CN107267608B - A kind of MATR3 TFE3 fusions and its detection primer and application - Google Patents
A kind of MATR3 TFE3 fusions and its detection primer and application Download PDFInfo
- Publication number
- CN107267608B CN107267608B CN201710458099.3A CN201710458099A CN107267608B CN 107267608 B CN107267608 B CN 107267608B CN 201710458099 A CN201710458099 A CN 201710458099A CN 107267608 B CN107267608 B CN 107267608B
- Authority
- CN
- China
- Prior art keywords
- tfe3
- matr3
- primer
- pcr primer
- transposition
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
- C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
- C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
- C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
- C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
- C12Q2600/00—Oligonucleotides characterized by their use
- C12Q2600/112—Disease subtyping, staging or classification
Landscapes
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Engineering & Computer Science (AREA)
- Immunology (AREA)
- Pathology (AREA)
- Analytical Chemistry (AREA)
- Zoology (AREA)
- Genetics & Genomics (AREA)
- Wood Science & Technology (AREA)
- Physics & Mathematics (AREA)
- Biotechnology (AREA)
- Microbiology (AREA)
- Molecular Biology (AREA)
- Hospice & Palliative Care (AREA)
- Biophysics (AREA)
- Oncology (AREA)
- Biochemistry (AREA)
- Bioinformatics & Cheminformatics (AREA)
- General Engineering & Computer Science (AREA)
- General Health & Medical Sciences (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a kind of MATR3 TFE3 fusions and its detection primer and application.Fusion of the present invention is merged by producer between MATR3 15 exons and the exon of TFE3 genes 4 and formed；Wherein, MATR3 genes are located at No. 5 chromosomes, and position is 139,273,752 139331677, and the sequential version number in GeneBank is GRCh38.p7, totally 19 extrons.A kind of PCR primer of detection MATR3 TFE3 transposition tumours, to detect the PCR primer of MATR3 TFE3 fusions.Application of the PCR primer in MATR3 TFE3 transposition tumour diagnostic reagents are prepared.PCR primer of the present invention, the detection range of former primer combination is expanded, applied to clinic, the recall rate and accuracy rate for diagnosing such tumour can be improved.
Description
Technical field
The invention belongs to field of medical examination, is related to a kind of MATR3-TFE3 fusions and its detection primer and application.
Background technology
WHO in 2004 was modified to clear-cell carcinoma Pathological cassification in 1997, increased newly Xp11.2 transpositions/
TFE3 Gene Fusion correlations kidney (Xp11.2 transpositions kidney).TFE3 genes are located at XP11.2, are Xp11.2 transposition kidneys
Unique driving gene of cancer, its pathogenesis clear and definite：This kind of tumour all refers to the TFE3 genes positioned at Xp11.2 with other
Chromosome translocation and its caused formation fusion, by promoter conversion so as to high expression TFE3 fusion proteins, and TFE3 makees
For a transcription factor, by being combined with special DNA structure, in transcriptional control body, several genes expression is final causes a disease.Mesh
Preceding at least 10 kinds different transposition companions and fusion are reported, including ASPL-TFE3, PRCC-TFE3, SFPQ-TFE3,
NONO-TFE3, CLTC-TFE3, LUC7L3-TFE3, KHSRP-TFE3, PARP14-TFE3, DVL2-TFE3 and RBM10-TFE3
Deng every intra-tumor only exists single translocated forms.In addition to clear-cell carcinoma, leaf tumour equally exists TFE3 between some soft tissues
The pathogenic group translocation of gene, including alveolar soft part sarcoma, part epithelioid pericyte tumour etc., these leaves
Tumour and Xp11.2 transpositions kidney are referred to as Xp11.2 transposition tumours together.
Xp11.2 transposition tumours are a rare tumor types, although its overall incidence is very low, are suffered from renal cell carcinoma in children
About 1/3 is such kidney in person, and retrospective study shows that such tumour is not uncommon in China.The disease is with age of onset
Light is prominent features, therefore causes extremely heavy family and burden on society.And research is it has proven convenient that Xp11.2 transposition kidneys are pre-
After than non-Xp11.2 transpositions kidney poor prognosis, and the prognosis of different genes type Xp11.2 transposition kidneys area
Not.In addition, there is positive evidence to show the patient of Xp11.2 transposition tumours to vascular endothelial growth factor receptor (vascular
Endothelial growth factor receptor, VEGFR) or mammal rapamycin (mammalian target
Of rapamycin, mTOR) molecular targeted therapy sensitivity.Separately there are some researches show MET EGFR-TKs merge for ASPL-TFE3
The target gene of gene, and it is expected to the therapy target as Xp11.2 transposition tumours.Therefore, according to genotype come Precise Diagnosis this
Class tumour seems particularly significant.
