CN107267608A

CN107267608A - The new transposition companion of Xp11.2 a kind of and its detection primer and application

Info

Publication number: CN107267608A
Application number: CN201710458099.3A
Authority: CN
Inventors: 夏秋媛; 饶秋; 叶胜兵; 李芳秋; 周晓军
Original assignee: Nanjing General Hospital of Nanjing Command PLA
Current assignee: Nanjing General Hospital of Nanjing Command PLA
Priority date: 2017-06-16
Filing date: 2017-06-16
Publication date: 2017-10-20
Anticipated expiration: 2037-06-16
Also published as: CN107267608B

Abstract

The invention discloses the new transposition companion of Xp11.2 a kind of and its detection primer and application.The new transposition companion of Xp11.2 a kind of, is MATR3 TFE3 group translocations, and the gene is located at No. 5 chromosome 5q31.2, and Gene Fusion is betided between MATR3 15 exons and the exon of TFE3 genes 4.A kind of PCR primer of detection MATR3 TFE3 transposition tumours, to detect the PCR primer of MATR3 TFE3 group translocations of the present invention.Application of the PCR primer of the present invention in MATR3 TFE3 transposition tumour diagnostic reagents are prepared.The new position of fusion that the present invention has found for high-flux sequence devises specific PCR primer, expands the detection range of former primer combination, applied to clinic, can improve the recall rate and accuracy rate for diagnosing such tumour.

Description

The new transposition companion of Xp11.2 a kind of and its detection primer and application

Technical field

The invention belongs to field of medical examination, it is related to a kind of Xp11.2 new transposition companion and its detection primer and application.

Background technology

WHO in 2004 was modified to clear-cell carcinoma Pathological cassification in 1997, increased newly Xp11.2 transpositions/ TFE3 Gene Fusion correlations kidney (Xp11.2 transpositions kidney).TFE3 genes are located at XP11.2, are Xp11.2 transposition kidneys Unique driving gene of cancer, its pathogenesis clear and definite：This kind of tumour all refers to the TFE3 genes positioned at Xp11.2 with other Chromosome translocation and its caused formation fusion, by promoter conversion so as to high expression TFE3 fusion proteins, and TFE3 makees For a transcription factor, by being combined with special DNA structure, in transcriptional control body, several genes expression is final causes a disease.Mesh Preceding at least 10 kinds different transposition companions and fusion are reported, including ASPL-TFE3, PRCC-TFE3, SFPQ-TFE3, NONO-TFE3, CLTC-TFE3, LUC7L3-TFE3, KHSRP-TFE3, PARP14-TFE3, DVL2-TFE3 and RBM10-TFE3 Deng every intra-tumor only exists single translocated forms.In addition to clear-cell carcinoma, leaf tumour equally exists TFE3 between some soft tissues The pathogenic group translocation of gene, including alveolar soft part sarcoma, part epithelioid pericyte tumour etc., these leaves Tumour and Xp11.2 transpositions kidney are referred to as Xp11.2 transposition tumours together.

Xp11.2 transposition tumours are a rare tumor types, although its overall incidence is very low, but are suffered from renal cell carcinoma in children About 1/3 is such kidney in person, and retrospective study shows that such tumour is not uncommon in China.The disease is with age of onset It is gently prominent features, therefore causes extremely heavy family and burden on society.And study it has proven convenient that Xp11.2 transposition kidneys are pre- After than non-Xp11.2 transpositions kidney poor prognosis, and the prognosis area of different genes type Xp11.2 transposition kidneys Not.In addition, there is positive evidence to show the patient of Xp11.2 transposition tumours to vascular endothelial growth factor receptor (vascular Endothelial growth factor receptor, VEGFR) or mammal rapamycin (mammalian target Of rapamycin, mTOR) molecular targeted therapy sensitivity.It is another that there are some researches show MET EGFR-TKs merge for ASPL-TFE3 The target gene of gene, and it is expected to the therapy target as Xp11.2 transposition tumours.Therefore, according to genotype come Precise Diagnosis this Class tumour seems particularly significant.

The detection method of conventional diagnosis Xp11.2 transposition tumours mainly includes immunohistochemistry at present and fluorescence is former Position hybridization.Immunohistochemical detection nucleus TFE3 fusion proteins are directly perceived, quick, price is low, but it has the disadvantage that this method is held It is vulnerable to many factors influence, such as organizes set time, tissue repair mode, antibody cloning number and artificial interpretation factor Deng so that result is likely to occur false positive or false negative.Chromosome fluorescence in-situ hybridization (FISH) starts from traditional cytogenetics The combination with DNA technique is learned, rapid sensitive, specificity are good, concealment or small chromosome aberration and complicated core can be detected Type；A variety of fluorescence labelings can also be used, relative position and direction between display DNA fragmentation and gene, space orientation are accurate. But both detection methods can only point out the high expression or the transposition of TFE3 genes that there is TFE3 albumen, can not specify in tumour The specific transposition occurred changes.The transposition companion of accurate detection Xp11.2 transposition tumours and fusion site, are not only trouble The foundation of person's prognosis prediction, is also the guidance of following targeted therapy, therefore, specifies the group translocation position of Xp11.2 transposition tumours Point, with important clinical meaning.

