WO2007086342A1 - Procédé pour détecter le cancer au moyen d'une variante d'épissage du régulateur fir de transcription du gène c-myc ou d'une séquence de répétition à quatre bases dans l'intron 2 - Google Patents

Procédé pour détecter le cancer au moyen d'une variante d'épissage du régulateur fir de transcription du gène c-myc ou d'une séquence de répétition à quatre bases dans l'intron 2 Download PDF

Info

Publication number
WO2007086342A1
WO2007086342A1 PCT/JP2007/050915 JP2007050915W WO2007086342A1 WO 2007086342 A1 WO2007086342 A1 WO 2007086342A1 JP 2007050915 W JP2007050915 W JP 2007050915W WO 2007086342 A1 WO2007086342 A1 WO 2007086342A1
Authority
WO
WIPO (PCT)
Prior art keywords
fir
cancer
protein
dna
seq
Prior art date
Application number
PCT/JP2007/050915
Other languages
English (en)
Japanese (ja)
Inventor
Hideaki Shimada
Kazuyuki Matsushita
Takeshi Tomonaga
Fumio Nomura
Takenori Ochiai
Original Assignee
National University Corporation Chiba University
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by National University Corporation Chiba University filed Critical National University Corporation Chiba University
Priority to JP2007513551A priority Critical patent/JP4806776B2/ja
Publication of WO2007086342A1 publication Critical patent/WO2007086342A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57407—Specifically defined cancers
    • G01N33/57419—Specifically defined cancers of colon
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C07K14/4703—Inhibitors; Suppressors
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/156—Polymorphic or mutational markers
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/158—Expression markers

