucleotides in length, at least 21 nucleotides in length, or even at least 25 nucleotides in length.
  • the molecule includes oligonucleotides attached to the array via their 5'- or 3'-end.
  • each arrayed sample is addressable, in that its location can be reliably and consistently determined within the at least two dimensions of the array.
  • the feature application location on an array can assume different shapes.
  • the array can be regular (such as arranged in uniform rows and columns) or irregular.
  • the location of each sample is assigned to the sample at the time when it is applied to the array, and a key may be provided in order to correlate each location with the appropriate target or feature position.
  • ordered arrays are arranged in a symmetrical grid pattern, but samples could be arranged in other patterns (such as in radially distributed lines, spiral lines, or ordered clusters).
  • Addressable arrays usually are computer readable, in that a computer can be programmed to correlate a particular address on the array with information about the sample at that position (such as hybridization or binding data, including for instance signal intensity).
  • the individual features in the array are arranged regularly, for instance in a Cartesian grid pattern, which can be correlated to address information by a computer.
  • Also contemplated herein are protein-based arrays, where the probe molecules are or include proteins, or where the target molecules are or include proteins, and arrays including nucleic acids to which proteins/peptides are bound, or vice versa.
  • Binding or stable binding An association between two substances or molecules, such as the hybridization of one nucleic acid molecule to another (or itself) and the association of an antibody with a peptide.
  • An oligonucleotide molecule binds or stably binds to a target nucleic acid molecule if a sufficient amount of the oligonucleotide molecule forms base pairs or is hybridized to its target nucleic acid molecule, to permit detection of that binding.
  • Binding can be detected by any procedure known to one skilled in the art, such as by physical or functional properties of the target oligonucleotide complex. For example, binding can be delected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription, translation, and the like.
  • Physical methods of detecting the binding of complementary strands of nucleic acid molecules include but are not limited to, such methods as DNase 1 or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures.
  • one method involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target disassociate from each other, or melt.
  • the method involves detecting a signal, such as a detectable label, present on one or both complementary strands.
  • T m the temperature at which 50% of the oligomer is melted from its target.
  • T 1n the temperature at which 50% of the oligomer is melted from its target.
  • Complement component 2 Part of the classical pathway of the complement system. Activated Cl cleaves C2 into C2a and C2b. C2a leads to activation of C3. Deficiency of C2 has been reported to be associated with certain autoimmune diseases, including systemic lupus erythematosus, Henoch-Schonlein purpura, or polymyositis. C2 is a member of EC 3.4.21.43. It is also known as classical-complement-pathway C3/C5 convertase.
  • Complement Factor H Otherwise known as beta- IH; a serum glycoprotein that controls the function of the alternative complement pathway and acts as a cofactor with factor I (C3b inactivator). It regulates the activity of the C3 convertases such as C4b2a.
  • C3b inactivator C3b inactivator
  • C4b2a C4b2a
  • Complementarity and percentage complementarity Molecules with complementary nucleic acids form a stable duplex or triplex when the strands bind, (hybridize), to each other by forming Watson-Crick, Hoogsteen or reverse Hoogsteen base pairs. Stable binding occurs when an oligonucleotide molecule remains detectably bound to a target nucleic acid sequence under the required conditions.
  • Complementarity is the degree to which bases in one nucleic acid strand base pair with the bases in a second nucleic acid strand. Complementarity is conveniently described by percentage, that is, the proportion of nucleotides that form base pairs between two strands or within a specific region or domain of two strands. For example, if 10 nucleotides of a 15-nucleotide oligonucleotide form base pairs with a targeted region of a DNA molecule, that oligonucleotide is said to have 66.67% complementarity to the region of DNA targeted.
  • sufficient complementarity means that a sufficient number of base pairs exist between an oligonucleotide molecule and a target nucleic acid sequence (such as a CFH, BF or C2 sequence) to achieve detectable binding.
  • a target nucleic acid sequence such as a CFH, BF or C2 sequence
  • the percentage complementarity that fulfills this goal can range from as little as about 50% complementarity to full ( 100%) complementary.
  • sufficient complementarity is at least about 50%, for example at least about 75% complementarity, at least about 90% complementarity, at least about 95% complementarity, at least about 98% complementarity, or even at least about 100% complementarity.
  • DNA deoxyribonucleic acid
  • the repeating units in DNA polymers are four different nucleotides, each of which includes one of the four bases (adenine, guanine, cytosine and thymine) bound to a deoxyribose sugar to which a phosphate group is attached.
  • Triplets of nucleotides, referred to as codons, in DNA molecules code for amino acid in a polypeptide.
  • codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.
  • Drusen Deposits that accumulate between the RPE basal lamina and the inner collagenous layer of Bruch's membrane (see, for example, van der Schaft el al. ( 1992) Ophthalmol. 99:278-86; Spraul et al. ( 1997) Arch. Ophthalmol. 1 15:267-73; and Mullins et «/., Histochemical comparison of ocular "drusen” in monkey and human, In M. LaVail, J. Hollyfield, and R. Anderson (Eds.), in Degenerative Retinal Diseases (pp. 1 -10). New York: Plenum Press, 1997).
  • Hard drusen are small distinct deposits comprising homogeneous eosinophilic material and are usually round or hemispherical, without sloped borders. Soft drusen are larger, usually not homogeneous, and typically contain inclusions and spherical profiles. Some drusen may be calcified.
  • the term "diffuse drusen,” or “basal linear deposit,” is used to describe amorphous material which forms a layer between the inner collagenous layer of Bruch's membrane and the retinal pigment epithelium (RPE). This material can appear similar to soft drusen histologically, with the exception that it is not mounded.
  • Factor B BF
  • Factor b is converted by factor d to c3 convertase.
  • BF is a member of EC 3.4.21.47.
  • Factor B circulates in the blood as a single chain polypeptide.
  • complement factor d Upon activation of the alternative pathway, it is cleaved by complement factor d yielding the noncatalytic chain Ba and the catalytic subunit Bb.
  • the active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase.
  • BF is also known as alternative-complement-pathway C3/C5 convertase.
  • Genetic predisposition or risk Susceptibility of a subject to a genetic disease, such as AMD. However, such susceptibility may or may not result in actual development of the disease.
  • Haplotype The genetic constitution of an individual chromosome. In diploid organisms, a haplotype contains one member of the pair of alleles for each site. A haplotype can refer to only one locus or to an entire genome. Haplotype can also refer to a set of single nucleotide polymorphisms (SNPs) found to be statistically associated on a single chromatid.
  • SNPs single nucleotide polymorphisms
  • Hybridization Oligonucleotides and their analogs hybridize by hydrogen bonding, which includes Watson-Crick, Hoogsleen or reversed Hoogsteen hydrogen bonding, between complementary bases.
  • nucleic acid consists of nitrogenous bases that are either pyrimidines (cytosine (C), uracil (U), and thymine (T)) or purines (adenine (A) and guanine (G)). These nitrogenous bases form hydrogen bonds between a pyrimidine and a purine, and the bonding of the pyrimidine to the purine is referred to as "base pairing." More specifically, A will hydrogen bond to T or U, and G will bond to C.
  • “Complementary” refers to the base pairing that occurs between to distinct nucleic acid sequences or two distinct regions of the same nucleic acid sequence.
  • oligonucleotide or its analog
  • DNA or RNA target DNA or RNA target.
  • the oligonucleotide or oligonucleotide analog need not be 100% complementary to its target sequence to be specifically hybridizable.
  • An oligonucleotide or analog is specifically hybridizable when binding of the oligonucleotide or analog to the target DNA or RNA molecule interferes with the normal function of the target DNA or RNA, and there is a sufficient degree of complementarity to avoid non-specific binding of the oligonucleotide or analog to non-target sequences under conditions where specific binding is desired, for example under physiological conditions in the case of in vivo assays or systems. Such binding is referred to as specific hybridization.
  • Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing nucleic acid sequences. Generally, the temperature of hybridization and the ionic strength (especially the Na+ and/or Mg++ concentration) of the hybridization buffer will determine the stringency of hybridization, though wash times also influence stringency. Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol.
  • stringent conditions encompass conditions under which hybridization will only occur if there is less than 25% mismatch between the hybridization molecule and the target sequence.
  • Stringent conditions may be broken down into particular levels of stringency for more precise definition.
  • “moderate stringency” conditions are those under which molecules with more than 25% sequence mismatch will not hybridize; conditions of “medium stringency” are those under which molecules with more than 15% mismatch will not hybridize, and conditions of “high stringency” are those under which sequences with more than 20% mismatch will not hybridize.
  • Conditions of "very high stringency” are those under which sequences with more than 10% mismatch will not hybridize.
  • Hybridization 5x SSC at 65°C for 16 hours
  • Hybridization 5x.-6x SSC at 65°C-7O°C for 16-20 hours
  • Hybridization 6x SSC at RT to 55°C for 16-20 hours
  • Isolated An "isolated" biological component (such as a nucleic acid molecule, protein, or organelle) has been substantially separated or purified away from other biological components in the cell of the organism in which the component naturally occurs, such as other chromosomal and extra-chromosomal DNA and RNA, proteins and organelles.
  • Nucleic acid molecules and proteins that have been "isolated” include nucleic acid molecules and proteins purified by standard purification methods. The term also embraces nucleic acid molecules and proteins prepared by recombinant expression in a hosl cell as well as chemically synthesized nucleic acid molecules and proteins.
  • Linkage disequilibrium The non-random association of alleles at two or more loci, not necessarily on the same chromosome. LD describes a situation in which some combinations of alleles or genetic markers occur more or less frequently in a population than would be expected from a random formation of haplotypes from alleles based on their frequencies. The expected frequency of occurrence of two alleles that are inherited independently is the frequency of the first allele multiplied by the frequency of the second allele. Alleles that co-occur at expected frequencies are said to be in linkage equilibrium.
  • Locus The position of a gene (or other, significant sequence) on a chromosome.
  • Mutation Any change of the DNA sequence within a gene or chromosome. In some instances, a mutation will alter a characteristic or trait (phenotype), but this is not always the case. Types of mutations include base substitution point mutations (e.g., transitions or transversions), deletions, and insertions. Missense mutations are those that introduce a different amino acid into the sequence of the encoded protein; nonsense mutations are those that introduce a new stop codon.
  • mutations can be in-frame (not changing the frame of the overall sequence) or frame shift mutations, which may result in the misreading of a large number of codons (and often leads to abnormal termination of the encoded product due to the presence of a stop codon in the alternative frame).
  • This term specifically encompasses variations that arise through somatic mutation, for instance those that are found only in disease cells, but not constitutionally, in a given individual. Examples of such somalically-acquired variations include the point mutations that frequently result in altered function of various genes that are involved in development of cancers.
  • This term also encompasses DNA alterations that are present constitutionally, that alter the function of the encoded protein in a readily demonstrable manner, and that can be inherited by the children of an affected individual.
  • the term overlaps with "polymorphism,” as defined below, but generally refers to the subset of constitutional alterations.
  • Nucleic acid molecule A polymeric form of nucleotides, which may include both sense and anti-sense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above.
  • a nucleotide refers to a ribonucleotide, deoxynucleotide or a modified form of either type of nucleotide.
  • a "nucleic acid molecule” as used herein is synonymous with "nucleic acid” and "polynucleotide.”