Xp11.2 transposition tumours are heterogeneous larger tumor type, the fusion base being currently known between a kind of each individual Because form just include ASPL-TFE3, PRCC-TFE3, SFPQ-TFE3, NONO-TFE3, CLTC-TFE3, LUC7L3-TFE3, KHSRP-TFE3, PARP14-TFE3, DVL2-TFE3 and RBM10-TFE3 etc. more than ten is planted.

Current high-flux sequence is can uniquely to specify the detection means in unknown transposition site, but high-flux sequence expense High, detection cycle is long, and detection platform is rare, requires high to sample quality, is unfavorable for penetration and promotion, comes for Most patients Say nor preferred detection means.Previous experiences are relied on, specific PCR primer combination is designed for known position of fusion, Expand and be sequenced, the specific transposition site of detection fusion gene to entering performing PCR after the RNA reverse transcriptions that are extracted in tumor tissues, It is most accurate, convenient, economic method.Thus, it is found that new pathogenic position of fusion, and then design PCR primer and be beneficial to The further raising of the Xp11.2 transposition lesion detection degrees of accuracy.

The content of the invention

The purpose of the present invention is that not enough there is provided the new transposition companion of Xp11.2 a kind of for prior art above-mentioned.

It is a further object of the present invention to provide the detection primer of the new transposition companion.

It is yet another object of the invention to provide the application of primer.

The purpose of the present invention can be achieved through the following technical solutions：

The new transposition companion of Xp11.2 a kind of, is MATR3-TFE3 group translocations, and MATR3 genes are located at 5q31.2 (No. 5 dyes Colour solid, position 139273752-139331677, sequence comes from GeneBank, sequential version number GRCh38.p7), totally 19 show outside Son；Gene Fusion is betided between MATR3 15 exons and the exon of TFE3 genes 4.We pass through high-flux sequence The sample of the Xp11.2 tumor patients of the unknown fusion object of method detection, finds described Xp11.2 new transposition companion： MATR3-TFE3 group translocations, this site domestic and foreign literature do not reported, original TFE3 fusions amplimer also without Method detects this fusion, therefore can cause to fail to pinpoint a disease in diagnosis.

Described Xp11.2 new transposition companion preferably comprises the nucleotide sequence shown in SEQ ID NO.5.

Xp11.2 of the present invention new transposition companion is in MATR3-TFE3 transposition tumour diagnostic reagents are prepared Using.

A kind of PCR primer of detection MATR3-TFE3 transposition tumours, to detect MATR3-TFE3 bases of the present invention Because of the PCR primer of transposition.All primer pairs that can detect MATR3-TFE3 group translocations of the present invention are the present invention's In protection domain.

The new new transposition companion found for the present invention, we show in MATR3 15 exons and TFE3 4 extras Primer is separately designed in son.Design of primers principle is followed, primer is designed preferably in template cDNA conserved region, and primer length exists Between 15bp-30bp, primer G/C content is between 40%~60%, and annealing temperature is preferably close to 72 DEG C, primer itself and primer Between should not have a complementary series, amplified band is single special.Due to being frequently necessary to carry out in paraffin fixed preparation in work Work, paraffin specimen RNA fragmentations are serious, therefore amplified production should not be long, it is necessary to control in below 300bp.

By multiple debugging and verification, the primer sequence of final design is：MATR3-E15-F1： CAGTTCAGTGGGAGACGAGA(SEQ ID NO.1)；TFE3-E4-R1:GCGTTGGGTTCTCCAGAT (SEQ ID NO.2), The long 161bp of theoretical amplification product, the full sequence of amplified production (fusion) is as follows： CAGTTCAGTGGGAGACGAGACCGATCTTGCTAATTTAGGTGATGTGGCTTCTGATGGGAAAAAGGAACCATCAGATA AAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCAGCAAAGAAAAAGCTTAAAAAGGTGCAGACCCATCTGGAGAAC CCAACGC(SEQ ID NO.5).To ensure detection success rate, we have also been devised another pair substitute primer：Primer sequence is： MATR3-E15-F2：GGTGATGTGGCTTCTGATG(SEQ ID NO.3)；TFE3-E4-R2:CGAGTGTGGTGGACAGGT (SEQ ID NO.4), the long 184bp of theoretical amplification product, the full sequence of amplified production (fusion) is as follows： GGTGATGTGGCTTCTGATGGGAAAAAGGAACCATCAGATAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCAGC AAAGAAAAAGCTTAAAAAGGTGCAGACCCATCTGGAGAACCCAACGCGCTACCACCTGCAGCAGGCGCGCCGGCAGC AGGTGAAACAGTACCTGTCCACCACACTCG(SEQ ID NO.6).Experiments verify that, two pairs of primers can Successful amplification go out Purpose band, band is single, special.

