WO2007056826A1 - Multitargeting interfering rnas and methods of their use and design - Google Patents
Multitargeting interfering rnas and methods of their use and design Download PDFInfo
- Publication number
- WO2007056826A1 WO2007056826A1 PCT/AU2006/001741 AU2006001741W WO2007056826A1 WO 2007056826 A1 WO2007056826 A1 WO 2007056826A1 AU 2006001741 W AU2006001741 W AU 2006001741W WO 2007056826 A1 WO2007056826 A1 WO 2007056826A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- target
- rna molecule
- interfering rna
- sequence
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/111—General methods applicable to biologically active non-coding nucleic acids
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7105—Natural ribonucleic acids, i.e. containing only riboses attached to adenine, guanine, cytosine or uracil and having 3'-5' phosphodiester links
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/7115—Nucleic acids or oligonucleotides having modified bases, i.e. other than adenine, guanine, cytosine, uracil or thymine
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/712—Nucleic acids or oligonucleotides having modified sugars, i.e. other than ribose or 2'-deoxyribose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/70—Carbohydrates; Sugars; Derivatives thereof
- A61K31/7088—Compounds having three or more nucleosides or nucleotides
- A61K31/713—Double-stranded nucleic acids or oligonucleotides
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/16—Antivirals for RNA viruses for influenza or rhinoviruses
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1135—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against oncogenes or tumor suppressor genes
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1136—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against growth factors, growth regulators, cytokines, lymphokines or hormones
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1138—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against receptors or cell surface proteins
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2320/00—Applications; Uses
- C12N2320/50—Methods for regulating/modulating their activity
Definitions
- the present invention concerns methods and reagents useful jn modulating gene expression. Particularly, the invention relates to modulating gene expression using a multitargeting interfering RNA molecule that targets multiple target sites on one or more preselected RNA molecules.
- RNA interference is a diverse, evohitio ⁇ arfly conserved mechanism in eukaryot ⁇ c cells, which inhibits flic transcription and translation of target genes in a sequence-specific manner
- RfSTA RNA interference
- Some such mechanisms tolerate variation in the amount of sequence complementarity required between the modulatory (or interfering) RNA and the target RNA.
- Certain microRNAs can lranslationally repress target mRNA having as litrlc as 6 nucleotides of complementarity with the m ⁇ croRNA.
- RNA interfering agents * for example, using double-stranded RNA to repress expression of disease-related genes is currently an area of intense research activity.
- Double-stranded RNA of 19-23 bases in length is recognized by an RNA interference silencing complex (RISC) into which an effector ⁇ lrand (or "guide strand") of the KNA is loaded
- RISC RNA interference silencing complex
- This guide strand acts as a template for the recognition and destruction of highly complementary sequences present in the trunseriptome.
- interfering RNAs may induce translatiorial repression without mRNA degradation.
- I ⁇ inslationa] repression appears to be a mechanism of action of endogenous ⁇ u ' croRNAs, a group of short non-coding RNAs involved in differentiation and development.
- RNAsRNAs tl ⁇ uble-stranded RNAs
- dsRNAs tl ⁇ uble-stranded RNAs
- dsRNAs particularly those designed against one target, may have at least two categories of off-target side effects that need to be avoided or minimized.
- Undesirable side effects can arise through the triggering of innate immune response pathways (e.g.
- Some bioinfbrmatic and/or experimental approaches have been developed to try to minimize olf-target effects.
- Algorithms for in silica hybridization arc known, and others have been developed for predicting target accessibility and loading bias in an eU ⁇ rt to eliminate or minimize side-effects while maintaining effectiveness.
- RNA molecules for potentially treating human diseases of viral and nonvhai origin are in various stages of development.
- the diseases include Age-related Macular Degeneration, Amyotrophic T-ateral Sclerosis (ALS), and Respiratory Syncytial Virus (RSV) infection.
- ALS Amyotrophic T-ateral Sclerosis
- RSV Respiratory Syncytial Virus
- RNA interference may be useful and potent in obtaining knock-down of specific gene products, many diseases involve complex interactions between ontologically- unrelated gene products. Multiple putative targets can be identified for a single disease. Attempts to confirm that inhibiting these targets one by one is therapeutically valuable have been disappointing.
- obtai ning therapeutic effectiveness is proving to be extremely challenging, probably because of multiple levels of redundancy in most signaling pathways.
- many disorders such as cancer, type 2 diabetes, and atherosclerosis, feature multiple biochemical abnormalities.
- some putative targets may be subject to enhanced mutation rates, thereby negating the effects of interfering RNAs on any such target.
- viruses such as Severe Acute Respiratory Syndrome (“SARS”) and Avian Influenza Virus (“bird flu”) exemplify these challenges.
- SARS Severe Acute Respiratory Syndrome
- Avian Influenza Virus bird flu
- viruses such as those involved ill Acquired Immunodeficiency Syndrome or AIDS (e.g. Human Immunodeficiency Viruses, HIV-I and HIV-2), continue to defy efforts at treatment and vaccination because of on-going viral ⁇ mlalio ⁇ and evolution.
- nucleic acid therapeutics such as interfering RNAs arc candidates for viral therapy, in part because modem rapid gene sequencing techniques allow viral genome sequences to be determined even before any encoded functions can be assessed, the error-prone replication of viruses, particularly RNA viruses, means that substantia! genomic diversity can arise rapidly in an infected population. Tims far, strategies for the development of nucleic acid therapeutics have largely centered on the targeting of highly-conserved regions of the viral genome. It is unclear whether these constructs arc efficient at treating viral infection or preventing emergence of resistant viral clones.
- interfering RNAs which can target multiple pie-selected target sequences within one or more target genes to modulate expression of the targets. Methods for the design and for making such therapeutic mult.i targeting interfering RNAs are also needed.
- Antiviral interfering RNAs thai can be developed rapidly upon the isolation and identification of new viral pathogens and that can be used to help slow, or even prevent, the emergence of new, resistant isotypes are also needed.
- Interfering RNA molecules arc now designed and produced with specificity for multiple binding sequences present in distinct genetic contexts in one or more pre-selected target RNA molecules and arc used to decrease expression of the target sequences.
- this invention relates to a iiiullilargeting interfering RNA molecule comprising a guide strand of the Formula (1):
- S is completely complementary to the first portion of each of at least two binding sequences and also preferably, the first portion of each of at least two binding sequences is a seed sequence.
- X can consist of one or two nucleotides and Y can independently be at least partially complementary to a second portion of each of the binding sequences, said second portion is adjacent to and connected with the 5'-end of said first portion of the binding sequences.
- S is of a length of about 8 to about 15 nucleotides.
- XSY is preferably of a length of about 17 to about 25 nucleotides.
- the multitargeiing interfering RNA molecules ⁇ f this invention further comprise a passenger strand that is at least partially complementary to the guide strand Io allow formation of a stable duplex between the passenger strand and the guide strand and these RNA molecules preferably include one or more terminal overhangs and these overhangs preferably are of between 1 to 5 nucleotides.
- the passenger strand and the guide strand arc completely complementary to each other. It is possible for the inultitargeting interfering RNA molecules of this invention to target binding sctjuences prcse.nl in distinct genetic contexts in one or alternatively in at least. 2 pre-selected target RNA molecules.
- At least one of the pre-sclccted target RNA molecules is a tion- coding RNA molecule.
- at least one of the pre-selected target RNA molecules can be a messenger RNA molecule and preferably one or more of the prc-sclected target
- RNA molecules are involved in a disease or disorder.
- the disease is a human disease.
- at least one of the binding sequences is present in the 3'-u ⁇ uraiis]aled region (3'UTR) of a messenger RNA molecule.
- one or more of the prc-selected target RNA molecules encode a protein of a class selected from the group consisting of receptors, cytokines, transcription factors, regulatory proteins, signaling proteins, cytoskeleta) proteins, transporters, enzymes, hormones, and antigens.
- lhe one or more of the pre-selectcd target RNA molecules encode u protein selected from the group consisting of ICAM-1, VEC]F-A, MCP-I, IL-K, VEGF- R, ICiF-I, Gluc ⁇ p, Inppl I , bFGF.
- the multitargeting interfering RNA molecule decreases expression of any combination ⁇ f VEGF- A. ⁇ -ras and TCcl-2 in an expression system ⁇ r alternatively decreases expression of both MALAT-1 and BIC in an expression system or still alternatively decreases expression of both ICAM- 1 and VEGF-A in an expression system.
- muititargeti ⁇ g interfering RNA molecules decrease expression of both TGF ⁇ and IL-8 in an expression system or alternatively decrease expression of both IL-8 and MCT-I in an expression system.
- the mulliturgeting interfering RNA molecules of this invention can also further be manufactured to comprise a guide strand that tbmis stable interactions with at least two binding sequences present in distinct genetic contexts in one or more pre-sclccted target RNA molecules.
- one or more of the pre-sclcetod target RNA molecules is viral RNA
- the virus is preferably selected from the group consisting of a human immunodeficiency virus (ITIV), a hepatitis C vims (HCV), an influenza virus, a rhinovirus, and a severe acute respiratory syndrome (SARS) virus.
- IIV human immunodeficiency virus
- HCV hepatitis C vims
- influenza virus preferably hepatitis C vims
- SARS severe acute respiratory syndrome
- the pre-selected target RNA molecules preferably encode an essential protein selected from the group consisting of ClAG, PC ) L, VIF, VPR, TAT, NEF, RBV, VPU and ENV.
- the vims is TTCV
- one or more of the other preselected RNA molecules encodes TN Fa.
- the molecules preferably comprise at least one modified ribonucleotide, universal " base, acyclic nucleotide, abasic nucleotide, ⁇ on-ribonucleolide or combinations thereof.
- S consists essentially of a nucleotide sequence selected from the group consisting of:
- GUGCUCAUGGUG GSEQ ED NO: 79 CCUGGAGCCCUG (SEQ ID NO: 80), UCUCAGCUCXAC (SEQ ED NO: 81), ACCCUCGCACC (SEQ ID NO: 86), GUGUUGAAG (SEQ TD NO: 88), UUCCACAAC (SEQ ID NO: 90), UCCACUGUC (SEQ ID NO: 92), CACiAAUAG (SEQ ID NO: 93), AACUCUCUA (SEQ TD NO: 94) and CC,UGAAGAC (SEQ ID NO: 98).
- S consists essentially of a nucleotide sequence selected from the group consisting of: UAUGU CKiGUGGG (SEQ ID NO: 1), UCCUCACAGCKJ (SRQ ID NO: 78), CIUGUUGAAG (SEQ ID NO: 88), UUCCACAAC (SHQ ID NO: 90), AACUCUCUA (SEQ ID NO; 94) and CGUGAAGAC (SEQ TD NO: 98).
- S consists essentially of a nucleotide sequence of 6 or more contiguous bases contained within any of the sequences selected from the group consisting ' of: UAUGUGGGUGGG (SEQ ED NO: 1), UCCUCACAGGG (SEQ ID NO: 7X), GUGUUGAACI (SEQ ID NO: 88), UU(XACAAC (SEQ E) NO: 90), AACUCUCUA (SEQ ID NO: 94) and CXJUC]A AGAC (SEQ ID NO: 98).
- the multitargcting interfering RNA molecule consists essentially of:
- OLher exemplary Multiiargeting interfering RNA molecules include:
- the above mulli targeting interfering RNA molecules also include at least one modified ribonucleotide, universal base, acyclic nucleotide, abasic nucleotide and non- ribo ⁇ ucleotide, overhung variation or a combination thereof.
- the invention in another aspect of this invention, relates to a biological system comprising the multitargcting interfering RNA molecules of this invention and those preferred biological systems include a vims, a microbe, a cell, a plant, or an animal, Vectors comprising a nucleotide sequence that encodes the multitargeting interfering RNA molecules of this invention are also contemplated.
- Preferred vectors are viral vectors.
- Preferred viral vectors are selected from the group consisting of an itdeno-ass ⁇ oiuted virus, a retrovirus, an adenovirus, a le ⁇ tivirus, and an alphaviras.
- the invention also relates to cells comprising the vectors ⁇ f this invention.
- the multitargeting interfering KNA molecules of this invention can also be short hairpin RNA molecules.
- the invention further relates to pharmaceutical compositions comprising the multitargeting interfering RNA molecules of this invention and an acceptable carrier.
- the composition can include a vector comprising the RNA molecule and an acceptable carrier.
- the invention further relates to methods of using the multitargeting interfering RNA molecules of this invention.
- the method includes inducing RNA interference in a biological system, comprising the step of introducing a multitargeting interfering RNA molecule of this invention into the biological system. More specifically, the invention relates to methods of inducing RNA interference in a biological aystem, comprising the steps of: (a) selecting one or more target RNA molecules; (b) designing a multitargeting interfering RNA molecule comprising a guide strand that, can form stable interactions with at least two binding sequences present in distinct genetic contexts in the set of one or more target RNA molecules; (c) .
- the biological system is a virus, it microbe, a cell, a plant, or an animal.
- Preferred animals include ruts, mice, monkeys, and humans.
- the target RNA molecules comprise RNA molecules that arc involved in a disease or di&order ⁇ f the biological system or arc selected from the biological AlliimiUively, the target RNA molecules comprises one or more RNA molecules selected from a second biological system that is infectious to the biological system or where lhe target RNA molecules are selected from bolii a first biological system and a second biological system that is infectious to the firsl biological system.
- the target RNA molecules can comprise one or more RNA molecules selected from an animal or a plant and one or more RNA molecules selected from a microbe or a virus that is i ntcetious to the animal or the plant.
- the target RNA molecules can comprise one or more RNA molecules selected from a human and one or mote RNA molecules selected from a virus selected from the group consisting of a human immunodeficiency virus (HiV), a hepatitis C virus (HCV), an influenza virus, a rhinovudib, and a severe acute respiratory syndrome (SARU) virus.
- HiV human immunodeficiency virus
- HCV hepatitis C virus
- SARU severe acute respiratory syndrome
- the target RNA molecues can also t>c RNA molecules encoding a protein of a class of proteins, including, without limitation, receptors, cytokines, transcription factors, regulatory proteins, signaling proteins, eytoskeletal proteins, transporters, enzymes, horm ⁇ nea. and antigens.
- groups of proteins can include ICAM-I, VEGF-A, MCP- I , TL- 8, VEOF-B, IGF-I, Glucfip, Inppll, bFGF, PlGF, VECrF-C 1 ,, VEGF-D, (J-catenin, ⁇ -ras-R, tc-ras-A, EGFR, Bcl-2, presenilis 1, EACE-I, MALAT-I , BlC, TGF ⁇ , and TNF alpha.
- Preferred combinations include, for example, JCAM-I and VECTF-A, one or more viral RNA molecules such as human immunodeficiency virus (HlV) 1 a hepatitis C virus (HCV), an influenza virus, a rhinovirus, and a severe acute respiratory syndrome (SARS) virus or an essential protein for- HIV selected from the group consisting ⁇ f GAG, POL, VIF, VPR, TAT, NEF, REV, VPU and FNV.
- the target RNA molecules can also be selected fromiziman proteins including, for example, TNFalpha, LEDGF(p75), BAF, CCR5, CXCR4, furin, NFkH, STATl.
- Specific combinations include a virus protein and a human protein associated with the disease caused by that vims.
- preselected target RNA molecules can comprise Hepatitis C Virus (HCV) and one or more of (he other preselected RNA molecules encodes TNF ⁇ .
- HCV Hepatitis C Virus
- This invention also relates to methods for treating a disease or condition in a subject, lhe method comprising the steps of: ' (a) selecting one or more target RNA molecules, wherein the modulation in expression of the target RNA molecules is potentially therapeutic tor the treatment of the disease or condition; (b) designing a miiltilargeting interfering RNA molecule comprising a guide strand that can form stable interactions with at least two binding sequences present in distinct genetic contexts in the one or more target RNA molecules; (c) producing the multilargeling interfering RNA molecule; and (d) administering the mu I ti targeting interfering RNA molecule into the subject, whereby the guide strand of the inultilargeting interfering RNA molecule forms stable interactions with the binding sequences present in distinct genetic contexts in the one
- the invention also relates to methods for designing a mullilargeting interfering RNA molecule, comprising the steps of: a) selecting one or- more target RNA molecules, wherein modulation in expression of lhe target RNA molecules is desired; b) obtaining at least one nucleotide sequence for each of the target RNA molecules; c) selecting a seed sequence of 6 nucleotides or more, wherein said seed sequence occurs in at least two distinct genetic contexts in nucleotide sequences identified in step b) for the target RNA molecules; d) selecting at least two binding sequences, wherein each of binding sequences comprises the seed sequence, and the binding sequences are present in distinct genetic contexts in the target molecules; and e) designing a multitargeting interfering RNA molecule having a guide strand that shares a substantial degree of complementarity with each of (he at ieast two binding sequences to allow stable interaction therewith.
- the method further comprises designing a passenger strand that is at least, partially complementary to the guide strand to
- step b) selecting a seed sequence of die length n from the candidate seed sequences, wherein the seed sequence occurs at least in two distinct genetic contexts in nucleotide sequences identified in step b); g) selecting a consensus target sequence, wherein said consensus target sequence comprises the seed sequence and a desired consensus sequence for the sequence flunking either one or " both of the 5' and 3' ends of (he. seed; and h) designing a . mul Ii targeting interfering KNA molecule comprising a guide strand that shares a substantial degree of complementarity with the consensus target sequence to allow stable interaction therewith.
- the step of generating u is
- the step of selecting seed sequences comprises the step of discarding any sequence of the length n that i) is composed of a consecutive string of 5 or more identical single nucleotides; ii) is composed of only adenosine and uracil; iii) is predicted to occur with an unaceeplably high frequency in the non-target transcriptome of interest; iv) is predicted to have a propensity to undesirably modulate the expression or activity of one or more cellular component; or v) is any combination of i) to iv).
- steps c) to g) can be repeated with a new value of H.
- the multitargeting interfering RNA molecules, once designed can then be tested in an expression system.
- the step of selecting a consensus target sequence further comprises the step of discarding any sequence that is composed of only a single base, is composed only of A and U, has a consecutive string of 5 or more bases which are C, is GIC rich at the 3' end, is predicted, to occur with unacceptable frequency in the non-target transcriptome of interest; or any combination thereof.
- the passenger strand is designed so that it is at least partially complementary to the guide strand to allow formation of a stable duplex between the passenger strand and the guide strand.
- modifying methods are also contemplated within the scope of the invention and a preferred method comprises modifying the njullitargeting interfering RNA molecule comprising the steps alone or in combination of i) improving the incorporation of the guide strand of the mulritargccing interfering RNA molecule into the RNA induced silencing complex (RISC?); ii) increasing or decreasing the modulation of the expression of at least one target RNA molecule; iii) decreasing stress or inflammatory response when the multitargeting interfering RNA molecule is administered into a subject; iv) altering the half life of the multitargeting RNA molecule in an expression system.
- RISC RNA induced silencing complex
- the invention futher relates to a method of designing a full length mullitargeting interfering RNA from a seed sequence, comprising the steps of: a) deducing the sequence of lhe complete complement of the seed sequence; b) generating permutations for the extension of the complete complement of the seed sequence to lhe desired length n; c) creating a collection of putative guide strand sequences, each of which comprises the sequence of the complete complement of the seed sequence.and one of the permutations generated in step b); d) using RNAhybrid to determine the binding pattern and the minimum free energy (infe) of the putative guide strand sequences created in step c) against all the target sequences comprising the seed sequence; e) discarding putative guide strand sequences where i) there is a contiguous run of 5 or more G residues; and ii) the Load Bias is ⁇ 1.2; and f) selecting a guide strand sequence of the length n for a multitargeting inter
- the invention relates to a method of making a multitargeting interfering RNA molecule, comprising the steps of: i) designing a multitargeting interfering RNA molecule having a guide strand that can form stable interactions with at least two binding sequences present in distinct genetic contexts in a set of prc-scleetcd target RNA molecules; and ii) producing the multitargeting interfering RNA molecule.
- the invention further comprises a pharmaceutical composition comprising a therapeutically effective amount of one or more multitargeting interfering RNA molecules together with a pharmaceutically acceptable carrier.
- FIG. 1 A flow-chart highlighting aspects of an exemplary design process for multitargeling interfering RNAs (CODEMTRs or VIROMIRs).
- CODEMTRs multitargeling interfering RNAs
- VIROMIRs multitargeling interfering RNAs
- Figure 2 Graph showing cytotoxicity of control siRNA and CODEMIRs at a final concentration of 40 nM in ARPE- 19 cells in culture medium at 48 hrs post-transfection.
- A mock transfected cells (Lipofcctamine2 ⁇ 00 alone);
- B irrelevant siRNA control;
- C VECiF- spccific siRNA;
- D ICAM-specific siRNA;
- E CODEMIR-I;
- F CODEMIR-2.
- Figure 3 Graph showing VEGF (closed bars) and ICAM (open bars) protein expression as a percent of control (unlransfcctcd) cells in cells treated with various siRNAs and CODEMIRs.
- Figure 4 Comparison of CODRMlR 1 activity with that of a naturally-occurring microRNA with some sequence similarity.
- Figure 6 Tolerance of CODEMTRs for mismatches at the 5' extremity for activity against VEGF (closed bars) and ICAM- 1 (open bars) expression.
- A Untransfected cells; B; Irrelevant siRNA; C: ICAM- and VRGF-specific siRNAs; D: CODEM IR- 13; H: CODEMTR- 14; F: CODF-MiR- 15.
- the presence of a single mismatch at the 5 'extremity of the seed did not significantly reduce the activities of CODEMIRs -14 and -15 relative to the fully matched seed of CODEM IR- 13 (see Table 8-2 for sequences).
- FIG. 7 Production of p24 HlV capsid protein in HEK.-293 cells c ⁇ -transfcct.cd with pNL4.3 plasmid and 67 ng of cither pSIL vector (control) or pSIL vector encoding sequences for shRNA approximating VMQ04, VMOO ⁇ or VMOlO.
- C VMOOG shRNA construct
- D VMOtO shRNA construct.
- Figure S Survival of TICTl 16 cells with anil without serum withdrawal following transection with 40 tiM CC0I4-21 and siRN A controls.
- A Mock-trausfected cells
- H Irrelevant control siRNA (siGC47); C: cytotoxic transfection siRNA control (siTOX); D: Bd-2-spccific siRNA; E: Kras-specifiu siRNA; F: VEGF-s ⁇ ecific siRNA (PVB); G: CCO 14; H; CCO 15; I: CC016; J : CC017; K: CCOl B; T.: CCO 19; M: CC020 and N: CC02 I .
- Figure 9 Abundance of K-Rus in HCTI 16 cells following transfection wilh 40 ntvt CCO 14-21 as measured by Western and normalized to beta-a ⁇ li ⁇ , Ar Mock-transfected cells.; B: CCO 14; C: CCO 15; D; CC016; E: CC017; F: CCOlH; G: CCO 19; H: CC020; 1: CC021 ; J : Kras- speciftc siRNA.
- Figure 10 Secretion of VHCiF by HCT 1 16 cells 48 h post-transfection with 40 riM
- VEGF in the cell medium was measured by ELTSA.
- PVO is a VRGF-specifk si UNA active in several species (human and rodent).