The detection method of currently used diagnosis Xp11.2 transposition tumours mainly includes immunohistochemistry and fluorescence is former
Position hybridization.Immunohistochemical detection nucleus TFE3 fusion proteins are directly perceived, quick, price is low, but its shortcoming is that this method is held
It is vulnerable to many factors influence, such as organizes set time, tissue repair mode, antibody cloning number and artificial interpretation factor
Deng so that result is likely to occur false positive or false negative.Chromosome fluorescence in-situ hybridization (FISH) starts from traditional cytogenetics
The combination with DNA technique is learned, rapid sensitive, specificity are good, can detect concealment or small chromosome aberration and complicated core
Type；A variety of fluorescence labelings can also be used, the relative position and direction, space orientation between display DNA fragmentation and gene are accurate.
But both detection methods can only prompt the high expression or the transposition of TFE3 genes that TFE3 albumen be present, can not specify in tumour
The specific transposition occurred changes.The transposition companion of accurate detection Xp11.2 transposition tumours and fusion site, are not only to suffer from
The foundation of person's prognosis prediction, and the guidance of following targeted therapy, therefore, specify the group translocation position of Xp11.2 transposition tumours
Point, there is important clinical meaning.
Xp11.2 transposition tumours are heterogeneous larger tumor types between a kind of each individual, the fusion base being currently known
Because form just include ASPL-TFE3, PRCC-TFE3, SFPQ-TFE3, NONO-TFE3, CLTC-TFE3, LUC7L3-TFE3,
KHSRP-TFE3, PARP14-TFE3, DVL2-TFE3 and RBM10-TFE3 etc. more than ten is planted.
High-flux sequence is the detection means that can uniquely specify unknown transposition site at present, but high-flux sequence expense
High, detection cycle length, detection platform is rare, requires high to sample quality, is unfavorable for popularizing, comes for Most patients
Say nor preferred detection means.Previous experiences are relied on, specific PCR primer combination is designed for known position of fusion,
Enter performing PCR afterwards to the RNA reverse transcriptions extracted in tumor tissues to expand and be sequenced, the specific transposition site of detection fusion gene,
It is most accurate, convenient, economic method.Thus, it is found that new pathogenic position of fusion, and then design PCR primer and be beneficial to
The further raising of the Xp11.2 transposition lesion detection degrees of accuracy.
The content of the invention
The purpose of the present invention is the above-mentioned deficiency for prior art, there is provided a kind of MATR3-TFE3 fusions.
It is a further object of the present invention to provide the detection primer of the MATR3-TFE3 fusions.
It is yet another object of the invention to provide the application of primer.
The purpose of the present invention can be achieved through the following technical solutions：
A kind of MATR3-TFE3 fusions, the fusion by MATR3 15 exons and the extra of TFE3 genes 4
Producer fusion forms between aobvious son；Wherein, MATR3 genes are located at No. 5 chromosomes, position 139273752-
139331677, the sequential version number in GeneBank is GRCh38.p7, totally 19 extrons.We pass through high-flux sequence
The sample of the Xp11.2 tumor patients of the unknown fusion object of method detection, find described Xp11.2 new transposition companion：
MATR3-TFE3 group translocations, this site domestic and foreign literature do not reported, original TFE3 fusions amplimer also without
Method detects this fusion, therefore can cause to fail to pinpoint a disease in diagnosis.
Described MATR3-TFE3 fusions preferably comprise the nucleotide sequence shown in SEQ ID NO.5.
The detection reagent of MATR3-TFE3 fusions of the present invention is examined in preparation MATR3-TFE3 transposition tumours
Application in disconnected reagent.
A kind of PCR primer of detection MATR3-TFE3 transposition tumours, melt to detect MATR3-TFE3 of the present invention
Close the PCR primer of gene.All primer pairs that can detect MATR3-TFE3 fusions of the present invention are the present invention's
In protection domain.