Application of the PCR primer of the present invention in MATR3-TFE3 transposition tumour diagnostic reagents are prepared.

A kind of MATR3-TFE3 transpositions tumor diagnosis kit, including PCR primer of the present invention.

Beneficial effect：

The new position of fusion that the present invention has found for high-flux sequence devises specific PCR primer, expands original and draws The detection range of thing combination, applied to clinic, can improve the recall rate and accuracy rate for diagnosing such tumour.For diagnosis typing and point Sub- targeted therapy provides foundation.According to our experimental result, the specificity and sensitiveness of the primer combined diagnosis reach 100%, and operation object only needs to the progress in paraffin-embedded tissue section, the time is only three working days.Using the present invention The probe combinations of offer carry out detection MATR3-TFE3 transposition tumours, not only easily and fast, reliable but also recall rate it is high, can It is the fast and accurately diagnosis of MATR3-TFE3 transposition tumours for preparing MATR3-TFE3 transposition tumor diagnosis kits There is provided new instrument.

Brief description of the drawings

Fig. 1：In known MATR3-TFE3 pattern of fusion tumour (MATR3-E15-F1 is combined using primer of the present invention；TFE3- E4-R1) verified, the MATR3-TFE3 fusion sequencer maps that success is detected.

Fig. 2：Using present invention substitute primer combination (MATR3-E15-F2 in known MATR3-TFE3 pattern of fusion tumour； TFE3-E4-R2) verified, the MATR3-TFE3 fusion sequencer maps that success is detected.

Fig. 3：In the Xp11.2 tumor cases of unknown fusion object (MATR3-E15-F1 is combined using primer of the present invention； TFE3-E4-R1), the MATR3-TFE3 fusion sequencer maps that success is detected.

Fig. 4：Using present invention substitute primer combination (MATR3-E15- in the Xp11.2 tumor cases of unknown fusion object F2；TFE3-E4-R2), the MATR3-TFE3 fusion sequencer maps that success is detected.

Embodiment

The invention will be further elaborated by the following examples.

Embodiment 1 is directed to the case clarified a diagnosis and verified：

The case of the new position of fusion of MATR3exon15-TFE3exon4 is detected for high-flux sequence RNA-seq, is used The primer that we design is verified.

First, RNA extraction：

Extracted in strict accordance with RNeasy FFPE Kit operating instructions.1. dewax：The slide gathered is subjected to diformazan Benzene dewaxes, then is rinsed with absolute ethyl alcohol, is scraped off and is fitted into 1.5ml EP pipes with knife blade after air-drying；2. digest：Add 150 μ l digestive juices, add 10 μ l Proteinase Ks, mix, 56 DEG C of enzymolysis 15min, 80 DEG C of 15min, cooled on ice；3. 16 μ l are added DNDNA enzyme buffer liquids, add 10 μ l DNase I, mix, and are stored at room temperature 15mimin, 12000rpm centrifugation 15min, take Clearly；4. 320 μ l combination liquid liquid are added and add 720 μ l absolute ethyl alcohols, are mixed, are transferred in adsorption column points for 2 times, 8000rpm from Heart 1min, abandon waste liquid；5. wash：Add 500 μ l cleaning solutions, 8000rpm centrifugations 1min；Repeated washing once, abandons waste liquid, will Adsorption column is transferred in a new 2ml collecting pipe, 12000rpm centrifugations 5min；6. elute：Adsorption column is transferred to 1.5ml's In EP pipes, 100 μ l eluent is added, 1min, 12000rpm centrifugation 1min, by the eluent gathered (i.e. DNA is stored at room temperature Extract solution) concentration and purity testing are carried out, -80 DEG C are deposited stand-by.

2nd, reverse transcription PCR RT-PCR

Using kit (K1622, RevertAid First Strand cDNA Synthesis Kit, MBI) to RNA Reverse transcription is carried out, method refers to kit explanation.Pcr amplification primer thing combines for this patent MATR3-TFE3 fusions primer. Reaction system includes：0.125μl TaKaRa Ex Taq^TMHS liquid, 2.5 μ l 10 × Taq Buffer (Mg²⁺Plus), 2 μ l DNTP (is purchased from Japanese Takara companies), and primer concentration is 20 μm of ol/l, and cDNA masterplates are 100ng, and aseptic deionized water adds To 25 μ l.After PCR amplification conditions is 94 DEG C of denaturation 3min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, totally 35 circulations, last 72 DEG C extension 5min.3% agarose of PCR primer, voltage 100V, electrophoresis, Ethidum Eremide dyeing after observing result under ultraviolet light, And send sequencing.