Definitions

  • the present invention relates to a splicing variant of a c-myc gene transcription repressor FIR or a cDNA encoding the same or a mRNA corresponding thereto, a DNA containing a 4-base repeat sequence in intron 2 of the FIR gene, and the presence thereof
  • the present invention relates to a cancer detection method to be detected and a measurement kit to be used for the method.
  • c-Myc protein is extremely important for cell life activity and is a transcription factor that controls cell proliferation, differentiation and cell death (apoptosis). It is strictly controlled by transcription factors.
  • the c-myc gene senses physical and mechanical changes in double-stranded DNA generated by transcription, not through protein synthesis, in order to respond quickly to intracellular and external stimuli and maintain homeostasis. There is an unknown mechanism, which is thought to keep the transcription level constant. So far, any site force upstream of the c-myc gene 3 ⁇ 4-myc gene has been examined for its influence on transcription, and only a few tens of bases 1.5 kb upstream of the transcription start site of the c-myc gene.
  • FUSE Fluor Upstream Element
  • This FBP protein has a strong transcriptional activity (2_4), and FIR was identified by the Yeast Two-Hybrid System as a protein that binds to this FBP (5).
  • FIR FBP Interacting Repressor
  • c-Myc protein is thought to suppress c-myc gene transcription by suppressing the helicase activity of TFIIH (6).
  • Patent Document 1 Western blot and RT-PCR using anti-FIR antibodies have been carried out. Describes that FIR expression in cancer tissues is increased.
  • Patent Document 1 International Publication No. WO2004Z018518 Pamphlet
  • Patent Document 2 International Publication No. WO2004Z018679 Pamphlet
  • An object of the present invention is to provide more effective and reliable detection / diagnosis of cancer, particularly digestive organ cancer represented by colorectal cancer, and to provide a genetic diagnosis system and gene for such cancer.
  • Treatment The purpose is to provide various biomolecules used in the development of clinical research systems.
  • amino acid sequence shown in SEQ ID NO: 1 the amino acid sequence in which one or several amino acids are deleted, substituted or added, or homology with the amino acid sequence shown in SEQ ID NO: 1 is 95% or more
  • DNA comprising a continuous base sequence including a base sequence indicating a gene polymorphism in a 4-base repeat sequence in intron 2 of the FIR gene.
  • Aspect 8 The protein according to Aspect 1 or 2, or a fragment peptide thereof, the cDNA according to Aspect 3 or 4, or the mRNA corresponding thereto, or an oligonucleotide comprising a part thereof, or any one of Aspects 5-7 A method for detecting cancer, comprising measuring the presence of DNA comprising a continuous base sequence comprising the 4-base repeat sequence described in the section.
  • Aspect 9 The detection method according to Aspect 8, using an antigen-antibody reaction with an antibody specific for FIR or a splicing variant thereof.
  • Aspect 12 The detection method according to Aspect 11, which is RT—PCR.
  • Aspect 13 The detection method according to Aspect 11, which is real-time quantitative PCR.
  • a detection method which utilizes PCR using a primer set for amplifying a nucleic acid molecule comprising the DNA according to any one of Aspects 5-7.
  • Aspect 15 The detection method according to any one of Aspects 8 to 14, wherein the cancer is a cancer of the extinct organ.
  • Aspect 16 The detection method according to any one of Aspects 8 to 14, wherein the cancer is colorectal cancer.
  • the measurement kit according to embodiment 17, comprising a primer set for amplifying the nucleic acid molecule according to any one of -7 as an element.
  • the splicing variant protein lacking FIR exon 2 which is a transcriptional repressor of the c myc gene of the present invention is specifically expressed only in cancer thread and tissue, and encodes an external protein and the protein.
  • m RNA (cDNA) can be significantly detected at level.
  • cancer detection 'diagnosis can be performed based on the gene polymorphism in the 4-base repeat sequence in intron 2 of the FIR gene.
  • FIG. 1 FIR splicing variant (FIR ⁇ exon2) lacking exon 2, which is a transcriptional repression site of c-myc gene, is specifically expressed in cancer tissue (colon) cancer tissue!
  • RT PCR results (2.5% agarose gel electrophoresis photograph) showing that.
  • FIR A exon2 is data from various experiments showing that, unlike FIR, it increases the expression of endogenous c-Myc.
  • FIG. 4 FIR A exon2 is data of various experiments showing that apoptosis cannot be induced.
  • FIG. 4 is an image diagram showing that the cause of carcinogenesis.
  • FIR intron 2 (2400 bp) has a CCCG (/ CCTG) repeat sequence of 9 times.
  • FIG. 7 shows the number of FCG intron 2 CCCG (/ CCT G) repeat sequences for which significant differences were observed between healthy subjects and cancer patients.
  • FIG. 8 shows the detailed structure of the repeating sequence of FIR intron 2 (CCCG / CCTG) in healthy subjects and cancer patients shown in FIG.
  • FIR FBP Interacting Repressor
  • the first to eighth “MATATIAL” in SEQ ID NO: 1 is exon 1, followed by exon 2 consisting of 29 amino acids “QVNGQQGGGSEPAAAAAWAAGDK WKPPQ” is missing in SEQ ID NO: 1.
  • the alanine continuous sequence “AA AAAWAA” in Exon 2 is a characteristic sequence for transcription repressor.
  • the protein of the present invention includes an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 1, or the amino acid sequence shown in SEQ ID NO: 1. And a protein having an amino acid sequence of 95% or more, preferably 98% or more, and having substantially the same activity as the polypeptide having the amino acid sequence shown in SEQ ID NO: 1.
