WO2007086342A1 - METHOD OF DETECTING CANCER USING SPLICING VARIANT OF c-myc GENE TRANSCRIPTIONAL REGULATOR FIR OR FOUR-BASE REPETITIVE SEQUENCE IN INTRON 2 - Google Patents

Abstract

[PROBLEMS] To provide a method of more effectively and surely detecting, diagnosing and/or treating cancer, in particular, digestive system cancer typified by colon cancer; and various biomolecules to be used in developing such gene diagnosis systems for cancer as described above and clinical research systems of gene therapy. [MEANS FOR SOLVING PROBLEMS] A splicing variant of c-myc gene transcriptional regulator FIR, a cDNA encoding the same or an mRNA corresponding to the same; a DNA containing a four-base repetitive sequence in intron 2 of FIR gene; a method of detecting cancer by detecting the occurrence thereof; and an assay kit to be used therefor.

Description

 Specification

 Cancer detection method by splicing variant of c-myc gene transcription repressor FIR or 4-base repeat sequence in intron 2

 Technical field

 [0001] The present invention relates to a splicing variant of a c-myc gene transcription repressor FIR or a cDNA encoding the same or a mRNA corresponding thereto, a DNA containing a 4-base repeat sequence in intron 2 of the FIR gene, and the presence thereof The present invention relates to a cancer detection method to be detected and a measurement kit to be used for the method.

 Background art

[0002] c-Myc protein is extremely important for cell life activity and is a transcription factor that controls cell proliferation, differentiation and cell death (apoptosis). It is strictly controlled by transcription factors. On the other hand, the c-myc gene senses physical and mechanical changes in double-stranded DNA generated by transcription, not through protein synthesis, in order to respond quickly to intracellular and external stimuli and maintain homeostasis. There is an unknown mechanism, which is thought to keep the transcription level constant. So far, any site force upstream of the c-myc gene ¾-myc gene has been examined for its influence on transcription, and only a few tens of bases 1.5 kb upstream of the transcription start site of the c-myc gene. Was shown to be very important for c-myc gene transcription and named FUSE (Far Upstream Element) (1). That is, the physical strain of double-stranded DNA generated by transcriptional activity causes negative supercoiling upstream of the promoter, which causes the double-stranded DNA to unfold into single-stranded DNA, which is c -It was reported to be extremely important for the transcriptional control of the myc gene (1-7). The protein that binds to FUSE was identified by oligonucleotide affinity chromatography and found to be FBP (FUSE Binding Protein) having a molecular weight of 70 kDa. This FBP protein has a strong transcriptional activity (2_4), and FIR was identified by the Yeast Two-Hybrid System as a protein that binds to this FBP (5). FIR (FBP Interacting Repressor) is thought to suppress c-myc gene transcription by suppressing the helicase activity of TFIIH (6). [0003] The ability of such c-Myc protein to induce apoptosis regardless of whether it increases or decreases in a cell has many unclear points regarding its detailed mechanism and its relation to canceration. So far, in the international patent applications PCT / JP2003 / 5046 (Patent Document 1) and PCT / JP 2003/10676 (Patent Document 2) relating to the inventors' own invention, Western blot and RT-PCR using anti-FIR antibodies have been carried out. Describes that FIR expression in cancer tissues is increased.

 [0004] Furthermore, in PCT / JP2003 / 10676 (Patent Document 2), substitution of a plurality of bases or amino acids at positions 1 to 135 of the FIR amino acid sequence was detected by FIR sequencing from 3 cases of colorectal cancer. When FIR is induced to induce expression in HeLa cells, apoptosis is induced. On the other hand, a mutant FIR protein that deletes the N-terminal 77 amino acids of the FIR transcriptional activity does not induce apoptosis. It is described that, when co-expressed, apoptosis induction by FIR was inhibited, and furthermore, the expression of FIR protein and mRNA was increased in colorectal cancer.

 Patent Document 1: International Publication No. WO2004Z018518 Pamphlet

 Patent Document 2: International Publication No. WO2004Z018679 Pamphlet

 Disclosure of the invention

 Problems to be solved by the invention

[0005] An object of the present invention is to provide more effective and reliable detection / diagnosis of cancer, particularly digestive organ cancer represented by colorectal cancer, and to provide a genetic diagnosis system and gene for such cancer. Treatment The purpose is to provide various biomolecules used in the development of clinical research systems.

 Means for solving the problem

[0006] As a result of research that solves the above problems, the present inventor has found that c-Myc expression is increased. In the cancer tissue of colon (colon), FIR ^ lacking exon 2 containing a transcriptional repression site. In the process of investigating the mechanism of splicing expression of FIR gene, it was newly found that the expression of the pricing variant (FIR Δ exon2) was increased specifically in cancer. I discovered that Microsatellite Instability (MIN) / Simple Sequence Repeat (SSR) exist. The present invention has been completed based on these new findings. That is, the present invention relates to the following aspects.

 [Aspect l] A protein which is a splicing variant in which exon 2 of FIR which is a transcription repressor of c myc gene is deleted.

 [Aspect 2] Protein having the following amino acid sequence:

 (1) a protein comprising the amino acid sequence shown in SEQ ID NO: 1, or

 (2) In the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence in which one or several amino acids are deleted, substituted or added, or homology with the amino acid sequence shown in SEQ ID NO: 1 is 95% or more And a protein having substantially the same activity as a polypeptide having the amino acid sequence shown in SEQ ID NO: 1.

 [Aspect 3] cDNA encoding the protein according to aspect 1 or 2, or mRNA corresponding thereto

[Aspect 4] cDNA consisting of the following nucleotide sequences or mRNA corresponding thereto:

 (1) the base sequence shown in SEQ ID NO: 2, or

 (2) A base sequence that hybridizes under stringent conditions with DNA having a base sequence ability complementary to the base sequence shown in SEQ ID NO: 2 and encodes the protein according to aspect 1 or 2.

 [Aspect 5] DNA comprising a continuous base sequence including a base sequence indicating a gene polymorphism in a 4-base repeat sequence in intron 2 of the FIR gene.

 [Aspect 6] 4 bases 9 times repeated sequence found in the base sequence from position 118 to position 153 in SEQ ID NO: 3 (genomic DNA containing exon 2 and intron 2 of FIR gene: total 2487 bp), or its The DNA according to aspect 5, comprising 5 or 6 repeat sequences of the 4 bases in the region.

