WO1998006871A1 - Materials and methods relating to the diagnosis and prophylactic and therapeutic treatment of papillary renal cell carcinoma - Google Patents

Abstract

The present invention relates to materials and methods for the diagnosis, prophylactic and therapeutic treatment of papillary renal cell carcinoma. It has been found that the t(X;1) translocation found in papillary renal cell carcinoma results in the fusion of the TFE3 transcription factor gene to various other fusion partners. Therefore, the present invention allows the identification of a characteristic fusion product comprising a TFE3 sequence associated with a fusion partner.

Description

Materials and Methods Relating to the Diagnosis and Prophylactic and Therapeutic Treatment of Papillary Renal Cell Carcinoma

The present invention concerns materials and methods relating to the diagnosis and treatment (prophylactic and therapeutic) of papillary renal cell carcinomas. In particular, the present invention relates to diagnostic, prophylactic and therapeutic materials and methods based upon polynucleotides and polypeptides which are characteristic of papillary renal cell carcinoma and specific binding members therefor. In particular, the present invention relates to diagnostic materials and methods relating to the use of amplification techniques such as the polymerase chain reaction (PCR) to identify certain polynucleotide sequences characteristic of papillary renal cell carcinoma (RCC) .

RCC can be divided into papillary cell, clear cell, granular cell and sarcomatoid subgroups based on histological appearance (Murphy et al , Atlas of tumour pathology, Vol 11, 1994; Savage, Curr. Opin. Oncol. 6, 301-307, 1994) . For the clear cell, granular cell and sarcomatoid tumours loss or inactivation of the von Hippel-Lindau (VHL) suppressor gene on chromosome arm 3p has been implicated in tumour development (Gnarra et al, Nature Genet. 7, 85-90, 1994; Herman et al , Proc . Nat. Acad. Sci. 91, 9700-9704, 1994) . By comparison capillary renal cell tumours, which count for around 15- 20% of renal carcinomas (Murphy et al, Vol 11, 1994) , do not exhibit mutation of the VHL suppressor gene or loss of 3p (Gnarra et al, Nature Genet. 7, 85-90, 1994). Recurrent numerical abnormalities of other chromosomes have been identified in capillary tumours including tetrasoney 7, tetrasoney 10, 12, 16, 17 and 20 and loss of the Y chromosome (Mitelman, Catalog of Chromosome Aberrations in Cancer 5th ed, Wiley-Liss, New York, 1994; Kovacs et al , Int. J. Cancer. 40, 171-178, 1987; Kovacs et al , Genes Chrom. Cancer, 3, 249-255, 1991; van den Berg et al, Int. J. Oncol. 55, 223-237, 1993). However, there is evidence that some of these alterations may also be present in the surrounding normal tissue and thus are not tumour specific (Elfvmg et al, Cytogenet. Cell Genet. 69, 90-96, 1995) .

Abnormalities of Xp 11.2 region have frequently been observed in papillary RCC. A specific and recurrent translocation between chromosome X and 1, t(X;l) (pll .2 ;q21.2) , has frequently been found (de Jong et al, Cancer Genet. Cytogenet. 21, 165-169, 1986; Meloni et al , Cancer Genet. Cytogenet. 65, 1-6, 1993; Shipley et al, Cytogenet. Cell Genet. 71, 280-284, 1995; Tonk et al , Cancer Genet. Cytogenet. 81, 72-75, 1995) . The TFE3 gene, which encodes a member of the helix-loop-helix family of transcription factors (Beckman et al , Genes Dev. 4, 167-179, 1990) has recently been mapped adjacent to the position of the t(X;l) breakpoint (Shipley et al , Cytogenet. Cell Genet. 71, 280-284, 1995) .

The diagnosis of renal carcinomas is currently based upon histological appearance and immunohistochemical staining. Since treatment of renal carcinomas may depend on their type, it is important to have an accurate means of diagnosis. As a way to providing this, the applicants have studied the disruption of the TFE3 gene in papillary RCCs carrying the t(X,-l) translocation.

The present invention provides materials and methods both for establishing the presence or absence of characteristics specifically associated with papillary renal cell carcinoma (eg the t(X;l) translocation) as a way of diagnosing papillary renal cell carcinoma and for the prophylactic and therapeutic treatment of papillary renal cell carcinoma. The present applicants have found that the t(X;l) (pll .2;q21.2) translocation found in papillary RCC results in the fusion of a novel chromosome 1 gene designated herein papillary renal cell c_arcinoma (PRCC) at lq21.2 to the TFE3 transcription factor gene at

Xpll.2. The translocation has the effect of creating a new polypeptide sequence which codes for a new fusion polypeptide/protein (which is coded for jointly by the two unrelated sequences brought together as a consequence of the translocation) which is absent from normal individuals in whom the translocation event has not occurred. The translocation is predicated to result in the fusion of the N-terminal region of the PRCC protein, which includes a proline-rich domain, to the entire TFE3 protein. Notably, the generation of the chimaeric PRCC- TFE3 gene has appeared in some instances to be accompanied by complete loss of normal TFE3 transcripts.

Further, the present applicants have found a second and a third fusion partner for TFE3 within papillary RCC. The second fusion protein is the result of a translocation at inv(X) (pll.2,-ql3-24) . In certain cell lines this translocation is at inv(X) (pll .2 ;ql2) . The partner gene is called NonO (also known as p54^nr) and has been previously characterised (Human NonO-Accession No. U02493 and 114599; Mouse NonO-Yang et al , Mol . Cell. Biol . , 13, 5593-5603, 1993). The characteristics of the fusion are very similar to those mentioned above for PRCC and TFE3 with the exception that the fusion position within TFE3 is slightly different.

The third fusion protein is the result of a translocation at t(X;l) (pll.2,-p34). The partner gene is the human PSF splicing factor gene (Patton et al Genes Dev. 7, 393-406, 1993) . Broadly, the present invention provides a method of diagnosing papillary renal cell carcinoma by identifying a characteristic fusion product comprising a TFE3 sequence associated with a fusion partner. The fusion product may be a polynucleotide sequence. In which case it may comprise a fusion of the TFE3 gene and a different nucleotide sequence. The fusion product may be a polypeptide (generally termed "fusion protein" herein) which is the result of such a polynucleotide being translated.

Further, the present applicants propose that these fusion products appear to define a completely novel class of renal cancer that is distinct from classic papillary renal cancer and from childhood Wilm's tumour. The major supporting evidence for this is that the majority of cancer cases with the TFE3 abnormality are from humans, having an average age of approximately 25 years old. This compares to 50-70 years old as the typical age for developing classic papillary renal cancer. Therefore, the present invention further provides the possibility of defining a group of tumours that behave differently in terms of prognosis/response to treatment that other kidney cancers. Further, the TFE3 fusions may be useful targets for new therapies.

It will be appreciated that there will be many variations in the fusion products characteristic of papillary renal cell carcinoma. At one level there is be variability in the fusion partners associated with TFE3. The present applicants have identified three possible fusion partners namely PRCC, NonO and PSF, but the invention is not limited to these. At a second level, there is a variability within each fusion partner association. This may be due to variations in the breakpoint position or in the arrangement of the fusion partner with TFE3. For example, more than one fusion products have been found by the present applicants for the fusion between PRCC and TFE3. Fig 5 shows two possible positions of fusions with the PRCC protein.

Thus the present invention provides the diagnosis of papillary renal cell carcinoma by use of specific binding members such as (a) nucleic acids hybridizable with a nucleic acid comprising either TFE3 , or its fusion partner polynucleotide sequence; (b) a nucleic acid which hybridizes to both TFE3 and fusion partner originating portions of a new polynucleotide sequence resulting from a translocation event; (c) substances comprising an antibody binding domain with specificity for (i) one or more epitopes or sequences characteristic of TFE3 or its fusion partner or (ii) the fusion protein and not of the TFE3 , or its fusion partner polypeptides .

Where the specific binding member comprises nucleic acid, the member may simply be used as a specific probe in accordance with standard techniques and procedures. For example, a nucleic acid binding member, complimentary to a nucleotide sequence comprising TFE3 , or its fusion partner can be used to identify a specific nucleotide species characteristic of the fusion product on a Northern or Southern blot. Likewise, where the binding member is an antibody binding domain specific for TFE3 , or its fusion partner, it may be used to identify the fusion product, as distinct from normal products of TFE3 , and its fusion partner respectively, on a western blot. Thus, in these examples the binding members for TFE3 or its fusion partner (whether comprising nucleic acid or an antibody binding domain) are being used to identify a fusion product of the expected size.