- FIG. 1 P ⁇ sitivity for Annexin V (early apoptosis) and Pr ⁇ pidiurn Iodide (necrosis/lale apoptosis) staining of HCTl 16 cells 4S hr following transfection with 40 nM CCO 14-18 and controls.
- A Untreated cells; B; Mock-transfectcd cells; C: Irrelevant control siRNA (siGC47); D: cytotoxic lransfcclion control siRNA (si TOX): E: VEGF-specit ⁇ e siRNA; F: Bcl-2-specific siRNA; G: Kras-specific siRNA; H: CC014; 1: CC015; J; CC016; K: CCO 17 and L: CC018.
- Figure 12 Colony forming ability of HCTI 16 cells following transfection with 40 nM siRNAs, CCO 15 and CCO 18-21.
- Figure 13 VEGF Secretion by ARPE- 19 cells transfected wilh 4OnM 2'-F modified
- Oligo refers to the active gut de strand ⁇ f CODHMIR-I.
- FIG. 15 VRGF secretion by ARPF.- 19 cells lrunsfcctbd with 1OnM of each terminal conjugated variant of CODEMIR-I , VEGF in cell culture supernatant was measured hy ELISA, ⁇ sach point represents the mean of triplicate wells; error bars indicate standard deviation of the tnuan.
- A Untra ⁇ sfected cells; B: M ⁇ ck-transfccted cells; C: Irrelevant siRNA control; D: CODEMIR-I; E: CODEMTR-146; F: CODEMlR-147; G: CODEMIR-148; H: CODEM®.-149; 1: CODEMIR-150; .T: CODRMIR-151; K: CODEMlR-152; L: CODEMIR-153; M: CODEMlR- 154; N: CODTMIR- 155 and O: CODGMlR- 156.
- FIG. 16 Time course of VRGF suppression by CODEMIR-I.
- Cells were transfeetcd once on day O with 40 iiM dsRNA and repeatedly stimulated with defcrrox amine.
- SupematatU was collected at the indicated time points and assayed by ELlSA. Error bars indicate standard deviation of the mean.
- Squares LJutranstected cells;
- Triangles Mock-transfectcd; Inverted triangles: Irrelevant siRNA control and Diamonds: CODEMlR-I.
- FIG. 17 Su ⁇ ifity of chemically modified variants of CODEMIR-I in human serum.- K)OnM Duplex RNA was incubated ut 37°C in 10% human AB serum, with RNA concentration monitored using Oligrcen dye. Each point is the moan of triplicate samples. Error bars (in many cases smaller than symbols) indicate standard deviation of the mean. Solid squares: CODEMIR- !; Triangles: CODEM1R-33; Inverted triangles: CODF.MiR-87; Diamonds: CODEMIR-92; Circles: CODUMIR-144 and Open squares: CODEMIR-145.
- ARPE-19 cells were trausfectcd with 4OnM duplex RNA and VEGF or ICAM secretion was assayed 48 hours post-transfectio ⁇ by F.LISA.
- Rach bar represents the mean of triplicate samples. Error bars indicate standard deviation of the mean.
- FIG 19 Effect of mismatches in the seed region of CTODEMIR- 1 upon VCGF (open bars) ancl ICAM (closed bars) suppressive activity.
- ARPE-19 cells were iransfccted with 4OnM duplex RNA and VEGF (ELlSA) or ICAM (FACTS) assayed and expressed relative to results obtained with unlransrected cells. Expression was assayed 48 hours post-tntnsfeution. Each bar represents the mean of triplicate samples, Rrror bars indicate standard deviation of the mean.
- Figure 20 Schematic illustration of the design of all 32 variants of CODEMIR- 1 that arc directly aligned to the VEGF and ICAM vnRNAs. The sequence alignment.of two target sequences is shown. A potential guide strand (CODEMIR) is shown below the sequence alignment. Because of the lack of total consensus between the two turgcts, two possible bases can be used at some positions (alternate bases at mismatch positions are shown in the row indicated with an arrow). Note the possible use of a U to match and wobble-pair the two target sequences, respectively.
- FIG. 21 Screening 32 variants of CODEMFR-I for VEGF suppressive activity.
- ARPE- 19 cells were tra ⁇ sfectcd with 4OnM of the indicated RNA duplex, and VEGF secretion was measured by HLISA 48 hours post-transfcction.
- the guide strand of each CODEMIR is shown in the 5' to 3' direction. Each bar represents the mean of triplicate samples. Frror bars indicate standard deviation of the mean.
- A Untrunsfceied; B: Irrelevant siRNA control; C: CODBMTR-I; D: CODKMTR-52; F-: CODEMIR-53; F: CODEMIR-54; G; CODFMlR -55; H: CODEMlR-56; I: CODRMIR-57; J: CODBM1R-58; K: CODEM1R-59; L: CODEMIR-60; M: CODEMl R-6l ⁇ N: CODEMIR-62; O: CODBMIR-63; P: CODEMlR-64; Q: CODEMrR-65; R: CODEMlR-66; vS: CODEMIR-67; T: CODEJvlIR-68; U: CODEMIR-69; V: CODEMlR-70; W: CODEMlR-71; X: CODEM IR-72; Y: CODEMlR-73; Z: CODrjMlR-74
- FIG. 22 Relationship between target complementarity, length of 5' complementarity and VuCi F suppression for 32 variants ⁇ f (ODEMIR- 1.
- FIG. 23 Screening 31 variants of CODEMIR-I for suppression of ICAM production, ARPE-IQ cells were transacted with 4OnM of the indicated RNA duplex., and sICAM secretion was measured by ET .ISA 48 hours post-transfeclio ⁇ .
- the guide strand of each CODEMIR is shown in the 5' to 3' direction, Each bar represents the mean of triplicate samples. Error bars indicate standard deviation of (he mean.
- FIG. 24 Comparison of CODEMIR-I variants with (CODEMJR-56 and CODBMIR- 76) and without (CODEMIR- 120 and CODRMlR- 121) 7 G motifs.
- ARPE-J9 cells vvere ti-ansfected with 4OnM duplex RNA and VECiF (open bars) or ICAM (closed bars) expression was assayed 48 hours post-transfeetion. Each bar represents the mean of triplicate samples. Error bars indicate standard deviation ⁇ f the mean.
- A Untransfected; B: Mock-transfected cells; C: Irrelevant siRNA control; Dr VEGF- and ICAM-specjfic siRNAs; E: CODEMTR-56; F; CODEMTR-76; G: CODEM I R 420 and H: CODEMIR-121.
- FIG. 25 VEGF and ICAM expression in A.R ⁇ 'E-19 cells after lransfcction with LNA andiriosine containing CODEMIRs.
- ARPE-19 cells were transfceled with 4OnM duplex RNA and VECJF (cjosed bars) or ⁇ CAM (opcu. bars) expression was assayed 48 hours post- tranyfection. Each bar represents the mean of triplicate samples, Error bars indicate standard deviation of the mean.
- FIG. 26 Comparison of VRGF suppressive activity of CODEMIRs containing inosine bases oi- mismatches at positions 13 and/ ⁇ r 15 of the guide strand.
- ARI 1 H- IP cells were traiisfected with 1OnM duplex RNA and VHCTF (ELlSA) expression was assayed 48 hours po.st- tra ⁇ sfection.
- Each bar represents (he mean of triplicate samples. Error bars indicate standard deviation of the mean, A: Untransfected; B: Mock- Iran sfec ted cells; C: Irrelevant siRNA control;
- CODEMlR-1 containing asymmetric bulges- ARPE-19 cells were transfectcd with 4QnM of the indicated RNA duplex, and VEGF secretion was measured by ELKSA 48 hours post-traiisfection.
- Each bar represents the mean of triplicate samples. Error bars indicate standard deviation ⁇ f the mean.
- FIG. 28 Screening multiple seed sites in the VEGF 3' UTR, ARPE-19 cells were transfectcd with 4OnM of the indicated RNA duplex, and VEGF secretion was measured by
- ELISA 48 hours posi-lransfceli ⁇ n Each bar represents the mean of triplicate samples. Error burs indicate standard deviation of the mean.
- L CODEMlR- 115; M: CODBMIR-116; N: CODEMIR-117; O: CODEMIR-118 and P:
- FIG. 29 Design of shRNA bused on CODEMIR-I. Sequence shown is 5' to 3 1 (upper strand). Sequences in bold indicate the predicted active CODEMTR-I duplex.
- FIG 30 Effect, of CODEM IR -i hairpins on VEGF and ICAM-I expression.
- ARPH- 19 cells were transfected with 2 ⁇ g/ml of each hairpin plasmid.
- VEGF (A) and ICAM (B) expression was determined 48 hours post-tra ⁇ sfection.
- the open bars indicate results obtained with the "empty" vector control and the closed bars are those obtained with the shRNA constructed to approximate CODEMlR-I .
- Each bar represents the mean of triplicate samples.
- F.rror bars indicate standard deviation of the mean.
- RISC' RNA interference silencing complex
- RNAi RNA interference
- VIROMIR muHi target ing interfering RMA preferentially targeted to viral targets
- an “activity”, a “biological activity”, or a “functional activity” of a polypeptide or nucleic acid refers to an activity exerted by a polypeptide or nucleic acid molecule as determi ned in vivo ox in vitro, according to standard techniques. Such activities can be a direct activity, such as an association with or an enzymatic activity on a second protein, or an indirect activity, such as a cellular signaling activity mediated by interaction of a protein with a second protein.
- Bio system is meant, material, in a purified or u ⁇ puril ⁇ ed form, from biological sources, including but not limited to human, animal, plant, insect, microbial, viral or other sources, wherein the system comprises the components required for biologic activity (e.g., inhibition of gene expression).
- biological system includes, for example, a cell, a virus, a microbe, an organism, an animal, or a plant
- a “cell” means an autonomous s.elf-repltcati ⁇ g unit that may constitute an organism (in the case of unicellular organisms) or be a sub unit of multicellular " organisms in which individual cells may be specialized and/or differentiated for particular functions.
- a cell can be prokaryotic or cukaryotic, including bacterial cells such as K coli, fungal cells such as yeast, bird cell, mammalian cells such as cell lines of human, bovine, porcine, monkey, sheep, apes, swine, dog, cat, and rodent origin, and insect cells such as Dros ⁇ phila and silkworm derived cell fines, or plant cells,
- the cell can be of somatic or germ line origin, totipotent or hybrid, dividing or n ⁇ n- dividing.
- the cull can also be derived from or can comprise a gamete or embryo, a stem cell, or a fully differentiated cell.
- the term "cell” refers not only to the particular subject cell, but also to the progeny or potential progeny of such a cell. Because certain modifications can occur in succeeding generations due to either mutation or environmental influences, such progeny may not, in Fact, be identical to the parent cell, but are still included within lhe scope of the tc ⁇ n as used herein,
- Tlic le ⁇ n "complementary” or “complemcnU ⁇ rity”as used herein with respect to polynucleotides or oligonucleotides refers to a measure of the ability of individual strands of such poly- or oligonucleotides to associate with each other.
- Two major fundamental interactions iti RNA are stacking and hydrogen bonding. Both contribute to free-energy changes for associations of oli.g ⁇ ribonuclc ⁇ tides.
- the JRNA-RNA interactions include the standard Watson-Crick pairing (A opposite U, and G opposite C) and the ⁇ on- Watson-Crick pairing (including but not limited to the interaction through the Hoogsteen edge and/or sugar edge) (sec e.g., Leontis et al., 2002, Nucleic Acids Research, 30: 3497-3531),
- RNA-RNA associations e.g., RNAi activity or inhibition ⁇ f gene expression or formation of double stranded oligonucleotides. Such determination can be made using methods known in the art (see, e.g.. Turner ct al ., 1987, Cold Spring Harb Symp Quant Biol.
- complementarity can be partial, for example where at least one or more nucleic acid bases between strands can pair according io the canonical base pairing rules.
- sequences 5'-CTOACAATCG-.!', 5'- CGAAAGTCAC 1-3' are partially complementary (also referred to herein as "incompletely " complementary") to each other.
- Partial complementarity indicates that only a percentage of the contiguous residues of a nucleic acid sequence can form Watson-Crick base pairing with the same number of contiguous residue*; in a second nucleic acid sequence in an anti-parallel fashion, For example, 5, 6, 7, 8, 9, ⁇ r 10 nucleotides out of a total of 10 nucleotides in the first oligonucleotide forming Wtilson-Crick base pairing with a second nucleic acid sequence having 10 nucleotides represents 50%, 60%, 70%, 80%, 90%, and 100% complementarity respectively. Complementarity can also be tola!
- each and every nucleic acid base of one strand is capable ⁇ f forming hydrogen bonds according to the canonical base pairing rules, with u corresponding base in another, a ⁇ ti parallel strand.
- the sequences 5'- CTGAC:AATC(3-3' and 5'-CGAlTC5TCAC ⁇ -3' are totally complementary (also referred to herein as "completely complementary") to each other.
- complete complementarity or “completely complementary” indicates that all the contiguous residues of a nucleic acid sequence can form Watson-Crick base pairing with the same number of contiguous residues in a second nucleic acid sequence in im anti-parallel fashion.
- the two strands would he considered t ⁇ have no complementarity.
- at least portions ⁇ f two antipamllel strands will have no complementarity, In certain embodiments such portions may comprise even a majority of the length of the two strands.
- strands that are incompletely or partially complementary there may be portions or sections of the strands wherein there arc several or even many contiguous bases which arc completely complementary to each other, and other portions of the incompletely complementary strands which have less than complete complementarity - i.e. those sections are only partially complementary to each other.
- the percentage of complementarity between a first nucleotide sequence and a second nucleotide sequence can be evaluated by sequence identity or similarity between the first nucleotide sequence and the complement of the second nucleotide sequence.
- a nucleotide sequence that is X% complementary to a second nucleotide sequence is X% identical to the complement of the second nucleotide sequence.
- sequence identity or similarity us known in tlic art, is r.lic relationship between two or more polypeptide sequences or Iwo of more polynucleotide sequences, as determined by comparing the sequences. In the art, identity also means the degree ⁇ f sequence relatcd ⁇ ess between polypeptide or polynucleotide sequences, us the case can be, as determined by the match between strings of such sequences.
- sequences are aligned for optimal comparison purposes (e.g., gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence).
- gaps can be introduced in the sequence of a first amino acid or nucleic acid sequence for optimal alignment with a second amino or nucleic acid sequence.
- the amino acid residues or nucleotides at.
- % identity number of identical positions/total number of positions (e.g-i overlapping positions) x 100). In one embodiment, the two sequences are the same length.
- Roth identity and similarity can be readily calculated.
- Methods commonly employed to determine identity or similarity between sequences include, but are not liuiited to those disclosed in Can I Io el. al, ( 1988), SiAM J. Applied Math. 48, 1073, Preferred methods to determine identity are designed to give the largest match belween the sequences tested. Methods to determine identity and. similarity are codified in computer programs.
- a non-limiting example of a mathematical algorithm utilized for the comparison of two sequences is the algorithm of Karliti el al., (1990), Pr ⁇ c. Nail. Acad. Sci. USA 87:2264-2268, modified as in Karlin et al., (1993), Prac, Na(I. Acad.
- die FASTA method (AtschuJ et al., (1990), J. Moiec. Biol. 215, 403), can also be used.
- Another non-limiting example of a mathematical algorithm useful for lhe comparison uf sequences is the algorithm of Myers el al, ( 1988), CABlOS 4: 1 i- 17. Such an algorithm is incorporated into the ALIGN program (version 2.0).
- the percent identity between two sequences is determined using the Needlcman and Wimsch ⁇ J. MoL Biol (48):444-453 (1970)) algorithm which has been incorporated imo the GAP program in the GCG software package.
- the GCCl GAl' program aligns two complete sequences t ⁇ maximize the number uf matehes and minimizes the number of gaps.
- the percent identity between two sequences is determined using the local homology algorithtn of Smith and Waterman (J MoI Biol. 19Sl 1 147(1): 195-7), which has been incorporated into the BestFit program in the GCC3 software package.
- the RestFit program makes an optimal alignment of the best segment of similarity between two sequences. Optimal alignments are found by inserting gaps to maximize the number of matches.
- nucleotide sequences that share a substantial degree of complementarity will form a stable interaction with each other.
- stable interaction indicates that the two nucleotide sequences have lhe natural tendency to interact with each other to form a double stranded molecule.
- Two nucleotide sequences can form a stable interaction with each other within a wide range of sequence complementarity. In general, the higher the complementarity the stronger or the more stable the interaction. Different strengths of interactions may be required for different processes.
- the strength of interaction for the purpose of forming a stable nucleotide sequence duplex in vitro may be different from that for the purpose of forming a stable interaction between an ⁇ RNA and a binding sequence in vivo.
- the strength of interact ion can be readily determined experimentally or predicted with appropriate software by a person skilled in lhe art.
- Hybridization can be used to )est whether two polynucleotides are substantially complementary to each oiher and to measure how stable the interaction is, Polynucleotides that share a sufficient degree of complementarity will hybridize to each other under various hybridization conditions.
- polynucleotides that share a high degree of complementarity thus form a strong stable interaction and will hybridize to each other under stringent hybridization conditions.
- Stringent hybridization conditions has the meaning known in the an, as described in Sam brook et a!.. Molecular Cloning; A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory, Cold Spring Harbor, New York, (1989).
- An exemplary stringent hybridisation condition comprises hybridization in 6 ⁇ sodium chloride/sodium citrate (SSC) al about 45 0 C, followed by one or more washes in 0.2x SSC and 0.1% SDS at 50 - 65 "C.
- SSC sodium chloride/sodium citrate
- mismatch ttsfers to a nucleotide of either strand of two interacting strands having no corresponding nucleotide on the corresponding strand ⁇ r a nucleotide of either strand of two interacting strands having a corresponding nucleotide on the corresponding strand that is non-complementary.
- a "match” refers to a complementary pairing of nucleotides.
- the term “expression system” refers to any.it) vivo or in vitro system thai. can be used to evaluate the expression of a target RNA molecule and or the RNAi activity of a multitargeting RNA molecule of the invention.
- the "expression system” comprises one or more target RNA molecules, a multitargeting interfering KNA molecule targeting the one or more target RNA molecules, and a cell or any type of in vitro expression syslem known to a person skilled in the art that allows expression of the target RNA molecules and RNAi.
- RNA includes any molecule comprising at least one ribonucleotide residue, including those possessing one or more natural nucleotides of the following bases: adenine, cytosinc, guanine, and uracil; abbreviated A, C, G, and U, respectively, modified ribonucleotides, universal base, acyclic nucleotide, abasic nucleotide and non- ribonucleotides.
- “Ribonucleotide” means a nucleotide with a hydroxyl group at the 2' position of a p- D-ribo-fiiranosc moiety.
- Modified ribonucleotides include, for example 2'dcox.y, 2'd.c ⁇ xy-2 1 -fiuora, 2'Q-methyl, 2'0-methoxyelhyl, 4'thio or locked nucleic acid (LNA) ribonucleotides. Also contemplated herein is the use ⁇ f various types of ribonucleotide analogues, and RNA with uilemuclcotide linkage (backbone) modifications. Modified internucleotide linkages include for example, phosphorolhioatc-iti ⁇ dified, and even inverted linkages (i.e. 3'-3' or 5'-5").
- ribonucleotide analogues include sugar-modified, and imcleobase-modified ribonucleotides, as well as combinations thereof.
- T - OH-gro ⁇ p is replaced by a subslituent selected from H, OR, R, halo, SH 1 SR, NH 2 , NHR, NR 2 or ON, wherein R is C UC6 alky!, alkenyl or alkynyl and halo is F, Cl, Br, or I.
- phosphoesler group connecting to adjacent ribonucleotides is replaced by a modified group, eg.
- the 5'lerminj can be OH 1 phosphate, diphosphate or triphosphate.
- Nucleobase-modifittd ribonucleotides i.e. ribonucleotides wherein the naturally-occurring iiucleobase is replaced with a non-naturally occurring nueteohase instead, for example, uridines or cytidiiies modified at the S-position (e.g. 5 ⁇ (2-amino)propyl uridine, arid 5-broni ⁇ uridine); adenosines and guanosines modified at.
- lhe B-position e.g. 8-brofuo guanosine
- dca'ia nucleotides e.g. 7-dcaza-aden ⁇ sine
- O- and N-alkylatcd nucleotides e.g. N6-methyl adenosine
- universal base refers to nucleotide base analogs that form base pairs with each of the natural DNA/RNA bases with little discrimination between them.
- Nbri- limifcing examples of universal bases include C-phenyl, C-naphthyl and olher aromatic derivatives, inosi ⁇ e, azole carboxamides, and nilxoazolc derivatives such as 3- nitropyrrole, 4-. niti'oindolc, 5-nitroindole, and 6-nitroindole as known in the art (sec for example Loakes. 2001, Nucleic Acids Research, 29, 2437- 2447).
- acyclic nucleotide refers to any nucleotide having an acyclic ribose sugar, for example where any ⁇ f the ribose carbons (Cl, C2, C3, C4, or C5), arc independently or in combination absent from the nucleotide.
- the bases thymidine (“T”) and uridine (“U”) are frequently interchangeable depending on the source of the sequence information (DNA or RNA). Therefore, in disclosure of target sequences, seed sequences, candidate seeds, consensus target sequences, target RNA binding sites, and the like, the base “T” is fully interchangeable with the base “IJ".
- the base "U” cannot be generally substituted with "T” in a functional manner. It is however known in the art that certain occurrences of the base "U” in RNA molecules can be substituted with "T' without substantially deleterious effect on functionality.
- a “larget RNA molecule” or a “pre-selecled target RNA molecule” as used herein refers to any RNA molecule whose expression ⁇ r activity is desired to be modulated, for example decreased, by an interfering RNA molecule of the invention in an expression system.
- a "targe! RNA molecule” can be u messenger RNA (mRN A) molecule lhat encodes a polypeptide of interest.
- a messenger RNA molecule typically includes a coding region and non-coding regions preceding ("5 1 UTR") and following ("3HJTR") the coding region.
- a "larget RNA molecule" elm also be a non-coding RNA (ncRNA), such as small temporal RNA (stRNA), micro RNA (raiRJNA), small nuclear RNA (snRNA).. short interfering RNA (siRMA), small nucleolar RNA ' (snoRNA), ribosoma] RNA (rRNA), transfer RNA (tRNA) and precursor RNAs thereof,
- ncRNA non-coding RNA
- stRNA small temporal RNA
- rRNA small nuclear RNA
- rRNA ribosoma] RNA
- tRNA transfer RNA
- Such non-coding RNAs can also serve as target RNA molecule.
- the target RNA can further be the genome of a vims, for example & RNA virus, or a replicative intermediate of any virus at any stage, us well as any combination of these.
- target RNA molecule can be a RNA molecule that is endogenous Io a biological system, or a RNA molecule that is exogenous to the biological system, such as a RNA molecule of a pathogen, for example a virus, which is present in a cell after infection thereof.
- a cell containing the target RNA can be derived from or contained in any organism, for example a plant, animal, protozoan, yirus, bacterium, or fungus.
- Non-limiting examples of plants include nonocots, dicots, Or gymnosperms, N ⁇ n-liiniling examples of animals include vertebrates or invertebrates.