 [Aspect 7] A DNA according to Aspect 6, wherein the base sequence of the 4-base repeat is CCCG or CCTG

[Aspect 8] The protein according to Aspect 1 or 2, or a fragment peptide thereof, the cDNA according to Aspect 3 or 4, or the mRNA corresponding thereto, or an oligonucleotide comprising a part thereof, or any one of Aspects 5-7 A method for detecting cancer, comprising measuring the presence of DNA comprising a continuous base sequence comprising the 4-base repeat sequence described in the section. [Aspect 9] The detection method according to Aspect 8, using an antigen-antibody reaction with an antibody specific for FIR or a splicing variant thereof.

 [Aspect 10] The detection method according to Aspect 9, characterized by measurement by Western plotting.

 [Aspect 11] Aspect 8 according to aspect 8, wherein PCR using a primer set for amplifying a nucleic acid molecule comprising the cDNA according to aspect 3 or 4 or the mRNA corresponding thereto or an oligonucleotide comprising a part thereof is used. Detection method.

 [Aspect 12] The detection method according to Aspect 11, which is RT—PCR.

 [Aspect 13] The detection method according to Aspect 11, which is real-time quantitative PCR.

 [Aspect 14] A detection method according to Aspect 8, which utilizes PCR using a primer set for amplifying a nucleic acid molecule comprising the DNA according to any one of Aspects 5-7.

 [Aspect 15] The detection method according to any one of Aspects 8 to 14, wherein the cancer is a cancer of the extinct organ.

 [Aspect 16] The detection method according to any one of Aspects 8 to 14, wherein the cancer is colorectal cancer.

 [Aspect 17] A measurement kit used in the detection method according to any one of Aspects 8 to 14.

 [Aspect 18] Antibody specific to antibody FIR or a splicing variant thereof, or Aspect 3

The measurement kit according to embodiment 17, comprising a primer set for amplifying the nucleic acid molecule according to any one of -7 as an element.

 The invention's effect

[0008] The splicing variant protein lacking FIR exon 2 which is a transcriptional repressor of the c myc gene of the present invention is specifically expressed only in cancer thread and tissue, and encodes an external protein and the protein. _m RNA (cDNA) can be significantly detected at level. Furthermore, cancer detection 'diagnosis can be performed based on the gene polymorphism in the 4-base repeat sequence in intron 2 of the FIR gene.

 Brief Description of Drawings

 [0009] [Fig. 1] FIR splicing variant (FIR Δ exon2) lacking exon 2, which is a transcriptional repression site of c-myc gene, is specifically expressed in cancer tissue (colon) cancer tissue! RT—PCR results (2.5% agarose gel electrophoresis photograph) showing that.

[Figure 2] Expression of FIR Δ exon2 in gastrointestinal cancer patients measured by real-time quantitative PCR The state of is shown.

 [Figure 3] FIR A exon2 is data from various experiments showing that, unlike FIR, it increases the expression of endogenous c-Myc. A: RT—PCR, B: Immunohistochemical staining, C and D: Flow cytometry.

 [Fig. 4] FIR A exon2 is data of various experiments showing that apoptosis cannot be induced. A: Immunohistochemical staining, B: Flow cytometry.

 [Fig.5] In cancer thread and tissue, FIR Δ exon2 is specifically expressed to competitively inhibit c-myc gene transcription repression by normal FIR, and simultaneously induce apoptosis induction and increase c-Myc expression. FIG. 4 is an image diagram showing that the cause of carcinogenesis.

 [FIG. 6] FIR intron 2 (2400 bp) has a CCCG (/ CCTG) repeat sequence of 9 times. FI

The first part of R intron 2 (12-206) and the last part of intron l (4880bp) (4682-4880) contain 9 repeats of CCCG (/ CCTG), 121bp / 195bp = 62.1% high homology Sex was recognized.

 FIG. 7 shows the number of FCG intron 2 CCCG (/ CCT G) repeat sequences for which significant differences were observed between healthy subjects and cancer patients.

 FIG. 8 shows the detailed structure of the repeating sequence of FIR intron 2 (CCCG / CCTG) in healthy subjects and cancer patients shown in FIG.

 BEST MODE FOR CARRYING OUT THE INVENTION

 [0010] [Aspects 1 and 2]

 c A splicing variant of FIR (FBP Interacting Repressor), which is a transcriptional repressor of myc gene, and relates to the protein itself lacking exon 2. As a specific example of such a protein, there can be mentioned a protein having a sequence ability of 513 amino acids shown in SEQ ID NO: 1.

[0011] S column number 1: single letter amino acid]

[0012] The first to eighth “MATATIAL” in SEQ ID NO: 1 is exon 1, followed by exon 2 consisting of 29 amino acids “QVNGQQGGGSEPAAAAAWAAGDK WKPPQ” is missing in SEQ ID NO: 1. In addition, the alanine continuous sequence “AA AAAWAA” in Exon 2 is a characteristic sequence for transcription repressor.

 [0013] The protein of the present invention includes an amino acid sequence in which one or several amino acids are deleted, substituted, or added in the amino acid sequence shown in SEQ ID NO: 1, or the amino acid sequence shown in SEQ ID NO: 1. And a protein having an amino acid sequence of 95% or more, preferably 98% or more, and having substantially the same activity as the polypeptide having the amino acid sequence shown in SEQ ID NO: 1.

[0014] Here, "homology" means each amino acid residue comprising the chain between two chains in a polypeptide sequence (or amino acid sequence) or polynucleotide sequence (or base sequence). This means the amount (number) of things that can be determined to be the same in the mutual relationship between each other or each base, and the degree of sequence correlation between two polypeptide sequences or two polynucleotide sequences. That means. Homology can be easily calculated. Many methods for measuring homology between two polynucleotide or polypeptide sequences are known, and the term “homology” (also referred to as “identity”) is well known to those skilled in the art ( For example,, Lesk, AM (Ed.), Omputational Molecular Biology, Oxford University Press, New York, (1988); Smith, DW (Ed.), Biocomputing: Informatics and Genome Projects, Academic Press, New York, ( 1993); Grifin, AM & Grifin, HG (Ed.), Computer Analysis of Sequence Data: Part I, Human Press, New Jersey, (1994); von Heinje, G., Sequence Analysis in Molecular Biology, Academic Press, New York, (1987); Gri bskov, M. & Devereux, J. (Ed.), Sequence Analysis Primer, M-Stockton Press, New York, (1991), etc. ). Common methods used to measure the homology of two sequences include Martin, J. Bishop (Ed.), Guide to Huge Computers, Academic Press, San Diego, (19 94); Carillo, H. & Lipman, D., SIAM J. Applied Math., 48: 1073 (1988) and the like. The power is not limited to these. Preferred / methods for measuring homology are those designed to obtain the largest match between the two sequences tested. Such methods include those assembled as computer programs. Preferred computer programming methods for measuring homology between two sequences include the GCG program package (Devereux, J. et al., Nucleic Acids Research, 12 (1): 387 (1984)), BLASTP, BLASTN ゝForces such as FASTA (Atschul, SF et al., J. Molec. Biol, 215: 403 (1990) and the like can be used methods known in the art without being limited thereto.