As a result：Two couples of primer (MATR3-E15-F1/TFE3-E4-R1 of the present invention are used respectively；And MATR3-E15-F2/ TFE3-E4-R2) visible single special electrophoretic band after PCR, is sequenced to amplified production, obtains MATR3exon15- TFE3exon4 fusion gene sequences (Fig. 1, Fig. 2), it was demonstrated that the primer combination of this Project design is reliable and sensitive.

Embodiment 2 is detected for the Xp11.2 tumours of unknown transposition companion

We detect that RNA is carried at the Xp11.2 tumours to 35 unknown transposition companions using the primer combination of the present invention Take, reverse transcription PCR and sequence measurement ibid.

As a result：Primer combine detection is designed using the present invention, totally 1 detects MATR3-TFE3 fusions (Fig. 3, figure 4), by method validations such as immunohistochemistry, FISHs, real result is reliable.

Evaluate：Primer combination of the present invention is the supplement to original Xp11.2 fusions primer, covers TFF3 fusion bases Cause does not report site, adds the recall rate that RT-PCR method diagnoses the tumour.

<110>Nanjing General Hospital, PLA Nanjing Region

<120>The new transposition companion of Xp11.2 a kind of and its detection primer and application

<160> 6

<210> 1

<211> 22

<212> DNA

<213>Artificial sequence

<220>

<223>Primer MATR3-E15-F1

<400> 1

cagttcagtg ggagacgaga 20

<210> 2

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223>Primer TFE3-E4-R1

<400> 2

gcgttgggtt ctccagat 18

<210> 3

<211> 19

<212> DNA

<213>Artificial sequence

<220>

<223>Primer MATR3-E15-F2

<400> 3

ggtgatgtgg cttctgatg 19

<210> 4

<211> 18

<212> DNA

<213>Artificial sequence

<220>

<223>Primer TFE3-E4-R2

<400> 4

cgagtgtggt ggacaggt 18

<210> 5

<211> 161

<212> DNA

<213>Artificial sequence

<220>

<223>Fusion amplified production

<400> 5

cagttcagtg ggagacgaga ccgatcttgc taatttaggt gatgtggctt ctgatgggaa 60

aaaggaacca tcagataaag ctgtgaaaaa agatggaagt gcttcagcag cagcaaagaa 120

aaagcttaaa aaggtgcaga cccatctgga gaacccaacg c 161

<210> 6

<211> 184

<212> DNA

<213>Artificial sequence

<220>

<223>Fusion amplified production

<400> 6

ggtgatgtgg cttctgatgg gaaaaaggaa ccatcagata aagctgtgaa aaaagatgga 60

agtgcttcag cagcagcaaa gaaaaagctt aaaaaggtgc agacccatct ggagaaccca 120

acgcgctacc acctgcagca ggcgcgccgg cagcaggtga aacagtacct gtccaccaca 180

ctcg 184

Claims

1. a kind of Xp11.2 new transposition companion, it is characterised in that be MATR3-TFE3 group translocations, the gene is located at No. 5 dyeing Body, position 139273752-139331677, the sequential version number in GeneBank is GRCh38.p7, totally 19 extrons； Gene Fusion is betided between MATR3 15 exons and the exon of TFE3 genes 4.

2. Xp11.2 according to claim 1 new transposition companion, it is characterised in that include the core shown in SEQ ID NO.5 Nucleotide sequence or the nucleotide sequence shown in SEQ ID NO.6.

3. the new transposition companion of the Xp11.2 described in claim 1 is in MATR3-TFE3 transposition tumour diagnostic reagents are prepared Using.

4. a kind of PCR primer of detection MATR3-TFE3 transposition tumours, it is characterised in that described in test right requirement 1 The PCR primer of MATR3-TFE3 group translocations.

5. the PCR primer of detection MATR3-TFE3 transposition tumours according to claim 4, it is characterised in that selected from following Any pair of primer：The TFE3-E4-R1 shown in MATR3-E15-F1 and SEQ ID NO.2 shown in SEQ ID NO.1；Or The TFE3-E4-R2 shown in MATR3-E15-F2 and SEQ ID NO.4 shown in SEQ ID NO.3.

6. application of the PCR primer in MATR3-TFE3 transposition tumour diagnostic reagents are prepared described in claim 4 or 5.

7. a kind of MATR3-TFE3 transpositions tumor diagnosis kit, it is characterised in that including the PCR described in claim 4 or 5 Primer.