Alternatively, the specific binding member may comprise a pair of oligo- or polynucleotide sequences for use in an amplification technique such as PCR. Further, if a new fusion protein resulting from a translocation event is detected as being "foreign" (ie other than native) by the body, there is the likelihood that the body will mount an immune response against it, generating antibodies with specificity for one or more epitopes of the new fusion protein.

Thus the present invention provides the diagnosis of papillary RCC by use of a specific binding member comprising one or more epitopes or sequences characteristic of a new polypeptide sequence of a fusion protein and not of the TFE3 , or its fusion partner polypeptides, in a specific binding assay to detect the presence or absence of such antibodies in a suitable sample obtained from an individual .

A specific binding member (sbm) has specificity for a particular binding partner (bp) . Together they comprise what may be termed a specific binding pair (sbp) which normal conditions bind to each other in preference to binding to other molecules. Examples of specific binding pairs are antigens and antibodies, hormones and receptors and complementary nucleotide sequences. The skilled person will be able to think of many other examples and they do not need to be listed here. Further, the term "specific binding pair" is also applicable where either or both of the specific binding member and binding partner comprise just the binding part of a larger molecule. Thus in the context of antibodies, a specific binding member may comprise just a domain of an antibody (antibody binding domain) which is able to bind to either an epitope of an antigen or a short sequence which although unique to or characteristic of an antigen, is unable to stimulate an antibody response except when conjugated to a carrier protein. The present invention provides a binding member which is either: (i) specific for a new polynucleotide sequence resulting from a translocation event which is characteristic of papillary RCC (preferably, where the specific binding member is for only part of the new polynucleotide sequence, it should be specific for a part which is characteristic of the new sequence and not of TFE3 or its fusion partner) ; (ii) specific for a new polypeptide sequence of a fusion protein resulting from a translocation event which is characteristic of papillary RCC (preferably, where the specific binding member is for only part of the new polypeptide, it should be specific for a part which is characteristic of the new polypeptide and not of the constitutive polypeptides TFE3 or its fusion partner) ; and (iii) specific for an antibody for either a new fusion protein produced by the patient as a result of a translocation event which is characteristic of papillary RCC.

The binding member specific for a new polynucleotide sequence resulting from a translocation event may be DNA or RNA and may be used in any standard technique for detecting the new polynucleotide sequence, for example RNAse protection assay. Further, a binding partner directed to TFE3 may be used to determine a loss in native TFE3 in a sample under test which may be indicative of the presence of a fusion product.

In particular, the present invention provides oligonucleotide primer pairs for amplification of a polynucleotide sequence which comprises a sequence portion spanning the breakpoint (which spanning polynucleotide sequence may comprise part or all of the new polynucleotide sequence created by the translocation event) . In which case, the oligonucleotide primer pairs are designed to hybridize target regions of the new polynucleotide sequence, which are spaced apart from one another with the breakpoint locating between them.

The primer pairs may be designed by use of the sequence information herein provided. Having increased the copy number of a new polynucleotide sequence (or part of it spanning the breakpoint) , the amplified sequences may be readily detected by standard methods such as the provision of radioactive nucleotides for inclusion in the sequences being copied, ethidium bromide staining, sequencing and hybridization probing. Of course, no amplification would occur if polynucleotide sequence comprising targets for the primers is absent from the sample selected for testing.

Where primers designed to amplify a sequence portion which is characteristic of a new polynucleotide sequence created by a translocation event are used (eg a portion of sequence around the breakpoint) , any amplification would be indicative of papillary RCC, whereas no amplification would be indicative of the absence of papillary RCC.

Thus the present invention provides a method for diagnosing papillary RCC by taking a suitable sample from a patient, for example, a tumour sample, or samples such as blood or urine that may contain tumour cells, and detecting the presence or absence of a new polynucleotide sequence resulting from a translocation event which is characteristic of Papillary RCC by adding to the sample suitable oligonucleotide primer pairs (see above) , and other standard ingredients for carrying out a polynucleotide sequence amplification (an amplification based on a DNA template or an RNA template) , and applying standard hybridization, elongation and denaturation or strand separation conditions to amplify any new polynucleotide sequence positioned between the two primers and looking for the presence or absence of an amplification product or products, to determine the presence or absence of the TFE3 translocation products.

The primers may be designed from the polynucleotide sequences for TFE3 , its fusion partner or a new polynucleotide sequence created by a translocation event (eg as now provided by the applicants) .

It may be helpful, but not essential, to know the distance between the two primers, as this will aid m the analysis of the amplification product. The length of the primers should be such that they efficiently hybridize with good specificity. Typically the primers may be upwards of about 14 nucleotides. Generally, the primers may be 18-20 nucleotides.

It is not necessary to have 100% correspondence between the primers and their target region in the TFE3 or PRCC polynucleotide sequence or m the new polynucleotide sequence. The primers may comprise one or more non- complementary bases. All that is necessary is that the primer and target sufficiently correspond for specific hybridization to allow the desired amplification reaction to proceed.

The present invention also provides nucleic acid which comprises an oligo- or polynucleotide sequence hybridizable to either: (i) a polynucleotide sequence which codes for part or all of either the TFE3 ammo acid sequence as shown m Fig. 5b (accession number for 5 ' RACE TFE3- X96717) or the PRCC am o acid sequence as shown in Fig. 5a (accession number X97124)or (ii) a polynucleotide sequence which codes for part or all of a polypeptide having part or all of the am o acid sequence of Fig. 2a, Fig. 2b, Fig. 3a, Fig. 3b, Fig. 4a, Fig. 4b. Preferably the oligo- or polynucleotide sequence is hybridizable to a polynucleotide sequence at a portion spanning the translocation.

Generally speaking it is intended that alleles and derivatives (by deletion, insertion, substitution or inversion) of the polynucleotide sequences given in the Figures are included within the scope of the present invention, in that such alleles or derivatives will code for at least part of the given amino acid sequences.

The present invention also provides a nucleic acid which comprises an oligo- or polynucleotide which comprises part or all of a polynucleotide sequence as shown in either Fig. 2a, Fig. 2b, Fig. 3a, Fig. 3b, Fig. 4a, Fig. 4b or a sequence complementary thereto. The oligo- or polynucleotide may comprise a portion spanning the translocation.

The nucleic acid, oligo- or polynucleotide may be substantially free of other substances le isolated and substantially pure.

The present invention also provides recombinant transfer vectors and expression vectors which contain a nucleic acid or oligo- or polynucleotide as described above. The nucleotide sequences may be present in association with suitable control sequences such as promoters. The present invention also provides recombinant host cells which comprise such a transfer vector or expression vector. The recombinant host cells may be used to prepare polypeptides homologous to the polypeptides coded for by the PRCC or TFE3 polynucleotide sequences, or to part or all of a fusion protein coded for by a new polynucleotide sequence created by the translocation as explained above . Polypeptide homologues may be used in diagnostic tests to test patient samples for the presence or absence of antibodies with specificity for one or more epitopes characteristic of the new fusion proteins (see earlier discussion) .

Polypeptide homologues may also be used to raise antibodies (monoclonal or polyclonal) with specificity for one or more sequences or epitopes characteristic of the fusion proteins.

As mentioned earlier, polynucleotides as described above may be used as specific hybridization probes to determine the presence or absence in samples from patients of a new polynucleotide sequence resulting from a translocation. The probe preferably binds to a part of the new polynucleotide sequence which comprises nucleotides to either side of the breakpoint, in which case the probe would bind to sequences deriving from both TFE3 and its fusion partner. Probes may be directed to DNA or RNA complementary thereto. The probes maybe either cDNA probes, RNA probes or oligonucleotides.

The probes may be suitably labelled in accordance with standard procedures to aid detection of hybridization. Commonly the labels maybe radio-, fluoro or enzyme- labels .

Hybridization may be carried out in accordance with well known methodologies. The use of high stringency conditions will serve to minimise non-specific binding and the occurrence of false positives.

The present invention also provides a polypeptide having (i) part or all of the PRCC amino acid sequence shown in Fig. 5a; or (ii) part or all of the TFE3 amino acid sequence shown in Fig. 5b, particularly part or all of the ammo acid sequence upstream of amino acid residue 211; or (in) a polypeptide which has part or all of the ammo acid sequence shown in Fig. 2a, Fig. 2b, Fig. 3a, Fig. 3b, Fig. 4a or Fig. 4b.

The polypeptide may comprise the translocation portion.