In the present specification, “substantially the same activity as the polypeptide having the amino acid sequence represented by SEQ ID NO: 1” refers to various protein activities such as physiological activity, biological activity, and physicochemical activity. It means that the activity is substantially equivalent or homogeneous. Specific examples of such activity include, for example, a polypeptide having the amino acid sequence shown in SEQ ID NO: 1, that is, the same antigenicity as a splicing variant lacking exon 2 of FIR (an antibody that reacts with the splicing variant). As well as functions such as increased expression of c-myc gene, inhibition of apoptosis induction, cell proliferation and canceration.

[Aspects 3 and 4]

 The following SEQ ID NO: 2 is shown as a specific example of the base sequence (coding region) of a cDNA encoding a splicing noreant lacking exon 2 of FIR of the present invention.

 [0017] self-row number 2: 1542bp] atggcg acggcgacca tagctctc ggcac

agactccatc aagatggaga acgggcagag cacagccgcc aagctggggc tgcctcccct gacgcccgag cagcaggagg cccttcagaa ggccaagaag tacgccatgg agcagagcat

caagagtgtg ctggtgaagc agaccatcgc gcaccagcag cagcagctca ccaacctgca

gatggcggct cagcggcagc gggcgctggc catcatgtgc cgcgtctacg tgggctctat

ctactatgag ctgggggagg acaccatccg ccaggccttt gccccctttg gccccatcaa

gagcatcgac atgtcctggg actccgtcac catgaagcac aagggctttg ccttcgtgga

gtatgaggtc cccgaagctg cacagctggc cttggagcag atgaactcgg tgatgctggg

gggcaggaac atcaaggtgg gcagacccag caacataggg caggcccagc ccatcataga

ccagttggct gaggaggcac gggccttcaa ccgcatctac gtggcctctg tgcaccagga

cctctcagac gatgacatca agagcgtgtt tgaggccttt ggcaagatca agtcctgcac

actggcccgg gaccccacaa ctggcaagca caagggctac ggcttcattg agtacgagaa

ggcccagtcg tcccaagatg ctgtgtcttc catgaacctc tttgacctgg gtggccagta

cttgcgggtg ggcaaggctg tcacaccgcc catgccccta ctcacaccag ccacgcctgg

aggcctccca cctgccgctg ctgtggcagc tgctgcagcc actgccaaga tcacagctca

ggaagcagtg gccggagcag cggtgctggg taccctgggc acacctggac tggtgtcccc

agcactgacc ctggcccagc ccctgggcac tttgccccag gctgtcatgg ctgcccaggc

acctggagtc atcacaggtg tgaccccagc ccgtcctcct atcccggtca ccatcccctc

ggtgggagtg gtgaacccca tcctggccag ccctccaacg ctgggtctcc tggagcccaa

gaaggagaag gaagaagagg agctgtttcc cgagtcagag cggccagaga tgctgagcga

gcaggagcac atgagcatct cgggcagtag cgcccgacac atggtgatgc agaagctgct

ccgcaagcag gagtctacag tgatggttct gcgcaacatg gtggacccca aggacatcga

tgatgacctg gaaggggagg tgacagagga gtgtggcaag ttcggggccg tgaaccgcgt

catcatctac caagagaaac aaggcgagga ggaggatgca gaaatcattg tcaagatctt

tgtggagttt tccatagcct ctgagactca taaggccatc caggccctca atggccgctg

gtttgctggc cgcaaggtgg tggctgaagt gtacgaccag gagcgttttg ataacagtga

cctctctgcg tga An example of the base sequence encoding exon 2 (SEQ ID NO: 4: 87 bp) is as follows: AGTGGTGGCAGCGGGAGACAAATGGAAACCTCCACAG ₀

[0019] A DNA encoding the protein (or polypeptide) of the present invention can be easily prepared by those skilled in the art based on the description in the present specification and known techniques in the technical field. For example, RT-PCR using mRNA prepared from cancer tissue force as a template, and other NASBA (Nucleic acid sequence base amplification) methods and TMA (Transcription-mediated) for appropriate cDNA libraries. Amplification), SDA (Strand Displacement Amplification) and ICAN (isothermal and chimeric primer-initiated amplification of nucleic acids) methods, etc. It is possible. The human FIR gene containing the exon 2 part is registered under NCBI GenBank as registration number NM_014281. Therefore, the base sequence of a primer used for RT-PCR or the like can be appropriately designed and selected based on the registered base sequence and the information disclosed in Patent Document 1 or Patent Document 2.

 [0020] Based on site-directed mutagenesis known to those skilled in the art, it is also possible to prepare by introducing a base mutation into the DNA using a commercially available mutation system or the like. Furthermore, an oligonucleotide consisting of a part of such DNA obtained by treating with PCR or an appropriate restriction enzyme is also included in the above DNA.

[0021] In addition, the above DNA can be obtained by known methods (for example, Carruthers (1982) Cold Spring Harbor Symp. Quant. Biol. 47: 411—418; Adams (1983) J. Am. Chem. Soc. 105: 661 ; Belousov (19 97) Nucleic Acid Res. 25: 3440-3444; Frenkel (1995) Free Radic. Biol. Med. 19: 373—380; Blommers (1994) Biochemistry 33: 7886—7896; Narang (1979) Meth. Enzymol. 68: 90; Brown (1979) Meth. Enzymol. 68: 109; Beaucage (1981) Tetra. Lett. 22: 1859; US Pat. No. 4,458,066). It can also be synthesized in vitro. It can also be produced by a method such as cleaving the polynucleotide of the present invention with an appropriate restriction enzyme. In the present specification, “stringent conditions” are conditions that enable selective and detectable specific binding between the polynucleotide or oligonucleotide and genomic DNA. . Stringent conditions are defined by a suitable combination of salt concentration, organic solvent (eg, formamide), temperature, and other known conditions. That is, stringency increases by decreasing salt concentration, increasing organic solvent concentration, or increasing hybridization temperature. In addition, the washing conditions after the noisyization also affect the stringency. This wash condition is also defined by salt concentration and temperature, and the stringency of the wash increases with decreasing salt concentration and increasing temperature.