  • a nucleic acid molecule is usually at least 10 bases in length, unless otherwise specified. The term includes single and double stranded forms of DNA.
  • a polynucleotide may include either or both naturally occurring and modified nucleotides linked together by naturally occurring and/or non-naturally occurring nucleotide linkages.
  • Nucleotide Includes, but is not limited to, a monomer that includes a base linked to a sugar, such as a pyrimidine, purine or synthetic analogs thereof, or a base linked to an amino acid, as in a peptide nucleic acid (PNA).
  • a nucleotide is one monomer in a polynucleotide.
  • a nucleotide sequence refers to the sequence of bases in a polynucleotide.
  • Oligonucleotide A nucleic acid molecule generally comprising a length of 300 bases or fewer. The term often refers to single stranded deoxyribonucleotides, but it can refer as well to single or double stranded ribonucleotides, RNA:DNA hybrids and double stranded DNAs, among others.
  • oligonucleotide also includes oligonucleosides (that is, an oligonucleotide minus the phosphate) and any other organic base polymer. In some examples, oligonucleotides are about 10 to about 90 bases in length, for example, 12, 13, 14, 15, 16, 17, 18, 19 or 20 bases in length.
  • Oligonucleotides are about 25, about 30, about 35, about 40, about 45, about 50, about 55, about 60 bases, about 65 bases, about 70 bases, about 75 bases or about 80 bases in length. Oligonucleotides may be single stranded, for example, for use as probes or primers, or may be double stranded, for example, for use in the construction of a mutant gene. Oligonucleotides can be either sense or anti sense oligonucleotides. An oligonucleotide can be modified as discussed above in reference to nucleic acid molecules. Oligonucleotides can be obtained from existing nucleic acid sources (for example, genomic or cDNA), bul can also be synthetic (for example, produced by laboratory or in vitro oligonucleotide synthesis).
  • Polymorphism A variation in the gene sequence.
  • the polymorphisms can be those variations (DNA sequence differences) which are generally found between individuals or different ethnic groups and geographic locations which, while having a different sequence, produce functionally equivalent gene products.
  • the term can also refer to variants in the sequence which can lead to gene products that are not functionally equivalent.
  • Polymorphisms also encompass variations which can be classified as alleles and/or mutations which can produce gene products which may have an altered function.
  • Polymorphisms also encompass variations which can be classified as alleles and/or mutations which either produce no gene product or an inactive gene product or an active gene product produced at an abnormal rate or in an inappropriate tissue or in response to an inappropriate stimulus. Further, the term is also used interchangeably with allele as appropriate.
  • Polymorphisms can be referred to, for instance, by the nucleotide position at which the variation exists, by the change in amino acid sequence caused by the nucleotide variation, or by a change in some other characteristic of the nucleic acid molecule or protein that is linked to the variation.
  • Probes and Primers A probe comprises an identifiable, isolated nucleic acid that recognizes a target nucleic acid sequence. Probes include a nucleic acid that is attached to an addressable location, a detectable Jabel or other reporter molecule and that hybridizes to a target sequence. Typical labels include radioactive isotopes, enzyme substrates, co-factors, ligands, chemiluminescent or fluorescent agents, haptens, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, for example, in Sambrook el al. (ed.), Molecular Cloning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989 and Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999.
  • Primers are short nucleic acid molecules, for instance DNA oligonucleotides 10 nucleotides or more in length, for example that hybridize to contiguous complementary nucleotides or a sequence to be amplified. Longer DNA oligonucleotides may be about 15, 20, 25, 30 or 50 nucleotides or more in length. Primers can be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then the primer extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, for example, by the PCR or other nucleic-acid amplification methods known in the art, as described below.
  • nucleic acid probes and primers are described, for example, in Sambrook et al. (ed.), Molecular Cioning: A Laboratory Manual, 2nd ed., vol. 1-3, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY, 1989; Ausubel et al. Short Protocols in Molecular Biology, 4th ed., John Wiley & Sons, Inc., 1999; and lnnis et al. PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990.
  • Amplification primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5, ⁇ 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA).
  • Primer Very 0.5, ⁇ 1991 , Whitehead Institute for Biomedical Research, Cambridge, MA.
  • probes and primers can be selected that include at least 20, 25, 30, 35, 40, 45, 50 or more consecutive nucleotides of a target nucleotide sequences.
  • Sample A sample obtained from a human or non-human mammal subject.
  • biological samples include all samples useful for genetic analysis in subjects, including, but not limited to: cells, tissues, and bodily fluids, such as blood; derivatives and fractions of blood (such as serum or plasma); extracted galls; biopsied or surgically removed tissue, including tissues that are, for example, unfixed, frozen, fixed in formalin and/or embedded in paraffin; tears; milk; skin scrapes; surface washings; urine; sputum; cerebrospinal fluid; prostate fluid; pus; bone marrow aspirates; BAL; saliva; cervical swabs; vaginal swabs; and oropharyngeal wash.
  • Single Nucleotide Polymorphism or SNP A DNA sequence variation, occurring when a single nucleotide: adenine (A), thymine (T), cytosine (C) or guanine (G) - in the genome differs between members of the species.
  • SNP single nucleotide polymorphism
  • SNPs may fall within coding sequences (CDS) of genes or between genes (intergenic regions). SNPs within a CDS change the codon, which may or may not change the amino acid in the protein sequence. The former may constitute different alleles. The latter are called silent mutations and typically occur in the third position of the codon (called the wobble position).
  • Subject Human and non-human mammals (such as veterinary subjects).
  • Methods for identifying a subject at increased risk of developing age-related macular degeneration include analyzing the subject 's factor B (BF) and/or complement component 2 (C2) genes, and determining whether the subject has at least one protective polymorphism, wherein the protective polymorphism is selected from the group consisting of: a) R32Q in £F (rs641 153); b) L9H in #F (rs4151667); c) IVS 10 in C2 (rs547154); and d) E318D in C2 (rs9332739).
  • BF subject 's factor B
  • C2 complement component 2
  • the method may further include analyzing the subject's CFH gene, or any other desired gene. As described herein, the delTT polymorphism in the CFH gene has been identified as being protective for AMD.
  • the methods may also include analyzing the subject's genotype at either the BF or C2 locus and at the CFH locus, and determining if the subject has at least one protective genotype selected from the group consisting of: a) heterozygous for the R32Q polymorphism in BF (rs641153); b) heterozygous for the L9H polymorphism in BF (rs4151667); c) heterozygous for the IVS 10 polymorphism in C2 (rs547154); d) heterozygous for the E318D polymorphism in C2 (rs9332739); e) homozygous for the delTT polymorphism in CFH; and f) homozygous for the Rl 50R polymorphism in BF (rs 1048709) and homozygous for Y402 in CFH; wherein if the subject does not have at least one protective genotype, the subject is at increased risk for developing AMD.
  • the method may alternatively include analyzing the subject's genotype at both the BF and C2 locus, and at the CFH locus.
  • the methods provided herein are also useful for identifying a subject at decreased risk of developing AMD, by determining if the subject has at least one of the above-identified polymorphisms or genotypes.
  • the analysis of a subject's genetic material for the presence or absence of particular polymorphisms is performed by obtaining a sample from the subject. This sample may be from any part of the subject's body that DNA or RNA can be isolated from. Analysis may also be performed on protein isolated from a sample. Examples of such samples are discussed in more detail below.
  • the subject may have been diagnosed with AMD, including early AMD, choroidal neovascularization, or geographic atrophy.
  • the subject may have symptoms of AMD, such as drusen, pigmentary alterations, exudative changes such as hemorrhages, hard exudates, or subretinal/sub-RPE/intraretinal fluid, decreased visual acuity, blurred vision, distorted vision (metamorphopsia), central scotomas, or trouble discerning colors.
  • the subject may not have been diagnosed with AMD, but may be in a high risk group, based on family history, age, race, or lifestyle choices.
  • Subjects at risk for developing AMD also include those that are heterozygous or homozygous for the risk haplotype Y402H in the CFH gene.
  • analyzing a subject's BF, C2 or CFH genes for the particular polymorphisms disclosed herein is also intended to include detection of any mutations that confer the same amino acid change as found in the polymorphism.
  • the L9 ⁇ polymorphism in BF changes the nucleotide codon for the 9 lh amino acid from CTC to CAC, generating a histidine instead of a leucine. This change could also be specified by the nucleotide codon CAT.
  • the E318D polymorphism in C2 changes the nucleotide codon for the 318 th amino acid from GAG to GAC, generating an aspartic acid instead of a glutamic acid. This change could also be specified by the nucleotide codon GAT.
  • the R 150R polymorphism in BF changes the nucleotide codon for the 150 th amino acid from CGG to CGA. This change does not change the amino acid encoded (arginine). Arginine could also be encoded by CGT or CGC. ⁇ n addition, arginine could be encoded by AGA or AGG.
  • the Y402H polymorphism in CFH changes lhe nucleotide codon for the 402 ml amino acid from a TAT to a CAT, generating a histidine instead of a tyrosine. This change could also be specified by lhe nucleotide codon CAC. Any of these nucleotide codons, or others capable of being identified by one of skill in the art, can be detected in a subject. [0089]
  • the methods of the invention may identify at least about 5%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70% of subjects that will develop AMD.
  • the present disclosure also provides methods of avoiding or reducing the incidence of AMD in a subject determined to be genetically predisposed to developing AMD. For example, if in using the methods described above a mutation or protective polymorphism in the BF, C2 and/or CFH genes is not identified in a subject at risk for AMD based on any of the risk factors described above, a lifestyle choice may be undertaken by the subject in order to avoid or reduce the incidence of AMD or to delay the onset of AMD. For example, the subject may quit smoking; modify diet to include less fat intake; increase the intake of antioxidants, including vitamins C and E, beta-carotene, and zinc; or take prophylactic doses of agents that retard the development of retinal neovascularization.
  • Treatment for such individuals could involve vaccines against certain pathogens, or antibiotics, or antiviral or fungal drugs. Treatment could also involve anti-inflammatory drugs, or complement inhibitors.
  • the treatment selected is specific and tailored for the subject, based on the analysis of that subject's genetic profile.
  • Methods for detecting known polymorphisms include, but are not limited to, restriction fragment length polymorphism (RFLP), single strand conformational polymorphism (SSCP) mapping, nucleic acid sequencing, hybridization, fluorescent in situ hybridization (FISH), PFGE analysis, RNase protection assay, allele-specific oligonucleotide (ASO), dot blot analysis, allele-specific PCR amplification (ARMS), oligonucleotide ligation assay (OLA) and PCR-SSCP.
  • MALDl Matrix Assisted Laser Desorption/Ionization
  • MALDI-TOF MALDI- Time Of Flight
  • DNA microchip technology for the detection of mutations. See, for example, Chapters 6 and 17 in Human Molecular Genetics 2. Eds. Tom Strachan and Andrew Read. New York: John Wiley & Sons Inc., 1999.
  • These techniques may include amplifying the nucleic acid before analysis. Amplification techniques are known to those of skill in the art and are discussed below.
  • a polymorphism causes a nucleotide change that creates or abolishes the recognition site of a restriction enzyme
  • that restriction enzyme may be used to identify the polymorphism.
  • Polymorphic alleles can be distinguished by PCR amplifying across the polymorphic site and digesting the PCR product with a relevant restriction endonuclease. The different products may be detected using a size fractionation method, such as gel electrophoresis. Alternatively, restriction fragment length polymorphism (RFLP) may be used. In cases where the polymorphism does not result in a restriction site difference, differences between alleles may be detected by amplification-created restriction site PCR.
  • RFLP restriction fragment length polymorphism
  • a primer is designed from sequence immediately adjacent to, but not encompassing, the restriction site.