  • homology means each amino acid residue comprising the chain between two chains in a polypeptide sequence (or amino acid sequence) or polynucleotide sequence (or base sequence). This means the amount (number) of things that can be determined to be the same in the mutual relationship between each other or each base, and the degree of sequence correlation between two polypeptide sequences or two polynucleotide sequences. That means. Homology can be easily calculated.
  • BLASTP BLASTN ⁇ Forces
  • FASTA Altschul, SF et al., J. Molec. Biol, 215: 403 (1990) and the like can be used methods known in the art without being limited thereto.
  • substantially the same activity as the polypeptide having the amino acid sequence represented by SEQ ID NO: 1 refers to various protein activities such as physiological activity, biological activity, and physicochemical activity. It means that the activity is substantially equivalent or homogeneous. Specific examples of such activity include, for example, a polypeptide having the amino acid sequence shown in SEQ ID NO: 1, that is, the same antigenicity as a splicing variant lacking exon 2 of FIR (an antibody that reacts with the splicing variant). As well as functions such as increased expression of c-myc gene, inhibition of apoptosis induction, cell proliferation and canceration.
  • SEQ ID NO: 2 is shown as a specific example of the base sequence (coding region) of a cDNA encoding a splicing noreant lacking exon 2 of FIR of the present invention.
  • cctctctgcg tga An example of the base sequence encoding exon 2 (SEQ ID NO: 4: 87 bp) is as follows: AGTGGTGGCAGCGGGAGACAAATGGAAACCTCCACAG 0
  • a DNA encoding the protein (or polypeptide) of the present invention can be easily prepared by those skilled in the art based on the description in the present specification and known techniques in the technical field. For example, RT-PCR using mRNA prepared from cancer tissue force as a template, and other NASBA (Nucleic acid sequence base amplification) methods and TMA (Transcription-mediated) for appropriate cDNA libraries. Amplification), SDA (Strand Displacement Amplification) and ICAN (isothermal and chimeric primer-initiated amplification of nucleic acids) methods, etc. It is possible.
  • the human FIR gene containing the exon 2 part is registered under NCBI GenBank as registration number NM_014281. Therefore, the base sequence of a primer used for RT-PCR or the like can be appropriately designed and selected based on the registered base sequence and the information disclosed in Patent Document 1 or Patent Document 2.
  • the above DNA can be obtained by known methods (for example, Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47: 411—418; Adams (1983) J. Am. Chem. Soc. 105: 661 ; Belousov (19 97) Nucleic Acid Res. 25: 3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19: 373—380; Blommers (1994) Biochemistry 33: 7886—7896; Narang (1979) Meth. Enzymol. 68: 90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; US Pat. No. 4,458,066).
  • stringent conditions are conditions that enable selective and detectable specific binding between the polynucleotide or oligonucleotide and genomic DNA.
  • Stringent conditions are defined by a suitable combination of salt concentration, organic solvent (eg, formamide), temperature, and other known conditions. That is, stringency increases by decreasing salt concentration, increasing organic solvent concentration, or increasing hybridization temperature.
  • the washing conditions after the noisyization also affect the stringency. This wash condition is also defined by salt concentration and temperature, and the stringency of the wash increases with decreasing salt concentration and increasing temperature.
  • the “stringent condition” means the degree of homology between each base sequence, for example, about 80% or more, preferably about 90% or more, more preferably about 95% or more on average in the whole. This means that the hybrid is specifically formed only between the base sequences having high homology.
  • the conditions include a sodium concentration of 150 to 900 mM, preferably 600 to 900 mM, and a pH of 6 to 8 at a temperature of 60 ° C to 68 ° C.
  • Specific examples of stringent conditions include 5 X SSC (750 mM NaCl, 75 mM trisodium citrate), 1% SDS, 5 X Denhardt's solution 50% formaldehyde, and 42 ° C. The sample is washed and washed under the conditions of 0.1 X SSC (15 mM NaCl, 1.5 mM trisodium citrate), 0.1% SDS, and 55 ° C.
  • Hybridization is described, for example, in Current Protocol in Molecular Biology (.edited by Frederick M. Ausubel et al, 1987). It can be carried out according to a method known in the art such as the method described, or a method analogous thereto, and when a commercially available library is used, it can be carried out according to the method described in the attached instruction manual.
  • the thus obtained DNA encoding the protein of the present invention is inserted into an appropriate recombination DNA such as a plasmid vector, a fuzzy vector, and various hybrid vectors, and the expression vector thus obtained is obtained.
  • an appropriate recombination DNA such as a plasmid vector, a fuzzy vector, and various hybrid vectors
  • the protein of the present invention can be produced by transforming various cells using, and culturing the transformant under appropriate culture conditions. This recombination DNA should be handled using conventional recombinant DNA techniques known to those skilled in the art. Can be any vector.
  • host cells transformed with a vector containing a DNA encoding a protein are not particularly limited, but human-derived cells such as HeLa, mammalian cells such as COS7 and CHO cells, insect cells, and yeasts.
  • human-derived cells such as HeLa
  • mammalian cells such as COS7 and CHO cells
  • insect cells such as E. coli and Bacillus subtilis
  • prokaryotic cells containing various bacteria such as E. coli and Bacillus subtilis can be used.
  • the protein of the present invention can be produced using an appropriate in vitro translation system known to those skilled in the art, such as a rabbit reticulocyte lysate or a wheat germ extract.