 Therefore, the “stringent condition” means the degree of homology between each base sequence, for example, about 80% or more, preferably about 90% or more, more preferably about 95% or more on average in the whole. This means that the hybrid is specifically formed only between the base sequences having high homology. Specifically, for example, the conditions include a sodium concentration of 150 to 900 mM, preferably 600 to 900 mM, and a pH of 6 to 8 at a temperature of 60 ° C to 68 ° C. Specific examples of stringent conditions include 5 X SSC (750 mM NaCl, 75 mM trisodium citrate), 1% SDS, 5 X Denhardt's solution 50% formaldehyde, and 42 ° C. The sample is washed and washed under the conditions of 0.1 X SSC (15 mM NaCl, 1.5 mM trisodium citrate), 0.1% SDS, and 55 ° C.

 [0024] Hybridization is described, for example, in Current Protocol in Molecular Biology (.edited by Frederick M. Ausubel et al, 1987). It can be carried out according to a method known in the art such as the method described, or a method analogous thereto, and when a commercially available library is used, it can be carried out according to the method described in the attached instruction manual.

[0025] Furthermore, the thus obtained DNA encoding the protein of the present invention is inserted into an appropriate recombination DNA such as a plasmid vector, a fuzzy vector, and various hybrid vectors, and the expression vector thus obtained is obtained. The protein of the present invention can be produced by transforming various cells using, and culturing the transformant under appropriate culture conditions. This recombination DNA should be handled using conventional recombinant DNA techniques known to those skilled in the art. Can be any vector.

 [0026] In the present invention, host cells transformed with a vector containing a DNA encoding a protein are not particularly limited, but human-derived cells such as HeLa, mammalian cells such as COS7 and CHO cells, insect cells, and yeasts In addition, various prokaryotic cells containing various bacteria such as E. coli and Bacillus subtilis can be used.

 [0027] Alternatively, the protein of the present invention can be produced using an appropriate in vitro translation system known to those skilled in the art, such as a rabbit reticulocyte lysate or a wheat germ extract.

 [0028] The protein of the present invention is produced as a fusion protein with any tag known to those skilled in the art such as HA tag, His tag, FLAG tag, and myc tag for convenience of purification operation and detection. It is also possible to make it live. Furthermore, for convenience of protein measurement and detection, it can also be produced as a fusion protein with enzymes such as GST and various fluorescent proteins.

 [0029] The above expression vectors include various promoters such as constitutive expression promoters or various inducible expression promoters known to those skilled in the art, depending on the expression system used, host cells, and the like. And various regulatory elements such as silencers, ribosome binding sites, signal sequences, replication origins, cloning sites, translation initiation sequences, partial positions of terminators, and poly A addition sites, as well as other foreign or endogenous proteins. It can appropriately contain genes to be encoded, various drug resistance genes, genes that complement auxotrophy, and the like.

 That is, according to any method known to those skilled in the art, DNA encoding the protein of the present invention can be appropriately selected depending on the host cell into which these vectors are to be introduced. As an example, in eukaryotic cell systems, vectors known to those skilled in the art such as pCGNM2 vector plasmid (6), pKAl, pCDM8, and pSVK3 can be mentioned. Such a vector can be introduced into a host cell to transiently express the protein of the present invention, or the entire or part of the host cell genome can be located in one or more places in the genome. Can be threaded. As such a vector, various commercially available vectors known to those skilled in the art can be used.

[0031] The transformant of the present invention can be obtained by using an appropriate DNA fragment itself containing a gene encoding the protein of the present invention obtained by PCR amplification or the like instead of the expression vector. Both are possible. In such a case, the composition can be used for transformation as a composition such as a solution optionally containing an appropriate buffer and other auxiliaries in addition to a strong DNA fragment.

 [0032] The expression vector (DNA for recombination) containing the DNA of the present invention or the DNA fragment itself, such as, for example, the method, elctroporation, Lipofectamine Plus reagents (Gibco BRL input [repulsive norme method, protoplast-PEG method, It can be introduced into a host cell by any known method such as Ti plasmid method, particle gun method, nanovirus method, etc. Further, a transformant can be prepared. It is also possible by the Yong method.

 [0033] A transformant that expresses the protein of the present invention can be produced by culturing the protein under conditions favorable for production of the protein, expressing the protein, and recovering the host cell and Z or medium power. The medium used for host cell culture is appropriately selected from any medium known to those skilled in the art, depending on the configuration of the expression vector used (type of promoter, etc.) and the type of host. be able to.

 [0034] The protein of the present invention produced by a host cell is used in an appropriate combination of any means known to those skilled in the art, for example, separation of a medium and cells by centrifugation or filtration, and an ammonium sulfate-like protein. It can be recovered from the medium by precipitation of the protein components of the medium with the appropriate salt and subsequent use of hydrophobic chromatography, ion exchange chromatography, affinity chromatography, or other chromatography. Alternatively, the protein of the present invention can be produced by a chemical synthesis method.

[0035] [Aspects 5-7]

 The DNA (oligonucleotide) containing a base sequence showing a gene polymorphism in the 4-base repeat sequence in intron 2 of the FIR gene of the present invention is, for example, 1 to 2100 (for example, about 2058), preferably 1 to: L It consists of a continuous base sequence of 100 (for example, about 1032), more preferably 1 to 600, and still more preferably 40 to 600 (for example, about 513). As an example of such DNA, a sequence contained in SEQ ID NO: 3 (genomic DNA containing exon 2 and intron 2 of the FIR gene) shown below can be mentioned.