  • the primer is deliberately designed to have a single base mismatch in a noncritical position which does not prevent hybridization and amplification of both polymorphic sequences. This nucleotide mismatch, together with the sequence of the polymorphic site creates a restriction site not present in one of the alleles.
  • Single strand conformational polymorphism (SSCP) mapping detects a band that migrates differentially because the sequence change causes a difference in single- strand, intramolecular base pairing.
  • Single-stranded DNA molecules differing by only one base frequently show different electrophoretic mobilities in nondenaturing gels. Differences between normal and mutant DNA mobility are revealed by hybridization with labeled probes.
  • This method does not detect all sequence changes, especially if the DNA fragment size is greater than about 500 bp, but can be optimized to detect most DNA sequence variation.
  • the reduced detection sensitivity is a disadvantage, but the increased throughput possible with SSCP makes it an attractive alternative to direct sequencing for mutation detection on a research basis.
  • the fragments which have shifted mobility on SSCP gels are then sequenced to determine the exact nature of the DNA sequence variation.
  • the detection of specific alleles may also be performed using Taq polymerase (Holland et ⁇ /. (1991) Prnc. Natl. Acad. Sci. U.S.A. 88:7276-80; Lee et al. ( 1999) /. MoI. Biol. 285:73-83). This is based on the fact that Taq polymerase does not possess a proofreading 3' to 5' exonuclease activity, but possesses a 5' to 3' exonuclease activity.
  • This assay involves the use of two conventional PCR primers (forward and reverse), which are specific for the target sequence, and a third primer, designed to bind specifically to a site on the target sequence downstream of the forward primer binding site.
  • the third primer is generally labeled with two fluoropbores, a reporter dye at the 5' end, and a quencher dye, having a different emission wavelength compared to the reporter dye, at the 3' end.
  • the third primer also carries a blocking group at the 3' terminal nucleotide, so that it cannot by itself prime any new DNA synthesis.
  • a polymorphism may be identified using one or more hybridization probes designed to hybridize with the particular polymorphism in the desired gene.
  • a probe used for hybridization detection methods should be in some way labeled so as to enable detection of successful hybridization events. This may be achieved by in vitro methods such as nick -translation, replacing nucleotides in the probe by radioactively labeled nucleotides, or by random primer extension, in which non-labeled molecules act as a template for the synthesis of labeled copies. Other standard methods of labeling probes so as to detect hybridization are known to those skilled in the art. [0098] For DNA fragments up to about 2 kb in length, single-base changes can be detected by chemical cleavage at the mismatched bases in mutant-normal heteroduplexes.
  • a strand of the DNA not including the polymorphism of interest is radiolabeled at one end and then is hybridized with a strand of the subject DNA.
  • the resulting heterod ⁇ plex DNA is treated with hydroxylamine or osmium tetroxide, which modifies any C or C and T, respectively, in mismatched single- stranded regions; the modified backbone is susceptible to cleavage by piperidine.
  • the shortened labeled fragment is detected by gel electrophoresis and autoradiography in comparison with DNA not including the polymorphism of interest.
  • Mismatches are hybridized nucleic acid duplexes in which the two strands are not 100% complementary.
  • Mismatch detection can be used to detect point mutations in the gene or in its mRNA product. While these techniques are less sensitive than sequencing, they are simpler to perform on a large number of samples.
  • An example of a mismatch cleavage technique is the RNase protection method. This method involves the use of a labeled riboprobe which is complementary to one variation of the polymorphism being detected (generally the polymorphism not associated with protection from AMD).
  • the riboprobe and either mRNA or DNA isolated from the subject are annealed (hybridized) together and subsequently digested with the enzyme RNase A which is able to detect some mismatches in a duplex RNA structure. If a mismatch is detected by RNase A, it cleaves at the site of the mismatch. Thus, when the annealed RNA preparation is separated on an electrophoretic gel matrix, if a mismatch has been detected and cleaved by RNase A, an RNA product will be seen which is smaller than the full length duplex RNA for the riboprobe and the mRNA or DNA.
  • the riboprobe need not be the full length of the mRNA or gene but can be a segment of either. Alternatively, mismatches can be detected by shifts in the electrophoretic mobility of mismatched duplexes relative to matched duplexes.
  • DNA sequences of the BF, C2 or CFH genes which have been amplified by use of PCR may also be screened using allele-specific probes or oligonucleotides (ASO).
  • ASO oligonucleotides
  • These probes are nucleic acid oligomers, each of which contains a region of the gene sequence harboring a known mutation or polymorphism.
  • one oligomer may be about 30 nucleotides in length, corresponding to a portion of the BF, C2 or CFH gene sequence.
  • Hybridization of allele-specific probes with amplified BF, C2 or CFH sequences can be performed, for example, on a nylon filter. Reverse dot-blotting may also be used. For example, a screen for more then one polymorphism may be performed using a series of ASOs specific for each polymorphic allele, spotted onto a single membrane which is then hybridized to labeled PCR-amplified test DNA. These assays may range from manually-spotted arrays of small numbers to very large ASO arrays on "gene chips" that can potentially detect large numbers of polymorphisms. Hybridization to a particular probe under high stringency hybridization conditions indicates the presence of the same polymorphism in the tissue as in the allele-specific probe. Such a technique can utilize probes which are labeled with gold nanoparticles to yield a visual color result (Elghanian et al. ( 1997) Science 277: 1078-81).
  • Allele-specific PCR amplification is based on a method called amplification refractory mutation system (ARMS) (Newton et al. (1989) Nucleic Acids Res. 17:2503-16). In this method, oligonucleotides with a mismatched 3'-residue will not function as primers in the PCR under appropriate conditions. Paired PCR reactions are carried out with two primers, one of which is a common primer, and one that exists in two slightly different versions, one specific for each polymorphism.
  • ARMS amplification refractory mutation system
  • alleie-specific primers are designed to be identical to the sequence of the two alleles over a region preceding the position of the variant nucleotide, up to and terminating in the variant nucleotide itself. Therefore, if the particular polymorphism or mutation is not present, an amplification product is not observed.
  • additional control primers are used to amplify an unrelated sequence.
  • the location of the common primer can be designed to give products of different sizes for different polymorphisms, so that the PCR products from multiplexed reactions form a ladder on a gel.
  • the polymorphism-specific primers may be label with different fluorescent or other labels, or may be given 5' extensions of different sizes. This method may be adapted for use in real-time PCR.
  • oligonucleotide ligation assay two oligonucleotides are designed to hybridize to adjacent sequences in the target.
  • the site at which they join is the site of the polymorphism.
  • DNA ligase will join the two oligonucleotides only if they are perfectly hybridized (Nickerson et a). ( 1990) P roc. Natl. Acad. Sci. U.S.A. 87:8923-7).
  • the assay may use various formats, including ELISA analysis or a fluorescence sequencher.
  • the technique of nucleic acid analysis using microchip technology may also be used.
  • this technique potentially thousands of distinct oligonucleotide probes are built up in an array on a silicon chip.
  • Nucleic acid to be analyzed is fluorescently labeled and hybridized to the probes on the chip. It is also possible to study nucleic acid-protein interactions using these nucleic acid microchips.
  • Using this technique one can determine the presence of mutations or even sequence the nucleic acid being analyzed or one can measure expression levels of a gene of interest.
  • the method is one of parallel processing of many, even thousands, of probes at once and can tremendously increase the rate of analysis.
  • Alteration of BF, C2 or CFH mRNA expression can be detected by any technique known in the art. These include Northern blot analysis, PCR amplification and RNase protection. Diminished mRNA expression indicates an alteration of the wild-type gene. Allele detection techniques may be protein based if a particular allele produces a protein with an amino acid variant. For example, epitopes specific for the amino acid variant can be detected with monoclonal antibodies. Alternatively, monoclonal antibodies immunoreactive with BF, C2 or CFH can be used to screen a tissue. Lack of cognate antigen would indicate a mutation. Antibodies specific for products of mutant alleles could also be used to detect mutant gene product.
  • Such immunological assays can be done in any convenient formats known in the art. These include Western blots, immunohistochemical assays and ELISA assays. Any means for detecting an altered protein can be used to detect alteration of the wild-type BF, C2 or CFH gene. Functional assays, such as protein binding determinations, can be used. In addition, assays can be used which detect BF, C2 or CFH biochemical function. Finding a mutant BF, C2 or CFH gene product indicates alteration of a wild-type BF, C2 or CFH gene. Amplification of Nucleic Acid Molecules
  • the nucleic acid samples obtained from the subject may be amplified from the clinical sample prior to detection.
  • DNA sequences are amplified.
  • RNA sequences are amplified.
  • Any nucleic acid amplification method can be used.
  • polymerase chain reaction PCR
  • TMA transcription-mediated amplification
  • PASA polymerase chain reaction of specific alleles
  • ligase chain reaction ligase chain reaction
  • a pair of primers may be utilized in the amplification reaction.
  • One or both of the primers can be labeled, for example with a detectable radiolabel, fluorophore, or biotin molecule.
  • the pair of primers may include an upstream primer (which binds 5' to the downstream primer) and a downstream primer (which binds 3' to the upstream primer).
  • the pair of primers used in the amplification reaction may be selective primers which permit amplification of a nucleic acid involved in AMD.
  • An additional pair of primers can be included in the amplification reaction as an internal control. For example, these primers can be used to amplify a "housekeeping" nucleic acid molecule, and serve to provide confirmation of appropriate amplification.
  • a target nucleic acid molecule including primer hybridization sites can be constructed and included in the amplification reactor.
  • One of skill in the art will readily be able to identify primer pairs to serve as internal control primers.
  • Amplification products may be assayed in a variety of ways, including size analysis, restriction digestion followed by size analysis, detecting specific tagged oligonucleotide primers in the reaction products, allele-specific oligonucleotide (ASO) hybridization, sequencing, hybridization, and the like.
  • ASO allele-specific oligonucleotide
  • PCR-based detection assays include multiplex amplification of a plurality of polymorphisms simultaneously. For example, it is well known in the art to select PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously. Alternatively, it is possible to amplify different polymorphisms with primers that are differentially labeled and thus can each be detected. Other techniques are known in the art to allow multiplex analyses of a plurality of polymorphisms. A fragment of a gene may be amplified to produce copies and it may be determined whether copies of the fragment contain the particular protective polymorphism or genotype. Immunodetection of Protective Proteins
  • a protein assay is carried out to characterize polymorphisms in a subject's C2 or BF genes, e.g., to detect or identify protective proteins.
  • Methods that can be adapted for detection of variant proteins are well known and include analytical biochemical methods such as electrophoresis (including capillary electrophoresis and two-dimensional electrophoresis), chromatographic methods such as high performance liquid chromatography (HPLC), thin layer chromatography (TLC), hyperdiffusion chromatography, mass spectrometry, and various immunological methods such as fluid or gel precipitin reactions, immunodiffusion (single or double), imm ⁇ noelectrophoresis, radioimmnunoassay (RIA), enzyme-linked immunosorbent assays (ELlSAs), immunofluorescent assays, western blotting and others.
  • analytical biochemical methods such as electrophoresis (including capillary electrophoresis and two-dimensional electrophoresis), chromatographic methods such as high performance liquid chromatography
  • immunological binding assay formats suitable for the practice of the invention are known (see, e.g., Harlow, E.; Lane, D. Antibodies: A laboratory manual. Cold Spring Harbor, N. Y.: Cold Spring Harbor Laboratory; 1988; and Ausubel et al., (2004) Current Protocols in Molecular Biology, John Wiley & Sons, New York NY.
  • the assay may be, for example, competitive or non-conpetitive.
  • immunological binding assays (or immunoassays) utilize a "capture agent" to specifically bind to and, often, immobilize the analyte.