- Non-limiting examples of fungi include molds or yeasts,
- a "target RNA molecule” as used herein may include any variants or polymorphism of a desired RNA molecule. Most genes are polymorphic in that a low but nevertheless significant rate of sequence variability occurs in a gene among individuals of the same species. Thus, a RNA molecule may correlate with multiple sequence entries, each of which represents a variant or a polymorplusm of the RNA molecule, In designing any gene suppression tool there is the risk lhat the selected binding scquencc(s) used in the computer-based design may contain relatively infrequent alleles. As a result, the acr.ive sequence designed might be expected to provide the required benefit in only a small proportion of individuals.
- SNPs single nucleotide polymorphisms
- a limitless number ot sequences available for any particular target may be used in the design stages of an interfering RNA of the invention to make sure that the t ⁇ i geled binding sequence is present HI the maio ⁇ ty of allelic variants, with the exception of the situation in which targeting ot the allelic variant is desired (that is, when the allelic variant itself is implicated in the disease of interest).
- a "target RNA molecule” comprises at least one targeted binding sequence that is sufficiently complementary to the guide sequence of an interfering RNA molecule of the invention to allow a stable interaction of the binding sequence with the guide sequence-
- the tatgeled binding sequence can be refined to include any part of the transcript sequence (eg.
- the targeted binding sequence can include sequences in the B IJTR for effective franslationa! repression
- Tlic "targeted binding sequence”, “binding sequence”, or “target sequence' * shall all mean a portion of a target RNA molecule sequence comprising a seed sequence and the sequence flanking cither one or both ends of the seed, said binding sequence is predicted to form a stable inteiaction with the guide strand of a multitargcting interfering RNA of the inveiibon based on the c ⁇ mplemcnUirity between the guide strand and the binding sequence.
- the term “non-target transcriptome” or “non-targerod lranscnplome 71 indicates the tran.scriptome aside from the targeted RNA molecules.
- the no ⁇ -targcted transcriptome it (that of the host.
- the nori-largeted transcriptome is the ti a.iscriptomc- of the biological system aside from the targeted given RNA.
- seed or “seed sequence” or “seed region sequence” refers to a sequence of ar least about 6 contiguous nucleotides present in a target RNA that is completely complementary Io a poitioii of the guide strand of an mtci tcnng RNA. Although 6 or more contiguous bases are ptetcrred, the expression ''about 6" refers to the fact (hat windows of at least 5 or more contiguous bases or more can piovide useful candidates in some ca.ses and can ultimately lead to the design of useful interfering RNAs. Thus, all such seed sequences are contemplated within the scope of the instant invention.
- Constant or conserved indicates the extent to which a specific sequence, such as the seed sequence, is found t ⁇ be represented in a group of related target sequences, regardless of the genetic context of the specific .sequence.
- Geneetic context refers to the flanking sequences thai surround a specific identified sequence and (hat are sufficiently long to enable one of average skill in the art to determine its position within a genome ⁇ r RNA molecule relative to sequence annotations or other markers in common use.
- the term “inlerferitig RNA” is used to indicate single or double stranded
- RNA molecules that modulate the presence, processing, transcription, translation, or half-life of a target RNA molecule, for example by mediating RNA interference ("RNAi"), in a sequence- specific manner
- RNA interference or "RNAi” is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post- transcriptional gene silencing, translational inhibition, or epigeuetics. This includes, for example, RISC-mediated degradation or txanslatkmat repression, as well as transcriptional silencing, altered RNA editing, competition for binding to regulatory proteins, and alterations of mRNA splicing.
- interfering RNAs may exert (lieir functional effect via any of the foregoing mechanisms alone, or in combination with one or more other means of RNA modulation known in the art.
- the interfering RNAs provided herein can be used to manipulate or alter the genotype or phenotype of an organism or cell, by intervening in cellular processes such as genetic imprinting, transcription, translation, or nucleic acid processing (e.g., transamination, methylation, etc.).
- interfering RNA is meant ( ⁇ be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAt, for example short interfering RNA (siKNA), double- stranded RNA (dsRNA), microRNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically-modified siRNA, post- transcriptional gene silencing RNA (plgsRNA), and others.
- siKNA short interfering RNA
- dsRNA double- stranded RNA
- miRNA microRNA
- shRNA short hairpin RNA
- plgsRNA post- transcriptional gene silencing RNA
- the "interfering RNA” can be, fur example, a double-stranded polynucleotide molecule comprising self-complementary sense and antisciise strand.
- the "sense” also named “passenger” strand is required for presentation of the "antisetise” also named “guide”, “guiding”, or “targct,- cor ⁇ plemcnlary” strand to the RISC.
- the guide strand is retained iti the active RISC complex and guides the RISC to lhe target nucleotide sequence by means of complementary base-pairing, which in turn results in RNAi.
- the relative thermodynamic characteristics of the 5' termini of the two strands of a double-stranded interfering RNA determine which strand will serve the function of a passenger or a guide stit ⁇ nd during RNAi.
- the asymmetric RISC formation can be defined by the relative thermodynamic strength of the first four inicieotidc-pairs of Che 5' termini of an interfering RNA calculated by the nearest -neighbor methods.
- Hutvagner (2005), FEJiS Letters 579: 5850-5857 Hutvagner (2005), FEJiS Letters 579: 5850-5857.
- the guide strand can be pie-determined by the 5' termini thermodynamic characteristics.
- the guide strand can have a sequence completely complementary to one or more but not all binding sequences present iti the one or more target RNA molecules. It can also be partially complementary to a binding .sequence present iti a target RNA molecule, so long as the complementarity is sufficient for the formation of a stable interaction between the guide strand and the binding sequence on the target molecule.
- the "passenger strand” can be completely or partially complementary Io the guide strand, so long as the complementarity is sufficient for the formation of a stable interaction between the guide strand and the passenger strand.
- the passenger strand can be completely or partially identical to the binding sequence on a target molecule.
- Both the passenger strand and the guide strand can be modified and refilled to enhance some aspect of the function of the interfering RNA molecule of the invention.
- various pharmacophores, dyes, markers, ligands, conjugates, antibodies, antigens . , polymers, peptides and other molecules can be conveniently linked to the molecules of the invention.
- the interfering RMA can further comprise a terminal phosphate group, such as a 5'- phosphate or 5',3'- diphosphate. These may be of use to improve cell uptake, stability, tissue targeting or any combination thereof.
- the "interfering RNA” can be assembled from two separate oligonucleotides, where one oligonucleotide is the sense strand and the other is the anlisense strand.
- the “interfering RNA” can also be assembled from a single oligonucleotide, where the scl ( " -complementary sense and antiscnse regions of the interfering RNA are linked by means of a nucleic acid based or ⁇ on- nucleic acid-based linkcr(s).
- the "interfering RNA” can be a polynucleotide with a duplex, asymmetric duplex, hairpin or asymmetric hairpin secondary structure, having self- complemeulury sense and antisense regions.
- the "intcr.fering RNA” can also be a single- stranded polynucleotide having one or more loop structures and a stem comprising self- complementary regions (e.g. short hairpin RNA, shRNA), wherein the polynucleotide can be processed cither in vivo or in vitro to generate one or more double stranded interfering RNA molecules capable of mediating RNA inaclivation.
- shRNA self- complementary regions
- the "interfering RNA” can also be a single stranded polynucleotide having nucleotide sequence complementary to a nucleotide sequence in a target nucleic acid molecule or a portion thereof (i.e., the guide strand), for example, where such interfering RNA molecule docs not require lhe presence within the molecule of nucleotide sequence corresponding Io the target nucleic acid sequence or a po ⁇ i ⁇ n thereof (i.e., the passenger strand).
- interfering RNA need not be limited to those molecules containing only RNA, but further encompasses those possessing one o ⁇ more modified ribonucleotides and non- nucleotides, such as those desorihcd supra.
- interfering RNA includes double- stianded RNA, single-stranded RNA.
- isolated RNA such as partially purified RNA, essentially pure RNA, synthetic RNA, recombinant ⁇ produced RNA, as Well as altered RNA that differs from naturally occurring RNA by the addition, deletion, substitution and/or alteration of one or more nucleotides.
- Such alterations can include addition of non-miclcolide material, such as to the end(s) of the multitargcling interfering RNA or internally, for example at one or ttiore nucleotides of the RNA.
- Nucleotides in the RNA molecules of the instant invention can also comprise non-standard nucleotides, such as non-naliirally ⁇ ccurcing nucle ⁇ tidcs or chemically synthesized nucleotides or deoAynticleotides. These altered RNAs can be referred to as analogs or analogs of uaturaUy- occurri ⁇ g RNA.
- the interfering RNA of the invention also termed “multitargetitlg interfering RNA” is an interfering RNA having a guide strand that can form stable interactions with at least iwo binding sites present in distinct genetic contexts on one or more target RNA molecules.
- rnultit ⁇ rgeting interfering RNA include CX)DEMiRs, COmputationally-DEsigrmd, Multi- targeting Interfering RNAs, and VIROMIRs, where these inultitafgeting interfering RNA. molecules arc preferentially targeted l ⁇ viral targets.
- Sequence means the linear order in which monomers occur in a polymer, for example, the order of amino acids in a polypeptide or the order of nucleotides in a polynucleotide.
- a "subject” as used herein, refers to an organism to which the nucleic acid molecules of the invention can be administered.
- a subject can be an animal or a plant, preferably a mammal, most preferably a human, who has been (tie object ⁇ f treatment, observation or experiment, or any cell thereof.
- 'therapeutically effective amount means that amount of active compound or pharmaceutical agent that elicits lhe biological or medicinal response in a subject that is being sought by a researcher, veterinarian, medical doctor or other clinician, which includes preventing, ameliorating or alleviating the symptoms of the disease or disorder being treated. Methods are known in the art for determining therapeutically effective doses for the instant pharmaceutical composition.
- a “vector” refers to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked.
- p ⁇ asmid which refers to a circular double stranded DNA loop into which additional DNA segments can be inserted.
- Another type of vector is a viral vector, wherein additional DNA segments can be inserted.
- Certain vectors are capable of autonomous replication in it host cell into which they are introduced (e. g., bacterial vectors having abacterial origin of replication and episomal mammalian vectors). Other vectors (e.g., noti-episomal mammalian vectors) are integrated into the genome of a host cell upon, introduction into the host cell, and thereby are replicated along with the host genome. Moreover, certain vectors, expression vectors, are capable of directing the expression of gene.s to which they are operably linked.
- modulate means any RNA interference mediated regulation of the level and/or biological activity of the RNA molecule It includes any RNAi-related transcriptional orpost-lra ⁇ sc ⁇ plional gene silencing, such as by cleaving, destabilizing the target RNA molecule or preventing RNA translation.
- the term “modulate” can mean “inhibit,” but the use of the word “modulate” is not limited to this definition.
- the modulation of the target RNA molecule is determined in a suitable expression system, for example in vivo, in one or more suitable cells, or in an acellulfir or in vitro expression system such as arc known in the art. Routine methods for measuring parameters oftlic transcription, translation, or other aspects of expression relating l ⁇ RNA molecules arc known in the art. and any such measurements are suitable for use herein.
- inhibit By “inhibit”, ''down-regulate”, “reduce”, or “decrease” as with respect l ⁇ a target UNA or its expression it is mount thai the expression of the gene or level and/or biological activity of target RNA molecules is reduced below that observed in the absence of the nucleic acid molecules (e.g., multitargeting interfering RNA) of the invention, In one embodiment, inhibition, down-regulation or reduction with a multitargeting interfering RNA molecule is greater than that observed in the presence of an inactive or attenuated molecule.
- nucleic acid molecules e.g., multitargeting interfering RNA
- inhibition, down- regulation, or reduction with a tnultita ⁇ geting interfering RNA molecule is greater than that.observed in the presence of, for example, multitargeting interfering RNA molecule with scrambled sequence or with mismatches.
- inhibition, down-regulation, or reduction of gene expression with a nucleic acid molecule of the instant invention is greater in the presence of the nucleic acid molecule than in its absence.
- a target RNA or its expression encompasses, for example, reduction of the amount or rate of transcription or translation of a target RNA, reduction of the amount or rate of activity of the target RNA, and/or J ⁇ combination of the foregoing in a selected expression system.
- a decrease in the total amount of transcription, the rate ⁇ f transcription, the total amount, of translation, or the rate of translation, or oven the activity of an encoded gene product arc indicative of such a decrease.
- the "activity" of an RNA refers to any detectable effect the RNA may have in a cell or expression system, including for example, any effect on transcription, such as enhancing or suppressing transcription of itself or another RNA molecule.
- the measurement of a "decrease” in expression or the determination of the activity of a given RNA can be performed in vitro or in vivo, in any system known or developed for such purposes, or adaptable thereto.
- Preferably lhe measurement of a "decrease" in expression by a particular interfering RNA is made relative to a control, for example, in which no interfering RNA is used. Tn some comparative embodiment 1 ? such measurement is made relative to a control in which some other interfering RNA or combination of interfering RNAs is used.
- a change such as (he decrease is statistically significant based on a generally accepted test of statistical significance.
- a change such as (he decrease is statistically significant based on a generally accepted test of statistical significance.
- a given RNA need only show an arithmetic decrease in otie such MI vitro or in viva assay to be considered to show a "decrease in expression" as used herein.
- the biological modulating activity of the multi targeting interrerinjr RNA is not limited to, or necessarily reliant on, degradation or translati ⁇ nal repression by conventional RISC protein complexes involved in siRNA and mjeroRNA gene-silencing, respectively, indeed, short double-stranded and single-stranded RNA have been shown to have other possible sequence-specific roles via alternative mechanisms ' .
- abort doublc- SLrandcd RNA (dsRNA) species may act as modulatory effectors of differentiation/cell activity.
- dsRNA may lead to the degradation of rnRNA through the involvement of AU- rich clement (ARF,)-bindt ⁇ g proteins (Jing, Q., et al,, (2005), Call, 120: 623-34).
- ARF AU- rich clement
- dsRN ⁇ may also induce epigenclie transcriptional silencing (Morris, K.V., et al,, (2004) Science, 305: 1289-K9), Processing of mRNA can also bn altered through A to 1 editing and modified splicing.
- ⁇ AU- rich clement
- palindrome or "palindromic sequence” means a nucleic acid sequence that is completely complementary to a second nucleotide sequence that is identical to the nucleic acid sequence, e.g., UGGCC]A.
- the term also includes a nucleic acid molecule comprising two nucleotide sequences that arc palindromic sequences.
- Phc ⁇ otypic change refers to any detectable change to a cell or an organism that occurs in response to contact or treatment with a nucleic acid molecule of the invention.
- detectable changes include, butH not limited to, changes in shape, size, proliferation, motility, protein expression or KNA expression or other physical or chemical changes as can be assayed by methods known in the art.
- the detectable change can also include expression of reporter genes/molecules such as Green Fluorescent Protein (GFi') or various tags that are used to identify an expressed protein or any other cellular component that can be assayed.
- GFi' Green Fluorescent Protein
- the present invention provides a multilargcting interfering RNA molecule comprising a guide strand that forms stable interactions with at least two binding sequences present in distinct genetic contexts in one or more pre-seleeted target RNA molecules.
- the present invention provides a m ⁇ ltitargeling interfering KNA molecule comprising a guide strand of the Formula (F):
- p consists of a terminal phosphate group that can be present or absent from lhe 5' -end of the guide strand, Any terminal phosphate group known to a person skilled in the ar! can be used.
- phosphate groups include, but are not limited Iu, monophosphate, diphosphate, triphosphate, cyclic phosphate or to a chemical derivative of phosphate .such as a phosphate ester linkage.
- S consists of a first nucleotide sequence of a length of about 5 to about 20 nucleotides that is at least partially, preferably completely, complementary to a first portion of each of at least two binding sequences present in distinct genetic contexts in one or more preselected target RNA molecules, in particular embodiments, S has a length of ahoul 6 to about 15 nucleotides, such as a length of 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 nucleotides that are at least partially, preferably completely, complementary to the first portion of the at least two binding sequences.
- S is completely complementary to a seed sequence of each of one, two, tliree, four, five, or more distinct binding sequences present in distinct genetic contexts in one or more pi'c-s ⁇ lectcd target RMA molecules.
- the skilled artisan will appreciate that the at least two distinct binding sequences may be on the same target KNA molecule, or they can be on different RNA molecules.
- S consists essentially of a nucleotide sequence selected from the group consisting of:
- UAUGUGC ⁇ CiUGGG (SEQ ID NO: 1) 3 ⁇ UGUUUUO (SEQ ID NO: 2), ACCCCCiUCOClJ (SEQ ID NO: 5), AGCUGCA (SEQ ID NO: 7), AAACAAUGGAAUG (SBQ ID NO: S), GGUAGC5UCGGUGGG (SEQ ID N(J: 10), CUGCUUGAU (SEQ ID Nt): 12).
- I JCCOUUCCA SRQ ID NO: 13
- UUUUUCUUU (SEQ ID NO: 14), UtJCUGAUGUUU (SEQ FD NO: 15).
- UCUUCCUCUAU (SHQ ID NO: 16), UCGUAGCUGAA (KEQ JD NO: 17), CUTJUC5GUUCCU (SEQ ID NO: 18), CUACUAAUGCU (SEQ ID NO: 19), UCCUGCUUGAU (SEQ ID NO: 20), AUUCUUUAGUU (SEQ ID NO: 21).
- S consists, essentially of a nucleotide sequence selected from the group consisting of: UAUGUGGGUGGG (SEQ ID NO- 1), UCCUCACAGGG (SRQ ID NO. 78), GUCiUUCrAAG (SEQ ID NO 1 88).
- UUCCAC AAC SEQ ID NO: 90
- AACUCUCUA SEQ ID NO 94
- CGUGAACiAC SEQ ID NO: 98
- S consists essentially of a nucleotide sequence of 6 or more contiguous bases contained within any of the sequences selected from the group consisting of:
- UAUGUOGG UGOGG (SEQ ID NO: 1), UCCUCACAGGG (SRQ ID NO: 78), GUGOUGAAG (SRQ ID NO: 8K), UUCCACAAC (SRQ 1D NO 90), AACUCUCUA (SEQ TD NO: 94) and CGUGAAGAC (SEQ ID NO- 98).
- S is partially complementary to a first portion of at least two distinct binding sequences present m distinct genetic contexts in one ⁇ r more pre-belected target RNA molecules, such as 6 of 7, 7 or 8, 8 nf 9. 9 of 10, 10 of 1 1, 11 of 12, 12 of 13. 13 of 14, 14 of 15, oi 15 of 16 consecutive nucleotides of S arc completely complementary to the fust portion of at least two target RNA binding sequences.
- S and the first portion of the distinct binding sequence have lesser overall complmnentarity such as 10 of 12, 1 1 of 13, 12 of 14, 13 of 15, or 14 of 16 nucleotides of complete complementarity
- X is absent or consists of a second nucleotide sequence. In particular embodiments, X consists of one or two nucleotides.
- Y is absent or consists of a third nucleotide sequence, provided that X and Y arc not absent sitnultancously.
- Y has complementarity thai ranges from complete to nonexistent with respect to a second portion of each of the al least two distinct binding sequences, where the second portion is adjacent Io and connected with the 5'-e ⁇ d of the first portion of the binding sequences.
- Y is al least partially complementary (o a second portion of at least one binding sequence, thus allowing the guide strand to have improved interaction with the at least one binding sequence.
- Y provides optimal or desired binding to each of (he second portions of the distinct binding sequences by comprising a consensus-like sequence to which these second portions can bind.
- This aspect of having a region of less than complete complementarity in the guide strand is particularly useful in certain embodiments, for example, by providing an area of some consensus between distinct binding sequences, In particular embodiments of the invention, by combining in the guide strand, S with complete complementarity to a seed portion of each binding sequence, and Y, that is incompletely complemeulary to a.
- the overall nucleotide sequence of XSY is such that it is at least partially complementary to each of the distinct binding sequences to allow a stable interaction with each of the binding sequences, thus providing rnultitargeting interfering KNA of any target molecules comprising the binding sequences,
- XSY may be fully complementary to at least one of the distinct binding sequences.
- XSY is partially complementary to both distinct binding sequences.
- the multitargeting interfering RNA can comprise both a guide strand of formula (I) described supra and a passenger strand that is at least partially complementary to the guide strand to allow formation of stable duplexes between tile passenger strand and the guide strand.
- the passenger strand and the guide strand can be completely complementary Io each other.
- the passenger strand and fhu guide strand can have the same or different length.
- each strand of a multilargetiiig interfering RNA molecule of the invention is independently about 17 to about 25 nucleotides in length, in specific embodiments about 17, :l 8, 19, 20, 21 , 22, 23, 24, and 25 nucleotides in length.
- the interaction between the passenger strand and the guide strand can be adjusted to improve loading of the guide strand into the cellular RISC complex (Khvorova ct ah (2003) Cell, 115: 209-16; Schwarz et al. (2003) CJcIl, 1 15: 199-208), or to otherwise improve the functional aspects of the multitargeting interfering RNA.
- the skilled artisan will appreciate that there arc routine methods for altering the strength and other properties of the base paired strands ⁇ hr ⁇ ugh the addition, deletion, or substitution of one or more bases in either stratid of the synthetic duplex.
- these strategies can be applied to the design of the extremities of the duplex to ensure that the predicted thermodynamics of the duplex are conducive to lhe loading of the desired strand. These strategies are well known to persons skilled in the art.
- a substantially double-stranded RNA molecule comprises a single-stranded RNA molecule with, foe example, a hairpin loop or similar secondary structure that allows the .molecule to self-pair to form at least a region of double- stranded nucleic acid comprising the guide strand of Formula (J).
- RNA molecules provide certain advantages for use in therapeutic applications.
- blunt-ended molecule arc disclosed herein for certain embodiments, in various; other embodiments, overhangs, for example of 1-5 nucleotides, are present at either or both termini.
- the overhangs are 2 or 3 bases in length.
- Presently preferred overhangs include 3'-UU overhangs.
- Other overhangs .exemplified for use herein include, but are not limited to, 3'-AA, 3'-CA, 3'-AU, 3'-UC, 3'-CU, 3'-UG, 3'-CC, 3'-UA 1 3'-U, and 3'-A.
- Still other either 5'-, or more preferably 3 '-, overhangs of various lengths and compositions are contemplated for use herein on the RNA molecules provided.
- al least one target RNA molecule is an niRNA. More specifically, in some embodiments at least one target encodes a receptor, cytokine, transcription factor, regulatory protein, signaling protein, cytoskeletal protein, transporter, enzyme, hormone, or antigen.
- the potential range of protein targets in the celt is not limited, however the skilled artisan will appreciate that certain targets are more likely to be of value in a particular disease state or process.
- target RNA molecules, whether coding or regulatory, originating from a pathogen e.g. a virus
- At least one of the binding sequences is in the 3' UTR of an mRNA.
- RNA molecules preferably (ho target
- RNAs are not solely splice variants of a single gene, nor solely isofo ⁇ ns of each other. In other embodiments where it is vital or preferred to modulate sojue or all such splice variants or isoforms, the multiple targets may encompass such sequences.
- the inclusion of one target or more targets does not preclude the use of, or intention for, a particular interfering RNA to target another selected target.
- Such targeting of any additional RNA target molecules may result, in less, equal, or greater effect in an expression system.