For the new MATR3-TFE3 fusions that find of the present invention, our 15 exons and TFE3 in MATR3
4 exons in separately design primer.Design of primers principle is followed, primer preferably designs in template cDNA conserved region,
Primer length is between 15bp-30bp, and primer G/C content is between 40%~60%, and annealing temperature is preferably close to 72 DEG C, primer
There should not be complementary series between itself and primer, amplified band is single special.Due to being frequently necessary to fix in work in paraffin
Carried out the work in sample, paraffin specimen RNA fragmentations are serious, therefore amplified production should not be long, it is necessary to control in below 300bp.
By multiple debugging and verification, the primer sequence of final design is：MATR3-E15-F1：
CAGTTCAGTGGGAGACGAGA(SEQ ID NO.1)；TFE3-E4-R1:GCGTTGGGTTCTCCAGAT (SEQ ID NO.2),
The long 161bp of theoretical amplification product, the full sequence of amplified production (fusion) are as follows：
CAGTTCAGTGGGAGACGAGACCGATCTTGCTAATTTAGGTGATGTGGCTTCTGATGGGAAAAAGGAACCATCAGATA
AAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCAGCAAAGAAAAAGCTTAAAAAGGTGCAGACCCATCTGGAGAAC
CCAACGC(SEQ ID NO.5).Success rate is detected to ensure, we have also been devised another pair substitute primer：Primer sequence is：
MATR3-E15-F2：GGTGATGTGGCTTCTGATG(SEQ ID NO.3)；TFE3-E4-R2:CGAGTGTGGTGGACAGGT
(SEQ ID NO.4), the long 184bp of theoretical amplification product, the full sequence of amplified production (fusion) are as follows：
GGTGATGTGGCTTCTGATGGGAAAAAGGAACCATCAGATAAAGCTGTGAAAAAAGATGGAAGTGCTTCAGCAGCAGC
AAAGAAAAAGCTTAAAAAGGTGCAGACCCATCTGGAGAACCCAACGCGCTACCACCTGCAGCAGGCGCGCCGGCAGC
AGGTGAAACAGTACCTGTCCACCACACTCG(SEQ ID NO.6).Experiments verify that two pairs of primers can Successful amplification go out
Purpose band, band are single, special.
Application of the PCR primer of the present invention in MATR3-TFE3 transposition tumour diagnostic reagents are prepared.
A kind of MATR3-TFE3 transpositions tumor diagnosis kit, including PCR primer of the present invention.
Beneficial effect：
The new position of fusion that the present invention has found for high-flux sequence devises specific PCR primer, expands original and draws
The detection range of thing combination, applied to clinic, the recall rate and accuracy rate for diagnosing such tumour can be improved.For diagnosis typing and divide
Sub- targeted therapy provides foundation.According to our experimental result, the specificity and sensitiveness of the primer combined diagnosis reach
100%, and operation object only needs to carry out in paraffin-embedded tissue section, the time is only three working days.Using the present invention
The probe combinations of offer carry out detecting MATR3-TFE3 transposition tumours, not only easily and fast, reliable but also recall rate it is high, can
It is the fast and accurately diagnosis of MATR3-TFE3 transposition tumours for preparing MATR3-TFE3 transposition tumor diagnosis kits
Provide new instrument.
Brief description of the drawings
Fig. 1：Using primer of the present invention combination (MATR3-E15-F1 in known MATR3-TFE3 pattern of fusion tumour；TFE3-
E4-R1) verified, the MATR3-TFE3 fusion sequencer maps that success detects.
Fig. 2：Using present invention substitute primer combination (MATR3-E15-F2 in known MATR3-TFE3 pattern of fusion tumour；
TFE3-E4-R2) verified, the MATR3-TFE3 fusion sequencer maps that success detects.
Fig. 3：Using primer of the present invention combination (MATR3-E15-F1 in the Xp11.2 tumor cases of unknown fusion object；
TFE3-E4-R1), the MATR3-TFE3 fusion sequencer maps that success detects.
Fig. 4：Using present invention substitute primer combination (MATR3-E15- in the Xp11.2 tumor cases of unknown fusion object
F2；TFE3-E4-R2), the MATR3-TFE3 fusion sequencer maps that success detects.