  • the protein of the present invention is produced as a fusion protein with any tag known to those skilled in the art such as HA tag, His tag, FLAG tag, and myc tag for convenience of purification operation and detection. It is also possible to make it live. Furthermore, for convenience of protein measurement and detection, it can also be produced as a fusion protein with enzymes such as GST and various fluorescent proteins.
  • the above expression vectors include various promoters such as constitutive expression promoters or various inducible expression promoters known to those skilled in the art, depending on the expression system used, host cells, and the like. And various regulatory elements such as silencers, ribosome binding sites, signal sequences, replication origins, cloning sites, translation initiation sequences, partial positions of terminators, and poly A addition sites, as well as other foreign or endogenous proteins. It can appropriately contain genes to be encoded, various drug resistance genes, genes that complement auxotrophy, and the like.
  • DNA encoding the protein of the present invention can be appropriately selected depending on the host cell into which these vectors are to be introduced.
  • vectors known to those skilled in the art such as pCGNM2 vector plasmid (6), pKAl, pCDM8, and pSVK3 can be mentioned.
  • Such a vector can be introduced into a host cell to transiently express the protein of the present invention, or the entire or part of the host cell genome can be located in one or more places in the genome. Can be threaded.
  • various commercially available vectors known to those skilled in the art can be used.
  • the transformant of the present invention can be obtained by using an appropriate DNA fragment itself containing a gene encoding the protein of the present invention obtained by PCR amplification or the like instead of the expression vector. Both are possible.
  • the composition can be used for transformation as a composition such as a solution optionally containing an appropriate buffer and other auxiliaries in addition to a strong DNA fragment.
  • the expression vector (DNA for recombination) containing the DNA of the present invention or the DNA fragment itself such as, for example, the method, elctroporation, Lipofectamine Plus reagents (Gibco BRL input [repulsive norme method, protoplast-PEG method, It can be introduced into a host cell by any known method such as Ti plasmid method, particle gun method, nanovirus method, etc. Further, a transformant can be prepared. It is also possible by the Yong method.
  • a transformant that expresses the protein of the present invention can be produced by culturing the protein under conditions favorable for production of the protein, expressing the protein, and recovering the host cell and Z or medium power.
  • the medium used for host cell culture is appropriately selected from any medium known to those skilled in the art, depending on the configuration of the expression vector used (type of promoter, etc.) and the type of host. be able to.
  • the protein of the present invention produced by a host cell is used in an appropriate combination of any means known to those skilled in the art, for example, separation of a medium and cells by centrifugation or filtration, and an ammonium sulfate-like protein. It can be recovered from the medium by precipitation of the protein components of the medium with the appropriate salt and subsequent use of hydrophobic chromatography, ion exchange chromatography, affinity chromatography, or other chromatography. Alternatively, the protein of the present invention can be produced by a chemical synthesis method.
  • the DNA (oligonucleotide) containing a base sequence showing a gene polymorphism in the 4-base repeat sequence in intron 2 of the FIR gene of the present invention is, for example, 1 to 2100 (for example, about 2058), preferably 1 to: L It consists of a continuous base sequence of 100 (for example, about 1032), more preferably 1 to 600, and still more preferably 40 to 600 (for example, about 513).
  • SEQ ID NO: 3 genomic DNA containing exon 2 and intron 2 of the FIR gene shown below can be mentioned.
  • SEQ ID NO: 3 the first sequence shown in capital letters is exon 2 (87 bp), and the sequence shown in lower case following is the sequence of intron 2 (2399 bp). Furthermore, it is a sequence showing a gene polymorphism in a partial force base repeat (9 times) sequence surrounded by parentheses.
  • FIR is expressed not only in cancer tissues but also in normal tissues, whereas in some cases, splicing variants lacking exon 2 of FIR are observed.
  • the protein of the present invention is expressed only in cancer tissue cells of cancer patients and not expressed in normal tissue cells or blood cells adjacent to the cancer tissue. Therefore, such a protein and its encoding cDNA or corresponding mRNA, or an oligonucleotide that partially relies on them, serve as a very specific cancer detection marker in cancer detection and diagnosis. It is a substance that has utility.
  • the proportion of 9 homo repeats (including hetero in the base sequence type of repeat units) in the 4-base repeat sequence in intron 2 of the FIR gene is compared with that in normal tissues. Therefore, the above DNA containing a nucleotide sequence showing such a gene polymorphism is also a useful substance as a cancer detection marker in cancer detection and diagnosis.
  • the splicing variant protein or its fragment peptide lacking exon 2 of the above FIR, the cDNA encoding them or the mRNA corresponding thereto, or a partial oligonucleotide thereof, or in the intron 2 of the FIR gene Cancer can be detected or diagnosed significantly by measuring the presence of DNA (genomic DNA) consisting of a continuous base sequence containing a base sequence indicating a gene polymorphism in a 4-base repeat sequence.
  • DNA genomic DNA