- the multi targeting interfering RNAs of the instant invention are preferably screened for off-target effects, especially those that are likely. For example, reviewing lhc potential binding to the entire Iranscriptome, or as much as of it as is known at the time provides a useful approach to such screening. For example, Where a genome has been completely scqucnced, the skilled artisan w.ill appreciate that the entire Iranscriptome can be conveniently screened for likely off-target effects.
- tissue-specific lranscriptomes eg retina for ocular applications
- non-target transcripts that are identified through b ⁇ o ⁇ nfomialie approaches from the complete trunscriptomc may actually not be present in the tissue into which the multitargeting interfering RNA is applied.
- the guide strand of a multitargeting interfering RNA of the invention forms stable interactions with at least two targeted binding sequences present in distinct genetic contexts On a single target RNA molecule, thus modulating the expression or activity of the RNA molecule, Targeting multiple binding sites on a single target RNA molecule with a single guide strand can provide more effective RNAi of the target RNA molecule. Thjs approach is particularly useful for the modulation of virus gene expression where the mutation rate is high.
- the guide strand of a multi target ing interfering RNA of the invention forms s/.abJc interactions with at least two distinct binding sequences present in distinct genetic contexts on multiple pre-selected target RNA molecules, thus modulating the expression or activity of multiple prc-solecled target RNA molecules.
- Targeting multiple target RNA molecules with a single guide strand represents an alternative to the prototypical one-drug, one- taTget approach. Tn considering the complexity of biological systems, designing a drug selective for multiple targets will lead Io new and more effective medications for a variety of diseases and 5 disorders.
- RNA molecules thai fire involved in a disease or disorder of a biological syslem are pre-selected and targeted by a multitargeting interfering RNA molecule of the invention.
- The- biological system can be, for example, a planl, or an animal such as a rat, a mouse, a dog, a pig, a monkey, and a human.
- RNA molecules can, for example, a planl, or an animal such as a rat, a mouse, a dog, a pig, a monkey, and a human.
- RNA molecules can, for example, a planl, or an animal such as a rat, a mouse, a dog, a pig, a monkey, and a human.
- RNA molecules can, for example, a planl, or an animal such as a rat, a mouse, a dog, a pig,
- RNA molecules can, for example, encode a protein selected from the group consisting of ICAM-1, VEGF-A, MCP- 1 , IL-X, VF-GF- B, IGF- U Ciluc ⁇ p, Inppll, bFGF, PlGF, VEGF-C, VEGF-D, (3-caarticul ⁇ , K-ras-B, ⁇ -ras-A, EGFR 1
- the multitargeting interfering RNA molecule of the invention can, for example, decrease expression, of any combination of ICAM- I , VUGF-B, VEGF-C, VEGF-D, IL-X, IJFCF, PIGF, MCP-I and IGF-I, any combination of ICAM- 1 , VF-GF-A and IGF-I, any combination of f3-cate ⁇ in, ⁇ -ras, and EGFR, bolh ICAM-I and VEGF-A 7 both prese ⁇ ilin-1 and one or more isofo ⁇ ns of BACE-1, 0 both VHGF-A and bFGF, any combination of VF.GF-A, ICAM-L PlGF, and IGF-I , any combination of VEGF-A, K-ras, EGFR and Bcl-2,
- the pre-selected target RNA m ⁇ lecuie can also encode a protein, including an essential 5 protein, for a virus.
- Such essential proteins can be a protein, for example, thai is involved in the replication, transcription, translation, or packaging activity of the virus.
- Exemplary essential proteins for a HIV virus arc GAG, POL, VIF, VPR 1 TAT, NEF, RRV, VPU and ENV, all of which can be a pre-selected target, molecule ⁇ f lhe invention.
- RNA of lhe invention can be used to modulate RNA expression in viruses, including but not 0 limited to, a human immunodeficiency vims (HIV), a hepatitis C virus (TTCV). an influenza virus, a rhinovirus, and a severe acute respiratory syndrome (SARS) virus or a combination thereof.
- viruses including but not 0 limited to, a human immunodeficiency vims (HIV), a hepatitis C virus (TTCV). an influenza virus, a rhinovirus, and a severe acute respiratory syndrome (SARS) virus or a combination thereof.
- the tnultitargetmg interfering RNA of the invention ace designed Io target one or more target RNA molecules in a first biological system and one ⁇ r more target molecules in a second biological system that is infectious to the first biological system.
- the mullitargeting interfering RNA of the invention are designed to target one or more host RNA molecules and one or more RNA molecules of a virus or a pathogen for the host. Therefore, the multitargeling interfering RNA molecule of the invention can, for example, decrease expression of TNF alpha and modulate expression of a hepatitis C virus (HCV).
- HCV hepatitis C virus
- specific multitargeling interfering RNA molecules are provided which arc functional against, specific targets.
- These multitargeting interfering RNA molecules are useful for modulating expression of RNA, for example, their intended target RNA molecules, and data supporting the activity are also provided herein in the working examples.
- synthetic multitargcling interfering RNA molecules comprising the sequence UAUGUGGGOGGG (SCQ ID NO: t), or UGUtJlTUCi (SEQ ID NO: 2), are provided.
- the molecules arc double stranded in at ?casf the region comprising the recited sequence.
- Um molecules decrease expression of both VEGF-A and ICAM-I in an expression system.
- the imiltitargetiug interfering RNA molecules decrease expression of at least one target RNA molecule comprising the sequence CCCACCCACAUA (SEQ TO NO: 3), or CAAAACA (SEQ ID NO: 4). More preferably they target multiple sites on two or more RNAs.
- MuUiUffgeting interfering RNA molecules comprising the scc ⁇ ience ACCCCGUCl JCO (SKQ ID NO: 5 ⁇ arc also provided herein.
- the molecules arc double stranded in at least the region comprising the recited sequence.
- the multilargeting interfering RNAs decrease expression of any combination of ICAM-I, VEGF-A and IGF- 1 in an expression system.
- the iuultitargeting interfering RNA molecules decrease expression of at least one target UNA molecule comprising the sequence AGACi ACGGCiGU (SEQ ID NO; 6). More preferably they target multiple sites on two Or more RNAs.
- multitargeting interfering RNA molecules comprising the sequence AGCUGCA (SEQ TD NO: 7), In one embodiment the molecules are double stranded in at least, the region comprising the recited sequence,
- the niultitargcling interfering RNAs preferably decrease expression of any combination of ICAM- I, VuGF-B, VEGU-C, VEGF-D, IT. -8, bFGF, PlGF, MCP-I and IGF-I in an expression system.
- the mullilargeting interfering RNA molecules modulate expression of at least one target RNA molecule comprising the sequence UGCA ⁇ CU. More preferably (hey target. multiple sites on two or more RNAs.
- multitarg&ting interfering RNA molecules comprising the sequence AAACAAUGGAAUG (SBQ ID NO: 8) are provided.
- the molecules arc double stranded in al least the region comprising the recited sequence.
- the multitargeti ⁇ g interfering RNAs preferably modulate expression of any combination of ⁇ -ras, ⁇ ECiFR and ⁇ catcnin in an expression system.
- the mu I ti targeting interfering RNA molecules modulate expression of at least one target RNA molecule comprising the sequence CAUUCCAUUGUUU (SEQ ID NO: 9). More preferably they target multiple sites on two.or more RNAs.
- multitargeting interfering RNA molecules comprising the sequence GGUACKTUGGGUGGG (SEQ ID NC): 10).
- the molecules are double stranded in at least, the region comprising the recited sequence.
- the mult.ilargeting interfering RNAs preferably modulate expression of gluc ⁇ p and Iiippl 1 ill an expression system.
- the rnultitargoling interfering molecules preferably modulate expression of at least, one target RNA molecule comprising the sequence CCC ACCCACCU AOC (SEQ ID NO: 1 1). More preferably they target cither multiple sites on a single RNA or multiple sites on two or more RNAs.
- RNA molecules comprising the sequence CUGCUUGAU (SEQ ID NO: 12), UCCUUUCCA (SEQ ID NO: 13).
- UUUUUCUUU SEQ HD NO: 14
- UUCUG AUGUU U SEQ ID NO: 15
- UCUUCCUCUAU SEQ ID NO: 16
- UGGUACfCUGAA SCQ ID NO: 17
- CUUUCTGUUCCU SEQ ID NO: 18
- CUACUA AUGCU SRQ ID NO: 19
- the molecules we double stranded in at least the region comprising (he recited sequence.
- ihe multitargcling interfering RNAs preferably modulate expression of at least one RNA encoded by an ITTV genome. More preferably the multilargetmg interfering molecules modulate expression of at leasi. two RNAs so encoded.
- the multitargeiiiig interfering RNA molecules decrease expression of at least one target RNA molecule comprising the sequence AUCAAGCAG (SEQ ID NO: 35), UGGAAACK r A (SEQ i ⁇ NO: 36), A AAGAAAA A (SCQ ID NO: 37), AAACAUCAGAA (SEQ ID NO; 38), AUAGAGC5AAGA (SHQ ID NO: 39), UUCAGCUAC:c:A (SEQ ID NO: 40), AGGAACCA AAG (SEQ ID NO: 41), AGCAUUAGUAG (SEQ ID NO: 42), AUCAAGCAC.1GA (SEQ ID NO: 43), AACU AAAGAAU (SCQ ID NO: 44), CAGGAACJAUGG (SHQ ID NO: 45), GCiAAUUGGACK ⁇ (SEQ ID NO: 46), IJACAGUAUUACi (SC
- multitargeting interfering RNA molecules comprising the sequence GCCUAUCAUAU (SEQ ID NO: 58), UGGUGCCUGCU (SJBQ ID NO: 59), AAUUAAUAUGGC (SEQ ID NO: 60), CCCUCUGGGCU (SEQ ED NO: 61), UUCUUCCUCAU (SBQ ID NO: 62), U ⁇ UUUAUAC ⁇ GA (SRQ ID NO: 63), or
- CACrCAAAAUUC (SF,Q ID NO: 64) arc provided. h ⁇ one embodiment the molecules are double stranded in at least the region comprising the recited sequence:
- the multitargcting interfering RNAs modulate expression of presenilis- I and one urmore isoforms ⁇ f BACE-I in aii expression system.
- RNA molecules that, in an expression system modulate expression of at least one Target RNA molecule comprising the sequence AUAUGAUAGGC (SHQ ID NO: 65), AGCAGGCACCA (SHQ ID NO: 66), CJCCAUAUUAAUU (SHQ ID NO: 67), AGCCCAOAGGG (SEQ ID NO: 68), AUGAGCJAAGA A (SEQ E ) NO: 69), UCUGUAU AAAU A (SEQ ID NO: 70), or C AAUUULIGGUCJ (SEQ TD NO: 71). More preferably they target multiple sites on two or more RNAs.
- multitargeting interfering RNA molecules comprising the sequence UGAGUNNGAACAUCJ (.SHQ ID NO: 72), where N is any base. Tn one embodiment the molecules are double stranded in at least, the region comprising the recited sequence.
- the i ⁇ ullilargeting interfering RN As modulate expression of VEGP-A and bFGF in an expression system.
- the multitargeting interfering RNA molecules preferably modulate expression in an expression system of at least one target RNA molecule comprising the sequence AAUGULfCWACUCA (SEQ ID NOi 73) where VV is CC or AG. More preferably they target multiple sites on two or more RNAs.
- arc rouIliUtrgeting interfering RNA molecules comprising the sequence CUCCAGG (SEQ ID NO: 74). Jn one embodiment the molecules are double stranded in at least the region comprising the recited sequence.
- These multitargeting interfering RNAs modulate expression of any combination of VEGF-A, ICAM- 1 7 PiGF and K ⁇ F- I in an expression system.
- the multitargeting interfering RNA molecules preferably modulate expression, in an expression system, of at least one target RNA molecule comprising the sequence CCUGGAG (SEQ ID NO: 75). More preferably they target multiple sites on two or more RNAs. ⁇
- multitargeting interfering RNA molecules comprising the sequence UCAGUCGG (SBQ IQ NO". 76) are provided herein.
- the molecules are double stranded in at least the region comprising the recited sequence.
- the multitargcting interfering RNAs. modulate expression of any combination of VUCJ F-A, ⁇ -ras, EGFR and bcl 2 in an expression system.
- KNA molecule comprising the sequence CCCACUGA (SEQ ID NO: 77) in such an expression system. More preferably they target multiple sites on Iwo or more RNAs.
- provided arc mulliUirgeting interfering RNA molecules comprising I Ke sequence UCCUCACAGGO (SHQ ID NO: 7S) 1 GUGClK 3AUGGi! G (SRQ TD NO: 79), CC U GCi A GCCCUG (SEQ ID NO: KO), or UCUCACiCUCCAC (SF,Q ID NO: K I ).
- the molecules are double stranded in al least the region comprising the recited sequence.
- the multi targeting interfering RNAs preferably decrease expression of TNl- ' ra and at least one RNA encoded by the HCV genome in an expression system.
- the multitargeling interfering RNA molecules preferably decrease expression of at least one target RNA molecule comprising the sequence CCCUGUGAGGA (STCQ ED NO: 82), CACCAUGAGCAC (SRQ E> NO: 83), CAG ⁇ GCUCCAGG (SEQ ID NO: 84), or GUGGAGCUGAGA (STiQ ID NO: 85) in an expression system. More preferably they taiget multiple sites on Iwo or more RNAs.
- rnultitargeting interfering RWA molecules comprising the sequence ACCCUCGC ⁇ CC (SEQ ID NO: 86), In one embodiment the molecules are double stranded m at least the region comprising the recited sequence.
- the multitargeting interfering RNAs preferably modulate expression of MATAT-I and BlC in an expression system.
- the multitargeting interfering molecules preferably modulate expression of at least one target RNA molecule comprising the sequence GGUGCGAGGGU (SEQ ID NO: 87). More preferably they target either multiple sites ⁇ n a single RNA or multiple sites on two or more RNAs.
- multi targeting interfering KNA molecules comprising the sequence CJ UGUUGA ACl (SEQ iD NO: 88).
- the molecules arc double stranded in at least the region comprising the recited sequence.
- the multitargeling intctfering RNAs preferably modulate expression of TCiF ⁇ and IL-8 in an expression system.
- the miiilitargeting interfering molecules preferably modulate expression of al least one target RNA molecule comprising the sequence CUUC 1 AACAC (SEQ ID NO: 89). More preferably they target either multiple sites on a single KNA or multiple sites on two or more KNAs
- RNA molecules comprising the sequence UUCCACAAC (SEQ ID NO: 90).
- the molecules are double stranded in at least the region comprising the recited sequeneo.
- the mullilargeting interfering RNAs preferably modulate expression of IL-S and MCT- 1 in an expression system.
- the i ⁇ ultitargeting interfering molecules preferably modulate expression of a
- multitargeting interfering RNA molecules comprising the sequences UCCACUGUC (SIjQ ID NO: 92), CAGAAUAG (SEQ ID NO: 93) or AACUCXTCUA (SEQ ID NO: 94).
- the molecules arc double stranded in at least the region comprising the recited sequence.
- These l ⁇ wltitargcirng interfering RNAs in one embodiment, modulate expression of any combination of VCGF-A, Bcl-2 ami K-Ras in an expression system.
- the multitargeting interfering RNA molecules preferably modulate expression, in an expression system, of at least one target RNA molecule comprising the sequences GACAGUGC.
- A SEQ ID NO: 95
- CUAUlJCUG SEQ ID NO: 96
- UAGACJAGUU SEQ JD NO: 97
- provided arc multitargeting interfering RNA molecules comprising the sequence CGUGAAGAC (SEQ ID NO: 98). In one embodiment the molecules arc double stranded in at least the region comprising (he recited sequence.
- Tile multi targeting interfering RNAs preferably modulate expression of HCV in an expression system.
- the inultitargetirtg interfering molecules preferably modulate expression of at least one target RNA molecule comprising the sequence GUCUUCACG (SEQ ID NO: 99). More preferably they larget either multiple sites on a single RNA or multiple sites on two or more RNAs.
- the 12-base seed: CCCACCCACAUA (SEQ ID NO: 3) comprises further two 11-base , , three 1.0- base, four 9-basc, five 8-base, six 7-basc and seven 6-base seeds, all of which could be used in the design of useful multitargeting interfering RNA.
- Such molecules can target multiple sites on a single RNA or multiple sites on two ⁇ r more. RNAs and are useful to decrease the expression of such one Oi- preferably two or more such targeted RNAM in an expression system.
- a given nuilti targeting interfering RNA will be more effective at modulating expression of one of several target RNAs than another.
- the niultitarget ⁇ ng interfering RNA will similarly affect all targets in one or more expression systems.
- RNAi efficiency Various factors can be responsible for causing variations in silencing or RNAi efficiency; (i) asymmetry ⁇ f assembly of the RISC causing the passenger strand to enter more efficiently into the RISC than lhe guide strand; (ii) inaccessibility of the targeted segment on the target RNA molecule; (iii) a high degree of off-target activity by the interfering RNA; (iv) Sequence-dependent variations for natural processing of RNA, and (v) lhe balance of the structural and kinetic effects described in (i) to (iv). See Hossbach et al. (2006), RNA Biology 3: 82-89. In designing a multi targeting interfering RNA molecule of the invention, special attention can be given to each ⁇ f the listed factors to increase or decrease the RNAi efficiency on a given target RNA molecule.
- Another general aspect of the invention is a method for designing a mullitargeting interfering RNA.
- the method of the invention includes various means leading to a multi targcti Ug interfering RNA that effectively targets distinct, binding sequences present in distinct genetic contexts in one or more pre-selcctcd target RNA molecules.
- a inultitargeting interfering RNA can be designed by visual or computational inspection of the sequences of the target molecules, for example, by comparing target sequences and identifying sequences of length n which occur in the one or more targei, sequences.
- all possible sequences of a prc-Seleeted length n can be generated by virtue of each permutation possible for each nucleotide position to a given length (4 n ) and then examining for their occurrence in the target sequences.
- the methods provided herein design interfering RNA molecules, cither single or duplex in nature, which have at least one region (S) of complete complementarity to a first portion (a seed) of the distinct binding sequences, .and io certain embodiments, further comprises a second region (Y) of at least partial complementarity to a second portion of one or more distinct binding sequences, in other embodiments, the region Y can have complete complementarity to a second portion of one or more distinct binding sequences, and in yet others there may be no complementarity between Y and a second portion of one or more distinct binding sequences.
- a method of designing a in ul Ii targeting interfering RNA comprises (he steps of a) selecting one or more target RNA molecules, wherein the modulation in expression of the one or more target RNA molecules is desired; b) obtaining at least one nucleotide sequence for each of the one or ⁇ i ⁇ re target RNA molecules; c) selecting a seed sequence of 6 nucleotides or more, said seed sequence occurs in distinct genetic contexts in the target RNA molecules; d) selecting at least two distinct binding sequences, each of which comprises the seed sequence and is present in distinct genetic contexts in the target molecules; e) designing a rnultitargetitig interfering RNA molecule having a guide strand thai shares a substantial degree of complementarity with each of the at least two binding sequences to allow stable interaction therewith.
- the method comprises designing a passenger strand that is at least partially complementary to the guide strand to allow formation of a stable duplex between the passenger strand and (he guide strand.
- the method of the invention comprises the sleps of: a) selecting one or more target RNA molecules, wherein the modulation iu expression of the target RNA molecules is desired; b) obtaining at least one nucleotide sequence for each of the target RNA molecules; e) selecting a length, n, in nucleotides, fox a seed sequence; wherein n — about 6 or ⁇ ore; d) generating a collection of candidate seed sequences of the length n from each of the - nucleotide sequences obtained in step b), wherein each candidate seed sequence occurs at least once in nucleotide sequences obtained in step b); e) determining the genetic context of each of the candidate seed sequences in nucleotide sequences obtained in step b), by collecting, for eacii occurrence of the candidate seed sequence, a desired amount of the 5' and 3' flanking sequence; f) selecting a seed sequence of the length n from the candidate seed sequences, wherein the
- the method further comprises repeating steps c) to h) with a different value of n.
- the method may comprise repeating steps f) to h) for a different seed sequence.
- the method may comprise selecting a different consensus target sequence based around a particular seed and flanking sequence.
- the method of (he invention further comprises the steps of making the multilargetmg interfering RNA molecule and testing it in an expression system.
- target RNA molecules are strategically-selected molecules, for example viral or host RNAs involved in disease processes, viral genomes, particularly those of clinical significance, and the like.
- viral or host RNAs involved in disease processes for example viral or host RNAs involved in disease processes, viral genomes, particularly those of clinical significance, and the like.
- a detailed discussion of target RNA is provided above and applies equally to this and other aspects of the invention, as if set oul in its entirety here. The basis for the selection of a target RNA molecule will be appreciated by those of skill in lhe art.
- Preferred tai'gcl RNAs are those involved in diseases or disorders one wishes to control by the administration of the mulritargeting interfering RNA
- the step of obtaining the sequences for the selected target is conducted by obtaining sequences from publicly available sources, such as the databases provided by the National Center For Biotechnology Information (NC ⁇ i) (through the National Institutes of Health (NIH) in the United States), the European Molecular Biology Laboratories (through the European - l ⁇ ioinf ⁇ nnatics Institute throughout Europe) available on the World-Wide Web, or proprietary sources such as fee-based databases and the like. Sequences can also be obtained by direct determination.
- RNA molecules can be used for the design of tnullitargctiiig interfering RNA of the invention.
- a plurality of independent target nucleotide sequences are obtained in step b) for each of one or more target RNA molecules selected in step a).
- Tlic databases described above frequently have multiple sequences available for particular targets. This is especially true where genetic variation is naturally higher, for example with viral sequences.
- the plurality of target nucleotide sequences represents strain variation, allelic variation, mutation, or multiple species. The number of such a plurality of sequences may range from several or a low multiple, to numerous - for example dozens or even hundreds or thousands of sequences for a given, target. It. is especially possible to have such numbers of sequences when working with viral sequences.
- sequences chosen can be further limited based on additional desirable or undesirable features such AS ureas of low sequence complexity, poor sequence quality, or thoses that contain artefacts relating to cloning or sequencing such as inclusion of vector-related sequences. Furthermore, regions with extensive inaccessible secondary structure could he filtered out at this stage. Indeed, Luo and Chang have demonstrated that siRNA targeting accessible regions of rt ⁇ RNA structure such as loops were more likely to be effective than those aligned with stems (Luo & Chang, (2004) ⁇ Bivchem. Bivphys. Res. Commun., 318: 303- 10). The sequences chosen, however, need not be limited to 3'IJTR sequences or regions of low secondary structure (as illusttated in sonic of the specific examples.)
- the step of selecting a length of n nucleotide- bases for a seed sequence is preferably an iterative process that does not require any particular basis or logic at first glance - i.e. Ihe starting seed length may be any number of bases above about 5. The longer the length (hat is chosen for a seed, the less likely it will appear in a portion of the target RNA, e.g. in a target RNA binding sequence. TIw shorter the seed sequence length, the more frequently it will occur as would be expected.
- an iterative process is used to find the preferred sequences for candidate seeds as described below.
- another value e.g.
- the process can be repeated to identify candidate seed sequences of length »+7, n-1 and so on.
- the number of candidate seeds will increase as the length of the seed is decreased, In a situation where a plurality of sequences are available for particular target RNA molecule (eg viral isolates), it will be appreciated by one of skill in the art that, the totality of the sequences can be searched For candidate seeds.