  • the capture agent is a moiety that specifically binds to a variant C2 or BF polypeptide or subsequence.
  • the bound protein may be detected using, for example, a detectably labeled anti-C2/BF antibody.
  • at least one of the antibodies is specific for the variant form (e.g., does not bind to the wild-type C2 or BF polypeptide.
  • the method involves obtaining a biological sample from a subject (e.g., blood, serum, plasma, or urine); contacting the sample with a binding agent that distinguishes a protective and nonprotecdve form of C2 or BF, and detecting the formation of a complex between the binding agent and the nonprotective form of C2 or BF, if present.
  • a biological sample e.g., blood, serum, plasma, or urine
  • a binding agent that distinguishes a protective and nonprotecdve form of C2 or BF
  • panels of antibodies may be used to detect protective proteins in a patient sample.
  • the invention also provides antibodies that specifically binds a protective C2 or DF protein but does not specifically bind a wild-type polypeptide (i.e., a C2 or BF protein not associated with protection).
  • the antibodies bind an epitope found in only the protective form.
  • an antibody may not bind a wild-type BF (encoded by Genbank Accession Nos. NM_001710; AAB67977) or C2 (encoded by Genbank Accession Nos. NM_000063; NP_000054) but binds to a BF or C2 variant, as described above (i.e., a protein having one of the polymorphisms described herein as being protective for AMD).
  • the antibody may recognize a BF protein having glutamine at position 32 or histidine at position 9 or a C2 with an aspatric acid at position 318.
  • the antibodies can be polyclonal or monoclonal, and are made according to standard protocols. Antibodies can be made by injecting a suitable animal with a protective protein or fragments thereof. Monoclonal antibodies are screened according to standard protocols (Koehler and Milstein 1975, Nature 256:495; Dower et al., WO 91/17271 and McCafferty et al., WO 92/01047; and Vaughan et al., 1996, Nature Biotechnology, 14: 309; and references provided below). Monoclonal antibodies may be assayed for specific immunoreactivity with the protective polypeptide, but not the corresponding wild-type polypeptide, using methods known in the art.
  • Antibodies can be expressed as tetramers containing two light and two heavy chains, as separate heavy chains, light chains, as Fab, Fab' F(ab')2, and Fv, or as single chain antibodies in which heavy and light chain variable domains are linked through a spacer.
  • the nucleic acid samples obtained from the subject may be amplified from the clinical sample prior to detection.
  • DNA sequences are amplified.
  • RNA sequences are amplified.
  • Any nucleic acid amplification method can be used.
  • polymerase chain reaction PCR
  • TMA transcription-mediated amplification
  • PASA polymerase chain reaction of specific alleles
  • ligase chain reaction ligase chain reaction
  • a pair of primers may be utilized in the amplification reaction.
  • One or both of the primers can be labeled, for example with a detectable radiolabel, fluorophore, or biotin molecule.
  • the pair of primers may include an upstream primer (which binds 5' to the downstream primer) and a downstream primer (which binds 3' to the upstream primer).
  • the pair of primers used in the amplification reaction may be selective primers which permit amplification of a nucleic acid involved in AMD.
  • An additional pair of primers can be included in the amplification reaction as an internal control. For example, these primers can be used to amplify a "housekeeping" nucleic acid molecule, and serve to provide confirmation of appropriate amplification.
  • a target nucleic acid molecule including primer hybridization sites can be constructed and included in the amplification reactor.
  • One of skill in the art will readily be able to identify primer pairs to serve as internal control primers.
  • Amplification products may be assayed in a variety of ways, including size analysis, restriction digestion followed by size analysis, detecting specific tagged oligonucleotide primers in the reaction products, allele-specific oligonucleotide (ASO) hybridization, sequencing, hybridization, and the like.
  • ASO allele-specific oligonucleotide
  • PCR-based detection assays include multiplex amplification of a plurality of polymorphisms simultaneously. For example, it is well known in the art to select PCR primers to generate PCR products that do not overlap in size and can be analyzed simultaneously. Alternatively, it is possible to amplify different polymorphisms with primers that are differentially labeled and thus can each be detected. Other techniques are known in the art to allow multiplex analyses of a plurality of polymorphisms. A fragment of a gene may be amplified to produce copies and it may be determined whether copies of the fragment contain the particular protective polymorphism or genotype.
  • the CFH gene is located on chromosome Iq in a region repeatedly linked to AMD in family-based studies. Recently, three independent studies have revealed that a polymorphism, a T- ⁇ C substitution at nucleotide 1277 in exon 9, which results a tyrosine to histidine change (Y402H) in the complement factor H gene makes a substantial contribution to AMD susceptibility (Klein et al. (2005) Science 308:385- 389; Haines et al. (2005) Science.308:4l9-421; Edwards et al. (2005) Science.308:421-424).
  • Activation of the alternative pathway is initiated by factor D-catalyzed cleavage of C3b-bound factor B (BF), resulting in the formation of the C3Bb complex (C3 convertase).
  • BF C3b-bound factor B
  • C3 convertase This complex is stabilized by the regulatory protein properdin, whereas its dissociation is accelerated by regulatory proteins including CFH.
  • BF and C2 are paralogous genes located only 500 bp apart on human chromosome 6p21. C2 functions in the classical complement pathway.
  • C4A and 4B comprise a "complotype" (complement haplotype) that occupies approximately 100- 120kb between HLA-B and HLA-DR/DQ in the major histocompatibility complex (MHC) class III region.
  • C4A complement components 4A
  • C4B complement haplotype
  • Appropriate samples for use with the current disclosure in determining a subject's genetic predisposition to AMD include any conventional clinical samples, including, but not limited to, blood or blood-fractions (such as serum or plasma), mouthwashes or buccal scrapes, chorionic villus biopsy samples, semen, Guthrie cards, eye fluid, sputum, lymph fluid, urine and tissue. Most simply, blood can be drawn and DNA (or RNA) extracted from the cells of the blood. Alteration of a wild- type BF, C2, and/or CFH allele, whether, for example, by point mutation or deletion, can be detected by any of the means discussed herein.
  • Serum or other blood fractions can be prepared in the conventional manner. For example, about 200 ⁇ L of serum can be used for the extraction of DNA for use in amplification reactions.
  • the sample can be used directly, concentrated (for example by centrifugation or filtration), purified, or combinations thereof, and an amplification reaction performed.
  • rapid DNA preparation can be performed using a commercially available kit (such as the InstaGene Matrix, BioRad, Hercules, CA; the NucliSens isolation kit, Organon Teknika, Netherlands).
  • the DNA preparation method yields a nucleotide preparation that is accessible to, and amenable to, nucleic acid amplification.
  • methods for detecting a polymorphism in the BF, C2, and/or CFH genes use the arrays disclosed herein.
  • Such arrays can include nucleic acid molecules.
  • the array includes nucleic acid oligonucleotide probes that can hybridize to polymorphic BF, C2, and/or CFH gene sequences, such as those polymorphisms discussed herein.
  • Certain of such arrays can include other polymorphisms associated with risk or protection from developing AMD, as well as other sequences, such as one or more probes that recognize one or more housekeeping genes.
  • the arrays herein termed “AMD detection arrays,” are used to determine the genetic susceptibility of a subject to developing AMD.
  • a set of oligonucleotide probes is attached to the surface of a solid support for use in detection of a polymorphism in the BF, C2, and/or CFH genes, such as those amplified nucleic acid sequences obtained from the subject. Additionally, if an internal control nucleic acid sequence was amplified in the amplification reaction (see above), an oligonucleotide probe can be included to detect the presence of this amplified nucleic acid molecule.
  • the oligonucleotide probes bound to the array can specifically bind sequences amplified in an amplification reaction (such as under high stringency conditions). Oligonucleotides comprising at least 15, 20, 25, 30, 35, 40, or more consecutive nucleotides of the BF, C2, and/or CFH genes may be used. [0131]
  • the methods and apparatus in accordance with the present disclosure take advantage of the fact that under appropriate conditions oligonucleotides form base- paired duplexes with nucleic acid molecules that have a complementary base sequence.
  • the stability of the duplex is dependent on a number of factors, including the length of the oligonucleotides, the base composition, and the composition of the solution in which hybridization is effected.
  • the effects of base composition on duplex stability may be reduced by carrying out the hybridization in particular solutions, for example in the presence of high concentrations of tertiary or quaternary amines.
  • the thermal stability of the duplex is also dependent on the degree of sequence similarity between the sequences. By carrying out the hybridization at temperatures close to the anticipated T m 's of the type of duplexes expected to be formed between the target sequences and the oligonucleotides bound to the array, the rate of formation of mis-matched duplexes may be substantially reduced.
  • the length of each oligonucleotide sequence employed in the array can be selected to optimize binding of target BF, C2, and/or CFH nucleic acid sequences. An optimum length for use with a particular BF, C2, and/or CFH nucleic acid sequence under specific screening conditions can be determined empirically.
  • oligonucleotide probes are from about 20 to about 35 nucleotides in length or about 25 to about 40 nucleotides in length.
  • the oligonucleotide probe sequences forming the array can be directly linked to the support, for example via the 5'- or 3'-end of the probe.
  • the oligonucleotides are bound to the solid support by the 5' end.
  • one of skill in the art can determine whether the use of the 3' end or the 5' end of the oligonucleotide is suitable for bonding to the solid support.
  • the internal complementarity of an oligonucleotide probe in the region of the 3' end and the 5' end determines binding to the support.
  • the oligonucleotide probes can be attached to the support by non- BF, C2, and/or CFH sequences such as oligonucleotides or other molecules that serve as spacers or linkers to the solid support.
  • an array includes protein sequences, which include at least one BF, C2, and/or CFH protein (or genes, cDNAs or other polynucleotide molecules including one of the listed sequences, or a fragment thereof), or a fragment of such protein, or an antibody specific to such a protein or protein fragment.
  • the proteins or antibodies forming the array can be directly linked to the support. • .
  • the proteins or antibodies can be attached to the support by spacers or linkers to the solid support.
  • detecting an abnormality includes contacting a sample from the subject with a BF, C2, and/or CFH protein-specific binding agent; and detecting whether the binding agent is bound by the sample and thereby measuring the levels of the BF, C2, and/or CFH protein present in the sample, in which a difference in the level of BF, C2, and/or CFH protein in the sample, relative to the level of BF, C2, and/or CFH protein found an analogous sample from a subject not predisposed to developing AMD, or a standard BF, C2, and/or CFH protein level in analogous samples from a subject not having a predisposition for developing AMD, is an abnormality in that BF, C2, and/or CFH molecule.
  • the microarray material is formed from glass (silicon dioxide).
  • Suitable silicon dioxide types for the solid support include, but are not limited to: aliiminosilicate, borosilicate, silica, soda lime, zinc titania and fused silica (for example see Schena, Microarray Analysis. John Wiley & Sons, Inc, Hoboken, New Jersey, 2003).
  • the attachment of nucleic acids to the surface of the glass can be achieved by methods known in the art, for example by surface treatments that form from an organic polymer.
  • Particular examples include, but are not limited to: polypropylene, polyethylene, polybutylene, polyisobutylene, polybutadiene, polyisoprene, polyvinylpyrrolidine, polytetrafluroethylene, polyvinylidene difluroide, polyfluoroethylene-propylene, polyethylenevinyl alcohol, polymethylpentene, polycholorotrifluoroethylene, polysulfornes, hydroxylated biaxially oriented polypropylene, aminated biaxially oriented polypropylene, thiolated biaxially oriented polypropylene, etyleneacrylic acid, thylene methacrylic acid, and blends of copolymers thereof (see U.S. Patent No. 5,985,567, herein incorporated by reference), organosilane compounds that provide chemically active amine or aldehyde groups, epoxy or polylysine treatment of the microarray.
  • a solid support surface is polypropylene.