  • cancer is detected by measuring the expression level of the above-mentioned splicing variant protein, mRNA (cDNA) or oligonucleotide in cancer thread and tissue, and using this as a normal tissue or normal person derived from the same cancer patient. This can be done by measuring the expression level in the tissues and comparing these values. Such measurement of the expression level can be quantitative, semi-quantitative, or qualitative depending on the principle of the measurement method.
  • the splicing variant protein lacking exon 2 of the FIR of the present invention or the mRNA (cDNA) encoding the same is expressed specifically only in the cancer thread and tissue, so that cancer can be conveniently and highly sensitive (highly sensitive). (Specificity) can be detected.
  • the expression level of the splicing variant protein can be measured by any method known to those skilled in the art. Examples include Western plotting using appropriate antibodies, immunostaining and methods using various immunological specific reactions such as EIA, amino acid sequence analysis of gas phase sequencer etc. peptides using Edman's method, Furthermore, it can be detected by mass spectrometry represented by MALDI-TOF / MS and ESI Q-TOFZMS methods.
  • a test method is preferred in which the expression level of the white matter is measured by an antigen antibody reaction with an antibody specific for FIR or a splicing variant thereof.
  • antibodies include, for example, antibodies that recognize both FIR and a splicing variant lacking exon 2 of FIR as antigens.
  • the above-mentioned antibody is a splicing variant that lacks FIR or exon 2 of FIR.
  • a suitable partial polypeptide (peptide fragment) thereof or various derivatives or complexes thereof as antigenic substances or immunogens can be prepared by an appropriate method known to those skilled in the art.
  • a polyclonal antibody it can be administered to an appropriate animal such as mouse, rat, rabbit, goat, or chicken, and its antiserum can be prepared.
  • known methods described in monoclonal antibody production methods (“monoclonal antibodies”, Nagamune Kamei, Hiroshi Terada, Yodogawa Shoten, 1990; “Monoclonal Antibody” James W. Goding, third edition, Academic Press, 1996) It is also possible to prepare a monoclonal antibody by a method using cell fusion. For example, it can be prepared by the method described in Patent Document 1 or Patent Document 2.
  • Such an antibody is derived from a complete antibody such as Fab, F (ab '), Fv fragment, etc. by genetic engineering (DNA recombination technology) as long as the original antibody activity is not lost.
  • Such antibodies and the like include those labeled with various labeling substances known to those skilled in the art, such as enzymes, radioisotope fluorescent dyes, and metal atoms.
  • an antigen-antibody reaction with an anti-FIR antibody for example, when measured by Western plotting, a splicing variant protein (513 amino acids) lacking FIR exon 2 and FIR (542 Amino acid) can be specifically detected by the difference in molecular weight.
  • an antibody that specifically reacts only with a splicing variant protein lacking exon 2 of FIR for example, it can be measured by an enzyme immunoassay such as EIA.
  • Nucleic acid molecules containing DNA consisting of a contiguous base sequence that includes a base sequence that indicates a gene polymorphism in the sequence include various PCR methods such as RT-PCR and real-time quantitative PCR, and various microarray (DNA chip) methods. Can be amplified by methods known to those skilled in the art.
  • nucleic acid molecule containing each of the above DNAs is amplified by an RT-PCR method and electrophoresed
  • the nucleic acid molecule can be detected and identified from the amount of the molecules measured in combination.
  • the base sequence of mRNA corresponding to the splicing variant lacking FIR etason 2 (for example, FIR exon 1 and exon 3)
  • FIR etason 2 for example, FIR exon 1 and exon 3
  • a primer that specifically amplifies a nucleic acid molecule containing only a contiguous nucleotide sequence encoding an oligonucleotide or a partial oligonucleotide thereof. It becomes possible. It is also possible to use a method (sequence method) for directly determining the base sequence of the amplified DNA.
  • the base sequence of the primer used in the above RT-PCR and the like is based on the base sequence of FIR registered in GenBank as described above and the information disclosed in Patent Document 1 or Patent Document 2. You can choose 'design as appropriate'.
  • the primer it is preferable to have a base number that allows specific binding to the cage, for example, 15-40 bases, more specifically, about 15-25 bases.
  • commercially available primer design software such as 01igo TM (National Bioscience Inc.) can be used.
  • the measurement kit used in the detection method of the present invention can have an appropriate configuration depending on the measurement object or measurement principle.
  • the kit includes, for example, an anti-FIR antibody, an antibody against a splicing noriant protein lacking exon 2 of FIR, various secondary antibodies (labeled antibodies), and the above-mentioned mRNA (cDNA) amplification.
  • Probes for hybridization used in primers, DNA chips, etc. can be included.
  • the above kit contains other elements or components known to those skilled in the art, for example, various reagents, enzymes, buffers, reaction plates (containers), etc., depending on the configuration-purpose of use.
  • Cancer patients and non-cancerous tissues were collected from patients admitted to Chiba University Hospital for the treatment of primary colorectal cancer with written consent prior to surgery and stored at minus 80 ° C.
  • Various human cancer cell lines were obtained from the Cellellology Collection (http://www.atcc.org/3 ⁇ 4earcn and atalogs / ellBiology.c & i). Volunteers for healthy volunteers were collected with the consent of the healthy volunteers working at the Chiba University Medical Research Institute and the Chiba University Hospital.