The polypeptides may be immunologically cross-reactive with a native PSF, NonO, PRCC or TFE3 or with a fusion protein such as PRCC-TFE3, NonO-TFE3, TFE3-NonO, TFE3 - PSF, PSF-TFE3, respectively. They may be immunologically cross-reactive with a polypeptide having an ammo acid sequence as shown in either Fig. 2a, Fig. 2b, Fig 3a, Fig 3b, Fig. 4a, Fig. 4b. The polypeptide may comprise any part of the PRCC polypeptide, TFE3 polypeptide or NonO polypeptide which polypeptides are characterised by the sequences of Fig. 5a, Fig. 5b or Fig 9 respectively.

The polypeptides may be substantially free of other substances le isolated and substantially pure.

Derivative polypeptides retaining the cross-reactivity are also provided. The polypeptides above may be prepared by recombinant methodologies or by methods of standard chemical synthesis.

As stated above, the polypeptides may be used m diagnostic assays, or to raise antibodies.

The present invention also provides specific binding members comprising an antibody binding domain with specificity for one or more epitopes characteristic of the new fusion protein and not of the TFE3 protein or its fusion partner. The specific binding members may comprise antibodies, either monoclonal or polyclonal. Alternatively they may comprise derivatives, synthetic analogues or fragments of such antibodies which retain an antibody binding domain with the specificity described above .

In practice, diagnostic methods utilising specific binding methods comprising an antibody binding domain (see above) may be particularly favoured (perhaps for reasons of simplicity, cost and effectiveness) . The applicants' provision of the sequences herein, allows one of ordinary skill in the art to make monoclonal and polyclonal antibodies which specificity for the desired polypeptide/protein by the utilisation of standard procedures well known in the art. Of course having once produced an antibody, they may be altered to produce antibody derivatives, fragments or functional equivalents (with respect to specificity) which whilst differing from the original antibody, retain an antibody binding domain of required specificity. The term "specific binding members comprising an antibody binding domain" as used herein hence covers both monoclonal and polyclonal antibodies as well as fragments, derivatives and functional equivalents thereof.

The present invention also provides methods of diagnosing papillary RCC by detecting the presence or absence of the new fusion protein, or the new nucleotide sequence by use of a specific binding member as described above.

Diagnostic kits are also provided for each of the above mentioned embodiments which comprise a specific binding member as described above, along with other reagents required to conduct the diagnostic test.

The cytogenetically defined translocation t(X;l) (pll .2 ;q21.2) found in human papillary RCC involves the joining of the chromosome PRCC gene at lq21.2 to the TFE3 gene at Xpll.2. The fusion genes are then transcribed to produce PRCC-TFE3 hybrid transcript that is in turn translated to form PRCC-TFE3 fusion proteins. Antisense oligonucleotides can be used against native PRCC and TFE3 sequences as a therapeutic treatment. Alternatively the PRCC-TFE3 sequences or junctions can be targeted with antisense oligonucleotides.

The fusion product resulting from the combination of TFE3 and NonO is formed by an inversion of the X chromosome. The fusion results in two reciprocal products. Firstly, 5' NonO joined to 3' TFE3 creates a NonO-TFE3 fusion protein and secondly 3' TFE3 joined to 5' NonO creates a TFE3-NonO fusion protein.

The fusion product resulting from the combination of TFE3 and PSF is formed by the fusion of the splicing factor gene PSF located at Ip34 to the TFE3 helix- loop-helix transcription factor gene at Xpll.2.

Thus antisense RNA technology can be applied to prevent or inhibit mRNA expression of a sequence characteristically associated with papillary RCC.

Hence a further aspect the invention provides a polynucleotide sequence that can be transcribed to produce RNA that is at least in part complementary to a TFE3- fusion partner mRNA and wherein the complementary portion of said transcribed RNA is of sufficient length to inhibit translation of said mRNA in order to inhibit production of a polypeptide encoded by a TFE3- fusion partner polynucleotide sequence.

Suitably the complementary (or "antisense") RNA is homologous with, or complementary to, at least a portion of the nucleic acid shown in either Figure 2a, Fig 2b Fig. 3a or Fig. 3b, Fig. 4a, Fig. 4b or a variant or allele thereof and which is effective in blocking expression of DNA.

The production of the complimentary or antisense nucleic acid may be stimulated in vivo by the provision of a viral vector carrying a polynucleotide sequence that can be transcribed as stated above. This application may take the form of virus infection where the gene for the complimentary or antisense nucleic acid is inserted into the genomes of adenoviruses or retroviruses for delivery of infection.

Alternatively the effect of the fusion proteins can be blocked at the protein level. This may be achieved in several ways. Such as, (i) using peptides designed on the basis of oncogenes for inhibiting protein-protein interactions. For example, a peptide is designed which will interact with the fusion protein so as to inhibit the fusion protein's subsequent interaction with other molecules such as nucleic acids or proteins. In this way the interactive biological activity of the fusion protein is prevented and as a consequence any abnormal activity in the cell leading to tumour formation is likewise prevented. Further, the designed peptide may be replaced by other appropriate molecules, particularly smaller, non-peptide molecules, which have been identified by screening to have structural characteristics allowing them to inhibit the same interaction; (ii) by administering a specific binding member comprising an antibody binding domain as earlier described. The specific binding member may be an antibody and suitably monoclonal .

Antibodies can be raised in accordance with conventional methods known in the art (see earlier) . The use of the sequences provided herein and variants, derivatives or fragments thereof which are antigenically cross-reactive in the generation of antibodies forms a further aspect of the invention. For example, polyclonal antibodies have been raised in rabbits against the novel peptide PRCC.

The antibodies, where for use in therapy, may be

"humanised" for example using methods known in the art, in order to reduce the possibility of harmful hypersensitivity reactions occurring in human patients. For example, the tail region of a non-human antibody with the desired specificity may be exchanged for that of a human antibody. A more complete humanisation may be effected by exchanging further framework regions as is known in the ar . This may be done at the DNA level using recombinant techniques as known and used in the art.

The invention further provides polynucleotide eg cDNA which encodes the above specific binding members with an antibody binding domain.

The nucleic acid, oligo and polynucleotide sequences provided herein may also be inserted into suitable vectors for vaccine use eg pox virus vectors such as vaccinia. The vectors may also include appropriate control elements. Such vectors may be used for prophylactic or therapeutic vaccination in order to express in a controlled fashion the fusion polypeptide sequences and hence stimulate an immune response there against to prevent or mitigate any effects of carcinoma.

Thus the invention relates to the therapeutic application of various agents including an i-sense RNA constructs, substances comprising an antibody binding domain and vaccine vectors in the treatment of papillary RCC. Preferably these agents will be administered in the form of a pharmaceutical composition in combination with a pharmaceutically acceptable carrier or diluent . Suitable agents may be combined, conjugated or complexed to a targeting agent, such as an antibody or antibody binding domain, which binds a papillary RCC antigen. Such antigens, targeting agents and means of combining them with the agents of the invention would be derivable by the skilled person.

The above embodiments may be carried out using the information supplied herein along with standard techniques known in the art or with reference to such text books as Sambrook, Fritsch and Maniatis, Cold Spring Harbor Laboratory Press, 1989.

In order that the present invention is more clearly understood, embodiments will now be described by way of example only and not by way of limitation with reference to the following examples in which:

Fig. 1 a. Southern blot analysis of DNA from papillary renal tumour cell lines. DNAs digested with Bglll and HindiII were hybridised to a TFE3 probe that corresponded to a 379bp EcoRI-Bglll cDNA fragment at the 5' end of the published human TFE3 cDNA sequence (Beckman et al, Genes Dev. 4, pp 167-179 (1990)). Lanes labelled C contain control DNA from cell lines that did not harbour the t(X;l) translocation. Tumour UOK124, which arose in a female patient, has lost the untranslocated copy of the X chromosome (Shipley et al , Cytogenet. Cell Genet. 71, pp 280-284 (1995)). A TFE3 gene rearrangement was also observed when the same probe was hybridised to UOK120 DNA digested with EcoRI. b. Chromosomal localisation of the PRCC gene. Fluorescence in situ hybridisation was carried out using a 2.0kb PRCC cDNA clone as a probe. The arrows marks the position of the hybridisation signals. c. Restriction map of the

TFE3 gene showing its exon- tron structure. Restriction sites are: R, EcoRI, B, BamHI and H, Hindlll. Genomic DNA sequence that spans exons 1-8 are available; exons 1, 2 and 3, accession number X97160; exons 4, 5 and 6, accession number X97161; exons 7 and 8, accession number X97162. The position of the breakpoints in the UOK120, UOK124 and UOK146 cell lines are shown.