- candidate seeds may in some oases be found only in a proportion of the sequences for the RNA molecule, Tn these situations, U may he desirable to prioritise lho.se scuds which occur in a larger proportion of the sequences.
- the seeds can be selected from a p ⁇ l of “candidate seeds,” also referred to herein as “seed candidates.”
- Seed candidates include sequences of a particularly desired or selected length present at least once in each of the target molecules.
- the candidate seeds are preferably generated by computer, for example by moving stepwise along a target sequence with a "window” (expressed in terms of a number of contiguous nucleotides) of the desired or selected seed length.
- a “window” expressed in terms of a number of contiguous nucleotides
- each step is a single base progression, ihus generating a "moving window” of selected length through which the target sequence is sequentially viewed.
- Other step distances are contemplated, however, the skilled artisan will appreciate that only a step of one nucleotide will allow the generation of all possible seed sequences.
- the pool of candidate seeds includes any sequences of the selected length from the "moving window" scan of the target RNA molecule.
- the pool of candidate seeds includes those sequences of the Selected length from the "moving window” scan of the target RNA molecules, which occur at least once in each of the target RNA molecules.
- step (d) above comprises two substcps: (i) generating a collection of nucleotide sequences of the selected length n from each nucleotide sequence obtained in step b); and (ii) selecting candidate seed sequences of the length n from the collections of nucleotide sequences, Wherein each candidate seed sequence occurs at least once in the nucleotide sequences obtained in step b).
- the term "distribution" in the context of a seed or candidate seed means the overall average frequency, ⁇ r number of occurrences, of a seed or candidate seed within a nucleotide sequence of interest, for example, Example 13 (below) has the following pattern of occurrence for a 9 base seed in HCV isolates of genotype la/lbr 4 times in genome: 5/ .155 isolates 3 times in genome: ( ⁇ /155 isolates 2 times in genome: 50/155 isolotes 1 time in genome; 31/155 isolates 0 times in genome: 1/155 isolates
- the method further comprises the step of discarding those candidate seed sequences that do not occur with at least a predetermined minimum average rate of occurrences within the sequences obtained for a target. RNA molecule. This stop allows the method to take into account, the average distribution of the candidate seed sequences within sequences for the same target RNA.
- the method further comprises the step o.f discarding those candidate seed sequences that do not. occur within at least a predetermined minimum percentage of the target nucleotide sequences obtained for a target nucleotide molecule (thai is, the extent, of conservation), This step allows lhe method to more fully take into account the frequency with which a particular candidate seed occurs across multiple target sequences obtained for a target RNA.
- the multitargeti ⁇ g function of preferred KNAs made by the methods provided herein is enhanced by the higher representation of a- candidate seed sequence both within and across such sets of target sequences.
- the method ultimately chosen will include one or more of these steps, or all of them as needed.
- lhe method further comprises the step of discarding any candidate seed sequence that: is composed of only u single base, is composed only of A and U, has a consecutive string of 5 or more bases which are C, is predicted to have a propensity to undesirably moduiale the expression or activity of one or more cellular components, is predicted to occur with unacceptable frequency in the non-target transcriptomc of interest; or any combination thereof.
- candidate seed sequences may also be discarded if they contain sequences predicted to have a propensity to activate a cellular sensor of foreign nucleic acid, have a consecutive string of 5 or more bases which are (5, or a combination thereof.
- Seeds then are selected from the pool of candidate sequences as the ones that arc present in two different genetic contexts in the one or more target sequences. Genetic contexts arc determined by collecting, for each occurrence of the candidate seed sequence, a desired amount of the 5' and 3' flanking sequence.
- a seal sequence is used to generate one or more ''consensus target sequence.?", which comprises (he: seed sequence and a desired consensus sequence for the sequence flanking either one or both of the 5' and 3' ends of the seed.
- TIic "consensus sequence for the sequence flunking cither one or both of the 5' and 3 1 cuds of the . seed” is readily derived from the examination of the genetic context of seed sequence in each of the target molecules by visual inspection, or through the use of bioin forma tic tools or
- the consensus target sequence docs not include any sequence that is predicted to have a propensity to undesirably modulate the expression or activity of one or more cellular components.
- Consensus target sequences may Ixi determined by eye or by algorithm. For example, a 0 computer algorithm can be used to score all possible permutations of paired nucleotides in the positions in wliich the sequences are different between the at least two targets. This is' particularly useful when the targets have some identity beyond the seed, but for which an alignment by eye proves difficult. This method can be used to determine the consensus target sequence, or alternatively, the anlisense strand of the candidate multitargeting interfering R.NA 5 directly.
- the algorithm suo ⁇ es wobbles (G: U, U;G), other non-canojiical pairs (eg A;C, C:A) and remaining mismatches with increasingly large ' negative penalty terms, respectively.
- These penalty terms arc adjusted for their position within the mill Ii targeting interfering KNA, with those placed at the 3' extremity incurring lower fractional penalties.
- Penalties are also adjusted in the presence of multiple contiguous mismatches or wobbles. Those proposed mu I ti targeting interfering RNAs with the lowest aggregate penalty scores for all targets are prioritized for further evaluation.
- a further alternative approach that is particularly useful when there is little identity between the target sequences outside of the seed sequence or when a large number of " target sequences need to he considered is to generate all possible permutations of the extension from the complement of the seed in the 3 1 direction Iu a required length, thereby generating the putative SY of Formula (I) and hybridising each putative SY against the target sequences of interest in silica to determine those which demonstrate the most favourable properties in terms of hybridisation to the target and preferential strand loading.
- Hybridization is typically examined from a thermodynamic perspective using RNAhybrid software (Rchirismeier et al., 2004, RNA, 10: 1507-17) or similar algorithm,
- the invention provides an algorithm for determination of the guide strand of a length n for a multitargeting interfering RNA comprising a seed sequence.
- 1) Definition of terms a. Load Bias: Scoring A Or U as " 1" atld G or C as "2" in each candidate guide strand: i. Multiply the A-WG-C score by the relevant scaling factor in the Table below ii. sum the products for the residues at positions 1-5. iii. sum the products for the residues at positions n to n-4. iv. divide the total at (iii) by the total at (ii)
- Activity Score For each target Ti ...T n , calculate the product of lhe minimum free energy (mfe) of the binding of the guide strand and the number of contiguous bases complementary to Hie target tit the 5' cud of the guide strand, (r-5 1 ). The product of these scores is the Activity Score,
- Relative Activity Score The Activity Score for ail interfering RNA divided by lhe Maximum Activity Score for. the targets.
- vScoring A or IJ as "I” and CJ or C as "2" in the guide strand i. multiply the A-U/G-C score by the relevant scaling factor in the Table A below; ii. sura the products for the residues al positions 1-5; iii. sum the products for the residues at positions n-4 to n (excepting overhangs if present); iv. divide lhe total at (iii) by the total at (ii); and v. scores greater than 1.2 for the guide strand indicate likely favourable loading of that strand.
- ⁇ number of nucleotides involved in forming the duplex (excluding overhangs if present).
- this method used to design the active multitargeting interfering RNA can, with alight modification, be used to design suitable consensus target sec ⁇ ie ⁇ ces, which are then converted to putative SY sequences. Regardless of the flow path of design, the candidate SY sequences are then prioritized for testing not only on this basis but also taking into account other features that may be important for the functionality of the multitargeting interfering RNA (by, for example, use of appropriate penalty terms).
- a further embodiment comprises the step of discarding seeds that are extremely G/C rich at their 3' extremity.
- a G/C rich 3' extremity of the seed may be undesirable as the resulting matching guide strand could be dismdvuntaged from a loading point of view, depending on the G/C content of the T end of the guide strand (excluding the overhangs), Whilst this may not be preferable, strategies can be used to overcome the predicted poor loading bius when seeds arc G/C rich at their 3' end. These include, but are not limited to, the use of an A/U-rich extension in Hie 5' end of the guide strand, i.e.
- RNA duplexes such as LNA, 2 1 -0-tncthyl and 2'-tncUiox.yethyl can be used for bases positioned at the 5' end of the passenger strand so as to favor loading of the guide strand.
- steps can optionally be addcd.individually or in combination. Such steps are used to further the rational process of designing the multitargeting interfering RNAs - such as to reduce the number of sequences unlikely to work for the intended purpose, to increase the effectiveness of the RNAs, to reduce off target effects and the like. Many of these steps can be automated, or require only a limited amount of input from at ⁇ operator, though the use of bioinformiUiu computer systems, which as the skilled artisan will appreciate, will facilitate the methods.
- RNA sequences may detect particular RNA sequences and produce stress responses (for example, sec Sioud, M. (2005), J MoI Biol 348, 1079- 1090, Specific "motifs" associated with increased inflammatory responses (Homung, V. et al. (2005) Nat Med 71, 263-270; Judge. A.I), et al. (2005) Nat Mad 11, 263-270) could be easily excluded.
- a further embodiment to excluding seeds specifically related to duplex molecules of the invention applies to the presence of a GK". rich region al the 3' end and to the presence of 5 or more contiguous Gs in the seed or consensus target sequence (which includes the seed).
- the method further comprises the step of discarding any consensus target sequence that: is composed of only a single base, is composed only of A atid U, , has a consecutive string of 5 or more bases wluch are C, is G/C ridh at the 3' end, is predicted to occur with unacceptable frequency in. the non-larget tr ⁇ mscriptome of interest; or any combination thereof.
- consensus target sequences may also be discarded if (hey contain sequences predicted to have a propensity to activate a cellular sensor of foreign nucleic acid, if they arc predicted to be involved in intramolecular base pairing, have a consecutive string of 5 or more bases which are G, or a combination thereof.
- consensus target sequences can be used as intermediates in the design of a mu I ti targeting interfering RNA of the invention.
- the consensus target sequences are used to design a strand of the corresponding multitargeling interfering RNA
- the consensus target sequences are at least substantia! iy the complement of a "guide strand" of a candidate multitargeling interfering RNA.
- they are the complete complement of a "guide strand" of a candidate mullitargcting interfering RNA.
- the consensus target sequence is at least possibly, but not. necessarily, identical to the "passenger strand" of the corresponding candidate ⁇ iultitargeting interfering RNA, when these are double stranded.
- Scanning the consensus target, sequences against a non-target transcriptonic of interest fov prediction of off-target effects, and eliminating any sequence predicted to have unacceptable off- target effects on a ti ⁇ n-targel transcriptomc of interest are also useful ways of reducing the number of consensus target sequences, and any of the foregoing may be added as a step in the process. This is performed by searching for similar sequences using, for example, BLAST Software.
- An alternative, but not necessarily equivalent procedure includes the in silico hybridization of the complement of the consensus target sequence against the transcriptome using, for example, KNAhybrid or equivalent software.
- it is prudent to routinely screen specific designed multitargetmg interfering RNAs e.g. CODEMIRs, VlRQMIRs and the like, for cytotoxicity, due to unforeseen, but problematic, off-target effects.
- Any undesirable properties for such a therapeutic RNA can be used as a basis on which to discard candidate seed sequences, consensus binding sites or proposed multitargeting interfering RNA.
- RNA molecules obtained from the basic method outlined above can be modified and often will be to improve (heir properties.
- the methods then can further comprise the step of modifying a rnu I ti targeting interfering RNA duplex designed in step h) Io improve actual or predicted loading into a RISC complex, to improve activity against at least one target RNA molecule, to decrease stress or inflammatory response when administered in a host cell; to alter half-life in ati expression system, or any combination thereof.
- the designed multi targeting interfering RNA molecule can be modified, for example, i) to improve the incorporation of the guide strand of the multitargeting interfering RNA molecule into the RNA induced silencing complex (RISC 1 .); ii) to increase or decrease the modulation of the expression of at least one target RNA molecule; iii) to decrease stress or inflammatory response when the ⁇ nilti targeting interfering RNA molecule is administered into a subject; or iv) any combination of i) to iii).
- RISC 1 . RNA induced silencing complex
- the modifying step comprises one or more of altering, deleting, or introducing one or more nucleotide bases to create at least one mismatched base pair, wobble base pair, or terminal overhang, or to increase RISC mediated processing. Techniques for doing so are known in the art. Preferably the modifications are at least initially performed in silica, and tlic effects of such modifications can be readily tested against experimental parameters Io determine which offer improved properties of the interfering RNA products.
- the methods, through Io the step of actually making an RNA are conducted entirely in silico, or by visual inspection and determination.
- the method further comprises the step of choosing a new value for the seed length, /!, and repeating each of the remaining steps. It is clear that the method can be iterative and the benefits of computers for such purposes are well known. Al so provided herein are methods that further comprise the step of actually making and testing at leasl one designed interfering RNA in a suitable cellular expression system.
- a combination of careful in silico design along with biological testing of candidates can l>c used to identify candidates wilh superior activity in an efficient manner.
- Screens that can be considered for the high throughput assessment of candidates include reporter assays, multiplexed ETJSAs 1 viral replicon systems, dot-blot assays, JlT-PCR etc.
- Candidate multii ⁇ rgeting interfering RNA are routinely synthesized as double-stranded RNA molecules with 19 bp of complementarity and 3' two nucleotide overhangs.
- the two nucleotide overhangs are routinely designed to be complementary to the target RNAs, although dTdT or UU overhangs may also suit.
- the passenger strand (complementary to the guide strand) can be usually designed to include a 3 1 two nucleotide UU overhang. FTowever, other types and lengths of overhangs could be considered, as could "blunt-ended" duplexes.
- Candidate multilargeting interfering RNA can also be single- stranded molecules,
- multiple multitargeling interfering RNAs When produced by an expression system such as a vector or plasmid, it is possible to assemble multiple multitargeling interfering RNAs into a single therapeutic product. Skilled artisans will realize that multiple multilargeting interfering RNAs can be co-expressed by several strategies, including but not limited to, expression of individual multitargeting interfering RNAs from multiple expression vectors (plasmid or viral), expression from multiple expression cassettes contained within a single vector, with each expression cassette containing a promoter, a single multitargeting interfering RNA and terminator. Multiple multitargeting interfering RNAs can also be generated through a single polycistronic transcript, which contains a series of multitargeting intcrfering.RNAs.
- the multiple multitargeting interfering RMAs can be expressed sequentially (sense / intervening loop / antisense) or expressed with the sense sequence of each multitargeting interfering RNA sequentially linked 5' to 3', joined directly or with intervening loop / spacer sequence, followed by the antisense sequence of ouch mul Ii targe ting interfering RNAs sequentially linked 5' to 3' .
- multitargeting interfering RNA are typically tested in cell culture using an appropriate cell line representative of the targeted tissue. Some non-limiting specific conditions used arc outlined in the specific examples. Multilargeting interfering RNA that modulate target RNA expression or activity can then be studied further. Specifically, semi- quantitative RT-PCR for the target RNA may be performed to establish whciher repression "is likely to be mediated by RNA degradation. Tn general, cells are transacted with the multitargcli ⁇ g interfering RNA al a concentration of 5-40 nM in the culture medium and after 4K hours, arc washed, irypsinizcd and harvested for total KNA vising a RNeasy kit (Qiagen). RT- PCR is then performed using primer sets specific for the target RNAs.
- Pi'Olcumic and microartfty experiments may be used lo assess off- target effects.
- analysis of markers of JFN-response eg STAT I , IF-Nb, 11,-8, phosphoEi ⁇ etc. can be performed on treated cells.
- the candidate mullilargeting interfering RNA arc tested for non-specific toxic effects by, for example, direct assays of cell toxicity.
- cytotoxicity is the desired outcome and " may reflect the successful repression of key oncogenic signaling pathways.
- Mult ⁇ targciing interfering RNA are additionally assessed for their ability to repress the production of specific target proteins.
- Multitargeling interfering RNA demonstrating efficacy in this respect are then assessed for additional evidence of off-target effects, including arrest of non-target protein production and activation of Protein Kinase R mediated responses.
- Tlie RNA molecule may be expressed from transcription units inserted into vectors.
- the vector may be a recombinant DN A or RNA vector, and includes DNA plasmids or viral vectors.
- the viral vectors expressing the multitargeting interfering RNA molecules can be constructed based on, but not limited to, adeno-associated virus, retrovirus, adenovirus, letllivirus or alphavirus.
- the vector is an expression vector suitable for expression in a mammalian cell.
- Methods which are well known to those skilled in the art can be used to construct expression vectors containing a sequence which encodes the multi target RNA molecule. These methods include in vitro recombinant PNA techniques, synthetic techniques and in vi v ⁇ recombination or genetic recombination. Such techniques are described. in Sainbrook et al (1989) Molecular
- Suitable r ⁇ ules of administration of the pharmaceutical composition of lhe present invention may, for example, include oral, rectal, transmucosal, or intestinal administration; parenteral delivery, including intramuscular, intravenous and subcutaneous injections.
- the pharmaceutical composition may be administered in a local rather than systemic manner, for example, via injection of the pharmaceutical composition directly into a target organ ⁇ r tissue, such as intramedullary, intrathecal, direct intraventricular, intraperitoneal, or iiilraocular injections, often in a depot or sustained release formulation.
- a target organ ⁇ r tissue such as intramedullary, intrathecal, direct intraventricular, intraperitoneal, or iiilraocular injections, often in a depot or sustained release formulation.
- Tni ⁇ tvesiculur instillation and intranasal/i ⁇ halali ⁇ n delivery arc other possible means of local administration as is direct application to the skin or affected area.
- the pharmaceutical composition of the present invention may be delivered in a targeted delivery system, for example, in a liposome coated with target cell-specific antibody. The liposomes will be targeted to and taken up selectively by the target. Cell.
- Other delivery strategies include, but are not limited to, dendrimers, poly
- the multilargetiug interfering KNA molecules of the invention can he added directly, or can be complexcd with cali ⁇ nic lipids, packaged within liposomes, or otherwise delivered to target cells or tissues.
- the nucleic acid or nucleic acid eomplc ⁇ es can be locally administered to relevant tissues ex vivo, or in vivo through injection, infusion pump or stent, with or without their incorporation in biopoly ⁇ iers.
- the invention provides biological systems containing one or more mullitargeting interfering RNA molecule of this invention.
- the biological system can be, for example, a virus, a microbe, a plant, an animal, or a cell.
- the invention also provides a vector comprising a nucleotide sequence that encodes the multitargeting interfering RNA molecule of the invention.
- the vector is viral, from example, derived from a virus selected from the group consisting of an adcno-associated virus, a retrovirus, an adenovirus, a lcnlivirus, and an alphavims.
- the mullilargettllg interfering RNA can be short a hairpin RNA molecule, which can be expressed from a vector of the invention.
- the invention further provides a pharmaceutical composition comprising a multilargeting interfering RNA molecule of the invention and an acceptable carrier.
- the pharmaceutical composition comprises a vector for a multitarget ⁇ ng interfering RNA molecule of the invention,
- the present invention provides a method of inducing RNA interference in a biological system, which comprises the step of introducing a inultitargeling interfering RNA molecule ⁇ f the invention into the biological system.
- the present invctui ⁇ provides a method of inducing RNA interference in a biological system, comprising the steps of: (a) selecting a set of target RNA molecules; (b) designing a multitarguling interfering RNA molecule comprising a guide strand that can form stable interactions with at least two binding sequences present in distinct genetic contexts in the set of target RNA molecules; (c) producing the mullitargcling interfering RNA molecule; and (d) administering the multitargct.ing interfering RNA molecule into the biological system, whereby (he guide strand of the multitargeting interfering RKA molecule forms stable interactions with the binding sequences present in distinct genetic contexts in the set of target RNA molecules, and thus induces RNA interference of
- the present i nvenlion provides a method of treating a disease or condition in u subject, the method comprising the steps of: (a) selecting a set of target RNA molecules, wherein the modulation iti expression of the target RNA molecules is potentially therapeutic for the treatment of the disease or condition; (b) designing a multitarget ⁇ ng interfering RNA molecule comprising a guide strand that can form stable interactions with at least, two binding sequences present in distinct genetic contexts in the set of target.
- RNA molecules comprising: (e) producing the mulUlargeting interfering RNA molecule; (d) administering the multitargeling interfering RNA molecule into the subject, whereby the guide strand of the multitargeting interfering RNA molecule forms stable interactions with the binding sequences present, in distinct genetic contexts in the set of target RNA molecules, and thus induces modulation of expression of the target RNA molecules.
- the target RNA molecule or molecules can be selected, for example, from any RNA in a cell or virus.
- a viral genome, or even multiple viral genomes, for example two or more related or unrelated viruses, can also be conveniently targeted.
- the useful or desirable targets for any disease or related process may be identified by any of one or more means including, for example, projected or validated drug targets from the literature, including the patent literature, or from target discoveiy processes. The skilled artisan will understand and appreciate how to select useful or desirable targets.
- the target genes are then prioritized based on evidence supporting a key role for their products in the disease process of interest.
- RNA targets In some cases, specific attention may need to be paid to lhe accuracy and/or relevance of the sequence to the disease of interest. For example, in targeting cancer, it is advisable to avoid mutational "hot-spots", It is also to be noted that the sequence used need not be the complete sequence. Also, selective targeting of a specific splice variant or is ⁇ form muy be desired and the target sequence used in the design of mullitargcling interfering RNAs may need to be restricted to that, predominantly present only in the diseased tissue that is targeted by the multitargeting interfering RNA of tlic invention. Thu use of Single- or double-stranded RNA compounds that can target multiple sites within a vital genome, for example, viral RNA targets, is also provided herein.
- VlROMlRs The multilargeting interfering RNA molecules that target multiple sites in the genome of one or multiple isolates of a virus are sometimes referred herein as "VlROMlRs".
- VlROMlRs The multilargeting interfering RNA molecules that target multiple sites in the genome of one or multiple isolates of a virus are sometimes referred herein as "VlROMlRs".
- Targeting repeated sequence elements in viral genomes is an attractive approach for viral therapy. Such multttargeting is calculated to create a daunting hurdle to (he emergence of resistant clones, which would require multiple, simultaneous, mutations.
- multiple sites can be chosen to maximize coverage of sequence variations across a range of viral isolates.
- Elements can be identified comput.alionu.tly that are present in a pre-sclected percentage ⁇ f isolates, such as a majority or even the totality of known isolates, thereby ensuring maximal therapeutic benefit.
- isolates of greatest actual or projected clinical significance can be preferentially targeted.
- the design process can also facilitate development, manufacture, and ultimately administration of the therapeutic compounds.
- the additional targeting of one or more host proteins or other intermediates of the pathway involved in the pathogenesis of the viral disease can also be designed. Bacterial infection and any other disease caused by a pathogen can be targeted by a similar approach.
- RNA compounds of the present invention can be used to treat or prevent diseases in plants, animals and in particular humans.
- the RNA compounds can be either cell-expressed into the relevant plant, animal or human cell to derive the required effect or be administered as a chemically synthesized compound directly or indirectly by means of a delivery molecule or device.
- the RNA compounds of the present invention can be used to treat or minimise pest attack on plants and animals.
- the pests may be vertebrate or invertebrate. J&J 5206
- the present invention may lie used for treatment or prevention ⁇ f a disease state resulting from expression of the target genes.
- Disease stales include, but are not limited to, autoimmune diseases, inherited diseases, cancer, or infection by a pathogen. Treatment would inciiide prevention or amelioration ⁇ f any symptom or clinical indication associated, with the disease.