  • FIR full-length FIR
  • cDNA obtained from cancer tissue and splicing variant cDNA (HA-FIR ⁇ exon2) lacking exon 2 of FIR
  • pCGNM2 vector plasmid 9
  • HA hemagglutinin
  • HA-FIR and HA-FIR A exon2 with a tag attached to its N-terminus were expressed.
  • the human c-Myc expression vector was a commercially available pcDNA3.1-c-myc, ueneStorm Expression—Ready Clones (Invitrogen, o., AL).
  • HeLa cells were cultured on a cover glass, and the above-mentioned vector (150 ftnol) containing HA-FIR and HA-FIR ⁇ exon2 gene was introduced using Lipofectamine Plus reagents (Gibco BRL) to examine the change in expression of c-Myc.
  • the primary antibodies used were mouse monoclonal anti-HA antibody (Santa Cruz Biotechnology, CA and rabbit polyclonal anti-c-My c3 ⁇ 4ri (Upstate Biotechnology, NY), diluted 500-fold and 1,000-fold, respectively.
  • Potato ⁇ cis 7 detected by iiTUNEL assay (Apoptosis Detection system, Fluorescein n Promega, WI, USA). Two-color analysis was performed in 50 ⁇ ⁇ terminal deoxynucleotidyl transferase (TdT) buffer containing FITC-labeled dUTP (MEBSTAIN Ap optosis Kit: Medical & Biological Laboratories, JAPAN) G Finally 250 ⁇ g of DNase -Cells were mixed with 0.5 ml propidium iodide (PI) solution (freshly diluted to 5 ⁇ g / ml in PBS) containing fr ee RNase A.
  • PI propidium iodide
  • lysis buffer (7M urea, 2M thiourea, 2% 3-[(3-Chola midopropyl) dimethylammonio—] 1—propanesulfate (CHAPS), 0.1 M Dithiothreitol (D TT), 2% IPG buffer (Amersham Phrmacia Biothech, Backinghampsnire, UK), 40 mM Tris) Dissolve 500 mg of frozen yarn and weave using Polytron homogenizer (Kinematica, Switzerland) and centrifuge at 100,000 xg for 1 hour at 4 ° C. The supernatant was used.
  • the primary antibodies used for Western blotting are the rabbit anti-FIR antibody (5) and the goat polyclonal anti-13-actin antibody (Santa Cruz, Santa Cruz, CA), which are used at 1,000 and 500 times, respectively.
  • 7 Secondary antibody is 3,000 times diluted with horseradish IgG horseradish peroxidase conjugate (HRP) (Jackson, west Grove, PA), and 500 fold diluted with rabbit horseradish IgG HRP (Cappel, West Chester, PA). used.
  • Antigen was detected with ECL TM detection reagents (Amersham Pharmacia Biothech) and expression levels were quantified by NIH Image.
  • Polyclonal anti-FIR antibody has two synthetic peptides (C (correction) DKWKPPQGTDSIKME (a Minoic acid 30-45) and C (additional caro) EVYDQERFDNSDLSA (amino acids 528-542)) were immunized simultaneously.
  • RNA and genomic DNA were extracted from cancerous and non-cancerous parts using RNeasy TM Mini Kit and DNeasy TM Tis sues Kit (Qiagen).
  • cDNA was synthesized from total RNA using the 1 st strand cDNA Synthesis Kit (Roche, Mannheim, Germany).
  • FIR cDNA was amplified by RT-PCR using the prepared cDNA.
  • the primers used were: forward 5,-GGCCCCATC AAGAGCATC -3 '(SEQ ID NO: 5), reverse 5,-GGGGCTGGGCCAGGGTCAG -3' (SEQ ID NO: 6).
  • GAPDH cDNA was used as a control.
  • FIR cDNA amplified by ReaH ime quantitative PCR was accurately quantified with LightCycler TM (Roche, Mannheim, Germany). We asked Gene research laboratories Inc (Sendai, Japan) to evaluate the optimal primer conditions. PIR for amplification of FIR cDNA ⁇ [MA (PCR product size is 275 base pairs): forward 5, — G and ACCTGGAGTC ATCACA-3, (SEQ ID NO: 7), reverse 5, -CGCAGAACCATCACTGTAG-3 '(SEQ ID NO: 8) was used.
  • Primers for human c-myc cDNA and human j8-actin cDNA are: forward 5,-GCCTCAGAGTGCATCGAC-3, (SEQ ID NO: 9), reverse 5, -TCCACA GAAACAACATCG-3 '(SEQ ID NO: 10) (c-myc), forward 5 '-TGGAGAAAATCTGG CACCAC-3' (SEQ ID NO: 11), reverse 5, -AATGGTGATGACCTGGCCGT-3, (SEQ ID NO: 12) ( ⁇ -actin) were used.
  • the following primer set was used for detecting the repeated sequence of FIR intron 2.
  • R04 5 '-AAGCCCATTCCTCCTTA-3' (SEQ ID NO: 14)
  • R05 5 '-TTTGACTTGCGCATTGC-3' (SEQ ID NO: 15)
  • PCR was performed using the IF-R04 primer set, and 2nd PCR was performed using the 1F-R05 primer set.
  • This PCR product was directly subjected to DNA sequencing according to a conventional method. PCR conditions are 95 ° C; 5 min, [95 ° C; 30 sec-56 ° C; 30 sec-72 ° C; 1 min] x35 cycles, 72. C; performed at 2 min.
  • DNA polymerase is Pfo DNA polymerase (Stratagene, La Jolla, CA) used.
  • an IF primer was used for the DNA sequence.
  • intron 2 of the FIR gene were significantly different in the number of repeats between genomic DNA derived from peripheral blood mononuclear suddenly in healthy subjects and genomic DNA derived from colon cancer tissue (FIGS. 7 and 8). That is, the proportion of cancer patients with 9 repeat sequences (homo) was significantly higher in cancer patients than in healthy individuals.
  • cancer detection can be diagnosed by examining the number of repetitive sequences present in intron 2 of the FIR gene.
  • the present invention provides a more effective and reliable detection 'diagnosis' treatment of cancer, particularly digestive organ cancer represented by colorectal cancer, as well as development of cancer gene diagnosis system and gene therapy clinical research system.
  • Various biomolecules used in the field are provided.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Analytical Chemistry (AREA)
  • Genetics & Genomics (AREA)
  • Pathology (AREA)
  • General Health & Medical Sciences (AREA)
  • Biochemistry (AREA)
  • Zoology (AREA)
  • Biophysics (AREA)
  • Biotechnology (AREA)
  • Physics & Mathematics (AREA)
  • Hospice & Palliative Care (AREA)
  • Urology & Nephrology (AREA)
  • Microbiology (AREA)
  • Wood Science & Technology (AREA)
  • Hematology (AREA)
  • Oncology (AREA)
  • Medicinal Chemistry (AREA)
  • Biomedical Technology (AREA)
  • Cell Biology (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • General Engineering & Computer Science (AREA)
  • Toxicology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Peptides Or Proteins (AREA)
  • Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)