Fig. 2 a. Nucleotide sequence of the PRCC-TFE3 fusion found in the UOK124 cell line together with predicted amino acid sequence. b. Nucleotide sequence of the PRCC-TFE3 fusion found in the UOK120 and UOK146 cell lines together with predicted amino acid sequence. The arrows represent the position of transition between 5 ' PRCC sequences and 3 ' TFE3 sequences .

Fig. 3 a. Nucleotide sequence of the NonO-TFE3 fusion found in the UOK109 cell line together with predicted amino acid sequence. b. Nucleotide sequence of the reciprocal TFE3-NonO fusion found in the UOK109 cell line together with predicted ammo acid sequence. NonO sequences are shown in bold.

Fig. 4 Nucleotide sequences of the TFE3 5' -RACE products obtained from the UOK145 (a) and the UOK109 (b) cell lines together with predicted amino acid sequences. The sequences have been extended 3' to show the position of the TFE3 5' -RACE primers which are marked by the lines under the sequences. Sequences that did not match the TFE3 sequence are shown in bold. The vertical arrows show the positions of thebreak points between PSF, NonO and TFE3 found in lines UOK109 and U0K145.

Fig . 5 a . The human chromosome 1 PRCC cDNA nucleotide sequence and predicted ammo acid sequences. The vertical arrows show the position of the breakpoints found m the UOK120 and UOK146 cell Ime ) and m the

UOK124 cell line (▼) . b. The human chromosome X TFE3 cDNA nucleotide sequence and predicted am o acid sequences. The novel 5' TFE3 cDNA sequences identified in our laboratory are shown in bold;

Fig. 6 Schematic representation of wild type PRCC and TFE3 proteins and of the PRCC-TFE3 chimaeric proteins. The PRCC protein is 491 amino acids in length and contains an N-terminal domain of 150 amino acids that is rich in proline, leucine and glycine (PLD-rich) . In UOK120 and UOK146 the 156 amino acids N-terminal region of PCC becomes fused to the entire TFE3 protein including the acidic activation domain (AAD) , the central basic- helix-loop-helix (HLH) and the leucine zipper (Z) regions. In UOK124 393 amino acids of N-terminal PRCC sequences become fused to the same TFE3 sequences. The region of the fusion proteins that is encoded by TFE3 mRNA sequences immediately upstream of the TFE3 initiating methionine is shown (stippled box) . RT-PCR of RNA from the three cell lines has been used to check the structures shown in this figure. The arrows represent the position of fusion of the PRCC protein to TFE3.

Fig. 7 Schematic representation of wild type PSF, NonO and TFE3 proteins and of the PSF-TFE3 and NonO-TFE3 chimeric proteins present in respectively UOK145 and UOK109. The PSF protein is 712 amino acids in length and contains an N-terminal domain rich in proline and glutamine (PQ) , a region rich in proline (P) and tandem RNA-binding domains (RBD) . The 471 amino acid NonO protein contains regions rich in glutamine and histidine (QH) and proline (P) , tanden RNA-binding domains (RBD) , and a belix-turn-belix-charged (HTH, +_.) region implicated in DNA binding. The regions of conservation between PSF and NonO which encompasses the RBD region and NonO HTH +/- region is shown by the bar. The TFE3 protein contains acidic activation (AAD) and DNA binding domains (bHLH,-Z) and has an overall length of 575 amino acids. To check the structure of the TFE3 protein we isolated and sequenced normal TFE3 cDNA clones. The predicted structure, which is shown in this figure, is agreement with that reported by Weterman et al 1996, Proc . Natl . Acad. Sci. USA, 93, 15294-15289. RT-PCR of RNA from the UOK109 cell line has been used to confirm the entire structure shown in this figure. The arrows represent the positions of fusion.

Fig. 8 a. Detection of PRCC-TFE3 hybrid transcripts by RT-PCR. PCR was performed using a 5 ' PRCC primer and a 3 ' TFE3 primer to amplify reverse transcribed RNA from papillary renal cell carcinomas (UOK120, UOK124, UOK146) and the following human tumour samples: STS255 and A2243, synovial sarcoma cell lines; RD, rhabdomyosarcoma cell line; HTB86 Ewmgs sarcoma cell line, and SK23 melanoma cell line b. Detection of normal TFE3 transcripts in the same RNA samples was performed by RT-PCR using a forward primer, corresponding to TFE3 exon 1 sequences and a reverse primer correspond to TFE3 exon 2 sequences. For primer sequences see the Materials and Methods Section;

Fig. 9 shows the nucleotide sequence and ammo acid sequence of NonO; and

Fig. 10 shows a Southern blot of Bglll digested renal cell carcinoma DNA hybridised to A TFE3 probe. DNAs are from the UOK109, UOK120, UOK124 and UOK146 papillary renal carcinoma cells lines. N denotes DNA from normal human blood cells. The TFE3 probe used in this experiment corresponds to nucleotides 897-1205 of the cDNA sequence shown m Fig. 5b. This experiments demonstrates rearrangement of the TFE3 gene in renal carcinoma cell lines.

Involvement of the TFE3 gene Southern blot analysis using a probe corresponding to the 5' end of the TFE3 gene detected rearrangements in three papillary renal tumour cell lines (UOK120, UOK124 and UOK146) shown in cytogenetic studies to contain the (X;l) (pll.2;q21.2) translocation (Fig. la).

Rearrangements in all three lines were detected following digestion of tumour DNA with HindiII and Bglll. These results were consistent with fluorescence in si tu hybridisation studies carried out on the UOK120 and UOK124 cell lines which demonstrated that probes prepared from individual cosmids spanning the 5' end of the TFE3 gene hybridised to both derivative X and derivative 1 chromosomes formed as a result of the t(X;l) translocation (results not shown) .

Fusion of TFE3 to the novel chromosome 1 gene PRCC To determine whether the TFE3 transcripts in UOK124 had been altered at their 5' ends TFE3 5 ' RACE products were obtained from this cell line. The sequence of the 5 ' RACE product (Fig. 5b) diverged from the normal TFE3 sequence (Roman et al , Mol . Cell Biol . , 12, 817-827, 1992) at its 5' end. Construction of the exon-intron map of the TFE3 gene (Fig. lc) revealed that the position of divergence from the normal cDNA sequence corresponded exactly to the site of the junction between TFE3 exon 1 and exon 2.

When a probe prepared from the unique 5' sequences present in the 5 'RACE product was used to isolate clones from human monocyte and foetal brain cDNA libraries, two clones of 1.5kb and 2kb were isolated. Use of the largest clone as a probe in FISH studies allowed the localisation of these sequences to chromosome band lq21.2 (Fig. lb) . The assignment of these sequences to chromosome 1 was confirmed by Southern analysis and PCR- based analysis of human-rodent somatic cell lines that contained a single copy of chromosome 1 (results not shown) . Sequencing of the cDNA clones generated a continuous sequence of 2039bp (Fig. 5a) . The size of the continuous cDNA sequence obtained in these studies was similar in size to normal transcripts of 2.0kb detected in Northern analyses of human sarcoma and melanoma cell lines (results not shown) . This gene, designated PRCC, contained an open reading frame of 491 amino acids (Fig. 4a) . The predicted PRCC protein possessed on N-termmal domain rich m proline (25%) , leucine (13%) and glycme (13%) but failed to exhibit significant homology to known protein sequences and contained no motifs suggestive of biochemical function. Searches of the EMBL databases did, however, reveal several EST sequences that matched the PRCC cDNA sequence (Fig. 5a) .

A comparison of normal PRCC and TFE3 gene sequences with the PRCC-TFE3 junction sequences isolated by 5 ' RACE allowed the position of the fusion of the PRCC to TFE3 to be identified. Although the break occurs upstream of the TFE3 initiating methionine fusion of PRCC to TFE3 is nonetheless predicted to generate a fusion protein (Fig. 5a) . Thus the new open reading frame extends from the P.RCC sequences through sequences upstream of the TFE3 initiating methionine and into the TFE3 open reading frame. These analyses revealed that in UOK124 cells 393 ammo of N-termmal PRCC sequences become fused to the entire TFE3 bHLH transcription factor, which includes an N-termmal acidic transcriptional activation domain (AAD) , a control basic-helix-loop-helix-leucme zipper region implicated in DNA binding and dimerisation (Beckman et al, Genes Dev. , 4, 167-179, 1990; Roman et al, Mol. Cell Biol . , 12, 817-827, 1992; Roman et al , Science, 254, 94-97, 1991; Artandi, Nucleic Acids. Res., 23, 3865-3871, 1995; Artandi et al , Mol. Cell. Biol . , 14, 7704-7716, 1994; Macchi et al , Genomics, 28, 491-494, 1995) . Notably the structure of the TFE3 protein present in this fusion was consistent with that recently reported by Macchi et al . (Macchi et al , Genomics, 28, 491-494, 1995) but was not consistent with earlier reports indicating that TFE3 may have an extended proline-rich C- terminal domain (Roman et al, Mol. Cell Biol., 12, 817- 827, 1992) .