  • suitable characteristics of the material that can be used to form the solid support surface include: being amenable to surface activation such that upon activation, the surface of the support is capable of covalently attaching a biomolecule such as an oligonucleotide thereto; amenability to "in situ" synthesis of biomolcculcs; being chemically inert such that at the areas on the support not occupied by the oligonucleotides are not amenable to non-specific binding, or when non-specific binding occurs, such materials can be readily removed from the surface without removing the oligonucleotides.
  • the surface treatment is amine-containing silane derivatives. Attachment of nucleic acids to an amine surface occurs via interactions between negatively charged phosphate groups on the DNA backbone and positively charged amino groups (Schena, Microarray Analysis. John Wiley & Sons, Inc, Hoboken, New Jersey, 2003, herein incorporated by reference).
  • reactive aldehyde groups are used as surface treatment. Attachment to the aldehyde surface is achieved by the addition of 5'-amine group or amino Jinker to the DNA of interest. Binding occurs when the nonbonding electron pair on the amine linker acts as a nucleophile that attacks the electropositive carbon atom of the aldehyde group.
  • a wide variety of array formats can be employed in accordance with the present disclosure.
  • One example includes a linear array of oligonucleotide bands, generally referred to in the art as a dipstick.
  • Another suitable format includes a two- dimensional pattern of discrete cells (such as 4096 squares in a 64 by 64 array).
  • other array formats including, but not limited to slot (rectangular) and circular arrays are equally suitable for use (see U.S. Patent No. 5,981,185, herein incorporated by reference).
  • the array is formed on a polymer medium, which is a thread, membrane or film.
  • An example of an organic polymer medium is a polypropylene sheet having a thickness on the order of about 1 mm (0.001 inch) to about 20 mm, although the thickness of the film is not critical and can be varied over a fairly broad range.
  • Particularly disclosed for preparation of arrays at this time arc biaxially oriented polypropylene (BOPP) films; in addition to their durability, BOPP films exhibit a low background fluorescence.
  • the array is a solid phase, Allele-Specific Oligonucleotides (ASO) based nucleic acid array.
  • ASO Allele-Specific Oligonucleotides
  • a "format” includes any format to which the solid support can be affixed, such as microtiter plates, test tubes, inorganic sheets, dipsticks, and the like.
  • the solid support is a polypropylene thread
  • one or more polypropylene threads can be affixed to a plastic dipstick-type device
  • polypropylene membranes can be affixed to glass slides.
  • the particular format is, in and of itself, unimportant.
  • the solid support can be affixed thereto without affecting the functional behavior of the solid support or any biopolymer absorbed thereon, and that the format (such as the dipstick or slide) is stable to any materials into which the device is introduced (such as clinical samples and hybridization solutions).
  • the arrays of the present disclosure can be prepared by a variety of approaches.
  • oligonucleotide or protein sequences are synthesized separately and then attached to a solid support (see U.S. Patent No. 6,013,789, herein incorporated by reference).
  • sequences are synthesized directly onto the support to provide the desired array (see U.S. Patent No. 5,554,501, herein incorporated by reference).
  • Suitable methods for covalently coupling oligonucleotides and proteins to a solid support and for directly synthesizing the oligonucleotides or proteins onto the support are known to those working in the field; a summary of suitable methods can be found in Matson et al. (1994) Anal. Biochem.
  • the oligonucleotides are synthesized onto the support using conventional chemical techniques for preparing oligonucleotides on solid supports (such as see PCT Publication Nos. WO 85/01051 and WO 89/10977, or U.S. Patent No. 5,554,501 , each of which are herein incoiporated by reference).
  • a suitable array can be produced using automated means to synthesize oligonucleotides in the cells of the array by laying down the precursors for the four bases in a predetermined pattern.
  • a multiple-channel automated chemical delivery system is employed to create oligonucleotide probe populations in parallel rows (corresponding in number to the number of channels in the delivery system) across the substrate.
  • the substrate can then be rotated by 90° to permit synthesis to proceed within a second (2°) set of rows that are now perpendicular to the first set.
  • This process creates a multiple-channel array whose intersection generates a plurality of discrete cells.
  • the oligonucleotide probes on the array include one or more labels, that permit detection of oligonucleotide probe:target sequence hybridization complexes. Kirs
  • kits that can be used to determine whether a subject, such as an otherwise healthy human subject, is genetically predisposed to AMD. Such kits allow one to determine if a subject has one or more genetic mutations or polymorphisms in BF, C2 or CFH gene sequences.
  • the kits contain reagents useful for determining the presence or absence of at least one polymorphism in a subject's BF, C2 or CFH genes, such as probes or primers that selectively hybridize to a BF, C2 or CFH polymorphic sequence identified herein. Such kits can be used with the methods described herein to determine a subject's BF, C2, or CFH genotype or haplotype.
  • Oligonucleotide probes and/or primers may be supplied in the form of a kit for use in detection of a specific BF, C2, or CFH sequence, such as a SNP or haplotype described herein, in a subject.
  • a kit for use in detection of a specific BF, C2, or CFH sequence, such as a SNP or haplotype described herein in a subject.
  • an appropriate amount of one or more of the oligonucleotide primers is provided in one or more containers.
  • the oligonucleotide primers may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance.
  • the container(s) in which the oligonucleotide(s) are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles.
  • pairs of primers may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers.
  • the sample to be tested for the presence of a BF, C2, or CFH polymorphism can be added to the individual tubes and amplification carried out directly.
  • each oligonucleotide primer supplied in the kit can be any appropriate amount, depending for instance on the market to which the product is directed. For instance, if the kit is adapted for research or clinical use, the amount of each oligonucleotide primer provided would likely be an amount sufficient to prime several PCR amplification reactions. Those of ordinary skill in the art know the amount of oligonucleotide primer that is appropriate for use in a single amplification reaction. General guidelines may for instance be found in Innis et al. (PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc., San Diego, CA, 1990), Sarnbrook et al. (In Molecular Cloning: A Laboratory Manual, Cold Spring Harbor, New York, 1989), and Aus ⁇ bel et al. (In Current Protocols in Molecular Biology, Greene Publ. Assoc, and Wiley-Intersciences, 1992).
  • a kit may include more than two primers, in order to facilitate the in vitro amplification of BF, C2, or CFH-encoding sequences, for instance a specific target BF, C2, or CFH gene or the 5' or 3' flanking region thereof.
  • kits may also include the reagents necessary to carry out nucleotide amplification reactions, including, for instance, DNA sample preparation reagents, appropriate buffers (e.g., polymerase buffer), salts (e.g., magnesium chloride), and deoxyribonucleotides (dNTPs).
  • appropriate buffers e.g., polymerase buffer
  • salts e.g., magnesium chloride
  • dNTPs deoxyribonucleotides
  • Kits may in addition include either labeled or unlabeled oligonucleotide probes for use in detection of BF, C2, or CFH polymorphisms or haplotypes.
  • these probes will be specific for a potential polymorphic site that may be present in the target amplified sequences.
  • the appropriate sequences for such a probe will be any sequence that includes one or more of the identified polymorphic sites, such that the sequence the probe is complementary to a polymorphic site and the surrounding BF, C2, or CFH sequence.
  • probes are of at least 6 nucleotides in length, and the polymorphic site occurs at any position within the length of the probe.
  • control sequences may comprise human (or non-human) BF, C2, or CFH nucleic acid molecule(s) with known sequence at one or more target SNP positions, such as those described herein. Controls may also comprise non-2?/ 7 , C2, or CFH nucleic acid molecules.
  • kits may also include some or all of the reagents necessary to carry out RT-PCR in vitro amplification reactions, including, for instance, RNA sample preparation reagents (including for example, an RNase inhibitor), appropriate buffers (for example, polymerase buffer), salts (for example, magnesium chloride), and deoxyribonucleotides (dNTPs).
  • RNA sample preparation reagents including for example, an RNase inhibitor
  • appropriate buffers for example, polymerase buffer
  • salts for example, magnesium chloride
  • dNTPs deoxyribonucleotides
  • kits may in addition include either labeled or unlabeled oligonucleotide probes for use in detection of the in vitro amplified target sequences.
  • the appropriate sequences for such a probe will be any sequence that falls between the annealing sites of the two provided oligonucleotide primers, such that the sequence the probe is complementary to is amplified during the PCR reaction.
  • these probes will be specific for a potential polymorphism that may be present in the target amplified sequences.
  • Kits for the detection or analysis of BF, C2, or CFH protein expression are also encompassed.
  • kits may include at least one target protein specific binding agent (for example, a polyclonal or monoclonal antibody or antibody fragment that specifically recognizes a BF, C2, or CFH protein, or a specific polymorphic form of a BF, C2, or CFH protein) and may include at least one control (such as a determined amount of target BF, C2, or CFH protein, or a sample containing a determined amount of BF, C2, or CFH protein).
  • the BF 1 C2, or CFH-protein specific binding agent and control may be contained in separate containers.
  • the antibodies may have the ability to distinguish between polymorphic forms of BF, CD and/or CFH protein.
  • BF, C2, or CFH protein or isoform expression detection kits may also include a means for detecting BF, C2, or CFHrbinding agent complexes, for instance the agent may be detectably labeled. If the detectable agent is not labeled, it may be detected by second antibodies or protein A, for example, which may also be provided in some kits in one or more separate containers. Such techniques are well known.
  • Additional components in specific kits may include instructions for carrying out the assay. Instructions will allow the tester to determine BF, C2, or CFH expression level. Reaction vessels and auxiliary reagents such as chromogens, buffers, enzymes, etc. may also be included in the kits. The instructions can provide calibration curves or charts to compare with the determined (For example, experimentally measured) values.
  • kits that allow differentiation between individuals who are homozygous versus heterozygous for specific SNPs (or haplotypes) of the BF, C2, or CFH genes as described herein.
  • kits provide the materials necessary to perform oligonucleotide ligation assays (OLA), as described in Nickerson et al. (1990) Proc. Natl. Acad. ScL U.S.A. 87:8923-8927.
  • these kits contain one or more microtiter plate assays, designed to detect polymorphism(s) in a BF, C2, or CFH sequence of a subject, as described herein.
  • kits will allow the tester to determine whether a specified BF, C2, or CFH allele is present, and whether it is homozygous or heterozygous. It may also be advantageous to provide in the kit one or more control sequences for use in the OLA reactions. The design of appropriate positive control sequences is well known to one of ordinary skill in the appropriate art.
  • the kit may involve the use of a number of assay formats including those involving nucleic acid binding, such binding to filters, beads, or microtiter plates and the like. Techniques may include dot blots, RNA blots, DNA blots, PCR, RFLP, and the like.
  • Microarray-based kits are also provided. These microarray kits may be of use in genotyping analyses. In general, these kits include one or more oligonucleotides provided immobilized on a substrate, for example at an addressable location. The kit also includes instructions, usually written instructions, to assist the user in probing the array. Such instructions can optionally be provided on a computer readable medium
  • Kits may additionally include one or more buffers for use during assay of the provided array.
  • buffers may include a low stringency wash, a high stringency wash, and/or a stripping solution. These buffers may be provided in bulk, where each container of buffer is large enough to hold sufficient buffer for several probing or washing or stripping procedures. Alternatively, the buffers can be provided in p ⁇ re-measured aliquots, which would be tailored to the size and style of array included in the kit.
  • Certain kits may also provide one or more containers in which to carry out array-probing reactions.
  • Kits may in addition include one or more containers of detector molecules, such as antibodies or probes (or mixtures of antibodies, mixtures of probes, or mixtures of the antibodies and probes), for detecting biomolecules captured on the array.
  • the kit may also include either labeled or unlabeled control probe molecules, to provide for internal tests of either the labeling procedure or probing of the array, or both.