- the disease state is cancer (eg colorectal adenocarcinoma), diabetes, diabolic retinopathy, age related macular degeneration (AMD), psoriasis, HFV infection, HCV infection or Alzheimer's disease,
- the current invention therefore encompasses, but is not limited t-O, the concept of treating these diseases with multitargcting interfering RNAs. As can be readily appreciated, the same principles can be applied to the treatment of all other complex diseases.
- the selection of target sequences; for the multitargcting interfering RNAs will be determined by the disease(s) against which the therapeutic is desired.
- the target RNA sequence may include mRNA, and noncod ⁇ ng RNA and may be encoded cither by the host or infectious agent or both.
- the target RNA set for any one multitargeting interfering RNA can be selected from any of these types and may represent any combination of gene or gene products including but not limited to: receptors, cytokines, transcription factors, viral genes, bacterial genes, plant genes, inscel genes, yeast and fungal genes, regulatory and/or signalling proteins, non-coding RNA, cytoskclelal proteins, transporters, enzymes, hormones, antigens, hypothetical proteins and proteins of unknown function. Additionally, targeting of different isolates of a pathogenic agent is envisaged. The multiple target sites can then be chosen to maximise coverage of. sequence variations across a range of isolates,
- the modulation of the target RNA molecule is determined in a suitable expression system, for example /Vi vivo, in one or more suitable cells, or in an acelhilar or in vitro expression system such as are known in the art. Routine methods for measuring parameters of the transcription, translation, or other aspects of expression relating to RNA molecules are known in the art, and any such measurements are suitable for use herein.
- the m ill ti targeting RNAs in accordance with various aspects of the invention are useful to -modulate the expression of one or more target RNA in an expression system. More preferably, they arc used to reduce expression of one or more target RNA. Such decrease can occur directly or indirectly by any mechanism known in the art, or which is yet to bu discovered, for the decrease of RNA expression as defined herein by an RNA. In some embodiments, they may completely eliminate expression of the one Or more RNA targets, tn some embodiments, a given RNA will be more effective at modulating expression of one of several target KNAs than another. In other cases, the RNA may similarly affect all targets in one or more expression systems.
- the muJlilargeting RNAs provided herein arc of particular value in the treatment of complex mulligenic diseases in which single gene-specific therapeutics may be at a disadvantage because of the multiple redundancies in pathophysiologic pathways.
- the current invention enables a conscious and calculated approach in which multiple or key proteins or pathways, such as signaling pathways or molecules, can be targeted with a single agent to generate greatly increased therapeutic potential.
- the targets of interest may be at least partially controlled by a. common "master regulator," for example, an upstream pleiotropic factor.
- LSUCI ⁇ common regulators arc often transcription factors.
- IL-8 and MCP-I could theoretically be down-regulated by targeting the nuclear factor, NFkappaB.
- NFkappaB is also a ⁇ factor involved in the survival of Retinal Pigmented Epithelial cells (RPIj) 1 particularly in times of stress,
- RPIj Retinal Pigmented Epithelial cells
- the novel approach disclosed herein is amenable to the modulation of multiple specific targets of interest, without having to indiscriminately modulate common upstream factors.
- RNA molecules inultitargcting interfering RNAs provided herein are applicable to the treatment of diseases characterized by cellular heterogeneity.
- diseases characterized by cellular heterogeneity For example, in solid tumours, the presence of mutated genes and activated pathways may vary widely within the same tumour, hetwcen tumours in the same patient, as well as between tumours of a similar histology in different patients.
- the development of an RNA molecule active against, several key pathways may derive synergistic activity against cells reliant on several of these targeted pathways. However, activity against a greater proportion of the tumour cells will also be likely because of the "multi-targeted" nature of the RNA molecule.
- targeting of several key pathways will "cover" or allow treatment of more of lhe patient population.. Hence, improved clinical outcomes are likely with treatment with the RNA molecules provided herein.
- the targeting of multiple disease-related transcripts with a single multitargcting interfering RNA makes optimal use of available RLSC', in contrast to the administration of multiple siRNA molecules, which could saturate the available intracellular machinery.
- Targeting multiple sites within the same RNA target sequence is also envisioned for the interfering RNAs provided herein, i.e. the mullitargeting aspect is not limited to multiple targets within multiple target.
- RNA molecules Many human diseases, including cancer and viral infections, arc characterized by RNA targets exhibiting high mutation rates. This increases the likelihood of resistance to nucleic acid therapeutics arising in these diseases, due to mutation of the target RNA. Targeting multiple sites within the target RNA decreases the likelihood of such resistance arising, since at least two simultaneous mutations would bo required for resistance.
- the multi-targeting approach used with muhitargeting interfering RNAs can be directed to the generation of 7Tiultiple hits against a single target RNA molecule, for example, to prevent escape mutants.
- Targeting of multiple sites within the same •transcript may also produce synergistic effects otl the inhibition of viral growth.
- employing a mechanism or mechanisms requiring only partial complementarity with the target RNA molecule can decrease the possibility of developing resistance through single point mutation.
- CX)DEMIRs suitable for therapy for DR were sought.
- VBGF-A and ICAM- 1 are likely drivers of the loss of integrity of the blood-retinal barrier, which loss leads for example (o diabetic macular edema, a prelude to angiogenesis and DR. Therefore, VEGF-A and ICAM- 1 were selected as largely for the design of CX)DCMIRS, Such CODHM IRs were also of therapeutic interest for treatment of psoriasis and other conditions characterized by mononuclear cell infiltration and angiogcnesis.
- Transcript sequences corresponding l ⁇ lhe 3' untranslated regions (3 * UTRs) of VEGF-A and ICAM- 1 were used to search for a suitable seed of at least 6 contiguous bases using a searching algorithm combined with a database.
- Publicly available sequences related to VEGF-A and ICAM- 1 obtained from the T ⁇ nsemb] database were used to perform the ini tial analysis (see Table 1-1), (Ensembl is a joint project between the European Molecular Biology Laboratory (EMB L)/F.uropean Bioinfofmatics Institute (HBI) and (he Wellcome Trust Sanger Institute (WTSI)), The database and related tools are publicly available on the World Wide Web at the Ensembl website.
- a pool of all possible candidate seeds of length 6 or greater was generated using the specified length as window and moving sec ⁇ ientially along lhe sequence in a stepwise fashion by advancing the window one base at a time. Low complexity seeds were eliminated.
- the pool of candidate seed sequences was further restricted to those for which at least three contiguous bases were predicted to bind to an unpaired region in at least 50% of optima] and suboptiinal folded structures.
- Optimal and siibopriinal (within - I k ⁇ ti/mol of the optimal fold energy) folded structures were determined using lhe Vienna RNA package (Hofacker, (2(K)3), Nucleic Acids
- the first sm.1 was selected on the basis of its length of 12 nucleotides. There were also several smaller seeds recorded. One 7 ⁇ t seed was in a genetic context that favored the design of lhe consensus Target sequence by virtue of additional, albeit discontinuous, regions of further identity between the two target sequences near the seed. The two seeds were used to generate two sets of consensus target sequences. The consensus target sequences for the first seed were determined by optical alignment of the two target sequences and determining the likely effect various base changes would have on the binding of the complementary sequence to both target KNA. Tn the ease of the second seed, a permutation analysis was favoured.
- the two target sequences differ at only seven positions over the 14 bases that arc 5' to the seed. Because the extreme tail of the nniltilargeting interfering RNA has less requirement for complementarity, on Iy two possible terminal triplets were considered for (lie 5'end of the consensus target sequence; namely TAT and GTC. This reduced by four the number of possible permutations.
- the consensus target sequences identified for each of the two seeds are listed in Table 1-2.
- Table 1-2 Exemplary Seed Sequences and Consensus Target Sequences for the design of multttargeling interfering RNAs, e,g. CODEMIRs targeting VKGF-A und ICAM-I (all 5' to 3'). *'" 2 These consensus target sequences were used to design CODRMIRl and C0DEMIR2, respectively.
- a ⁇ CACTC.ACCCACCCACATA ( SEO ID NO : 148 ) Only several exemplary sequences are listed in Ta " ble 1-2 because, as mentioned above, additional consensus target sequences with partial identity lo VBCTF-A and ICAM- 1 could have been readily generated, particularly for the second, shorter seed.
- five consensus target sequences for die 12 nt seed arc shown.
- VEGF-A and ICAM- 1 transcripts is also shown.
- CC)DRMIRs targeting VEC1F-A and ICAM-I were designed using the methods provided.
- Consensus target sequences (VAICl-OI to -05) were derived by aligning the target mRN A sequences 5' of the seed region to generate sites of 21 nucleotides in length.
- Candidate CODEMIR guide strand sequences complementary to these consensus target sequences were determined, and hybridization between the CODEMIR guide sequences and the targets was predicted by in yilico modeling. Based on the results, the consensus target sequence, VAIC 1-04, was Used t ⁇ generate CX)DEMlR t ⁇ Figures 2 and 3).
- Candidate CODEMIRs were synthesized as double-stranded RNA molecules wilh 19 bp of complementarity and 3' overhangs of two nucleotides in length.
- the two nucleotide overhangs for the guide strands were designed to be complementary to the consensus target sequences.
- the complementary passenger strand was designed to include a two nucleotide 3'- UU overhang.
- CODEM FRs Two CODEM FRs were selected for more extensive testing, otic each designed from the 12 nt seed and the 7 nt seed.
- the sequences of the guide strands and their predicted hybridization to the targeted VECrF-A and ICAM- 1 3' UTRs are shown in Table I -3. It can be seen that even with a seed sequence only 7 nt in length, using the approach provided herein, CODEMIRs (for example CODEM ⁇ R2, Table 1-3) can be designed to achieve significant hybridization with at least two different targets. The degree of 3' identity that the CC)DEMIRs have with the intended targets is evident.
- Table 1-3 Exemplary CODEMIRs multitargetmg both YEGF-A and ICAM-I.
- the seeds in the consensus target sites are shown in bolc ⁇ font.
- RPE Ordinal pigmented epithelium cells in culture were used to screen the aiiti-a ⁇ giogenic CODRMIRs designed, as described above.
- DMEM Dulbccco's Modified Eagle's Medium
- ARPE cells were seeded at 4 x I O 3 culls per well in a 96 well tissue culture plate.
- ARFB-19 cells were seeded at 2.5 x l ⁇ 4 cells per well in a 24 well tissue culture .plate. Cells were transfectcd 24 hours after seeding using lipofectamine (InVitrogen) at a ratio of 1 micro! , lipofectamine per 20 pmol of CODEM IR RNA duplex or control siRNA. .In most studies, medium was replaced 24 hours after transfection at which time deferoxamine (130 ⁇ M) or IL-l ⁇ (1 ng/mL) was added for the VEGF-A and ICAM-1 experiments, respccli vely. Experiments were performed in triplicate and repeated at least twice.
- VEGF-A and ICAM-I The ARPH- 19 cells were assayed to confirm production of both VEGF-A and ICAM-I.
- VEGp-A was assayed in the supernatant using a commercially available ELISA assay (R&D Systems) according to the manufacturer's instructions.
- Cell surface ICAM-I was assayed either by immunostaining followed by fluorescence activated cell sorting (FACS), by in situ im ⁇ umostain-ng of cell-surface ICAM- 1 in % well plates using colorimelric detection, or alternatively by ELISA of cell Iysates using a commercial TCAM ELISA kit (R&D systems). • . •
- CytotoxJty and Off-Target Effects Apart from being a source of proangiogenic factors, RPfci cells are critical to the survival of the neurosensory photoreceptor cells. Hence, the CODEMIRs were screened for cytotoxic effects in ARPE-19 cells to enable selection of CODHMlRs without significant cytotoxicity. CODEMTRs were lransfected into ARPH-19 cells, typically at Final concentrations of 1-100 nM in the culture medium. Cell survival was measured 48 hours after transfection using the CcI! ' liter Blue Assay, which measures ⁇ . cellular respiration.
- CODEMlRs against multiple RNk targets: The CODHMlRs were assessed for their ability to repress the production of each of the target proteins. Specific siRNAs individually targeting cither VHGF-A or TC A M-I were used as single target comparative controls. (See e.g. Table 1-4).
- siRNA CONTROL siRNA which targeted neither VEGF nor ICAM
- Tuhle 1-4 Sequences of comparative and non-targeting control .siRNA (guide ' strand).
- CODEMIR -I and CODEMlR -2 were evaluated for cytotoxicity in ARPE-19 cells. All were found to have negligible toxicity over the concentration range of 0 - 40 nM ( Figure 2) when ivanstectcd over a period of 48-72 hours. None of the CODEMIRs tested showed any appreciable toxicity at concentrations less than about 50 nM ' . Individual designed CODKMiRs were routinely screened for potential cytotoxicity due to off-target effects.
- FIG. 3 shows protein suppression by CODEMIRs multitargeting both VEGF-A and ICAM- 1 , ARPE- 19 cells were treated with a siRNA not targeted to cither VRGf or ICAM (siRN ⁇ Control), or RNAs specific for VEGF-A (siVEGF), ICAM-I (si/CAM), or CODEMIR- 1 or -2, each at a concentration of 4OnM.
- VEGF-A (as determined by HUSA) and cell-surface TCAM-I (as determined by FACS) proteins were assayed 48 hrs after treatment and expressed as a percentage of those from imtransfected control cells.
- TCAM-I cell-surface TCAM-I
- the Comparative controls each significantly reduced the expression of their respective targets (ANOVA and Durmetfs multiple comparison test ⁇ versus control siRN A, p ⁇ 0.0l), without reducing lhe other, non-targeted protein, in fact, increased !CAM-I expression was observed with siVEGF (ANOVA and Dunnctt's multiple comparison test versus control siRNA , p ⁇ 0.01).
- CODEMTR- I profoiindlyrepresscd VHGF-A secretion to an extent, that exceeded the comparative siRNA control at the same concentration.
- the same CODEMIR also suppressed ICAM- 1 expression in a comparable manner to the TCAM- 1 comparative control.
- CODKMlR -2 also repressed both ICAM- 1 and VEGF-A to a lessw, but nevertheless significant extent (ANOVA and Dunnett's multiple comparison test versus control siRN A, p ⁇ 0.01).
- An siRNA duplex targeting the exact CODHMLRl site in VEGF-A produced only slightly greater knock-down of VEGF-A secretion (data not shown).
- a lack of total complementarity in the interfering RNA molecules provided herein is not significantly deleterious, and the methods provided herein of designing individual CODEMIRs each of which target multiple RNAs, can be used to generate such interfering molecules.
- CODEMTR- 1 and CODRMIR-2 were assessed, in terms of VHGF mRNA expression, by UT-PCR. Comparative controls were analysed alongside; siVBGF (a comparative control siRNA targeting a different site in V.EGF) and si CONTRO L (a tio ⁇ - targeting control s ⁇ RNA) and, finally, a sample not containing DNA (water control).
- VAIC a. multitargeting interfering RNA designed to be fully complementary to the target binding sequence of CO DEMUR- 1 was also examined. Two RT-PCR reactions were run on samples of RNA prepared from ARPE-19 ceils.
- ARPH-19 cells were transacted with LipofccUtmine 2000 and 4OnM of the respective RNA treatment, incubated for 24 hrs, then treated with 130 rnicroM deferoxamine for an additional 24 hrs before harvest and extraction of RNA.
- the PCR product was a 266 nt PCR amplicon from part of the Open Reading Frame (ORF) of VEGF.
- ORF Open Reading Frame
- the amplified amplicon. (243 nt) is located in the 3'UTR of VEGF.
- PCR amplification of a GAPDLl "house-keeping" transcript was also determined. The relative intensities of the GAPDH bands were equal in all treatment lanes.
- CODCMIR-I has a relatively high degree of complementarity to The VEGF mRNA target, including the central base pairs adjacent to the RISC cleavage site, while CODBMJIR2 has a central mismatch with the VEGF target mRNA,
- CODEMiRs wilh less than complete complementarity to a given target RNA sequence may induce mRNA degradation, for example by RISC processing, as an additional means of modulation, or as an alternative to other mechanisms, such as repressing translation of the target
- muititargeting interfering RNA molecules will comprise the sequence corresponding to the complement ot " the seed.
- the complementary sequences arc UAUGUGGGUGGG (SHQ ID NO: I ) and UGUUUUG (SEQ ID NO: 2) Tor CODEMIRs 1 and 2 respectively.
- CODEMIRs targeting both VRGF and ICAM were designed based on each o ⁇ the consensus target sequences shown in Figure 1.
- Each of the CODBMIRS so designed was also significantly active in modulating the target RNAs (CODEMlRl previously described, other data not. shown).
- the active CODEMIRs are as follows:
- COJDEMIk-I has some homology with the naturally occurring human mieroRNA miR-299.
- miR-299-3p has a region with 12 of 15 of the same
- CODEMIR-I 15 bases as the guide strand of CODKIVlIR-I, and the first 8 of those bases are identical. That region of CODEMIR-I corresponds to the complement of the seed sequence used in its . design. Although the two sequences share this homology, they have different central and 3' tail regions (see below).
- RNA duplex comprising the predicted mature .strands of mi R- 299 demonstrated some VHGF suppressive activity, although less Than Ui at obtained with CODEM IR-I.
- the tniR-2'jy had no significant activity against ICAM-1 (daLii not shown).
- CODI3MIR-1 therefore . , has a. markedly different activity profile from the naturally occurring miR-299.
- r ⁇ iK-299 did not have any demonstrable activity with respect to the second RNA (ICAM-I) which CODEM I R-I was specifically designed to target. This shows the effectiveness of using a rational design process TO obtain a functional multitargcling interfering RNA, and the advantages that can be gained, even over naturally occurring sequences that have homology to the seed region used in the design process.
- RPE Pigmented Epithelial
- VEGF-A vascular endothelial growth factor
- VEGF-B IGF- 1
- MCP-I vascular endothelial growth factor
- IL- 8 TCAM-I 1 bFGF
- PlGK Tndeed this multitude of pro-angiogenic cytokines acting in combination is analogous to the angiogencsis seen in advanced cancer.
- the full mRNA transcripts derived from the Ensembl database see Table 1-1) for VEGH-A, ICAM-I and IGF-I were used in the search of suitable seeds as previously outlined. A seed consisting of 11 bp present in all 3 transcripts was identified (Table 3-1).
- Consensus target sequences were derived as described above (Table 3-1). Guide strand sequences for CODEMIRs targeting these sites were determined, and the predicted hinding of these CODEMIRs to the 3 target sequences was assessed using RNAhybrid software. Because the 3 ⁇ seed region contains 4 contiguous G bases, the loading bias is unjjkcly to be favorable. As shown in Table 3 -2, lhe high duplex binding energy at the 5'cnd of the guide strand can be reduced by the judicious introduction of mismatched base pairings by modification of the passenger strand.
- Table 3-2J Alteration of guide strand 5' terminal stability by introduction of mismatched base pairings through modification of the passenger strand. ' NOTE: Underlining in this table indicates the seed, -which in some instances has been modified (bolding).
- the 7 nt seed TGCAGCT ( WTCQ m NO : 210) can be used to construct CODEMlRs targeting simultaneously: VEGH-B 1 -C, -D, II.-8, bFCF, PiGF, MCP-I , ICAM-l and IGF-I .
- RNA molecules for altering expression of any combination of ICAM.- 1, VKGF-A and IGF-I the complementary sequence to the seed in Table 3-1 (AGAG ACGGU GT) ( SEQ TD NO ; 211 ) is ACCCCGUCUCU (SEQ ID NO: 5)- I ⁇ the example of an RNA molecule for altering expression of any combination of ICAM-I , VEGF-B, VEGF-C, VRGF-D, DL-K, bFGF, PlGF, MCP-J and IGF-i
- TGCAGCT the complementary sequence to the seed above (TGCAGCT) (SEQ ID NO; 210) is AGCUGCA (SEQ ID NO: 7).
- CODKMIRs may also be suitable for the treatment of complex metabolic diseases such as type 2 dinbetes.
- Two potential gene targets for the treatment of this disease are glucose-6-phosphatasc and Inppl 1.
- Full transcript sequences were examined for the presence of common candidate seeds. In this case, a seed of 14 nt identity (CCCACCCACCTACC) (SEQ ID NO : 212 ) was identified (top of Table 4- 1).
- Candidate CODBMIUs were then designed, via the intermediate of consensus target sites that are shown in Table 4-1.
- CODEMIRs multi targeting interfering RNA molecules
- these complementary sequences will comprise GGIJAGGUGGGUGGG (SEQ ID NO: 10).
- Table 4-1 Target sequences aligned with CODKMTR consensus target sites for targeting Gluc ⁇ and Inppll.
- CTCCTCcccAcccACcTACCA ( SKQ i ⁇ NO t 216 )
- CODGMlRs can also be applied to target multiple unrclaled cancer genes in order to more competently control the tumour phenotype.
- inappropriate activation of ⁇ -cater ⁇ ir ⁇ , K-Ras and EGPR is found in many advanced colorectal adenocarcinomas.
- Simultaneous targeting of these three genes was sought with a CODEMIR, The full-length transcripts for all three genes wore used in the search for candidate seeds, In the case of KL-rus, both alternative transcripts (a and b) were included.
- a 13 bp seed (C AUTJCCA U UGlJ UU) (SEQ ID NO: 9) was found and appropriate candidate CODRMIRs identified.
- CODKMIR consensus taegct sequences are listed in Table 5-1.
- CODRMIRs targeting this seed and which comprise a. complement to this seed may be of interest for the treatment of colorectal and other cancer, especial Iy those in wliich altered (3-catenin, K-ras and/or EGFR signaling contributes to the malignant phcnotypo.
- CODEMIRK multi targeting interfering RNA molecules
- the complementary sequence is AAACAAUGGAAUG (SEQ ID NO: S).
- CODHMlR The CODHMlR approach can be used to target proteins of interest that arc likely to be mutated in chronic forms of disease. Mutations may be particularly prevalent in cancer and viral disease in which drug- resistant forms often evolve,
- VIROMIRs were designed to target, multiple sites in the Human Immunodeficiency Virus ( ⁇ UV). The requirement for simultaneous mutation at several sites, hi order to overcome the effects of such a VlROMJR, is likely to provide a high genetie hurdle to the emergence of resistant viral clones or quasispecics.
- H.XB2 strain of HIV I serotype B (GenBank Accession K03455) was used as the principal sequence of interest and was examined with hioinforma ⁇ cs methods detailed elsewhere in this application to find seeds occulting at more than one location.
- All THIV 1 cladc B isolates in the LANL database as of 1 August 2005 which contain full sequences for any of the GAG, ENV, VOL, TAT, VJF, VPR, VPU and NEF genes were used in these analyses.
- ATCAAGCAG SEQ ID NO: 246
- TGGAAAGG A SEQ ID NO: 247
- AAAGAAAAA SEQ ID NO: 37
- the first seed (ATCAAGCAG) (SKQ LD NO; 246), which is of greater interest because of its greater base complexity, was found to be present in 91 %, 76%, 78% and 74% of the isolates with respect to the GAG, POL, VIF and BNV genclie contexts of this seed, respectively. This is shown below as the seed flanked by the genetic context at each site.