Abstract

L'invention a pour objet de mettre à disposition un procédé permettant plus efficacement et avec plus de fiabilité la détection, le diagnostic et/ou le traitement du cancer, en particulier du cancer du système digestif, typiquement le cancer du côlon, ainsi que différentes biomolécules à utiliser pour mettre au point de tels systèmes de diagnostic génique pour le cancer tels que décrits ci-dessus, et des systèmes de recherche clinique en thérapie génique. À cet effet, l'invention concerne une variante d'épissage du régulateur FIR de transcription du gène c-myc; un ADNc codant pour celle-ci ou un ARNm correspondant à celui-ci; un ADN contenant une séquence de répétition à quatre bases dans l'intron 2 du gène FIR; un procédé pour détecter le cancer grâce à la détection de son occurrence; et un kit d'essai à utiliser à cet effet.
PCT/JP2007/050915 2006-01-27 2007-01-22 Procédé pour détecter le cancer au moyen d'une variante d'épissage du régulateur fir de transcription du gène c-myc ou d'une séquence de répétition à quatre bases dans l'intron 2 WO2007086342A1 (fr)

Priority Applications (1)

Application Number Priority Date Filing Date Title
JP2007513551A JP4806776B2 (ja) 2006-01-27 2007-01-22 ｃ−ｍｙｃ遺伝子転写抑制因子ＦＩＲのスプライシングバリアント又はイントロン２内の４塩基繰り返し配列による癌検出方法

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2006-018341 2006-01-27
JP2006018341 2006-01-27

Publications (1)

Publication Number Publication Date
WO2007086342A1 true WO2007086342A1 (fr) 2007-08-02

Family

ID=38309135

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2007/050915 WO2007086342A1 (fr) 2006-01-27 2007-01-22 Procédé pour détecter le cancer au moyen d'une variante d'épissage du régulateur fir de transcription du gène c-myc ou d'une séquence de répétition à quatre bases dans l'intron 2

Country Status (2)

Country Link
JP (1) JP4806776B2 (fr)
WO (1) WO2007086342A1 (fr)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011129427A1 (fr) * 2010-04-16 2011-10-20 第一三共株式会社 Agent de diagnostic et agent thérapeutique pour les cancers
CN113226318A (zh) * 2018-08-13 2021-08-06 北京智康博药肿瘤医学研究有限公司 用于癌症疗法的生物标记物
US11753476B2 (en) 2018-04-08 2023-09-12 Cothera Bioscience, Inc. Combination therapy for cancers with BRAF mutation

Citations (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004018518A1 (fr) * 2002-08-23 2004-03-04 Japan Science And Technology Agency Peptides antigeniques de tumeur cancereuse solide humains, polynucleotides codant pour ceux-ci et utilisation de ceux-ci

Patent Citations (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2004018518A1 (fr) * 2002-08-23 2004-03-04 Japan Science And Technology Agency Peptides antigeniques de tumeur cancereuse solide humains, polynucleotides codant pour ceux-ci et utilisation de ceux-ci
WO2004018679A1 (fr) * 2002-08-23 2004-03-04 Japan Science And Technology Agency Methode et trousse de diagnostic du cancer

Non-Patent Citations (8)

* Cited by examiner, † Cited by third party
Title
DATABASE GENBANK [online] OTTENWAELDER B. ET AL., XP003017947, Database accession no. (CR857074) *
DATABASE GENBANK [online] OTTENWAELDER B., XP003017946, Database accession no. (CAH89379) *
KAJIWARA T. ET AL.: "Massho Kecchu deno c-myc Tensha Yokusei Inshi FIR splicing variant no Kenshutsu ni yoru Daichogan Shindan", DAI 65 KAI ANNUAL MEETING OF THE JAPAN CANCER ASSOCIATION KIJI, 28 August 2006 (2006-08-28), pages 392, P-1005, XP003017952 *
MATSUSHIT K. ET AL.: "An essential role of alternative splicing of c-myc suppressor FUSE-binding protein-interacting repressor in carcinogenesis", CANCER RES., vol. 66, no. 3, 2006, pages 1409 - 1417, XP003017953 *
MATSUSHITA K. ET AL.: "Apoptosis Yudosei c-myc Idenshi Tensha Yokusei Inshi ni yoru Shokaki Gan Idenshi Chiryoho no Kaihatsu", DAI 63 KAI ANNUAL MEETING OF THE JAPAN CANCER ASSOCIATION KIJI, 25 August 2004 (2004-08-25), pages 516, P-1494, XP003017950 *
MATSUSHITA K. ET AL.: "c-myc Idenshi Tensha Yokusei Inshi FIR no Gan Tokuiteki Screening Splicing Variant o Mochiita Gan Shindan", THE JAPANESE SOCIETY OF GASTROENTEROLOGICAL SURGERY ZASSHI, 1 July 2006 (2006-07-01), pages 449, 1187, XP003017951 *
MATSUSHITA K. ET AL.: "c-myc Idenshi Tensha Yokusei Inshi FIR no Hatsugen to Ganka eno Kanyo", DAI 28 KAI ANNUAL MEETING OF THE MOLECULAR BIOLOGY SOCIETY OF JAPAN KOEN YOSHISHU, 25 November 2005 (2005-11-25), pages 426, 2P-0467, XP003017949 *
MATSUSHITA K. ET AL.: "c-myc Idenshi Tensha Yokusei Inshi FIR no Splicing Variant no Ganka eno Kanyo", DAI 64 KAI ANNUAL MEETING OF THE JAPAN CANCER ASSOCIATION KIJI, 15 August 2005 (2005-08-15), pages 459, PA3-1042, XP003017948 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2011129427A1 (fr) * 2010-04-16 2011-10-20 第一三共株式会社 Agent de diagnostic et agent thérapeutique pour les cancers
US11753476B2 (en) 2018-04-08 2023-09-12 Cothera Bioscience, Inc. Combination therapy for cancers with BRAF mutation
CN113226318A (zh) * 2018-08-13 2021-08-06 北京智康博药肿瘤医学研究有限公司 用于癌症疗法的生物标记物