  • the control probe molecules may be provided suspended in an aqueous solution or as a freeze-dried or lyophilized powder, for instance.
  • the container(s) in which the controls are supplied can be any conventional container that is capable of holding the supplied form, for instance, microfuge tubes, ampoules, or bottles.
  • control probes may be provided in pre-measured single use amounts in individual, typically disposable, tubes or equivalent containers.
  • the amount of each control probe supplied in the kit can be any particular amount, depending for instance on the market to which the product is directed. For instance, if the kit is adapted for research or clinical use, sufficient control probe(s) likely will be provided to perform several controlled analyses of the array. Likewise, where multiple control probes are provided in one kit, the specific probes provided will be tailored to the market and the accompanying kit.
  • kits may also include the reagents necessary to carry out one or more probe-labeling reactions.
  • probe molecule for example, DNA or RNA
  • labeling for example, radiolabel incorporated during probe synthesis, attachable fluorescent tag, etc.
  • kits are provided for the labeling of probe molecules for use in assaying arrays provided herein. Such kits may optionally include an array to be assayed by the so labeled probe molecules. [0167] The disclosure is illustrated by the following non-limiting Examples. EXAMPLES
  • Subjects Two independent groups of AMD cases and age-matched controls of European-American descent over the age of 60 were used in this study. These groups consisted of 350 unrelated subjects with clinically documented AMD (mean age 79.5 +/- 7.8) and 1 14 unrelated, control individuals (mean age 78.4 +/- 7.4; matched by age and ethnicity) from the University of Iowa, and 548 unrelated subjects with clinically documented AMD (mean age 71.32 +/- 8.9 years), and 275 unrelated, matched by age and ethnicity, controls (mean age 68.84 +/- 8.6 years) from Columbia University. Subjects were examined by trained ophthalmologists.
  • Mutation Screening and Analysis Coding and adjacent intronic regions of BF and C2 were examined for variants using SSCP analyses, denaturing high performance liquid chromatography (DHPLC) and direct sequencing. Primers for SSCP, DHPLC and DNA sequencing analyses were designed to amplify each exon and its adjacent intronic regions using Mac Vector software (San Diego, CA). PCR- derived amplicons were screened for sequence variation, as described in Allikmets et ul. (1997) Science 277: 1805-1807 and in Hayashi et al. (2004) Ophthalmic Genet. 25: 1 1 1 -9. All changes detected by SSCP and DHPLC were confirmed by bidirectional sequencing according to standard protocols.
  • SNPs Single nucleotide polymorphisms
  • dbSNP Cetera Discovery System
  • Assays for variants with greater than 10% frequency in test populations were purchased from Applied Biosystems as Validated, Inventoried SNP Assays-On-Demand, or submitted to an Applied Biosystems Assays-By-Design pipeline. The technique employed was identical to that described in Hageman et al., 2005, supra. Briefly, 5ng of DNA were subjected to 50 cycles on an ABl 9700 384- well thermocycler, and plates were read in an Applied Biosystems 7900 HT Sequence Detection System.
  • Genotypes were tabulated in Microsoft EXCEL and presented to SPSS (SPSS, Inc.) for contingency table analysis as described in Hageman et al., 2005, supra, and Klaver et al., 2001 , supra. Compliance to Hardy7 Weinberg Equilibrium was checked using SAS/Genetics (SAS Institute, Inc., Cary, NC), and all SNPs in both cases and controls survived a cut off of p ⁇ 0.05.
  • haplotype estimation we used snphap (written by David Clayton; Cambridge Institute for Medical Research, Cambridge, United Kingdom), downloaded from the Cambridge Institute for Medical Research website http://www- gene.cimr.cam.ac.uk/clayton/software/), SNPEM (Written by Dr.
  • haplotype analysis strategy used was first to obtain haplotype estimates using the Expectation Maximization (EM) or Gibbs sampling algorithm, second, to identify htSNPs representing a minimal informative set within a region of linkage disequilibrium, and third, to assess these for significant association with AMD. Linkage disequilibrium was assessed (not shown) using the graphical tools available at the Innate Immunity PGA website (www.innateimmunity.net).
  • the observed associations were highly significant when the entire AMD subject cohort was compared to controls, or when major subtypes of AMD, including early AMD (eAMD), choroidal neovascularization (CNV) and geographic atrophy (GA), were analyzed separately.
  • the GA group (a total of 133 subjects from the 2 cohorts) deviated from the general trend in some cases, similar to our observations related to CFH (Hageman et al., 2005, supra).
  • the haplotype tagged by the R32Q allele demonstrated the strongest protection against the disease - OR was 0.22 when the GA group was compared to controls vs. 0.45 when the rest of AMD samples were subjected to the same analysis. Although this deviation may be significant in terms of varying etiology of the disease, it did not reach statistical significance (the confidence intervals overlapped), most likely due to the small number of GA cases.
  • the case percentage is the percentage of cases for which the model was false; in other words, . they did not have protection as described by the model.
  • the control percentage is the percentage of controls that did have the protective factors described by the model, meaning the model was true.
  • Models were learned on the Columbia cohort; the resulting fittest models were retained and then applied to the Iowa cohort as a verification test (oui-of-sample verification) on an independent cohort. Finally, the models were applied to the combined sample set.
  • the resulting best performing model is depicted in Fig. 2C.
  • This model describes four possible individual (or combinations of) genotypes that would protect from AMD (i.e. combinations resulting in the model being "true”).
  • the method was further validated by randomizing the case and control designations and performing 3000 permutations of the dataset. The actual data was more significant than any of these permutations.
  • BF and C2 are expressed in the neural retina, RPE, and choroid. PCR amplicons of the appropriate sizes for BF and C2 gene products were detected from isolated RPE, the RPE/choroid complex, and the neural retina, from human donor eyes with (two donors aged 67 and 94) and without (two donors aged 69 and 82) AMD (data not shown).
  • BF protein was present in ocular drusen, within Bruch's membrane, and less prominently in the choroidal stroma (Fig. 3A). Ba (a Z?F-derived peptide) immunoreactivity was less pronounced, but distinctly present in patches associated with RPE cells and throughout Bruch's membrane (Fig. 3B). The distribution of BF is similar to that of C3 (Fig. 3C), both of which are essentially identical to that of CFH and C5b-9 (Hageman et al., 2005, supra). [0184] In summary, these data show that variants the complement pathway- associated genes C2 and BF are significantly associated with AMD.
  • MHC class II loci and BF haplotypes H7 and HlO do not show strong LD.
  • Sapio Sciences utilized its Exemplar Genotyping Analysis Suite to analyze the supplied data. Exemplar performs several association based analyses for case- control studies. The modules utilized for the analysis were:
  • G Module Genetic Algorithm Module
  • AS Module Association Study Module
  • This module calculates many useful statistics like Chi Square, Yates, Fisher Exact, Odds Ratio, Relative risk, Linkage Disequilibrium, D', r2 and Haplotype Estimates.
  • Exemplar typically finds models correlating with a phenotype. In other words, the models predict the factors contributing to getting the phenolype, not to protection from it, although protective factors can be inferred from the models. For example, if a model indicates that samples having... RSOOl as BB OR RSOOl as AB... correlate with having the phenotypp, then it can be inferred that those with RSOOl as AA are protected from the phenotype.
  • Exemplar models are logical combinations of SNP's.
  • the models can be hand-built to test hypothesis, or the Genetic Algorithm can be utilized to attempt to find models with high utility.
  • Genetic Algorithms are a machine learning method that excels at finding patterns within large data spaces.
  • the GA utilizes the two-thirds, one-third, validation method. This is accomplished by randomly assigning 2/3 of the cases and controls to the training set. The GA then learns models on this training set. When it completes the learning phase, it applies the best performing models to the test set (the remaining 1/3 of data). The best performing models across test and training are returned to the user.
  • Study Results Multiple statistics were generated for each SNP/genotype in the input dataset. Statistics were generated by building 2 x 2 contingency tables and doing proper counts of genotypes (Note that this is not allele counts, but genotype counts where the two genotypes not being calculated are collapsed into one value). The values for each cell of the 2 x 2 table are provided in the tables under the headings Case True, Case False, Control True, Control False. All statistics were two- tailed calculations.
  • Tables 3 through 6 show statistics on the Iowa and Columbia cohort side by side.
  • the "Category” column is the genotype where: 1 corresponds to AA, 2 to AB and 3 to BB.
  • Table 7 shows statistics for the combined cohorts.
  • RS547154 is G/A and RS 1061170 is T/T or
  • RS547154 is G/A and RS 1061170 is C/C or
  • RS4151667 is T/A and RS 1061170 is C/T or
  • RS4151667 is T/A and RS 1061170 is C/C
  • this model gives four possible combinations of genotypes that would protect from AMD (combinations that result in the model being "true"): 1. RS547154 as G/A AND RS1061170 as T/T • Controls 8.82%, Cases 5.45% 2. RS547154 as G/A AND RS 1061 170 as CIC .
  • GA Genetic Algorithm
  • Model Type indicates whether the model can have and's and or's, and's only, or or's only.
  • Model Size indicates an upper limit for how many SNP's can be in the models
  • AND-only models of small size are preferable. The reasons for this are two-fold. First, an AND-only model requires that all its SNP's be true for the model to be true, and its interpretation is therefore unambiguous, whereas models with OR's do not require all SNP's to be present for the model to be true, which introduces a level of uncertainty. Secondly, smaller models are easier to interpret due to having fewer SNP's to assess.
  • Exemplar utilizes a two-third, one-third validation method to avoid over- fitting to the input data with the desired outcome of having more generally applicable results.
  • the GA did find a model that performed well across Columbia, Iowa and the combined dataset.
  • the models performance on the Columbia data was superior to the Iowa data, as would be expected given that the model was trained on the Columbia data. Nonetheless, the model performance is notable given that the GA had no prior knowledge of the Iowa data and there was significant statistical difference between key SNP's between the two cohorts.
  • the resultant best model outperformed the hand built hypothesized model on the combined cohorts (RS 1061170). Initially, the model included an additional section with "INDELTT is homozygous AND RS547154 is GG," but upon further inspection, this section was determined to be extraneous to model interpretation and was therefore eliminated to produce the model with identical performance. A graphic of the final model may be found in Fig. 2C. [0204]
  • the GA specific Options for this task were as follows:
  • Models 1500 ⁇ this is the number of models the GA built internally as a foundation for evolving new generations of models
  • Model Size 5 — this allowed for the models to have a maximum of 16 genotypes to appear in a single model
  • Model Type AND/OR's - this let the GA build models that could use both and's and or's
  • RS 1048709 is G/G and RS 1061 170 is TAT or
  • RS547I54 is G/A or
  • RS4I51667 is T/A or
  • Table 13 shows the statistics for each cohort. The GA performed well across the board. Overall, those with the protective factors described by the model were 3.6581 times less likely to get AMD than those without the protective factors.
  • the single SNP had 625 permutations with an OR>1.5 versus 133 for the GA model and 46 for the hand built model.
  • the hand built model simply represents of combination of genotypes that is rarely occurring in any sample.
  • the GA model exhibited the best true case control performance and permutation results.
  • a subject presents with signs and/or symptoms of AMD, including drusen.
  • the subject tests negative for the protective polymorphisms R32Q and L9H in BF, and IVS 10 and E318D in C2. It is recommended that the subject be treated with protective BF protein (having the R32Q polymorphism).
  • the subject is administered intravenously an amount of protective BF in aqueous saline sufficient to bring the serum concentration of BF to between 9 and 31mg/dL, once a month for six months.
  • the subject is monitored for drusen as well as the presence of other signs and/or symptoms of AMD. If the signs and/or symptoms of AMD have not progressed, administration of protective BF is continued, once a month indefinitely, with monitoring of the clinical status of the patient as frequently as indicated, but at least once every six months.
  • the protective BF protein is administered intranasally once each day to provide more sustained exposure to the protective effects of the protein .