PCR detection of PRCC- TFE3 transcripts The presence of a PRCC-TFE3 hybrid transcript in all three papillary renal tumour cell lines was demonstrated by RT-PCR using 5 'PRCC and 3 ' TFE3 primers. A product of the predicted size (819bp) was observed for cell line U0K124 (Fig. 2a) . Much smaller (108bp) products were obtained for the line UOK120 and U0K146 (Fig. 2b). Analysis of the smaller products indicated that they corresponded to a fusion in which the 156aa proline-rich N-terminal domain of PRCC becomes joined to the same TFE3 sequences (Fig. 2). In parallel experiments reciprocal TFE3-PRCC hybrid transcripts were detected in the UOK146 and UOK120 lines but not in the U0K124 cell lines (result not shown) suggesting that it is the formation of the PRCC-TFE3 transcript that is a consistent feature associated with this translocation. When considered together with Southern blot data showing TFE3 rearrangements (Fig. la), these data allowed the mapping of the positions of the genomic breakpoint within all three tumours (Fig. lc) . Notably in UOK120 and UOK146 the breakpoint could be assigned to TFE3 intron 1.

Loss of normal TFE3 transcripts

RT-PCR using 5 'primer corresponding to TFE3 exon 1 sequences and a 3 'primer corresponding to TFE3 exon 2 sequences was used to detect intact TFE3 transcripts.

Transcription of TFE3 gene has been observed in all tissue examined (Roman et al , Science, 254, 94-97, 1991).

In agreement with this observation we found PCR products of the predicted size in sarcoma and melanoma lines that were examined. However we failed to detect expression of normal TFE3 transcripts in the three renal tumour cell lines (Fig. 8b). This would be expected for t(X;l) translocations found in males and for translocations in females involving the active X chromosome (UOK120 arose in a male while UOK124 and UOK146 arose in females) . This observation raises the intriguing possibility that the t(X;l) translocation may uniquely have a dual role in both generating a dominantly acting fusion protein and removing the activity of normal TFE3 proteins.

Fusion to the PSF gene in UOK145

To identify sequences fused to the TFE3 gene in the UOK145 cell line, 5' -RACE was performed using TFE3 gene exon 4 primer (Sidhar et al,1996 Hum. Molec. Genet., 64, 233-239). The sequence of the product obtained (Figure 4a) diverged from the normal TFE3 sequence 5' to exon 4. Database searches of the unique 5' sequences revealed that they were identical to the human PSF splicing factor gene (Patton et al, 1993 Genes Dev., 7, 393-406). The splicing reaction involves two steps. In step I unspliced pre-mRNA is converted into separate exon 1 and lariat- intron-exon 2 structures. In step II exons 1 and exons 2 are joined and an excised lariat-intron is formed. PSF is a component of the spliceosome complex which catalyses these reactions and has been shown to be required for catalytic step II of the splicing reaction (Gozani et al , 1994 EMBO. J. 13, 3356-3367). The 712 amino acid PSF protein contains several distinct regions (Figure 4a) including (i) an N-terminal domain rich in proline and glutamine and (ii) two conserved RNA-binding domains (Patton et al , 1993 Genes Dev., 7, 393-406). Notably the PSF-TFE3 hybrid transcript detected in U0K145 is predicted to encode a fusion protein containing almost the entire PSF protein fused to the C-terminal TFE3 DNA- binding domain (Fig. 4a) .

Fusion of the NonO gene in UOK109 To identify sequences fused to the TFE3 gene in the UOK109 cell line, TFE3 5' -RACE and 3 ' -RACE products were obtained. For both 5' and 3 '-RACE, sequences were obtained that diverged from known TFE3 sequences at the exon 3-exon 4 junction (e.g. the 5' -RACE product is shown in Fig. 4b) . Database searches of the new sequences present in the 5 '-RACE and 3' -RACE products revealed that they exactly matched adjacent regions of a gene designated NonO that is closely related to PSF (Dong et al, 1993 Nucleic Acids Res. 21, 4085-4092; Yang et al , 1993 Mol. Cell Biol. 13, 5593-5603).

The 471 amino acid NonO protein contains several distinct domains (Fig. 4b) including (i) a short N-terminal sequence composed entirely of histidine, glutamine and proline residues, (ii) a helix-turn-helix domain flanked by charged amino acids that is responsible for binding to the octamer sequence in double stranded DNA and (iii) a short C- terminal proline-rich region. The NonO protein has a region of 320 amino acids with 71% identify and 7% similarity to a 420 amino acid region of PSF (Patton et al, 1993 Genes Dev., 7, 393-406; Dong et al , 1993 Nucleic Acids Res. 21 4085-4092; Yang et al , 1993 Mol. Cell Biol. 13, 5593-5603). This same region of NonO exhibits 42% identity and 7% similarity to a 321 amino acid region of the 700 amino acid Drosophila NonAdiss protein. NonA mutants in Drosophila show abnormal phototaxis and optomotor response and this gene is also the locus of the dissonance (diss) allele which results in an altered male courtship song. p54^nrb (another name for NonO) , PSF and NonAdiss are all members of a family of proteins called DBHS (for Drosophila behaviour and human splicing) that are believed to have an important role in controlling splicing of pre-mRNA species. As observed for the PSF- TFE3 fusion the NonO (p54^nrb) -TFE3 hybrid transcript is predicted to encode a fusion protein in which almost the entire p54^nrb protein is fused to the C-terminal DNA- binding domain of TFE3. Interestingly both the PSF-TFE3 and NonO (p54^nrb) -TFE3 protein fusions (Fig 4b) lack the TFE3 acidic activation domain (AAD) indicating that this sequence is not essential for transformation.

RT-PCR detection of hybrid transcripts

The presence of a PSF-TFE3 hybrid transcript encoded by the der(l) chromosome in the UOK145 cell line was confirmed by RT-PCR. Using 5' -PSF and 3'-TFE3 primers a product of the predicted size was observed for UOK145 but not in other renal cell lines examined. The der (X) chromosome resulting from the t(X;l) (pll.2,-p34) translocation is absent in UOK145 and indeed we failed to detect the reciprocal TFE3-PSF hybrid transcript that would be encoded by the der(X) in this cell line (results not shown) . Using a similar approach we confirmed the presence of both the NonO-TFE3 and TFE3-NonO (result not shown) Transcript in the UOK109 cell line. As expected hybrid transcripts involving the PSF and NonO genes were not detected in other renal carcinoma cell lines. Analysis of the presence of normal PSF, NonO and TFE3 transcripts using pairs of primers that flanked the position of the translocations demonstrated that fusion of the X chromosome genes NonO and TFE3 in the male UOK109 cell line was associated with the loss of both normal NonO and normal TFE3 transcripts.

DISCUSSION

In these studies we report that the t(X;l) (pll .2 ;q21.2) translocation found in papillary renal cell carcinoma results in the fusion of a novel chromosome 1 gene called

PRCC to the TFE3 transcription factor gene. There have been very few reports of recurrent translocations and their molecular characterisation in human carcinomas. The current work therefore provides the first demonstration of a recurrent fusion involving a transcription factor gene in a human carcinoma. By comparison the involvement of transcription factor genes in chromosomal translocation genes found in sarcoma and leukaemias has been well documented (Cleary, M.L., Cell, 66, 619-622, 1991; Rabbitts, T.H., Nature, 372, 143-149, 1994) . Of particular note is the involvement of members of the bHLH gene family including CMYC, LYL1 , TALI and TAL2 in translocations found in haemopoietic malignancies. As a consequence of the translocations the bHLH genes become juxtaposed to immunoglobin light or heavy chain genes or to T-cell receptor genes (Cleary, M.L., Cell, 66, 619-622, 1991; Rabbitts, T.H. , Nature, 372, 143-149, 1994) . Notably these translocations result in deregulation or ectopic expression of the bHLH gene and, in contrast to the situation observe for TFE3 , are not associated with the formation of fusion proteins.