[0036] Self-row number 3: 2486bp] Exon2

catcctctccctcagg [cccgcccgcctgcccgcccgcccgcccgcctgcctg] tgcgtccctgggcccagagagggc tggctgggggcggggcgggaggaacctcgggaacccttctctgcctctgggcagacaactgcccgcaggaccacggc cctctccccgcaccagccctgcaccctccccacccaggcactgagctggcctttgccctctgcatctgccctgctccaa gcaccaggcggggcctgttgacagtctggctgggcggggacgccggggcctggagctcgcgcgttcttaggcatgagc gtcttgcaggaagggtgggccaagcttcccagaactcgcagtgcttgaggagccagaaggacagatttcatttcagacc tctgtgttttcatttaaataaaacagtgaagcaatgcgcaagtcaaagcacaggtctggttgggactcagccctccccat cttttttcggccccaggctccagagtgggtgcaggtgggtcttggtctgttcgatggcccagccttgggagcaggtcctc tcagaggtggagctgggcctgtggctgggtagttgggttctttgtgcttctccatggtagcgcccgcctccagagcattc cagtggggcctcagcaaggtggcctggcagcctcttggggctgggccctcctcttggtcccccaggcacactcagggg gtgggactgggacatggtatgcagcttggatcctgggagatgtgggggctggtgctccctggcccttggctggcgccca gccggccattggttggtgggagaagggccttttgtttaccaagacaaagaggagattgaaaaatgtctgggggctgagg gggttggcattgattaccatggtgacagcctgctctcaagtcccagcctctggctcttgggccctctttcccactaagga ggaatgggcttggggccagctgtgagggtggtgaggacagg cctagtgtgagccggactggggcacctggtgctgagg gtggtgaggacaggcctagtgtgagccggactggggcacctggtgctgagggtggtgaagacaggcctagtgtgagcc ggactggggcacctggtgctgagggtgattaggacaggcctggtgtgagccggactggggcacctggtgccacccaca gccagcctttgaccttcagggactggttggggctctggttgcctggggaggggtctccagggcttcctgccctttgagcc tgggccagcatcccagcacttggcaggcaggagggggttcttggggcttgggccagcctgtcccttcctgcctcctgtg tccctctgtccttgctcatcacttctgtgctggggacccttctctcttctctgctgtccctcaaggctgtgtctggaagtct cggagggcccggttggtgggccagtgatctttgtgcttgctgagctggaggacaggcgcaggcatgctgtttgcccatc ccacactctgatgggcctgctagccatgcctccctgctcacacagctgcgttcttccctctgcaaaaagcttagagatgg attttgacaggagggacgtaaacataatcctggttggcatcagcttgggtctgcagtggctgtgactgcccaagggcctc ttggtccccaggcccacctggctagggtgccagtggggtctgctcctggcttctcccagtgggccaggcaaagcccatg caagagtgtgtggaagtgagctggagccctcttcagggcttgtgtggcccgagagaggcctgtgttctctgggaggtgt gcacagtgcctgcggggacggtggggggagcactgttgggagagaggcccttgtattagctccttgggtgggccccttg aaactccagggaagctgagcctgtgtctgtggcagggactgtgaggaagcctggaggagcctgggagcaaggagtccc agaacgtccagagagccgtggcccttttctcctgccttggaggacggctgaggctggctctcctgccgggcatgtgata gcagctctggggtcagactgacaacaaggggctggaccccttttctgcctccagctgtttatcttggtggttcccgagga ggccactgtggcctgggccccacaactgctcgggttggcccagggcctccagggcacctgcctgcctcagtctgtgttc taccccatgggtcccgggggagacagtggcctgggctggggacagcaatgtcagaagggctggcctgagtacaggcc aggcaggggacagtctgtgctaggggtggccctcctggggccacgtgaaggagaacttgagcttgctgctgatggattc ccctgctcccttaccag

[0037] In SEQ ID NO: 3, the first sequence shown in capital letters is exon 2 (87 bp), and the sequence shown in lower case following is the sequence of intron 2 (2399 bp). Furthermore, it is a sequence showing a gene polymorphism in a partial force base repeat (9 times) sequence surrounded by parentheses.

 [0038] In this 4-base repeat sequence, 9-, 6-, and 5-fold repeats are observed, and CCCG or CCTG can be given as a specific example of the base sequence of 4 base repeats. In addition, as shown in FIG. 8, these 4-base repeat sequences are sometimes homozygous or heterozygous in the number of repeats or the type of base sequence of the repeat unit.

 [0039] As shown in the following Examples, FIR is expressed not only in cancer tissues but also in normal tissues, whereas in some cases, splicing variants lacking exon 2 of FIR are observed. The protein of the present invention is expressed only in cancer tissue cells of cancer patients and not expressed in normal tissue cells or blood cells adjacent to the cancer tissue. Therefore, such a protein and its encoding cDNA or corresponding mRNA, or an oligonucleotide that partially relies on them, serve as a very specific cancer detection marker in cancer detection and diagnosis. It is a substance that has utility.

 [0040] Furthermore, in the cancer tissue, the proportion of 9 homo repeats (including hetero in the base sequence type of repeat units) in the 4-base repeat sequence in intron 2 of the FIR gene is compared with that in normal tissues. Therefore, the above DNA containing a nucleotide sequence showing such a gene polymorphism is also a useful substance as a cancer detection marker in cancer detection and diagnosis.

[0041] [Aspects 8 to 18] Therefore, the splicing variant protein or its fragment peptide lacking exon 2 of the above FIR, the cDNA encoding them or the mRNA corresponding thereto, or a partial oligonucleotide thereof, or in the intron 2 of the FIR gene Cancer can be detected or diagnosed significantly by measuring the presence of DNA (genomic DNA) consisting of a continuous base sequence containing a base sequence indicating a gene polymorphism in a 4-base repeat sequence. There are no particular restrictions on the type of cancer to be treated, but particularly cancer cancer typified by colorectal cancer is preferred.

 [0042] For example, cancer is detected by measuring the expression level of the above-mentioned splicing variant protein, mRNA (cDNA) or oligonucleotide in cancer thread and tissue, and using this as a normal tissue or normal person derived from the same cancer patient. This can be done by measuring the expression level in the tissues and comparing these values. Such measurement of the expression level can be quantitative, semi-quantitative, or qualitative depending on the principle of the measurement method. In particular, the splicing variant protein lacking exon 2 of the FIR of the present invention or the mRNA (cDNA) encoding the same is expressed specifically only in the cancer thread and tissue, so that cancer can be conveniently and highly sensitive (highly sensitive). (Specificity) can be detected.

 [0043] The expression level of the splicing variant protein can be measured by any method known to those skilled in the art. Examples include Western plotting using appropriate antibodies, immunostaining and methods using various immunological specific reactions such as EIA, amino acid sequence analysis of gas phase sequencer etc. peptides using Edman's method, Furthermore, it can be detected by mass spectrometry represented by MALDI-TOF / MS and ESI Q-TOFZMS methods.

 [0044] Among the above methods, a test method is preferred in which the expression level of the white matter is measured by an antigen antibody reaction with an antibody specific for FIR or a splicing variant thereof. Such antibodies include, for example, antibodies that recognize both FIR and a splicing variant lacking exon 2 of FIR as antigens. In addition, it is possible to measure multiple types of antibodies, such as antibodies specific to FIR exon 2 and antibodies specific to exon 5, and detect the expression of the resulting white matter. It is.

[0045] Therefore, the above-mentioned antibody is a splicing variant that lacks FIR or exon 2 of FIR. Or a suitable partial polypeptide (peptide fragment) thereof or various derivatives or complexes thereof as antigenic substances or immunogens, and can be prepared by an appropriate method known to those skilled in the art. . For example, in the case of a polyclonal antibody, it can be administered to an appropriate animal such as mouse, rat, rabbit, goat, or chicken, and its antiserum can be prepared. Alternatively, known methods described in monoclonal antibody production methods (“monoclonal antibodies”, Nagamune Kamei, Hiroshi Terada, Yodogawa Shoten, 1990; “Monoclonal Antibody” James W. Goding, third edition, Academic Press, 1996) It is also possible to prepare a monoclonal antibody by a method using cell fusion. For example, it can be prepared by the method described in Patent Document 1 or Patent Document 2.