Landscapes

  • Chemical & Material Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Health & Medical Sciences (AREA)
  • Organic Chemistry (AREA)
  • Wood Science & Technology (AREA)
  • Analytical Chemistry (AREA)
  • Zoology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Pathology (AREA)
  • Immunology (AREA)
  • Microbiology (AREA)
  • Molecular Biology (AREA)
  • Biotechnology (AREA)
  • Biophysics (AREA)
  • Physics & Mathematics (AREA)
  • Biochemistry (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
PCT/US2007/003696 2006-02-13 2007-02-13 Variants in complement regulatory genes predict age-related macular degeneration Ceased WO2007095185A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
AU2007215218A AU2007215218B2 (en) 2006-02-13 2007-02-13 Variants in complement regulatory genes predict age-related macular degeneration
CA002638916A CA2638916A1 (en) 2006-02-13 2007-02-13 Variants in complement regulatory genes predict age-related macular degeneration
JP2008554415A JP5290772B2 (ja) 2006-02-13 2007-02-13 補体調節遺伝子における変異体が加齢性黄斑変性症を予測する
EP07750527A EP1989319A4 (en) 2006-02-13 2007-02-13 VARIANTS OF COMPLEMENTARY REGULATOR GENES AS FORECAST FOR AGE-RELATED MACULAR GENERATION
NZ570431A NZ570431A (en) 2006-02-13 2007-02-13 Variants in complement regulatory genes predict age-related macular degeneration
IL193396A IL193396A (en) 2006-02-13 2008-08-12 Variables in a complementary series of age-related gene predictions of age-related macular degeneration

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US77298906P 2006-02-13 2006-02-13
US60/772,989 2006-02-13

Publications (2)

Publication Number Publication Date
WO2007095185A2 true WO2007095185A2 (en) 2007-08-23
WO2007095185A3 WO2007095185A3 (en) 2008-09-25

Family

ID=38372062

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2007/003696 Ceased WO2007095185A2 (en) 2006-02-13 2007-02-13 Variants in complement regulatory genes predict age-related macular degeneration

Country Status (8)

Country Link
EP (1) EP1989319A4 (https=)
JP (1) JP5290772B2 (https=)
CN (1) CN101421409A (https=)
AU (1) AU2007215218B2 (https=)
CA (1) CA2638916A1 (https=)
IL (1) IL193396A (https=)
NZ (1) NZ570431A (https=)
WO (1) WO2007095185A2 (https=)