A frequent theme observed for translocations found in sarcomas is the fusion of a transcription factor activation domain to a transcription factor DNA-binding element. It is therefore possible that fusion of the N- terminal PRCC domain to TFE3 may act in a manner similar to that observed for the EWS fusions by creating a PRCC- TFE3 fusion protein that has an N-terminal protein-rich transcriptional activation domain adjacent to the TFE3 DNA-binding domain.

The TFE3 protein binds μE3 elements in the immunoglobin heavy chain, (IgH) intronic enhancer, in Ig kappa enhancers and in some IgH variable region promoters (Beckman et al, Genes Dev., 4, 167-179, 1990;

Roman et al, Mol. Cell Biol., 12, 817-827, 1992; Roman et al, Science, 254, 94-97, 1991; Artandi et al , Nucleic Acids. Res., 23, 3865-3871, 1995; Artandi et al , Mol. Cell. Biol., 14, 7704-7716, 1994; Macchi et al , Genomics, 28, 491-494, 1995) . However, since TFE3 transcripts are found in all tissue examined, including kidney, the encoded protein may have a much broader role in transcriptional control (Roman et al , Science, 254, 94-97, 1991) . The N-terminal transcriptional activation domain of TFE3, called AAD (Fig. 6) is encoded by the 105 nucleotide exon 3 of the TFE3 gene (Roman et al , Science, 254, 94-97, 1991). Removal of this exon by differential splicing produces a shortened isoform of the TFE3 protein (TFE3-S) that is expressed in kidney cells (Roman et al, Science, 254, 94-97, 1991) and that has as a dominant negative effect on TFE3 activity. We have found in analysis of each of the papillary RCC that formation of the t(X;l) is often accompanied by loss of expression of the normal TFE3 transcripts. It is therefore interesting to consider the possibility that the transformation that results from t(X;l) formation may require both the generation of the PRCC-TFE3 fusion protein and the removal of the shortened inhibitory isoform TFE3-S. However, we did detect a normal TFE3 transcript in the UOK145 cell line in addition to the hybrid PSF-TFE3 transcript. This observation supports the view that removal of normal TFE3 transcript is not an essential step in the transformation process.

We also report that the UOK145 papillary renal cell carcinoma cell line contains a t(x;l) (pll.2-.p34) translocation that results in the fusion of the PSF gene located on chromosome arm Ip to the TFE3 transcription factor gene. This translocation has been observed previously in renal tumours (Kovacs et al , 1987 Int. J. Cancer, 40 171-178; Dijkuizen et al , 1995 Genes Chrom. Cancer, 14, 43-50; Yoshida et al, 1995 Abst . Proc. Ann. Assoc. Cancer Res., 26. 31) and therefore represents a recurrent abnormality in this tumour type. We also demonstrated that in the UOK109 cell line an inv(X) (pll.2,-ql2) results in the fusion of the NonO gene to the TFE3 gene. The abnormality inv (X) (pll .2 ;ql2 ) has not been cytogenetically detected previously in renal carcinoma but this subtle alteration is not evident by standard cytogenetic examination. Taken together, our observations, therefore, demonstrate consistent alteration of the TFE3 gene in papillary renal cell carcinoma but show that TFE3 may have a variety of fusion partners. Notably, a t (X; 17) (pll .2 ,-q25) translocation

(Tomlinson et al , 1991 Cancer Genet. Cytogenet., 57, 11- 17) and a t (X; 10) (pll .2 ;q23) translocation (Dijkuizen et al, 1995 Genes Chrom. Cancer, 14, 43-50) have also been reported in papillary renal cell carcinoma suggesting that the TFE3 gene may have partners in addition to those currently identified.

Analysis of the fusion between the PRCC and TFE3 genes indicated that it is the generation of the PRCC-TFE3 hybrid transcript, rather than the formation of the TFE3- PRCC hybrid transcript, that is a consistent feature associated with the t (X; 1) (pll .2 ,-q21.2) translocation. By analogy it would be expected that the generation of the NonO-TFE3 and PSF-TFE3 hybrid transcripts are the key events in transformation. In agreement with this observation we failed to detect the reciprical TFE3-PSF transcript in UOK145 cells.

Several lines of circumstantial evidence have suggested links between RNA processing, transcription factors and oncogenesis . For example, WT1 protein which has been demonstrated to act as a transcriptional regulator (Hastic, 1994 Annu. Rev., Genet., 28, 523-558) was shown to be able to associate with spliceosomes and to coiled- bodies, nuclear oganelles of unknown function that contain components of the spliceosome (Larsson et al, 1995 Cell, 81, 391-401) . In Friend spleen focus forming virus -inducted erythroleukemia, insertional mutagenesis can occur adjacent to the Spi-I gene resulting in over expression of the normal Spi-I/PUl protein, a member of the Ets family of DNA-binding transcription factors. Recent evidence has shown that the 55 kDA Spi-l/PUl protein can also bind to the NonO protein and affect the splicing process m vitro (Hallier et al, 1996 J. Biol. Chem.,271, 11177-11181).

In the present study we provide a more direct link between the splicing process, transcription factors and oncogenesis by demonstrating fusion of the splicing factor genes PSF and NonO to the TFE3 transcription factor gene in papillary renal cell carcinomas. A notable feature of this fusion is that in each case it results m fusion of almost the entire splicing factor to the DNA binding domain of TFE3. It is therefore possible that the PSF-TFE3 and NonO-TFE3 fusions may retain activity in both splicing and DNA transcriptional control and it is possible that the resulting interference between these two processes may represent a new mechanism of tumour development .

It has been proposed that renal cell carcinomas bearing abnormalities of Xpll.2 may constitute a subgroup distinct from the classic histologically defined papillary carcinoma (Meloni et al, 1993 Caner Genet. Cytogenet., 65, 1-6). This idea was based on initial cytogenetic observations showing that tumours containing alterations of Xpll.2 were found entirely in male patients and arose mainly in children and young adults, although sporadic renal cell carcinoma is a disease that is most common in the fifth to seventh decades of life. We have now found alterations of the TFE3 gene in five of seven papillary renal cell carcinoma cell lines examined. In agreement with these earlier conclusions the average age of onset of these five tumours (27 years) was lower than that generally observed for renal cell carcinoma. In addition, three tumours harbouring TFE3 abnormalities arose in females demonstrating that this alteration is not restricted to male patients. With the work presented here, it is now possible to analyse a large series of tumours to determine its true age and sex distribution of patients with TFE3 abnormalities and to use this translocation as a diagnostic or prognostic marker.

MATERIALS AND METHODS

Cell lines

The UOK109, U0K112, UOK120, UOK124, UOK124, UOK132, UOK145 and UOK146 cell lines were derived from primary papillary renal cell carcinoma specimens as described (Anglard et al , Cancer Res., 52, 348-356, 1992). The cell lines UOK120, UOK124 and UOK146 were derived respectively from tumours arising in a 30 year old male, a 21 year old female and a 45 year old female.

Cytogenetic analyses of these three lines identified the reciprocal translocation t (X; 1) pll .2 :q21.2) translocation (Kovacs et al, Int. J. Cancer, 40, 171-178, 1987 and JS unpublished). The cell lines UOK145, UOK109, UOK112 and UOK132 were derived respectively from tumours arising in an 18 year old female, a 39 year old male, a 67 year old male and a 63 year old female.

Cytogenetics and FISH analysis Cytogenetic analysis of UOK109 and UOK145 was carried out using standard procedures. Chromosome 1 and X paints and a probe for the pericentric region of chromosome 1 were used singly or in combination with differentially labeled YAC probes as previously described in order to confirm the origin of the derivative 1 and X chromosomes (Shipley et al, 1993 Cytogenet. Cell genet., 64, 233-239; 1995 Cytogenet. Cell Genet., 71, 280-284). YAC clones for GATA and pTAK8 (Shipley et al, 1995 Cytogenet. Cell Genet., 71, 280-284) lie telo eric and centromeric to TFE3 at Xpll and were labeled with green and red flurochromes , respectively. These TACs were co-hybridised to chromosome preparations of the two cell lines and analysed as detailed previously (Shipley et al, 1993 Cytogenet. Cell genet., 64, 233-239; 1995 Cytogenet. Cell Genet., 71, 280-284) .

Analysis of DNA and RNA

Preparation of genomic DNA and cytoplasmic RNA were carried out as described (Clark et al, Nature Genet., 7, 502-508, 1994). Restriction endonuclease digestions, agarose gel electrophoresis , Southern transfer, hybridisation, washes and autoradiography were also carried out as described previously (Clark et al, Nature Genet., 7, 502-508, 1994).