Embodiment
The invention will be further elaborated by the following examples.
Embodiment 1 is directed to the case clarified a diagnosis and verified：
The case of the new position of fusion of MATR3 exon15-TFE3 exon4 is detected for high-flux sequence RNA-seq, is made
The primer designed with us is verified.
First, RNA extraction：
Extracted in strict accordance with RNeasy FFPE Kit operating instructions.1. dewax：The slide gathered is subjected to diformazan
Benzene dewaxes, then is rinsed with absolute ethyl alcohol, is scraped off and is fitted into 1.5ml EP pipes with knife blade after air-drying；2. digest：Add 150
μ l digestive juices, 10 μ l Proteinase Ks are added, mixed, 56 DEG C digest 15min, 80 DEG C of 15min, cooled on ice；3. add 16 μ l
DNDNA enzyme buffer liquids, 10 μ l DNase I are added, mixed, be stored at room temperature 15mimin, 12000rpm centrifugation 15min, take
Clearly；4. adding 320 μ l combination liquid liquid adds 720 μ l absolute ethyl alcohols, mix, be transferred in adsorption column points for 2 times, 8000rpm from
Heart 1min, abandon waste liquid；5. wash：Add 500 μ l cleaning solutions, 8000rpm centrifugations 1min；Repeated washing once, abandons waste liquid, will
Adsorption column is transferred in a new 2ml collecting pipe, 12000rpm centrifugations 5min；6. elute：Adsorption column is transferred to 1.5ml's
In EP pipes, 100 μ l eluent is added, is stored at room temperature 1min, 12000rpm centrifugations 1min, eluent (the i.e. DNA that will be gathered
Extract solution) carry out concentration and purity testing, -80 DEG C deposit it is stand-by.
2nd, reverse transcription PCR RT-PCR
Using kit (K1622, RevertAid First Strand cDNA Synthesis Kit, MBI) to RNA
Reverse transcription is carried out, method refers to kit explanation.Pcr amplification primer thing combines for this patent MATR3-TFE3 fusions primer.
Reaction system includes：0.125μl TaKaRa Ex TaqTMHS liquid, 2.5 μ l 10 × Taq Buffer (Mg2+Plus), 2 μ l
DNTP (is purchased from Japanese Takara companies), and primer concentration is 20 μm of ol/l, and cDNA masterplates are 100ng, and aseptic deionized water adds
To 25 μ l.After PCR amplification conditions are 94 DEG C of denaturation 3min, 94 DEG C of 30s, 60 DEG C of 30s, 72 DEG C of 1min, totally 35 circulations, last 72
DEG C extension 5min.3% agarose of PCR primer, voltage 100V, electrophoresis, Ethidum Eremide dyeing after observing result under ultraviolet light,
And send sequencing.
As a result：Two couples of primer (MATR3-E15-F1/TFE3-E4-R1 of the present invention are used respectively；And MATR3-E15-F2/
TFE3-E4-R2) visible single special electrophoretic band after PCR, is sequenced to amplified production, obtains MATR3 exon15-
TFE3 exon4 fusion gene sequences (Fig. 1, Fig. 2), it was demonstrated that the primer combination of this Project design is reliable and sensitive.
Embodiment 2 is detected for the Xp11.2 tumours of unknown transposition companion
We are detected the Xp11.2 tumours to 35 unknown transposition companions using the primer combination of the present invention, and RNA is carried
Take, reverse transcription PCR and sequence measurement are same as above.
As a result：Primer combine detection is designed using the present invention, totally 1 detects MATR3-TFE3 fusions (Fig. 3, figure
4), verify that real result is reliable by the methods of immunohistochemistry, FISH.
Evaluation：Primer combination of the present invention is the supplement to original Xp11.2 fusions primer, covers TFF3 fusion bases
Cause does not report site, adds the recall rate that RT-PCR method diagnoses the tumour.