- AAAC ⁇ CACTCGGGGGACATCAAGC ⁇ GCC ⁇ TCCAAATGTT ⁇ AAG (SEQ ID NO : 248 ) CAG' 91% CCTGT'PG ⁇ TGGGCGGGAaTC-aAGCAGGfiATTTGG ⁇ ATTCCCTAC ( SEQ TD NO : 249 ) POL 76V; T ⁇ GCCCTAGGTGTG ⁇ TATC ⁇ AGCA ⁇ GACATAAC ⁇ Z-GGTAGG ⁇ ( SEQ ID WO : 2 b ⁇ ) V TF 78% AACTC ⁇ C ⁇ GTCrGGGGCATCAAGCaGCTCC ⁇ GGCAAGAATCCTG ( Sr ⁇ ID KO : 251 ) ENV 74 %
- the boldcd regions correspond to independent occurrences of the seed. These regions have been annotated Iu the genes GAG, POL, VIF, and BNV.
- an effective RNA therapeutic of the invention should provide broad coverage of Lhe affected population and it is obviously desirable to target sequences that are highly represented in this patient population. Therefore, of the seeds presented above, those with undesirably low rates of occurrence in their specific genetic contexts in the Clade B isolates available from the LANI, Database as defined previously were removed from present consideration. For the purposes of this example, undesirably low rates of occurrence in their specific genetic contexts was defined as ⁇ 5 ⁇ % of the Clade B isolates.
- Seed 6 (POLTVTF; see above) was chosen as an example of the design of a Vl ROMlR to target multiple sites in a viral genome.
- a number of consensus target sequences for the two seed 6 occurrences were derived (Table 6-1), candidate V ⁇ ROMIR guide sequences were identified, and the predicted hybridisation of these sequences to the HIV target sites was assessed using RNAhybrid software.
- the predicted VIROMlR RNA duplexes were further analyzed with respect to factors likely to generate the desired strand loading bias.
- An example of a CODKiVl IR guide strand targeting seed site 6 in the HIV genome is shown in Figure 5.
- the K) VIROMIR candidates were thus:
- VIROMIRs Three representative VIROMIRs were selected (VM004, VM006 and VMOlO) for expression as shRNA .
- Contiguous DNA sequences corresponding to; BarnHI restriction site, G initiator, VIROM IR passenger, Xho loop sequence (ACTCGAGA), VIROMIK guide strand, pollll terminator and MindITI restriction site were assembled and prepared as dsDNA. They were then cloned into a pSIL vector under the control of a .111 promoter.
- the double-stranded DNA insert designed to encode an shRNA VIROMIR approximating VMOO ⁇ is shown below (loop sequence in parentheses and terminator italicized); G ' OAT ⁇ C ⁇ GKMri-i'TACCACCA ⁇ R ⁇ TCM fACTCCA ⁇ l ⁇ i ⁇ TCnTCM-JTGGT ⁇ tlCCATJITTTTY ⁇ -3 1 ( SEQ TH Nt): 329 )
- the encoded RNA folds itito a hairpin structure, which is modified by the eel lular Drosha and Dicer proteins to generate, active VIROMIR RNA duplcx(cs).
- the skilled artisan will also recognize that a number of variations of the design of the shRNA construct could be considered. These include but arc not limited to; length, sequence and orientation of the shRNA duplex components ⁇ guide strand, passenger strand, precursors), length and sequence of the loop, choice of promoter, initiator and terminator sequences as we3] as the cloning strategies used to assemble the final construct.
- H ⁇ K-293 cells were tested in H ⁇ K-293 cells by co-transfecting with the pNL4.3 p.asmid. Specifically, HEK-293 cells were seeded at density of 2 x 10 ⁇ 5 cells in 1 ml Optimem medium /well in a 12-well plate. Cells were transibcted 24 hr later with 200 ⁇ L DNA: Lipofectamine mix (200ng pNL4.3 plasmid, 67ng Vl ROMIR pSiL construct in lOO ⁇ L eornplcxed with 2.7 ⁇ L JUpofectamine 2OtK " ) in Optimem). After changing lhc medium 24 hours later, the production of p24 was assayed by collection of the supernatant after a further 24 hours of incubation.
- the production ⁇ f p24 was expressed as a percentage of the production from cells transfectcd with the empty conlrol plasmid. As shown in Figure 7, ill V was suppressed by 60% in the case of the shRNA form of VM006, whereas lhc other two constructs had no detectable activity.
- lhesc complementary sequences will comprise CUGCUUGAU (SEQ ID NO; 12), UCCUUUCCA (SEQ ID NO: 13), UUUUUC ⁇ ' U ⁇ (SEQ TD NO; 14), UUCUGAUGUUU (SBQ ID NO: 15), UCU ⁇ CCUCUAU (SEQ ID NO: 16), QGGUAGCUGA. ⁇ (SEQ TD NO: 17), CUUUGGUTJCCU (SBQ ID NO : 18), CUACUAAUGC ⁇ (SEQ ID NO: 19), UCCUGCUUGAU (SEQ ID NO : 20), AUUCUUUAGUU (SEQ ID NO: 21), CCAUCUUCC ⁇ G ⁇ SEQ ID NO : 22), CCUCCAAUUCC (SEQ ID NO: 23), CUAAUACUGUA (SEQ TD NO;
- transcript variants corresponding to at least one or ' the targets of interest.
- down-regulation of pre ⁇ e ⁇ ilin-1 and the four variant isoforms of BACE-1 could be therapeutically advantageous for the treatment of Alzheimer's disease.
- multitargeting interfering RNA molecules will comprise the sequence corresponding to the complement of the seed.
- these complementary sequences are GCCUAUCAUAU (SHQ ID NO: 58), I)GC)IiGCCUGCU (SEQ IP NO: 59), AA U UAAUAOGCC (SEQ ID NO: 60), CCCUCUGGGCU (SEQ ID NO: 61), UUCUUCCUCAU (SKQ TD NO: 62), UAUUUAUACAGA (SEQ f ⁇ NO; 63), and CACCA AAAUUC (SEQ TD NO; 64).
- the length of the seed may, in some cases be reduced to enable the requisite multi- targeting to occur. However, in these cases, it is advisable to limit, the selection of these short seeds to those that have regions of further identity juxtaposed near the identified seed.
- VEdF-A and bFGF targeting could be achieved through the design of a COL)EMIR guide strand that would be predicted to bind to A A TGTTCCC A CTCA (VBOF-A) (SEQ 113 • NO: 336) and A ATGTTC AGACTCA (bFGF) (SEQ ID NO : 337 ) . In this instance, this further region of identity may compensate for the short ACTCA ( SEQ ID NO : 33$ ) seed.
- the seed could include mismatches that would correspond to wobble base-pairing between the target and the CODEMlR guide strand,
- G;U wobble base pairing can be utilized to design the 5' region of a CODEMIR guide strand with predicted binding to several target transcripLs.
- the 5'regio ⁇ i of a CODBMIR targeting VEGF-A, ICAM-I, PlGF and IGF- I is derived from a suitable seed (CCTGG AG) (SEQ ID NO: 339) in the corresponding target inRN A.
- Table 8-1 Use of wobble-base pairing compatible mis-matches
- ⁇ Y indicates pyrimidine and R purine
- Tolerability of a mismatch in this position would greatly enhance the multi-targeting nature of CQDEMIRs. For example, in a situation in which two targets share the same seed, but a third target has a mismatch in the first seed position, maintaining activity in spite of this mismatch against the third target enhances the repertoire ⁇ f COD.KMTR activity. Flexibility in this position also enables modification of the 5'terminus of the CODEMlR guide strand with the goal of modulating strand-loading bias, which may also impact on activity.
- mullitargeting interfering RNA molecules (CODEM I Rs) will comprise the sequence corresponding to the complement of the seed.
- a guide strand could comprise UGAOlJNNGAACAtJU (SHQ ID NO: 72) where N is any base,
- the complementary sequence to the seed CCUGGAO (SEQ II> NO: 75) comprises CUCCAGG (SEQ ID NO: 74).
- CODEMfRs can also be utilized to target both the genome of the infectious agent and one or more key host “drivers" of the disease.
- TNF-alpha is considered a major disease-associated factor in Hepatitis C Virus infection and its sequelae.
- Analysis of the genome of i ICV and the TNF-alpha mRNA sequence was used to identify seeds consisting of: CCCTGTOAGGA (SEQ TD NO: 351), CACCATGAGCAC (SEQ ID NO: 352), CAGGGCTCCAGG (SEQ .ID NO: 353) and, GTGGAGCTGAGA (SEQ TD NO: 354).
- CCCTGTGAGGA SEQ ID NO: 351
- the seed is in the 5'NTR of HCV and the ORF of TNFaI pha
- a consensus target site is, possibly:
- this interfering RNA could be further modified Io improve its strand loading bias and stability, This could be achieved through the use of modified bases (eg LNA , 2'-F or 2'-O-rnethyl) in the 3' duplex section of the guide strand (would also likely improve stability), for example:
- modified bases eg LNA , 2'-F or 2'-O-rnethyl
- GGAUCAUUCCCCUGUGAGCiAG (SKQ ID NO; 359) CUUGfiUC ⁇ CGUGACAC'UCCUU C) guide 3' • b ⁇ (SEQ TH NO: 125)
- i ⁇ uilti targeting interfering RNA molecules will comprise the sequence corresponding to the complement of the 5 seed.
- these complementary sequences are UCCUCACAGGG (SEQ ID NO: 78), GUGCUCAUGGUG (SEQ ID NO: 79), CCUGGAGCCCUG (SEQ ID NO: 80) and UCUCACiClJCCAC (SEQ ID NO: 81).
- An extension or this concept can be considered in the case of some diseases in which 5 several tissue "compartments" act together iii augmenting the deleterious effects of the disease. Examples of such a situation would encompass, for example, the role of the stromal cells in cancer. In this situation, blocking the secretion of paracrine factors (eg growth factors such as VRGF) by the stroma would be advantageous. Indeed, targeting the neovasculature simultaneously with cytotoxic chemotherapy has significant clinical benefit in 0 the case of colorectal cancer.
- paracrine factors eg growth factors such as VRGF
- Seeds common to the mKNA sequences of the more limited sub-set of VEGF, Bcl-2 and K-Ras were identified as: GACAGTGGA, CTATFCTG and TAGAGAGTT.
- the sequences complementary Ui ihcsc seeds arc: UCCACUGUC .(SEQ ID NO: 92), CAGAAUAG (SEQ ID NO: 93) and AACUCUCUA (SEQ ID NO: 94).
- a set of H CODEMlRs (CC014-CC021) were designed from the latter three seeds, In
- CODEMlRs CC01-4
- CC015 was ⁇ f particular interest for rhe targeting of K-ra.s, because of (he presence of 2 binding sites featuring the need. All of these CODEMlRs were synthesized and tested against all three targets as part of the evaluation.
- the two colon cancer cell lines HCTl 16 and SW480 were used for the evaluation of anticancer CODEMlRs.
- Cells were plated at 4000 cells per well of a 96-wcll plate. Transfection was performed 24 hours later using 0,2 - 0.3 ⁇ L Lipofectaminc2000 per well and sufficient dsRNA to yield a final concentration of 40 ⁇ i.M. Transfection efficiency was evaluated by measuring the effect of siTOX (a cytotoxic siRNA from Dharm aeon) on cellular survival relative to mock and inactive controls using the Cell Titer Blue assay (CTB). All cancer CODEMIRs were then screened for effects on cellular survival using this assay.
- siTOX a cytotoxic siRNA from Dharm aeon
- VHGF production by HCT-116 cells was measured using the same VEGF ELlSA (R&D systems) used to measure the effects of CODHMfR-I (AM001) in ARPE cells.
- HCTl IC cells produce moderate levels of YEGF (-200 pg/mL in 48hrs when seeded at 4 ( XH) cells/well) as measured by ELISA.
- CODEMIRs CCO I 5, CCOl 9, CC020 and CC021 all resulted in a decrease in the production of VEGF by HCT 116 cells. The most marked effect, was caused by CC019 which resulted in a ⁇ 55 % reduction as compared to untransfecled cells ( Figure 10).
- CCO 15 which also had suppressive activity against K-ras, reduced VEGF by - 20%.
- Annexin V and P.I staining followed by FACS analysis was used to analyze apoptosis in HCTl 16 cells following transfection with various siRNAs and CODEMJ-Rs. Cells that arc positive for Annexin V and negative for. Propidium Iodide (PI) are considered to be cells undergoing early apoptosis. This assay was used to determine the number of dead (PI positive) and apoptotic cells following transection with several cancer CODEMIRs ' into HCTl 16 ( Figure I I) and SW480 (data not shown) cells.
- PI Propidium Iodide
- SiTOX, siBcl2 and siKRas each caused a marked increase in the Annexin V binding in HCTl 16 cells while another VEGF- specific siRNA only caused a slight increase (Figure 11).
- Transfection of HCTl 16 cells with CC015 resulted in Anriexin V binding similar to that for the K R as and Bcl2-specific siRNAs, CC015 also increased Annexin V binding in SW480 cells, as did transfection with siKRas (data not shown).
- a Caspase 3/7 activation assay FACS staining with caspase substrate was performed ' to gain more insight into the mode of apoptosis in HCTl 16 cells following transection with CCO 15.
- Soft agar-bascd anchorage independent growth assays arc of interest because it has been demonstrated that the abiliLy of a cell to form a colony in agar is lin.ked to its ability to form a tumour in vivo.
- a conventional ⁇ ofL-agar assay ' was performed in which the cells were transacted and harvested 24 h Jater, at which point ceils from each treatment were counted and re-plated in a 6-w ⁇ ll plate in 0.4 % low-melting agarose.
- CC015 which was designed using a seed found in the mRNA of Bcl-2, K-ras and VEGF, was able to suppress K-ras and to a lesser extent VEGF.
- CODEMlR-I it was clear that having the seed-binding region of the guide strand upstream of 3 mismatched bases, could not be expected to lead to suppression of Bcl-2.
- the positioning of the seed- binding region of CC0I6-1S in relation to this target was sub-optimal.
- multitargeiing interfering RNA molecules will comprise the sequence corresponding to the complement of the seed.
- these complementary sequences are UCCACUGUC (SKQ ID NO: l )2), CAGAAUAG (SKQ ID NO: 93) and AACUCUCUA (SEQ ID NO: 94).
- Example 1 Multitargeting when at least one target is a non-coding RNA
- non-coding RNA such as MALAT-J, BIC, PCG EMI , DD3 and BC200 have been shown to be associated with more aggressive progression and worse patient outcomes. Targeting seeds common to some or all of these could be considered in the de-sign of CODEMIRs.
- Other non-coding RNA eg. such as microRNA, pre- and pri-microRNA, snoRNA etc
- an exemplary seed sequence is: GGTGCGAGCGT (SEQ ID NO : 393 )
- the resulting duplex being, for example:
- the guide strand of this CODHMTR has predicted binding to the two targets (RNAhybrid) as follows:
- inuJtitargeting interfering RNA molecules will comprise the sequence corresponding to the complement of the seed.
- this complementary sequence is: ACCCUCGCACC (SEQ ID NO: 86).
- TGF ⁇ transforming growth factor ⁇
- the 3' CJTR of these mRJN A were used in this search as described in other examples.
- a seed common to 1L-8 and TGFb was identified as CUUCAACAG (SEQ ID NO: 89).
- Two consensus target sequences were designed by eye from the aligned mRNA sequences for these two targets. As shown in Table 12- 1 , the bias of complementarity for the two targets was reversed for P.F007 and PF008. That is, the consensus target sequence was in one case made more similar to IL-8 (PF007) and in the second way more similar to TGF- ⁇ (PF008).
- the corresponding base used in the passenger strand was a CJ Lo provide weaker wobble- base pairing.
- additional modification could be envisaged which is exemplified but not limited to the inclusion of an additional C or G to Lhc 3'end of the guide strand, an additional A or U to the 5'end of the guide strand, or both, Matching these in the corresponding passenger strand would improve further the loading bias without necessarily any deleterious impact on their functional activity.
- CODKMfRs were round including PFOlS which targets the seed of GUUCHJGGAA in IL- 8 and MCP-I .
- This CODEM Ik with the guide sequence UUCCACAACACAAGCUGUGUU ( SRQ ID NO : 135 ) , suppressed IL-H and MCP-I secretion by 45% and. 60%, respectively.
- the CC ) DEMlR PFOlS duplex is as follows:
- multilargcting interfering RNA molecules will comprise the sequence corresponding to "the complement of the seed.
- these complementary sequences are GUGUUGAAG (SBQ ID .NO; 88) and UUCCACAAC (SBQ TD NO: 90).
- this seed occurs only rarely in the 3 'UTR portion of the human transcriptomc, indicating that this seed would be unlikely to generate broad non-specific effects to the host tissue,
- This seed is G/C rich at the 3' extremity, such that a complementary guide sequence would, in the context of a double stranded multitargeting interfering RNA, be unlikely to load if the guide strand were to be completely complementary to this sequence and the 3' extremity of the passenger strand was not similarly G/C rich.
- Each putative full length XSY sequence was then tested for its load bias, to favour those XSY sequences that would, in the contexL of a double stranded multitargeling interfering RNA, be likely to have the guide strand loaded into the RISC complex. This was accomplished by examining the base composition for the 5 bases at the 5' terminus and the 5 bases at the 3' terminus of each XSY sequence and scoring them according to the following table:
- RNAhyb ⁇ d program LHo r aekcr (2003), Nucleic Acich Res., 31: 3429-311 was then used to determine the binding pattern for each of these 422848 .sequences against each of the 4 genetic contexts in a representative HCV strain (Genbank accession AB049092),
- the RNAhybrici analysis required an exact binding of the XS sequence (U UCGUG A AGAC) (SEQ ID NO; 406) to each genetic context for positions 3 to I I .
- the minimum free energy (mfe) and maximum length of contiguous completely complementary sequence were used to generate a relative binding score according to the following algorithm:
- Score (mfe of XSY sequence x length of contiguous complementarity x 100) / (mfe of the completely complementary sequence at that genetic context x 2.1 )
- the average score for each XSY sequence across the 4 genetic contexts was then determined. From the 422848 sequences, the 183 potential XSY sequences that satisfied the criteria of being in the top 100 average scores or having a score of > 40 in at least 3 of the four genetic contexts were considered for further analysis.
- the RNAhybrid and scoring analysis described above was used to analyse the binding patterns of the 183 selected XSY sequences against the sequences of the 4 genetic contexts of all 155 elude ia/1 b isolates (620 sequences). In this analysis an exact binding of the XS sequence (UUCGUCTAAGAC) (SEQ ID NO: 406) was not required,
- UUCGUGAAGACGGUAGGCCGA (SEQ ID NQ: 410) UUCGUGAAGACGGUAGGCCGG (SEQ ID HO: 411) u ⁇ CGUGAAGACGGUAGGCCGC (S ⁇ lQ ID NO: 412).
- UUCGQGAAGACAGUAGGCCGC (SEQ ID NO: 4.15) AU 9 XSY sequences had very similar binding patterns at each genetic context.
- Columns 2 and 3 shown below in Table 13-2 represent Lhc six possible binding patterns for the 9 XSY sequences to the four genetic contexts.
- the final candidate 1 ICV VlROMIR could have lhe following formula:
- multitargoting interfering RNA molecules will comprise the sequence corresponding to the complement of the seed.
- this complementary sequence is CGlJGAAdAC (SEQ ID NO: 98).
- dsRNA has limited stability in vivo, it is well understood by one skilled in the art that it may be desirable to chemically modify lhe multitargeting interfering RNA in order to improve stability and activity. Any chemical modification to the multitargetiiig interfering RNA is within the scope of Lhe invention.
- any chemical modification to the multitargetiiig interfering RNA is within the scope of Lhe invention.
- CO.DEMlR-i also 5 known as AMOOl
- Oligreen or Sybr Green 1 fluorescent dye was used Lo assess CODKMlR degradation in 10% human scrum. These, in particular Sybr Green I, bind avidly to dsRNA Lo produce enhanced fluorescence. Thus, monitoring of fluorescence during the incubation of dsRNA in 10% human scrum, or other biological solution, produces a facile method for monitoring stability.
- CODHMIR-I and chemically-modified analogs were incubated in 10% scrum for 30 minutes and separated by PAGE. Unmodified duplex RNA exhibited substantial degradation, and was presumably completely inactive.
- duplex RNA in which bolh strands were 2'-FIUOI ⁇ modified exhibited no 5 .degradation at all, which corresponds well to the results observed in the fluorescence, assay (data not shown).
- the two duplexes in which only a single strand was modified appeared to be incompletely degraded lo a duplex presumably a hybrid between lhc full-length modified strand and a partially degraded unmodified strand. Because this degradation product would be likely to have greatly decreased activity, it seems reasonable to infer that only constructs which demonstrate no degradation in the fluorescence assay would retain maximal activity. ,
- the activity of the pos.9- Fluoro variant in which only the passenger strand was modified (COT3BMIR-87), but not the pos9-ribo variant (CODEMIR- 144), was significantly decreased (p ⁇ 0,01).
- 2'FK ⁇ oro modification represents a viable strategy for the chemical modification of the mul Ii targeting interfering RNA of the invention, ailhough extensive modification, particularly that of the pos-9 nucleotide of the passenger strand may reduce activity in cell-based assays, Although the trade-off for stability may in some cases not appear worthwhile, the use of transfection reagents (in this case Lipofeetamine) may mask some of the benefits of chemical modification because lipid-based complexarion protects nucleic acid from degradation by nucleases.
- GODEMlR- 1 5 'AGACUCACCCACCCACAUAUU-'J ' ( SKQ ID NO : 101 ) 3 'AAUCtJGAGUGGGUGGGUGUAtI -5 ' ( SEQ ID NO : 100 )
- COD.RM ⁇ R-1 has been the prototype sequence in which the influence of chemical and sequence modifications have been tested.
- This CODBMIR may be particularly useful for the treatment of the wet forms of AMD as well as macular edema and diabetic retinopathy. This is because secreted V.E0F-A plays a major role in all of these diseases (Winner ct al (2003) Prog Re tin Eye. Res, 22, 1-29), although 1CAM- 1 overcxpression may be an early initialing event, particularly for diabetic retinopathy and macular edema (Kimats ⁇ el al., (2005) Ophthalmology, 1 12, «06-16.; Jousscn et al.
- RPK cells are also the primary site of uptake of foreign nucleic acids in the eye and, for these two reasons, are the appropriate cell model for evaluation of anli-angiogenjc ' CODKMIRs.
- the in vivo activities of two .oligonucleotide drugs correlated with their activity against RPB cells in culture (Garrctt et al. (2001) ./ Gene Med, 3, 373-83; Rakoczy et al. (1996), Antiaense Nucleic Acid Drug Dev, 6, 207-13) demonstrating the value of this cell culture model.
- This cell line forms polarized monolayers that mimic the RPK layer of the eye (Dunn et al., (1996), Exp Eye Rex, 62, 155-69), and which can be studied for protracted periods of lime.
- This property was used to evaluate VEGF secretion by repeated sampling of the supernatant of ARPE- 19 monolayers (ICAM-I cannot be studied in this same way because it requires harvesting of the cells).
- VEGF secretion was suppressed for at least 9 days following a single dose of CODKMIR-I ( Figure 16). This indicates that CODEMlR-I is expected to produce a durable inhibition of VEGF production in the eye.