RT-PCR analysis lμg of RNA was reverse transcribed using Superscript II reverse transcriptase (GIBCO BRL) . Most efficient reverse transcription was obtained when RNA was heated to 94 ^*C with a random 6-mer primer and cooled rapidly on dry ice prior to addition of the reverse transcriptase and buffer. Incubation was at 17°C for 18h. To detect PRCC- TFE3 hybrid transcripts the resulting cDNA was subject to amplification with the PRCC primer 5 ' CACTGAGCTGGTCATCAC3 ' (forward primer) and the exon 2 TFE3 primer 5 ' AGTGTGGTGGACAGGTACTG3 ' (reverse primer). The presence of intact normal TFE3 transcripts was assessed using the TFE3 exon 1 primer 5 ' TGTGGTTGGCGTCTCTGCTG3 ' (forward primer) in combination with the same TFE3 exon 2 reverse primer. To detect TFE3 -PRCC hybrid transcripts amplification was performed with the TFE3 primer, 5 ' CATCTCTGTGGTTGGCGT3 ' (forward primer) and 3 ' PRCC primer 5 ' GTTCTCCAGATGGGTCTGC3 ' (reverse primer) . For U0K124 the additional reverse primer 5 'ATGTTGATTCTCGCAGAGGC3 ' that lies 3' to the end of the PRCC open reading frame was also used in combination with the TFE3 forward primer in attempts to detect a TFE3 -PRCC hybrid transcript. To detect the PSF-TFE3 hybrid transcripts reversed transcribed RNA was subject to amplification using the PSF primer 5' TGGTGGTGGCATAGGTTATG 3' (forward primer) and TFE3 priimer 5' CGTTTGATGTTGGGCAGCTC 3' (reverse primer) . NonO-TFE3 hybrid transcripts were detected using the NonO primer 5' GAGAAACTAGACACAGCAAC 3' (forward primer) and the TFE3 primer 5' CTTTCTTCTGCCGTTCCTTC 3' (reverse primer) . Normal PSF trascripts were detected using the forward PSF primer described above together with the reverse PSF primer 5' TCTACCATATCCTGCTGGAG 3'. Normal NonO transcripts were detected using the foward NonO primer described above and the NonO reverse primer

5' CAAGTGGACCGCAACATCAAG 3'. Normal TFE3 transcripts were detected using the primers 5' CCCGCAAGTGCCCAGCCACTG 3' (forward primer, exon 3) and 5' CAGTTCCTTGATCCTGTCG 3' (reverse primer, exon 4) . As a positive control to confirm that each RNA sample could yield products RT-PCR amplification was carried out with actin primers as described previously (Clark et al , Nature Genet., 7, 502- 508, 1994; Sidhar et al 1996 Hum. Molec. Genet., 5, 1333- 1338) .

In these analyses all reverse transcribed samples gave an actin PCR product of the expected size. The amplification conditions were 93°C for 20s, 61°C for 40s and 72°C for 40s for 30 cycles in a final volume of 25μl. Alternative amplification conditions include 93°C for 20_g, 59°C for 30_s (cycles 7-36) and 68°C for 30₃ for 30 cycles using Expand High Fidelity DNA polymerase (Boehringer Mannheim) in a final volume of 25μl. For the first six cycles touch down annealing temperatures were 61°C (x2) and 59°C (x2) and 57°C (x2) . The products were separated by electrophoresis in agarose gels followed by staining with ethidium bromide.

5 'RACE lμg of RNA was reverse transcribed using Superscript II reverse transcriptase (GIBCO BRL) as described above using the TFE3 primer 5 ' TGAGCTGGACCCGATGGTGA 3'. Newly synthesised cDNA was then tailed with polydC at its 5' end using terminal transferase (Boehringer Mannheim) according to the manufacturers instructions. Amplification of cDNA ends was then performed. The first round PCR primers were oligonucleotide

5 ' TAGTGTGGGCAGCCTCAG3 ' (TFE3 reverse primer) and 5'GACTCGAGTCGACATCGGGIIGGGIIGGGIIG3' where I is inosine. Aliquots of this reaction were then subject to nested PCR using the primer oligonucleotides 5 ' CTCAGGGGCAGGCAGTGGCTG3 ' { TFE3 reverse primer) and 5 ' GACTCGAGTCGACATCG3 ' .

Further 5 'RACE and 3 'RACE

For 5 'RACE lμg of RNA was reverse transcribed using Superscript II reverse transcriptase using the TFE3 specific primer CAGTTCCTTGATCCTGTCGA and then tailed with 5'-polyC as described (Sidhar et al, 1996). Amplification of cDNA 5' ends was then performed using the first round PCR primers 5 ' -CTTTCTTCTGCCGTTCCTTC-3 ' where I is inosine. Aliquots of the reaction were then subject to nested PCR using the reverse primer 5'- CGTTTGATGTTGGGCAGCTC-3' (TFE3 reverse primer) and tag primer 5' GACTCGAGTCGACATC-3 ' . For 3 ' -RACE reverse transcription was performed using the tagged random hexamer primer 5' -GACTCGAGTCGACATCNNNNNN-3 ' , 3 ' -RACE was then performed using the TFE3 forward primer 5'- CCCGCAAGTGCCCAGCCACTG-3' together with the tag primer 5'- GACTCGAGTCGACATC-3' . Nested PCR was then performed using the TFE3 forward primer 5 ' -TCACCATCGGGTCCAGCTA-3 ' together with the tag primer. PCR conditions for both 5' PCR and 3 'RACE were 93°C for 15s,^• 57°C for 30s and 68°C for 30s for 30 cycles.

Fluorescence in situ hybridisation (FISH) FISH using the 2. Okb PRCC cDNA clone 75MI8 as a probe was performed exactly as described previously (Byrne et al, Human Genet., 97, 340-344, 1996).

cDNA libraries

A cDNA library made from the human monocyte cell line U937 in the pcDM8 vector and a human foetal brain cDNA library made in the pcDNA vector were kindly provided by the Sanger Centre, Cambridge, UK.

DNA sequencing

For sequence analysis PCR products were either subcloned with the TA Cloning kit (Invitrogen) following the manufacturers instructions or sequenced directly from PCR products which had been purified by electrophoresis through agarose gels and isolated using the Geneclean II (BIO101) kit. Both PCR products and subcloned cDNA fragments were sequenced by the dideoxy method using a TaqFS Dye Terminator Sequencing kit (ABI, Foster City, CA) and ABI 377 DNA sequencers. Sequencing of all RT-PCR products and both strands of the PRCC gene cDNA clones were completed using these methods.

Claims

1. A method of diagnosing papillary renal cell carcinoma by identifying in a sample obtained from a tissue of a patient the presence or absence of either a nucleic acid fusion product comprising nucleic acid sequence deriving from the TFE3 gene and fusion partner nucleic acid sequence or an entity which derives from, or is indicative of the presence in said patient of, said nucleic acid fusion product the method comprising the steps of: obtaining said sample; contacting said sample with a specific binding member (sbm) for determining said presence or absence of said nucleic acid fusion product or entity; and detecting binding or absence of binding of the sbm to the said nucleic acid fusion product or entity.

2. A method according to claim 1 which comprises the additional step of distinguishing between binding of the sbm to the said nucleic acid fusion product or entity and binding of the sbm to either non- fused TFE3 gene nucleic acid sequence and non- fused fusion partner nucleic acid sequence or entities which derive from or indicate the presence of said non- fused TFE3 gene nucleic acid sequence and/or non- fused fusion partner nucleic acid sequence.

3. A method according to claim 2 wherein said step of distinguishing is carried out by a molecular weight analysis.

4. A method according to any one of claims 1 to 3 wherein the sbm comprises an oligo- or polynucleotide sequence specific for specific hybridization to a nucleic acid sequence of TFE3 and/or the fusion partner.

5. A method according to claim 4 wherein the sbm comprises a pair of oligonucleotide primers for amplification of part or all of said nucleic acid fusion product.

6. A method according to claim 5 wherein one primer binds to a portion of the nucleic acid sequence deriving from the TFE3 gene and the other primer binds to a portion of the nucleic acid sequence deriving from the fusion partner.

7. A method according to any one of the preceding claims wherein the fusion partner is derived from PSF, PRCC or NonO.

8. A method according to any one of claims 1 to 7 wherein the nucleic acid fusion product comprises part or all of the fusion products shown in any one of Figures 2a, 2b, 3a, 3b, 4a, or 4b.