Also Published As

Publication number Publication date
JPWO2007086342A1 (ja) 2009-06-18
JP4806776B2 (ja) 2011-11-02

Similar Documents

Publication Publication Date Title
Sumegi et al. Recurrent t (2; 2) and t (2; 8) translocations in rhabdomyosarcoma without the canonical PAX‐FOXO1 fuse PAX3 to members of the nuclear receptor transcriptional coactivator family
US20130102542A1 (en) Cancer related isoforms of components of transcription factor complexes as biomarkers and drug targets
WO2017044801A2 (fr) Procédés pour identifier des cibles polypeptidiques modulées par des médicaments en vue d'une dégradation
Gire et al. The Gly56Arg mutation in NR2E3 accounts for 1–2% of autosomal dominant retinitis pigmentosa
WO2007086342A1 (fr) Procédé pour détecter le cancer au moyen d'une variante d'épissage du régulateur fir de transcription du gène c-myc ou d'une séquence de répétition à quatre bases dans l'intron 2
Szentirmay et al. The IGF2 receptor is a USF2-specific target in nontumorigenic mammary epithelial cells but not in breast cancer cells
US20030171273A1 (en) Novel transcription factor, BP1
US7666603B2 (en) Breast cancer related protein, gene encoding the same, and method of diagnosing breast cancer using the protein and gene
CA2803215A1 (fr) Compositions et methodes liees au cancer de la prostate
Xing et al. Characterization of the promoter of 1A6/DRIM, a novel cancer-related gene and identification of its transcriptional activator
Morozov et al. HPV 16 E7 oncoprotein induces expression of a 110 kDa heat shock protein
US20040197786A1 (en) Method of examining steroid resnponsiveness
WO2015194524A1 (fr) Nouveau gène chimère de la leucémie lymphoblastique aiguë à précurseurs b
Kokura et al. Identity between rat htf and human xbp-1 genes: determination of gene structure, target sequence, and transcription promotion function for HTF
JP4617257B2 (ja) ヒト癌関連遺伝子、それがコードする産物および適用
WO2000043522A1 (fr) Gene a l'origine du syndrome de rothmund-thomson et produit genique
JP4098236B2 (ja) 肝芽腫と正常肝で発現差がある核酸
KR20070027659A (ko) 유방암 특이적 단백질, 그를 코딩하는 유전자, 및 상기단백질 또는 유전자를 이용한 유방암의 진단 방법
CA2491420A1 (fr) Proteine induite par le gene rb1 (rb1cc1) et gene
RU2380422C2 (ru) Анализ и применение полиморфных форм par1 для оценки риска сердечно-сосудистых заболеваний
WO1998006871A1 (fr) Substances et procedes concernant le diagnostic et le traitement prophylactique et therapeutique du carcinome papillaire renal
US20050203283A1 (en) ISOFORMS OF NUCLEAR RECEPTOR RXR a
JP4830101B2 (ja) コステロ症候群原因遺伝子変異とその検出又は診断方法
JP5354484B2 (ja) がん検出方法
WO1997001634A2 (fr) Polypeptide pour la reparation d'informations genetiques, sequence nucleotidique codant pour ce polypeptide, et son procede de preparation (proteine de liaison de guanine-thymine - gtbp)

Legal Events

Date Code Title Description
WWE Wipo information: entry into national phase

Ref document number: 2007513551

Country of ref document: JP

DPE2 Request for preliminary examination filed before expiration of 19th month from priority date (pct application filed from 20040101)
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 07707178

Country of ref document: EP

Kind code of ref document: A1