[0046] Such an antibody is derived from a complete antibody such as Fab, F (ab '), Fv fragment, etc. by genetic engineering (DNA recombination technology) as long as the original antibody activity is not lost. Various

 2

 It may be a derivative, recombinant or fragment modified into various forms known to those skilled in the art, including derivatives. Such antibodies and the like include those labeled with various labeling substances known to those skilled in the art, such as enzymes, radioisotope fluorescent dyes, and metal atoms.

 [0047] As an antigen-antibody reaction with an anti-FIR antibody, for example, when measured by Western plotting, a splicing variant protein (513 amino acids) lacking FIR exon 2 and FIR (542 Amino acid) can be specifically detected by the difference in molecular weight.

 [0048] Furthermore, using an antibody that specifically reacts only with a splicing variant protein lacking exon 2 of FIR, for example, it can be measured by an enzyme immunoassay such as EIA.

[0049] A cDNA encoding a splicing noreant lacking exon 2 of such FIR or a corresponding mRNA, or a partial oligonucleotide thereof, or a 4-base repeat in intron 2 of the FIR gene Nucleic acid molecules containing DNA consisting of a contiguous base sequence that includes a base sequence that indicates a gene polymorphism in the sequence include various PCR methods such as RT-PCR and real-time quantitative PCR, and various microarray (DNA chip) methods. Can be amplified by methods known to those skilled in the art. [0050] For example, by using a primer set for amplifying a nucleic acid molecule containing cDNA or mRNA or an oligonucleotide that is a partial force thereof, a nucleic acid molecule containing each of the above DNAs is amplified by an RT-PCR method and electrophoresed The nucleic acid molecule can be detected and identified from the amount of the molecules measured in combination. In real-time quantitative PCR (intercalator method, TaqMan probe, cycling probe, etc.), the base sequence of mRNA corresponding to the splicing variant lacking FIR etason 2 (for example, FIR exon 1 and exon 3) Such a nucleic acid molecule is directly and quantitatively measured by using a primer that specifically amplifies a nucleic acid molecule containing only a contiguous nucleotide sequence encoding an oligonucleotide or a partial oligonucleotide thereof. It becomes possible. It is also possible to use a method (sequence method) for directly determining the base sequence of the amplified DNA.

 [0051] The base sequence of the primer used in the above RT-PCR and the like is based on the base sequence of FIR registered in GenBank as described above and the information disclosed in Patent Document 1 or Patent Document 2. You can choose 'design as appropriate'. In designing the primer, it is preferable to have a base number that allows specific binding to the cage, for example, 15-40 bases, more specifically, about 15-25 bases. Furthermore, it is also important to have a base sequence that does not have a hairpin structure in the primer or that the sense strand and the antisense strand are not annealed to each other. For example, commercially available primer design software such as 01igo ™ (National Bioscience Inc.) can be used.

 [0052] The measurement kit used in the detection method of the present invention can have an appropriate configuration depending on the measurement object or measurement principle. The kit includes, for example, an anti-FIR antibody, an antibody against a splicing noriant protein lacking exon 2 of FIR, various secondary antibodies (labeled antibodies), and the above-mentioned mRNA (cDNA) amplification. Probes for hybridization used in primers, DNA chips, etc. (for example, consisting of 10 to: about L00 continuous base sequences) can be included. Furthermore, the above kit contains other elements or components known to those skilled in the art, for example, various reagents, enzymes, buffers, reaction plates (containers), etc., depending on the configuration-purpose of use.

Example Hereinafter, the present invention will be described in detail by way of examples. However, the technical scope of the present invention is not construed as being limited by the description of the following examples. Also, unless otherwise stated, the following examples are for example Sambrook and Maniatis, in Molecular Cloning-A Laboratory Manual, Cold Spring Harbor Laboratory Press, New York, 1989; Ausu bel, FM et al., Current Protocols in Molecular Biology, John Wiley & Sons, New York, NY, 1995, etc. can be performed according to standard genetic engineering and molecular biological techniques known to those skilled in the art. In addition, the contents of the references cited in this specification constitute part of the disclosure of this specification.

 [0054] Human tissue specimen · mrnm · Healthy human peripheral blood mononuclear cells

 Cancer patients and non-cancerous tissues were collected from patients admitted to Chiba University Hospital for the treatment of primary colorectal cancer with written consent prior to surgery and stored at minus 80 ° C. Various human cancer cell lines were obtained from the Cellellology Collection (http://www.atcc.org/¾earcn and atalogs / ellBiology.c & i). Volunteers for healthy volunteers were collected with the consent of the healthy volunteers working at the Chiba University Medical Research Institute and the Chiba University Hospital.

[0055] Plasmid

 FIR (full-length FIR) cDNA obtained from cancer tissue and splicing variant cDNA (HA-FIR Δ exon2) lacking exon 2 of FIR were introduced into pCGNM2 vector plasmid (9) and hemagglutinin (HA ) HA-FIR and HA-FIR A exon2 with a tag attached to its N-terminus were expressed. The human c-Myc expression vector was a commercially available pcDNA3.1-c-myc, ueneStorm Expression—Ready Clones (Invitrogen, o., AL).

[0056] Immunohistochemical staining and flow cytometry analysis

HeLa cells were cultured on a cover glass, and the above-mentioned vector (150 ftnol) containing HA-FIR and HA-FIR Δexon2 gene was introduced using Lipofectamine Plus reagents (Gibco BRL) to examine the change in expression of c-Myc. The primary antibodies used were mouse monoclonal anti-HA antibody (Santa Cruz Biotechnology, CA and rabbit polyclonal anti-c-My c¾ri (Upstate Biotechnology, NY), diluted 500-fold and 1,000-fold, respectively. Secondary antibody rhodamine-conjugated Anti-m ouse IgG (Roche 8 fluorescein isothiocyanate (FIT) -one conjugated anti-rabbit IgG (Sigma) was used diluted 1,000-fold and 500-fold, respectively. Flow cytometry was used for gene transfer. Twenty-two hours later, HeLa cells were treated with trypsine and stained with FIR and c-Myc using the primary antibody described above. As secondary antibodies, FITC-conjugated anti-rabbit IgG (Sigma) and R-PE-conjugated anti-mouse IgG (PharMingen) were used at a 200-fold dilution (km). 10,000 cells were counted and c-Myc-FITC was detected in FL1 channel and HA-PE in FL2 channel. PE positive cells were displayed on the X axis.