9. A method according to any one of claims 1 to 8 wherein the sbm comprises an oligo- or polynucleotide sequence specific for nucleic acid sequence representing the TFE3 gene and/or nucleic acid sequence representing the fusion partner being PSF, PRCC or NonO, wherein said oligo- or polynucleotide sequence encodes part or all of the amino acid sequences as shown Figures 2a, 2b, 3a, 3b 4a, 4b, 5a, 5b and 7 or a sequence complementary thereto.

10. A method according to claim 1 wherein the sbm comprises an antibody binding domain.

11. A method according to claim 10 wherein the antibody binding domain is specific for a said entity which derives from the nucleic acid fusion product, said entity comprising an oligo- or polypeptide.

12. A method according to any one of claims 10 to 11 wherein the fusion partner is PSF, PRCC or NonO.

13. A method according to any one of claims 10 to 12 wherein the antibody binding domain is specific for an epitope of an oligo- or polypeptide comprising part or all of the ammo acid sequence as shown in Figs. 2a, 2b,

3a, 3b, 4a, 4b, 5a, 5b or 9.

14. An sbm for use in a method according to claim 1 which comprises an oligo- or polynucleotide sequence for specific hybridization to a nucleic acid sequence of TFE3 and/or the fusion partner.

15. An sbm according to claim 14 which comprises a pair of oligonucleotide primers substantially complementary to a pair of target sequences within said fusion product, which target sequences are spaced apart from one another.

16. An sbm according to claim 15 wherein one primer binds to a target sequence in the TFE3 sequence and the other primer to a target in the fusion partner sequence, which target sequences are spaced apart from one another.

17. An sbm according to any one of claims 14 to 16 wherein the oligo- or polynucleotide sequence is hybridizable to a polynucleotide sequence which codes for a polypeptide having part or all of the amino acid sequence as shown in Figs. 2a, 2b, 3a, 3b, 4a, 4b, 5a, 5b or Fig 9.

18. An sbm for use in a method according to claim 1 which comprises an antibody binding domain.

19. An sbm according to claim 18 wherein the antibody binding domain is specific for a said entity which derives from the nucleic acid fusion product, said entity comprising an oligo- or polypeptide.

20. An sbm according to any one of claims 18 to 19 wherein the fusion partner is PSF, PRCC or NonO.

21. An sbm according to any one of claims 18 to 20 wherein the antibody binding domain is specific for an epitope of an oligo-- or polypeptide comprising part or all of the amino acid sequence as shown in Figs. 2a, 2b, 3a, 3b, 4a, 4b, 5a, 5b or Fig 9.

22. An sbm for use in a method according to claim 1 in which method the entity comprises an antibody binding domain or an antibody- like binding domain and the sbm comprises and oligo- or polypeptide sequence.

23. An sbm according to claim 20 which comprises part or all of a polypeptide having part or all of the amino acid sequence as shown in Figs. 2a, 2b, 3a, 3b, 4a or 4b, 5a, 5b or Fig 9.

24. A nucleic acid fusion product comprising nucleic acid sequence deriving from the TFE3 gene and nucleic acid sequence deriving from a fusion partner.

25. A nucleic acid fusion product according to claim 24 wherein the fusion partner is PSF, PRCC or NonO.

26. A nucleic acid fusion product according to claim 25 comprising part or all of the polynucleotide sequence which encodes for part or all of an amino acid sequence as shown in Figs. 2a, 2b, 3a, 3b, 4a or 4b, or a sequence complementary thereto.

27. A vector comprising a nucleic acid fusion product according to anyone of claims 24 to 26.

28. A vector according to claim 27 which is a recombinant transfer vector.

29. A vector according to claim 27 which is an expression vector.

30. A vector according to claim 26 which is a vaccine vector.

31. A vector according to claim 30 which is form a pox virus.

32. A vector according to claim 31 which is from a vaccinia virus.

33. A recombinant host cell which comprises a vector according to any one of claims 27 to 33.

34. An oligo- or polypeptide comprising sequence encoded by a nucleic acid fusion product having nucleic acid derived from the TFE3 gene and nucleic acid derived from a fusion partner.

35. An oligo- or polypeptide according to claim 34 comprising part or all of a polypeptide which has part or al of the ammo acid sequence shown m Figs. 2a, 2b, 3a, 3b, 4a or 4b.

36. An oligo- or polypeptide according to claim 34 or claim 35 which is immunologically cross-reactive with a polypeptide having part or all of the ammo acid sequence of either Figs. 2a, 2b, 3a, 3b, 4a or 4b.

37. A molecule comprising an antibody binding domain for an oligo- or polypeptide sequence encoded by a nucleic acid fusion product having nucleic acid derived from the TFE3 gene and nucleic acid derived from a fusion partner.

38. A molecule according to claim 37 wherein the antibody binding domain is specific for an epitope of an oligo- or polypeptide comprising part or all of the ammo acid sequence as shown Figs. 2a, 2b, 3a, 3b, 4a or 4b, 5a, 5b or 9.

39. A molecule according to claim 37 or claim 38 which is an antibody.

40. A molecule according to claim 39 which is a monoclonal antibody.

41. A molecule according to claim 40 which is a humanised monoclonal antibody.

42. A molecule according to any one of claims 37 to 41 wherein the antibody binding domain is specific to an epitope which is characterising of an oligo- or polypeptide encoded by said nucleic acid fusion product said epitope not being of characteristic of an oligo- or polypeptide encoded by either non- fused TFE3 gene nucleic acid sequence or non-fused fusion partner nucleic acid sequence .

43. A pharmaceutical which comprises as an active ingredient a molecule according to any one of claims 37 to 42 or a vector according to any one of claims 27 to 32.

44. Use of a molecule according to any one of claims 37 to 42 or a vector according to any one of claims 27 to 32 in the preparation of a medicament for the prophylaxis or treatment of papillary renal cell carcinoma.

45. A method of preventing or treating papillary renal cell carcinoma which comprises administering to a patient a pharmaceutical according to claim 43.

46. An oligo- or polynucleotide which can be transcribed to produce an antisense oligo- or polynucleotide which is at least in part complementary to an mRNA sequence representing a nucleic acid fusion product comprising nucleic acid derived from TFE3 and nucleic acid derived from a fusion partner, and wherein the complementary portion of the antisense oligo- or polynucleotide is of sufficient length to inhibit translation of a said mRNA and production of a polypeptide encoded by the mRNA.

47. A pharmaceutical which comprises as an active ingredient an oligo- or polynucleotide according to claim 46.

48. Use of a oligo- or polynucleotide according to claim 46 in the preparation of a medicament for the treatment of papillary renal cell carcinoma.

49. A method of treating a patient with papillary renal cell carcinoma which comprises administering to the patient a pharmaceutical according to claim 47.

50. A method according to claim 5 or claim 6 which also comprises : contacting the sample with ingredients for carrying out a polynucleotide sequence amplification; applying standard hybridization, elongation and denaturation conditions: and detecting the binding of sbm to the nucleic acid fusion product by looking for the presence or absence of an amplification product.

51. A polynucleotide sequence which codes for all or part of the TFE3 amino acid sequence as shown in Fig. 5b having acession number X96717.

52. A polynucleotide according to claim 51 which codes for part or all of the amino acid sequence upstream of ammo ac d residue 211.

53. A polynucleotide according to claim 51 or claim 52 having the nucleotide sequence as shown in Fig. 5b.

54. A polypeptide sequence which has part or all of the ammo acid sequence as shown in Fig. 5b or is immunologically cross-reactive with a polypeptide having part or all of said sequence.

55. A polypeptide sequence according to claim 52 which has part or all of the ammo acid sequence upstream of ammo acid residue 211 or is immunologically cross- reactive with a polypeptide having part or all of said sequence.

56. A polynucleotide sequence which codes for part or all of the PRCC ammo acid sequence a shown m Fig. 5a having accession number X97124.

57. A polynucleotide sequence according to claim 56 having the polynucleotide sequence as shown in Fig. 5a.

58. A polypeptide sequence having part or all of the amino acid sequence as shown in Fig. 5a.

59. A molecule comprising an antibody binding domain or antibody-like binding domain specific for an epitope of a polypeptide comprising part or all of the polypeptide according to claims 54, 55 or 58.

60. A kit for use in relation to the diagnosis of papillary renal cell carcinoma which comprises one or more of an sbm according to any one of claims 14 to 23, a nucleic acid fusion product according to any one of claims 24 to 26, a vector according to any one of claims 27 to 29, a recombinant host cell according to claim 33, an oligo- or polypeptide according to any one of claims 34 to 38 or a molecule according to any one of claims 37 to 42.