Cited By (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011006161A2 (en) 2009-07-10 2011-01-13 The Regents Of The University Of Michigan Compositions and methods for diagnosing and treating macular degeneration
WO2010127176A3 (en) * 2009-04-29 2011-04-21 Massachusetts Eye And Ear Infirmary Methods and compositions for prognosing detecting age-related macular degeneration
WO2011053774A1 (en) * 2009-10-30 2011-05-05 Alcon Research, Ltd. Single nucleotide polymorphisms and genes associated with age-related macular degeneration
US8012683B2 (en) 2006-02-13 2011-09-06 University Of Iowa Research Foundation Variants in complement regulatory genes predict age-related macular degeneration
US9056874B2 (en) 2012-05-04 2015-06-16 Novartis Ag Complement pathway modulators and uses thereof
WO2015120130A1 (en) * 2014-02-07 2015-08-13 Novartis Ag Impact of genetic factors on disease progression and response to anti-c5 antibody in geographic atrophy
US9475806B2 (en) 2013-03-14 2016-10-25 Novartis Ag Complement factor B inhibitors and uses there of
US9676728B2 (en) 2013-10-30 2017-06-13 Novartis Ag 2-benzyl-benzimidazole complement factor B inhibitors and uses thereof

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN102707068B (zh) * 2012-05-31 2015-03-18 北京大学 补体h因子用作甲基苯丙胺成瘾患者的基因表达产物中的应用
WO2016100745A2 (en) * 2014-12-19 2016-06-23 Children's Hospital Medical Center Methods and compositions related to transplant-associated thrombotic microangiopathy
CN109082460B (zh) * 2018-09-27 2021-07-13 领航基因科技(杭州)有限公司 应用于snp分型的非竞争性探针设计方法、检测方法及应用
CN116507741A (zh) * 2020-08-20 2023-07-28 基因组评论股份有限公司 年龄相关性黄斑变性诊断用生物标记物及其用途

Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001051A1 (en) 1983-09-02 1985-03-14 Molecular Biosystems, Inc. Oligonucleotide polymeric support system
WO1989010977A1 (en) 1988-05-03 1989-11-16 Isis Innovation Limited Analysing polynucleotide sequences
US5554501A (en) 1992-10-29 1996-09-10 Beckman Instruments, Inc. Biopolymer synthesis using surface activated biaxially oriented polypropylene
US5981185A (en) 1994-05-05 1999-11-09 Beckman Coulter, Inc. Oligonucleotide repeat arrays
US5985567A (en) 1997-08-15 1999-11-16 Beckman Coulter, Inc. Hybridization detection by pretreating bound single-stranded probes
US6013789A (en) 1998-02-20 2000-01-11 Beckman Coulter, Inc. Covalent attachment of biomolecules to derivatized polypropylene supports

Family Cites Families (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5474796A (en) * 1991-09-04 1995-12-12 Protogene Laboratories, Inc. Method and apparatus for conducting an array of chemical reactions on a support surface
JP2008520242A (ja) * 2004-11-18 2008-06-19 イェール ユニバーシティ 視覚障害を処置するための方法および組成物

Patent Citations (6)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO1985001051A1 (en) 1983-09-02 1985-03-14 Molecular Biosystems, Inc. Oligonucleotide polymeric support system
WO1989010977A1 (en) 1988-05-03 1989-11-16 Isis Innovation Limited Analysing polynucleotide sequences
US5554501A (en) 1992-10-29 1996-09-10 Beckman Instruments, Inc. Biopolymer synthesis using surface activated biaxially oriented polypropylene
US5981185A (en) 1994-05-05 1999-11-09 Beckman Coulter, Inc. Oligonucleotide repeat arrays
US5985567A (en) 1997-08-15 1999-11-16 Beckman Coulter, Inc. Hybridization detection by pretreating bound single-stranded probes
US6013789A (en) 1998-02-20 2000-01-11 Beckman Coulter, Inc. Covalent attachment of biomolecules to derivatized polypropylene supports

Non-Patent Citations (23)

* Cited by examiner, † Cited by third party
Title
ANDERSON ET AL., AM. J. OPHTHALMOL., vol. 134, 2002, pages 41 - 3 1
AUSUBE1: "Current Protocols in Molecular Biology", 1992, GREENE PUBL. ASSOC. AND WILEY-TNIERSCIENCES
AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 2004, JOHN WILEY & SONS
BOK, D., PROC. NATL. ACAD, SCI. U.S.A., vol. 102, 2005, pages 7053 - 4
CRABB ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 99, 2002, pages 14682 - 7
EDWARDS, SCIENCE, vol. 308, 2005, pages 421 - 4
HAGEMAN ET AL., PROC. NATL, ACAD. SCI. U.S.A., vol. 102, 2005, pages 7227 - 32
HAGEMAN ET AL., PROC. NATL. ACAD. SCI. U.S.A., vol. 102, 2005, pages 7227 - 32
HAGEMAN ET AL., PROG. RETIN. EYE RES., vol. 20, 2001, pages 705 - 32
HAINES ET AL., SCIENCE, vol. 308, 2005, pages 419 - 21
HARLOW, E.; LANE, D.: "Antibodies: A laboratory manual.", 1988, COLD SPRING HARBOR
HOLERS; THURMAN, MOL. IMMUNOL., vol. 41, 2004, pages 147 - 52
INNIS: "PCR Protocols, A Guide to Methods and Applications", 1990, ACADEMIC PRESS, INC.
JOHNSON ET AL., EXP. EYE RES., vol. 73, 2001, pages 887 - 96
KINOSHITA, IMMUNOL. TODAY, vol. 12, 1991, pages 291 - 5
KLEIN ET AL., SCIENCE, vol. 308, 2005, pages 385 - 9
MATSON, ANAL. BIOCHEM., vol. 217, 1994, pages 306 - 10
MORGAN; WALPORT, IMMUNOL. TODAY, vol. 12, 1991, pages 301 - 6
MULLINS ET AL., FUSEB J., vol. 14, 2000, pages 835 - 46
NICKERSAN ET AL., PROC. NAIL. ACAD. SCI. U.S.A., vol. 87, 1990, pages 8923 - 8927
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR
SCHENA: "Microarray Analysis", 2003, JOHN WILEY & SONS, INC
See also references of EP1989319A4

Cited By (10)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8012683B2 (en) 2006-02-13 2011-09-06 University Of Iowa Research Foundation Variants in complement regulatory genes predict age-related macular degeneration
US9063139B2 (en) 2006-02-13 2015-06-23 The Trustees Of Columbia University In The City Of New York Variants in complement regulatory genes predict age-related macular degeneration
WO2010127176A3 (en) * 2009-04-29 2011-04-21 Massachusetts Eye And Ear Infirmary Methods and compositions for prognosing detecting age-related macular degeneration
WO2011006161A2 (en) 2009-07-10 2011-01-13 The Regents Of The University Of Michigan Compositions and methods for diagnosing and treating macular degeneration
EP2451983A4 (en) * 2009-07-10 2012-12-05 Univ Michigan COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING MACULATE GENERATION
WO2011053774A1 (en) * 2009-10-30 2011-05-05 Alcon Research, Ltd. Single nucleotide polymorphisms and genes associated with age-related macular degeneration
US9056874B2 (en) 2012-05-04 2015-06-16 Novartis Ag Complement pathway modulators and uses thereof
US9475806B2 (en) 2013-03-14 2016-10-25 Novartis Ag Complement factor B inhibitors and uses there of
US9676728B2 (en) 2013-10-30 2017-06-13 Novartis Ag 2-benzyl-benzimidazole complement factor B inhibitors and uses thereof
WO2015120130A1 (en) * 2014-02-07 2015-08-13 Novartis Ag Impact of genetic factors on disease progression and response to anti-c5 antibody in geographic atrophy

Also Published As

Publication number Publication date
EP1989319A2 (en) 2008-11-12
CN101421409A (zh) 2009-04-29
IL193396A0 (en) 2009-05-04
AU2007215218A1 (en) 2007-08-23
NZ570431A (en) 2011-12-22
EP1989319A4 (en) 2009-11-11
IL193396A (en) 2013-03-24
CA2638916A1 (en) 2007-08-23
WO2007095185A3 (en) 2008-09-25
JP2009526524A (ja) 2009-07-23
AU2007215218B2 (en) 2013-09-19
JP5290772B2 (ja) 2013-09-18

Similar Documents

Publication Publication Date Title
US9063139B2 (en) Variants in complement regulatory genes predict age-related macular degeneration
AU2007215218B2 (en) Variants in complement regulatory genes predict age-related macular degeneration
US20100273720A1 (en) Protective Complement Proteins and Age-Related Macular Degeneration
US11008618B2 (en) Genetic polymorphisms associated with autoinflammatory diseases, methods of detection and uses thereof
US20080305967A1 (en) Genetic Markers Associated with Endometriosis and Use Thereof
AU2007261095A1 (en) Biomarkers for the progression of Alzheimer's disease
EP1996214B1 (en) Complement proteins for protection against age-related macular degeneration
WO2006096737A2 (en) Diagnostic and therapeutic target for macular degeneration
ES2373044T3 (es) Procedimientos y composiciones para predecir la respuesta a warfarina.
JP2009514534A (ja) 加齢黄斑変性の識別および検査のための発展した方法(mert−armd)
US20200087728A1 (en) Genetic markers associated with endometriosis and use thereof
US20100003691A1 (en) Genetic Markers Associated with Degenerative Disc Disease and Uses Thereof
WO2008061048A2 (en) Methods and compositions for diagnosing and treating prostate cancer
Allikmets et al. Variants in complement regulatory genes predict age-related macular degeneration
US20070202502A1 (en) Assay For Bipolar Affective Disorder
JP2008502340A (ja) 味覚受容体をコードするヒト肥満感受性遺伝子及びその使用

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
WWE Wipo information: entry into national phase

Ref document number: 2638916

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 193396

Country of ref document: IL

Ref document number: 2008554415

Country of ref document: JP

Ref document number: 570431

Country of ref document: NZ

NENP Non-entry into the national phase

Ref country code: DE

WWE Wipo information: entry into national phase

Ref document number: 2007215218

Country of ref document: AU

REEP Request for entry into the european phase

Ref document number: 2007750527

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 2007750527

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 4680/CHENP/2008

Country of ref document: IN

ENP Entry into the national phase

Ref document number: 2007215218

Country of ref document: AU

Date of ref document: 20070213

Kind code of ref document: A

WWE Wipo information: entry into national phase

Ref document number: 200780012906.3

Country of ref document: CN