 [0057] Detection of apoptosis

Potato ~ cis 7 detected by iiTUNEL assay (Apoptosis Detection system, Fluorescein n Promega, WI, USA). Two-color analysis was performed in 50 μ \ terminal deoxynucleotidyl transferase (TdT) buffer containing FITC-labeled dUTP (MEBSTAIN Ap optosis Kit: Medical & Biological Laboratories, JAPAN) _G Finally 250 μ g of DNase -Cells were mixed with 0.5 ml propidium iodide (PI) solution (freshly diluted to 5 ^ g / ml in PBS) containing fr ee RNase A. 10,000 cells were counted and FITC corresponded to FL1 and PI corresponded to FL2. Apoptotic cells were shown as FITC-positive cells shown on the Y axis. Furthermore, the fragmentation of caspase 9 was examined by Western blotting for mouse monoclonal anti-caspase 9 (Upstate biotechnology, NY).

 [0058] Egret of white birch Western method

Extraction of protein from frozen tissue is lysis buffer (7M urea, 2M thiourea, 2% 3-[(3-Chola midopropyl) dimethylammonio—] 1—propanesulfate (CHAPS), 0.1 M Dithiothreitol (D TT), 2% IPG buffer (Amersham Phrmacia Biothech, Backinghampsnire, UK), 40 mM Tris) Dissolve 500 mg of frozen yarn and weave using Polytron homogenizer (Kinematica, Switzerland) and centrifuge at 100,000 xg for 1 hour at 4 ° C. The supernatant was used. The primary antibodies used for Western blotting are the rabbit anti-FIR antibody (5) and the goat polyclonal anti-13-actin antibody (Santa Cruz, Santa Cruz, CA), which are used at 1,000 and 500 times, respectively. 7 Secondary antibody is 3,000 times diluted with horseradish IgG horseradish peroxidase conjugate (HRP) (Jackson, west Grove, PA), and 500 fold diluted with rabbit horseradish IgG HRP (Cappel, West Chester, PA). used. Antigen was detected with ECL ™ detection reagents (Amersham Pharmacia Biothech) and expression levels were quantified by NIH Image. Polyclonal anti-FIR antibody has two synthetic peptides (C (correction) DKWKPPQGTDSIKME (a Minoic acid 30-45) and C (additional caro) EVYDQERFDNSDLSA (amino acids 528-542)) were immunized simultaneously.

 [0059] Reverse transcriptase RT— P and R and Real— time quantitative P and R

Total RNA and genomic DNA were extracted from cancerous and non-cancerous parts using RNeasy ™ Mini Kit and DNeasy ™ Tis sues Kit (Qiagen). cDNA was synthesized from total RNA using the 1 ^st strand cDNA Synthesis Kit (Roche, Mannheim, Germany). FIR cDNA was amplified by RT-PCR using the prepared cDNA. The primers used were: forward 5,-GGCCCCATC AAGAGCATC -3 '(SEQ ID NO: 5), reverse 5,-GGGGCTGGGCCAGGGTCAG -3' (SEQ ID NO: 6). GAPDH cDNA was used as a control.

 At the same time, FIR cDNA amplified by ReaH: ime quantitative PCR was accurately quantified with LightCycler ™ (Roche, Mannheim, Germany). We asked Gene research laboratories Inc (Sendai, Japan) to evaluate the optimal primer conditions. PIR for amplification of FIR cDNA ~~ [MA (PCR product size is 275 base pairs): forward 5, — G and ACCTGGAGTC ATCACA-3, (SEQ ID NO: 7), reverse 5, -CGCAGAACCATCACTGTAG-3 '(SEQ ID NO: 8) was used. Primers for human c-myc cDNA and human j8-actin cDNA are: forward 5,-GCCTCAGAGTGCATCGAC-3, (SEQ ID NO: 9), reverse 5, -TCCACA GAAACAACATCG-3 '(SEQ ID NO: 10) (c-myc), forward 5 '-TGGAGAAAATCTGG CACCAC-3' (SEQ ID NO: 11), reverse 5, -AATGGTGATGACCTGGCCGT-3, (SEQ ID NO: 12) (β-actin) were used.

 [0060] Detection of repetitive sequence of FIR intron 2

 The following primer set was used for detecting the repeated sequence of FIR intron 2.

 1F: 5 '-ATCTCCTTCCTGCCTGCAGCAGGT-3' (SEQ ID NO: 13)

 R04: 5 '-AAGCCCATTCCTCCTTA-3' (SEQ ID NO: 14)

 R05: 5 '-TTTGACTTGCGCATTGC-3' (SEQ ID NO: 15)

First, PCR was performed using the IF-R04 primer set, and 2nd PCR was performed using the 1F-R05 primer set. This PCR product was directly subjected to DNA sequencing according to a conventional method. PCR conditions are 95 ° C; 5 min, [95 ° C; 30 sec-56 ° C; 30 sec-72 ° C; 1 min] x35 cycles, 72. C; performed at 2 min. DNA polymerase is Pfo DNA polymerase (Stratagene, La Jolla, CA) used. For the DNA sequence, an IF primer was used.

[0061] Result (1):

 We found that a mutant FIR (FIR Δ exon2) lacking exon 2, which is a transcriptional repression site, was specifically expressed in cancer tissues (Figs. 1 and 2). Interestingly, this mutant FI R (FIR Δ exon2) has not been shown to suppress endogenous c-Myc protein expression (Figure 3A), but conversely, has been shown to enhance endogenous c-Myc protein expression. (Fig. 3B, C). It was also confirmed that FIR A exon2 was unable to induce apoptosis (Fig. 4A, B). Furthermore, co-expression of FIR and FIR A exon2 not only suppressed the expression of c-Myc protein, but also found that FIR apoptosis-inducing activity was inhibited (FIGS. 3D and 4B).

 As a result, in cancer, FIR Δexon2 lacking exon 2 which is a transcriptional repression site is specifically expressed, so that transcriptional repression of c-myc gene does not work, resulting in increased expression, inhibition of apoptosis induction, cell It was thought that this would lead to proliferation and canceration! /, So why not! / (Figure 5).

[0062] Yui (2):

 In the process of analyzing the expression mechanism of the FIR splicing variant, we examined the intron around the exon that caused splicing, and as described above, there was a 4-base repetitive sequence (MSI / SSR). There was a great deal of diversity (number of repeats, difference in base sequence) (Fig. 6).

 The repetitive sequences in intron 2 of the FIR gene were significantly different in the number of repeats between genomic DNA derived from peripheral blood mononuclear suddenly in healthy subjects and genomic DNA derived from colon cancer tissue (FIGS. 7 and 8). That is, the proportion of cancer patients with 9 repeat sequences (homo) was significantly higher in cancer patients than in healthy individuals.