<110>Nanjing General Hospital, PLA Nanjing Region
<120>A kind of MATR3-TFE3 fusions and its detection primer and application
<160> 6
<210> 1
<211> 22
<212> DNA
<213>Artificial sequence
<220>
<223>Primer MATR3-E15-F1
<400> 1
cagttcagtg ggagacgaga 20
<210> 2
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>Primer TFE3-E4-R1
<400> 2
gcgttgggtt ctccagat 18
<210> 3
<211> 19
<212> DNA
<213>Artificial sequence
<220>
<223>Primer MATR3-E15-F2
<400> 3
ggtgatgtgg cttctgatg 19
<210> 4
<211> 18
<212> DNA
<213>Artificial sequence
<220>
<223>Primer TFE3-E4-R2
<400> 4
cgagtgtggt ggacaggt 18
<210> 5
<211> 161
<212> DNA
<213>Artificial sequence
<220>
<223>Fusion amplified production
<400> 5
cagttcagtg ggagacgaga ccgatcttgc taatttaggt gatgtggctt ctgatgggaa 60
aaaggaacca tcagataaag ctgtgaaaaa agatggaagt gcttcagcag cagcaaagaa 120
aaagcttaaa aaggtgcaga cccatctgga gaacccaacg c 161
<210> 6
<211> 184
<212> DNA
<213>Artificial sequence
<220>
<223>Fusion amplified production
<400> 6
ggtgatgtgg cttctgatgg gaaaaaggaa ccatcagata aagctgtgaa aaaagatgga 60
agtgcttcag cagcagcaaa gaaaaagctt aaaaaggtgc agacccatct ggagaaccca 120
acgcgctacc acctgcagca ggcgcgccgg cagcaggtga aacagtacct gtccaccaca 180
ctcg 184
Claims (6)
- A kind of 1. MATR3-TFE3 fusions, it is characterised in that the fusion by MATR3 15 exons and TFE3 Producer fusion forms between the exon of gene 4；Wherein, MATR3 genes are located at No. 5 chromosomes, and position is 139273752-139331677, the sequential version number in GeneBank are GRCh38.p7, totally 19 extrons；Described MATR3-TFE3 fusions include the nucleotides shown in nucleotide sequence or SEQ ID NO.6 shown in SEQ ID NO.5 Sequence.
- 2. the detection reagent of the MATR3-TFE3 fusions described in claim 1 is examined in preparation MATR3-TFE3 transposition tumours Application in disconnected reagent.
- 3. a kind of PCR primer of detection MATR3-TFE3 transposition tumours, it is characterised in that the PCR primer will for test right Seek the PCR primer of the MATR3-TFE3 fusions described in 1.
- 4. the PCR primer of detection MATR3-TFE3 transposition tumours according to claim 3, it is characterised in that selected from following Any pair of primer：The TFE3-E4-R1 shown in MATR3-E15-F1 and SEQ ID NO.2 shown in SEQ ID NO.1；Or The TFE3-E4-R2 shown in MATR3-E15-F2 and SEQ ID NO.4 shown in SEQ ID NO.3.
- 5. application of the PCR primer in MATR3-TFE3 transposition tumour diagnostic reagents are prepared described in claim 3 or 4.
- 6. a kind of MATR3-TFE3 transpositions tumor diagnosis kit, it is characterised in that the kit includes claim 3 or 4 Described PCR primer.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710458099.3A CN107267608B (en) | 2017-06-16 | 2017-06-16 | A kind of MATR3 TFE3 fusions and its detection primer and application |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN201710458099.3A CN107267608B (en) | 2017-06-16 | 2017-06-16 | A kind of MATR3 TFE3 fusions and its detection primer and application |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN107267608A CN107267608A (en) | 2017-10-20 |
| CN107267608B true CN107267608B (en) | 2018-03-09 |
Family
ID=60067757
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN201710458099.3A Active CN107267608B (en) | 2017-06-16 | 2017-06-16 | A kind of MATR3 TFE3 fusions and its detection primer and application |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN107267608B (en) |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| GB9616986D0 (en) * | 1996-08-13 | 1996-09-25 | Cancer Res Campaign Tech | Materials and methods relating to the diagnosis and prophylactic and therapeutic treatment of papillary renal cell carcinoma |
| US8603948B2 (en) * | 2007-10-31 | 2013-12-10 | Cancer Genetics, Inc. | Panel for the detection and differentiation of renal cortical neoplasms |
| US8980554B2 (en) * | 2010-07-26 | 2015-03-17 | The Johns Hopkins University | Genetic make-up modifies cancer outcome |
| CN102424848B (en) * | 2011-12-26 | 2013-04-24 | 中国人民解放军南京军区南京总医院 | Probe combination for diagnosing Xp11.2 translocation renal cancer and application thereof |
| CN103952493B (en) * | 2014-05-20 | 2016-06-08 | 南京大学医学院附属鼓楼医院 | The fluorescence in situ hybridization polyclone separate probe of renal carcinoma and test kit application thereof |
| CN104212889B (en) * | 2014-08-19 | 2017-06-06 | 中国人民解放军南京军区南京总医院 | A kind of probe combinations and its application for diagnosing Xp11.2 transpositions blood vessel week epithelioid cell's tumour |
| CN104388423B (en) * | 2014-10-28 | 2018-01-05 | 南京大学医学院附属鼓楼医院 | ASPL TFE3 amalgamation kidney gene probes and its kit application |
-
2017
- 2017-06-16 CN CN201710458099.3A patent/CN107267608B/en active Active
Non-Patent Citations (2)
| Title |
|---|
| eview of renal carcinoma associated with Xp11 .2 translocations/TFE3 gene fusions with focus on pathobiological aspect;Naoto Kuroda等;《Histol Histopathol》;20120229;第27卷(第2期);133-140 * |
| Xp11.2易位性肾癌的研究进展;黄剑华等;《癌症》;20080930;第27卷(第9期);1006-1008 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN107267608A (en) | 2017-10-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN107365783B (en) | A kind of new fusion of MiT families transposition clear-cell carcinoma and its detection primer and application | |
| CN106434870A (en) | ncRNA and uses thereof | |
| CN105483218A (en) | Seminal plasma piRNA markers or their combination for detecting and/or predicting male reproductive dysfunction and application thereof | |
| CN110564850B (en) | EWSR1-TFEB fusion gene and detection primer and application thereof | |
| CN107130027A (en) | Application of the biomarker in colorectal cancer | |
| CN108315422B (en) | A kind of CLTC-TFEB fusion and its detection primer and application | |
| CN109161593A (en) | The application of circular rna and microRNA in colorectal cancer sieving and diagnosis | |
| CN107299134B (en) | It is a kind of for diagnosing the PCR primer combination and its application of PRCC-TFE3 transposition tumour | |
| CN108949969A (en) | Application of the long-chain non-coding RNA in colorectal cancer | |
| CN109022433B (en) | New translocation partner of TFEB (TFEB), detection primer and application thereof | |
| CN107287326B (en) | The new transposition companion FUBP1 of Xp11.2 a kind of and its detection primer and application | |
| CN109182519B (en) | It is a kind of for diagnosing the probe combinations and its application of ACTA2-MITF transposition blood vessel week epithelioid cell's tumour | |
| CN109022466B (en) | ACTA2-MITF fusion gene and detection primer and application thereof | |
| CN107267608B (en) | A kind of MATR3 TFE3 fusions and its detection primer and application | |
| KR101064561B1 (en) | Bio marker for predicting early-relapse after operation for lung adenocarcinoma | |
| CN109022434B (en) | Probe combination for diagnosing ACTB-TFEB (active transcription factor receptor-responsive element binding) translocation renal cancer and application thereof | |
| JPH08500731A (en) | Diagnostic method | |
| JP2005518790A (en) | Method for diagnosing abnormal proliferation of lymphocytes | |
| CN110157806A (en) | A kind of kit detecting EML4-ALK and its detection method and application | |
| CN105316350B (en) | Mycobacterium tuberculosis EmbB mutators and application thereof | |
| CN109880908A (en) | The reagent and kit of slow grain rapid change period are diagnosed based on hnRNPA1 splice variant | |
| CN109136379A (en) | Detect oligonucleotides, method and the kit of NonO-TFE3 fusion in sample | |
| CN102965447A (en) | Alzheimer's disease (AD) lesion early-stage APOE-4 gene mRNA (messenger ribonucleic acid) level in-situ hybridization screening kit, as well as screening method and application thereof | |
| CN103266181B (en) | Kit for detecting transthyretin (TTR) gene mutant G307C | |
| CN110257411B (en) | Probe combination for diagnosing EWSR1-TFEB translocation renal carcinoma and application thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| PB01 | Publication | ||
| PB01 | Publication | ||
| SE01 | Entry into force of request for substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| GR01 | Patent grant | ||
| GR01 | Patent grant |