 From this result, it is considered that cancer detection can be diagnosed by examining the number of repetitive sequences present in intron 2 of the FIR gene.

[0063] [Cited document]

1. Avigan, M., ι ·, Strober, Β ·, and Levens, D. A far upstream element stimulates c— myc expression in differentiated leukemia cells. J. Biol. Chem., 265: 18538—18545, 1 990. 2. Bazar, L., Meighen, D., Harris, V., Duncan, R., Levens, D., and Avigan, M. Tar geted melting and binding of a DNA regulatory element by a transactivator of c—myc • J. Biol. Chem., 270: 8241-8248, 1995.

 3. Duncan, R., Bazar, L., Michelotti, G., Tomonaga, Τ ·, Krutzsch, Η ·, Avigan, M., and Levens, D. A sequence-specific, single-strand binding protein activates the far upstream element of c— myc and defines a new DNA— binding motif. Genes Dev., 8: 4 65-480, 1994.

 4. Michelotti, GA, Michelotti, EF, Pullner, A., Duncan, RC, Eick, D., and Le vens, D. Multiple single— stranaed cis elements are associated with activated chroma tin of the human c one myc gene in vivo. Mol. Cell. Biol., 16: 2656-2669, 1996.

 5. Liu, J., He, L., Collins, I., Ge, Η, Libutti, D., Li, J., Egly, J., and Levens, D. The FBP Interacting repressor targets TFIIH to inhibit activated transcription. Mol. Cell, 5: 331-341, 2000.

 6. Liu, J., Akoulitchev, S., Weber, A., Ge, Η, Chuikov, S., Libutti, D., Wang, XW, Conaway, JW, Harris, CC, Conaway, RC, Reinberg, D., and Levens, D. Defective interplay of activators and repressors with TFIIH in xeroderma pigmentos um. Cell, 104: 353—363, 2001.

 7. Tomonaga, Tsuji, and Levens, D. Heterogeneous nuclear ribonucleoprotein K is a D NA-binding transactivator. J. Biol. Chem., 270: 4875-4881, 1995.

 8. Pelengaris, S., Khan, M., and Evan, G. I. Suppression of Myc— induced apoptosis in beta cells exposes multiple oncogenic properties of Myc and triggers carcinogenic progression. Cell, 109: 321—334, 2002.

 9. Leveillard, Τ ·, Andera, L., Bissonnette, Ν ·, Schaeffer, L., Bracco, L., Egly, JM, and Wasylyk, B. Functional interactions between p53 and the TFIIH complex are affected by tumor asiciated mutations EMBO J., 15: 1615-1624, 1996.

10. Robles, AI, Wang, XW, Harris, CC Drug-induced apoptosis is delayed a nd reduced in XPD lymphoblastoid cell lines: possible role of TFIIH in p53— mediated apoptotic cell death. Oncogene, 18: 4681-4688, 1999. 11. Bazan, V., Migliavacca, M., Tubiolo, C, et al. Have p53 gene mutations and protein expression a different biological significance in colorectal cancer? J. Cell Phy siol, 191: 237-246, 2002. Availability on

[0064] The present invention provides a more effective and reliable detection 'diagnosis' treatment of cancer, particularly digestive organ cancer represented by colorectal cancer, as well as development of cancer gene diagnosis system and gene therapy clinical research system. Various biomolecules used in the field are provided.

[0065] Furthermore, the splicing variant of c-myc gene transcription repressor FIR represses its expression.

• It can be used in screening methods for substances that can be reduced, and such substances are thought to have the effect of inducing apoptosis and suppressing and inhibiting cancer.

Claims

Claims [1] c—A protein that is a splicing variant in which exon 2 of FIR (FBP Interacting Repressor), which is a transcription repressor of the myc gene, is deleted. [2] Protein having the following amino acid sequence:

 (1) a protein comprising the amino acid sequence shown in SEQ ID NO: 1, or

 (2) In the amino acid sequence shown in SEQ ID NO: 1, the amino acid sequence in which one or several amino acids are deleted, substituted or added, or homology with the amino acid sequence shown in SEQ ID NO: 1 is 95% or more And a protein having substantially the same activity as a polypeptide having the amino acid sequence shown in SEQ ID NO: 1.

 [3] cDNA encoding the protein according to claim 1 or 2, or mRNA corresponding thereto.

[4] cDNA consisting of the following base sequence or mRNA corresponding thereto:

 (1) the base sequence shown in SEQ ID NO: 2, or

 (2) A base sequence that hybridizes under stringent conditions with DNA complementary to the base sequence shown in SEQ ID NO: 2 and encodes the protein according to claim 1 or 2.

 [5] DNA consisting of a continuous base sequence including a base sequence indicating a gene polymorphism in the 4-base repeat sequence in intron 2 of the FIR gene.

[6] The claim including the 9-repeat sequence of 4 bases found in the 118th to 153rd base sequences of SEQ ID NO: 3, or the 5 or 6 repeat sequences of the 4 bases in the region 5. DNA according to 5.

 [7] The DNA according to claim 6, wherein the base sequence of the 4-base repeat is CCCG or CCTG.

 [8] The protein according to claim 1 or 2, or a fragment peptide thereof, the cDNA according to claim 3 or 4, mRNA corresponding thereto, or an oligonucleotide comprising a part thereof, or claims 5-7 A method for detecting cancer, comprising measuring the presence of DNA comprising a continuous base sequence comprising the 4-base repeat sequence according to claim 1.

 [9] The detection method according to claim 8, wherein an antigen-antibody reaction with an antibody specific for FIR or a splicing variant thereof is used.

10. The detection method according to claim 9, wherein the measurement is performed by a Western plot method.

[11] The detection method according to claim 8, wherein PCR is performed using a primer set for amplifying a nucleic acid molecule comprising the cDNA or mRNA according to claim 3 or 4, or an oligonucleotide which is a partial force thereof.

 [12] The detection method according to claim 11, which is RT—PCR.

 [13] The detection method according to claim 11, which is real-time quantitative PCR.

 [14] The detection method according to claim 8, which utilizes PCR using a set of primers for amplifying a nucleic acid molecule containing the DNA according to any one of claims 5 to 7.

[15] The detection method according to any one of claims 8 to 14, wherein the cancer is a cancer of the extinguisher.

[16] The detection method according to any one of [8] to [14], wherein the cancer is colorectal cancer.

[17] A measurement kit used for the detection method according to any one of claims 8 to 14.

[18] The measurement kit according to claim 17, comprising an antibody specific for FIR or a splicing variant thereof, or a primer set for amplifying the nucleic acid molecule according to any one of claims 3 to 7 as elements. .