- RNA duplexes based upon CODEMlR-I, but with mismatches to the targets in the seed region, were designed and tested. These were aligned with the human transcriptome using BLAST and three sequences with the lowest predicted off-target siRNA activity were chosen (CODBMIRs J22-124). These feature mismatches at positions 4, 4+6 and 4+6+8, respectively (Table 16-1 ). Each of these CODEMIRs was assessed for activity against VEGF and ⁇ CAM in ARPE- 19 cells ( Figure 19). A mismatch at position 4 exhibited slightly impaired activity against both VEGF and ICAM-I, whereas mismatches at 4 and 6 or at
- RNAi efficacy of an additional 32 variants or COOEMIR-I differing in the composition of the 3' tail of the guide strand was analyzed.
- a consensus sequence of the VEGF and ICAM-I target sites was generated (allowing wobble base pairing between guide strand and the largct site - i.e. allowing G to be equivalent Io A and U to be equivalent to C-; Figure 20).
- CODEMIRs representing the 32 (2 s ) possible 3' tails targeting both transcripts were designed (Table 17-1).
- ARPE-19 cells treated with 40 nM of each of these CODEMLRs demonstrated VEGF suppression ranging from -50% to -90% ( Figure 21).
- CODEMIRs with complementarity to the VEGF mRNA at position 13 of the guide strand were substantially more effective that those with a mismatch at position 13 (12 bases of contiguous complementarity to the target); presumably because a mismatch at position 13 impairs RfSC mediated cleavage of the VEGF mRNA.
- CODEMIRs with a 14 base complementary seed produced strong suppression (-85%), but activity of these CODEMfRs was impaired by mismatches in the remainder of the 3 7 tail.
- AU of the CODEMIRs with 17 base complementary seed regions were highly active, with mismatches in the 3' tail having little effect upon activity.
- the CODEMlRs wilh a complementary seed longer than 17 bases had activity that appeared to more closely correlate wilh strand loading than with any other factor.
- ICAM-I suppressive activity is potentially attributable to the introduction of an A:U pair in place of a G:U pair in the guide/target interaction (rather than being a direct effect of removing the 7 G motif).
- activity of these CODEMLRs against VEGF was also improved (despite the fact that the predicted binding of these CODHMIRs to the VBGF mRNA is unchanged compared wilh CODEMlRs 56 and 76 - Table 17-2) shows thai the 7 G motif was detrimental to the activity of CODEMIRs 56 and 76.
- CODEMIR-100, 101 and 102, respectively; Table 17-3 One possible strategy to increase the activity ⁇ f CODEMIRs that have substantial complementarity to the target mRNA is lo include inosine bases al crucial points (sites that cannot he matched to all transcripts and are near to the RISC cleavage site).
- inosine bases al crucial points (sites that cannot he matched to all transcripts and are near to the RISC cleavage site).
- three variants of CODEMIR- 1 were designed which included inosine bases at positions 13, 15 or 13 and 15 of the guide strand (CODEMIR-100, 101 and 102, respectively; Table 17-3).
- CODEMIRs showed comparable ICAM-l suppressive activity to CODEMlR-I (which contains a mismatch at position 13), but reduced VEGF suppression relative to CODJEMIR-I in the case of CODKMIR-I OO and J 02 ( Figure 25).
- the comparable activity againsL ICAM-l may result from translational repression that is largely dependent upon the seed binding alone, and so is not affected by alterations in the 3' tail.
- the VEGF suppressive activity of inosine containing variants of CODEMIR-I was also compared lo similar variants of CODEMJR-I with mismatches Io the VEGF mRNA at positions 13, 15 or 13 unci 15 (CODHMIRs 68-71).
- Another strategy for increasing the activity of a CODEVfIR against multiple targets is to increase the hybridisation strength of the 3' tail by inclusion of chemically modified bases that have increased hybridization potential in RNA:RJNA duplexes.
- modified bases include LNA (locked nucleic acid), ENA (ethylene bridge nucleic acid), 2'Fluoro, 2'O- methyl and 2'O-alkyl-ribose among others. Strengthening of hybridisation in the seed region could also be envisaged, however, this may impact negatively on strand-loading bias.
- the comparable 1C AM-I suppression may reflect f) near maximal translalional suppression that cannot be improved upon without induction of RISC mediated cleavage.
- this experiment indicates that such chemical modifications are tolerated and can be considered in the design of CODEMlRs.
- Modifications such as the LNA modified base could be used in the 3'luil of a candidate n ⁇ ultitargcting i ⁇ Lerferi ⁇ g RNA so as to strengthen the interaction of this portion of the guide strand with the corresponding part of the passenger strand, thereby improving loading bias. Therefore, there are a number of uses for modified bases that are envisaged in this invention.
- the data primarily relates to principles of CODEMIR design and in particular supports the approach of obtaining maximum hybridisation of the active RNA to each of its targets. However, these data also support the fact that complete complementarity is not necessary for maximal activity and that significant activity can be obtained with the guide strand even when the guide strand has complete complementarity to just the seed region.
- Some of the factors that may be expected to influence the activity of CODEMTR activity at a given seed site are: i) secondary structure at the target site of the mRNA, ii) an adenosine at the final position of the target site (i.e. a uracil at the first position of the guide strand - naturally occurring microRNAs have a preference for this pairing) and iii) the number of seed sites in the target mRNA (i.e. the number of guide strand binding sites in the target).
- CODEMIRs were designed (Table 18-1) with, seed sites that had the characteristics: i) free target secondary structure, no initial A and only a single site (CODEMIRs 108-110), ii) free target secondary structure, an initial A and only a single site (CODEMTRs 111-113), iii) not free target secondary structure, an initial A and only a single site (CODEMIRs 114-1 16), and iv) not free target secondary structure, an initial A and two sites (CODBMlRs 117- 119).
- CODHIVURs may be expressed as short hairpin RNAs (shRNA)
- shRNA CQ.DEMIR was designed based on CODK MlR- 1.
- This hairpin was designed to include the 21 nucleotide core of CODEMIR-I at. the Tree (non-loop) terminus of the hairpin ( Figure 29).
- the hairpin was cloned into a piasraid vector and expressed from an H l promoter.
- ARPE- 19 cells were seeded into 96-well plated (4000 cells/well) and transacted wjth 200 ng plasmid DNA 24 hours later.
- VEGF and ICAM- 1 was evaluated 48 hours later by El-ISA and FACS, respectively.
- the hairpin demonstrated VBGF and ICAM.- 1 suppressive activity relative to a length matched hairpin- control ( Figure 30); demonstrating the applicability of expressed short-hairpin CODBMIRs
- blunt-ended duplexes may not be of utility in enhancing the stability of " the molecule
- this strategy can be used to enhance the loading of an active strand by designing flic passenger strand to be shorter than the guide strand and having its 5 1 end located at the blunt end of the duplex.
- CODEMIR-I and other multitargcting RNA of the invention could be tested in various preclinical models known to those skilled in lhc art.
- CODEMIR-I c ⁇ uld be tested in a retinopathy of prematurity mode).
- This model is well known to those working in the field of ocular angiogenesis and is used extensively as one of several models for the development of drugs active against the diseases of interest (AMD, diabetic retinopathy etc).
- the study could comprise of a suitable number of rnou.se or rat neonate pups equally divided into treatment groups.
- the treatment groups could include negative controls such as vehicle, irrelevant or scrambled sequence controls plus a number of multitai'gcling RNA including CODEMIR-1.
- negative controls such as vehicle, irrelevant or scrambled sequence controls plus a number of multitai'gcling RNA including CODEMIR-1.
- COD BMIR-I could alternatively be evaluated in vivo for inhibition of disease-related angiogenesis using the laser-induced Choroidal Neovascularization (CNV) model in rats or primates.
- CNV Choroidal Neovascularization
- animals under general anaesthesia have their pupils dilated and retina photographed.
- Choroidal neovascularisatio ⁇ (CNV) is induced by kryplon laser photocoagulation. This is performed using laser irradiation to either the left or alternatively, the right eye of each animal from all treatment • groups through a slit lamp. A total of 6-11 laser burns arc generally applied to each eye surrounding the optic nerve at the posterior pole.
- the imiH ⁇ targeling RNA arc injected into the affected eyes.
- the suitable time can be the day following laser indueti ⁇ n, or for an assessment against established CNV, the injections can be performed several days or weeks following injury.
- Intravitraal injections of the oligonucleotides are performed by inserting a 30- or 32-gauge needle into the viLreous. Insertion and infusion can be performed and directly viewed through an operating microscope. Care is taken not to injure The lens or the retina.
- the test compounds are placed in the superior and peripheral vitreous cavity.
- the neoangiogencsis is evaluated by either imaging and/or direct sampling (eg histology, immunohistochemistry). In all eases, the assessment of CN V is best performed by a skilled operator blinded to the actual treatment to ensure a lack of bias in the recording of the information.
- fluorescein angiography is used to image the vessels and areas of vascular leakage in the retina. This is performed on all of the animals following the intraperitoneal or intravenous injection of sodium fluorescein. The retinal vasculature is then photographed using the same camera as used for CFP but with a barrier filter for fluorescein angiography added. Single photographs can be taken at 0.5-1 minute intervals immediately after the administration of sodium fluorescein. The extent of fluorescein leakage is scored by a trained operator. The mean severity scores from each of the lime points arc compared by a suitable statistical analysis and differences considered significant at p ⁇ O.05. In addition, the frequency of each lesion score is counted, tabulated and represented graphically.
- rats can be euthanascd at selected time points following treatment (for example 7, 14 and 28 days post injection) and eyes examined by conventional histopathology. A reduction in the number and severity of lesions is expected to be seen with samples treated by active oligonucleotides of the invention.
- RNA of the invention testing in other preclinical models such as those that are well known to those skilled in the art.
- a non- exhaustive list includes pulmonary fibrosis (bleomycin induced), paw inflammation (carrageen), joint arthritis, diabetes, viral infection, tumour xenografts etc.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Chemical & Material Sciences (AREA)
- Biomedical Technology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Biotechnology (AREA)
- Biochemistry (AREA)
- Animal Behavior & Ethology (AREA)
- Veterinary Medicine (AREA)
- Public Health (AREA)
- Pharmacology & Pharmacy (AREA)
- Medicinal Chemistry (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Virology (AREA)
- Physics & Mathematics (AREA)
- Biophysics (AREA)
- Epidemiology (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Oncology (AREA)
- Communicable Diseases (AREA)
- AIDS & HIV (AREA)
- Pulmonology (AREA)
- Endocrinology (AREA)
- Tropical Medicine & Parasitology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2006315099A AU2006315099C1 (en) | 2005-11-21 | 2006-11-21 | Multitargeting interfering RNAs and methods of their use and design |
| EP06817512A EP1951736A4 (en) | 2005-11-21 | 2006-11-21 | INTERFERING MULTICIBLATION RNA AND METHODS OF USE AND DESIGN |
| JP2008541541A JP5078904B2 (ja) | 2005-11-21 | 2006-11-21 | 多標的干渉rnaならびにそれらの使用および設計方法 |
| CA002630932A CA2630932A1 (en) | 2005-11-21 | 2006-11-21 | Multitargeting interfering rnas and methods of their use and design |
| US12/124,590 US20090239816A1 (en) | 2005-11-21 | 2008-05-21 | Multitargeting Interfering RNAs And Methods Of Their Use And Design |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US73864005P | 2005-11-21 | 2005-11-21 | |
| US73844105P | 2005-11-21 | 2005-11-21 | |
| US60/738,640 | 2005-11-21 | ||
| US60/738,441 | 2005-11-21 |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US12/124,590 Continuation US20090239816A1 (en) | 2005-11-21 | 2008-05-21 | Multitargeting Interfering RNAs And Methods Of Their Use And Design |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007056826A1 true WO2007056826A1 (en) | 2007-05-24 |
Family
ID=38048226
Family Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2006/001741 Ceased WO2007056826A1 (en) | 2005-11-21 | 2006-11-21 | Multitargeting interfering rnas and methods of their use and design |
| PCT/AU2006/001750 Ceased WO2007056829A1 (en) | 2005-11-21 | 2006-11-21 | Multitargeting interfering rnas having two active strands and methods for their design and use |
Family Applications After (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2006/001750 Ceased WO2007056829A1 (en) | 2005-11-21 | 2006-11-21 | Multitargeting interfering rnas having two active strands and methods for their design and use |
Country Status (6)
| Country | Link |
|---|---|
| US (3) | US20070269815A1 (https=) |
| EP (2) | EP1951736A4 (https=) |
| JP (2) | JP2009516518A (https=) |
| AU (2) | AU2006315099C1 (https=) |
| CA (2) | CA2630932A1 (https=) |
| WO (2) | WO2007056826A1 (https=) |
Cited By (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008138066A1 (en) * | 2007-05-15 | 2008-11-20 | Johnson & Johnson Research Pty Limited | Suppression of viruses involved in respiratory infection or disease |
| WO2008053019A3 (en) * | 2006-11-02 | 2009-01-22 | Dsm Ip Assets Bv | Method for reducing the expression of a gene in a filamentous fungal cell |
| WO2008109105A3 (en) * | 2007-03-06 | 2009-03-19 | Flagship Ventures | Methods and compositions for improved therapeutic effects with sirna |
| WO2009035539A3 (en) * | 2007-09-05 | 2009-05-22 | Nt Omics Inc | Long interfering nucleic acid duplexes targeting multiple rna targets |
| EP2152722A4 (en) * | 2007-05-03 | 2011-12-28 | Rosetta Inpharmatics Llc | COMPOSITIONS COMPRISING MIR34 THERAPEUTIC AGENTS FOR TREATING CANCER |
| US8513209B2 (en) | 2007-11-09 | 2013-08-20 | The Board Of Regents, The University Of Texas System | Micro-RNAS of the MIR-15 family modulate cardiomyocyte survival and cardiac repair |
| US9163235B2 (en) | 2012-06-21 | 2015-10-20 | MiRagen Therapeutics, Inc. | Inhibitors of the miR-15 family of micro-RNAs |
| US20160145611A1 (en) * | 2013-01-08 | 2016-05-26 | Benitec Biopharma Limited | Age-related macular degeneration treatment |
| US10337009B2 (en) | 2014-12-15 | 2019-07-02 | Bonac Corporation | Single-stranded nucleic acid molecule for inhibiting TGF-β1 expression |
| WO2022269356A3 (en) * | 2021-06-23 | 2023-05-25 | Versameb Ag | Compositions and methods for modulating expression of genes |
Families Citing this family (50)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20120071539A1 (en) * | 2006-12-12 | 2012-03-22 | Emory University | Compounds and methods for modulating the silencing of a polynucleotide of interest |
| US8071752B2 (en) | 2007-01-29 | 2011-12-06 | City Of Hope | Multi-targeting short interfering RNAs |
| CA2679867A1 (en) * | 2007-03-02 | 2008-09-12 | Mdrna, Inc. | Nucleic acid compounds for inhibiting vegf family gene expression and uses thereof |
| WO2008109361A1 (en) * | 2007-03-02 | 2008-09-12 | Mdrna, Inc, | Nucleic acid compounds for inhibiting erbb family gene expression and uses thereof |
| US8097712B2 (en) | 2007-11-07 | 2012-01-17 | Beelogics Inc. | Compositions for conferring tolerance to viral disease in social insects, and the use thereof |
| GB2468477A (en) * | 2009-03-02 | 2010-09-15 | Mina Therapeutics Ltd | Double stranded RNA molecule comprising siRNA and miRNA precursors |
| CN107129998A (zh) | 2009-06-10 | 2017-09-05 | 淡马锡生命科学研究院有限公司 | 用于棉花中基因功能性分析的病毒诱导的基因沉默(vigs) |
| US8962584B2 (en) | 2009-10-14 | 2015-02-24 | Yissum Research Development Company Of The Hebrew University Of Jerusalem, Ltd. | Compositions for controlling Varroa mites in bees |
| US20130023578A1 (en) * | 2009-12-31 | 2013-01-24 | Samyang Biopharmaceuticals Corporation | siRNA for inhibition of c-Met expression and anticancer composition containing the same |
| ES2641642T3 (es) | 2010-03-08 | 2017-11-10 | Monsanto Technology Llc | Moléculas de polinucleótido para regulación génica en plantas |
| AR083445A1 (es) | 2010-10-14 | 2013-02-27 | Univ Mie | siARN CONTRA LA FIBROSIS |
| US10806146B2 (en) | 2011-09-13 | 2020-10-20 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10829828B2 (en) | 2011-09-13 | 2020-11-10 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10760086B2 (en) | 2011-09-13 | 2020-09-01 | Monsanto Technology Llc | Methods and compositions for weed control |
| WO2013040057A1 (en) | 2011-09-13 | 2013-03-21 | Monsanto Technology Llc | Methods and compositions for weed control |
| HK1200484A1 (zh) | 2011-09-14 | 2015-08-07 | Translate Bio Ma, Inc. | 多聚寡核苷酸化合物 |
| ES2673960T3 (es) * | 2011-12-22 | 2018-06-26 | Ionis Pharmaceuticals, Inc. | Métodos para modular la expresión de un transcrito-1 de adenocarcinoma en pulmón asociado a metástasis (MALAT-1) |
| US9212363B2 (en) * | 2012-05-11 | 2015-12-15 | City Of Hope | RNAI molecules with non-watson crick pairing based on artificial mutation consensus sequences to counter escape mutations |
| JP2015523854A (ja) | 2012-05-16 | 2015-08-20 | ラナ セラピューティクス インコーポレイテッド | Smn遺伝子ファミリー発現を調節するための組成物及び方法 |
| CA2873766A1 (en) | 2012-05-16 | 2013-11-21 | Rana Therapeutics Inc. | Compositions and methods for modulating atp2a2 expression |
| US10837014B2 (en) | 2012-05-16 | 2020-11-17 | Translate Bio Ma, Inc. | Compositions and methods for modulating SMN gene family expression |
| CA2873769A1 (en) | 2012-05-16 | 2013-11-21 | Rana Therapeutics Inc. | Compositions and methods for modulating hemoglobin gene family expression |
| AU2013262709A1 (en) | 2012-05-16 | 2015-01-22 | Rana Therapeutics, Inc. | Compositions and methods for modulating MECP2 expression |
| BR112014028634A2 (pt) | 2012-05-16 | 2017-06-27 | Rana Therapeutics Inc | composições e métodos para modulação da expressão de utrn |
| MX360866B (es) | 2012-05-24 | 2018-11-09 | A B Seeds Ltd | Composiciones y métodos para silenciar la expresión genética. |
| EP2895200B1 (en) | 2012-09-14 | 2019-11-06 | Translate Bio MA, Inc. | Multimeric oligonucleotide compounds |
| US10683505B2 (en) | 2013-01-01 | 2020-06-16 | Monsanto Technology Llc | Methods of introducing dsRNA to plant seeds for modulating gene expression |
| BR112015023051A2 (pt) | 2013-03-13 | 2017-11-14 | Monsanto Technology Llc | método para controle de ervas daninhas, composição herbicida, cassete de expressão microbiano e método de produção de polinucleotídeo |
| US10612019B2 (en) | 2013-03-13 | 2020-04-07 | Monsanto Technology Llc | Methods and compositions for weed control |
| US10568328B2 (en) | 2013-03-15 | 2020-02-25 | Monsanto Technology Llc | Methods and compositions for weed control |
| EP3030663B1 (en) | 2013-07-19 | 2019-09-04 | Monsanto Technology LLC | Compositions and methods for controlling leptinotarsa |
| US10174328B2 (en) | 2013-10-04 | 2019-01-08 | Translate Bio Ma, Inc. | Compositions and methods for treating amyotrophic lateral sclerosis |
| AU2014341879B2 (en) | 2013-11-04 | 2020-07-23 | Greenlight Biosciences, Inc. | Compositions and methods for controlling arthropod parasite and pest infestations |
| UA119253C2 (uk) | 2013-12-10 | 2019-05-27 | Біолоджикс, Інк. | Спосіб боротьби із вірусом у кліща varroa та у бджіл |
| WO2015108982A2 (en) | 2014-01-15 | 2015-07-23 | Monsanto Technology Llc | Methods and compositions for weed control using epsps polynucleotides |
| US9856475B2 (en) | 2014-03-25 | 2018-01-02 | Arcturus Therapeutics, Inc. | Formulations for treating amyloidosis |
| JP6771387B2 (ja) | 2014-03-25 | 2020-10-21 | アークトゥラス・セラピューティクス・インコーポレイテッドArcturus Therapeutics,Inc. | 遺伝子サイレンシング用トランスサイレチン対立遺伝子選択的unaオリゴマー |
| WO2015148580A2 (en) * | 2014-03-25 | 2015-10-01 | Arcturus Therapeutics, Inc. | Una oligomers having reduced off-target effects in gene silencing |
| WO2015153339A2 (en) | 2014-04-01 | 2015-10-08 | Monsanto Technology Llc | Compositions and methods for controlling insect pests |
| CN106795515B (zh) * | 2014-06-23 | 2021-06-08 | 孟山都技术公司 | 用于经由rna干扰调控基因表达的组合物和方法 |
| US11807857B2 (en) | 2014-06-25 | 2023-11-07 | Monsanto Technology Llc | Methods and compositions for delivering nucleic acids to plant cells and regulating gene expression |
| CN106604993A (zh) | 2014-07-29 | 2017-04-26 | 孟山都技术公司 | 用于控制昆虫害虫的组合物和方法 |
| CN108064288B (zh) | 2015-01-22 | 2021-11-26 | 孟山都技术公司 | 用于控制叶甲属的组合物和方法 |
| WO2016161299A1 (en) | 2015-04-01 | 2016-10-06 | Arcturus Therapeutics, Inc. | Therapeutic una oligomers and uses thereof |
| EP3302053B1 (en) | 2015-06-02 | 2021-03-17 | Monsanto Technology LLC | Compositions and methods for delivery of a polynucleotide into a plant |
| WO2016196782A1 (en) | 2015-06-03 | 2016-12-08 | Monsanto Technology Llc | Methods and compositions for introducing nucleic acids into plants |
| WO2017015671A1 (en) | 2015-07-23 | 2017-01-26 | Arcturus Therapeutics, Inc. | Compositions for treating amyloidosis |
| US10556019B2 (en) * | 2015-08-21 | 2020-02-11 | Universitätsklinikum Jena | Human microRNAs for treatment of malignant tumours |
| SG11201910115XA (en) * | 2017-05-01 | 2019-11-28 | Donald Danforth Plant Science Center | Rnai approach for crop pest protection |
| TW202540426A (zh) | 2019-02-27 | 2025-10-16 | 美商Ionis製藥公司 | Malat1表現之調節劑 |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003070912A2 (en) * | 2001-06-06 | 2003-08-28 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF EPIDERMAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
Family Cites Families (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005019453A2 (en) * | 2001-05-18 | 2005-03-03 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) |
| US20050187174A1 (en) * | 2001-05-18 | 2005-08-25 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA) |
| US20050048529A1 (en) * | 2002-02-20 | 2005-03-03 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA) |
| US20050148530A1 (en) * | 2002-02-20 | 2005-07-07 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of vascular endothelial growth factor and vascular endothelial growth factor receptor gene expression using short interfering nucleic acid (siNA) |
| US20050209180A1 (en) * | 2001-05-18 | 2005-09-22 | Sirna Therapeutics, Inc. | RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA) |
| CN1738648A (zh) * | 2003-01-17 | 2006-02-22 | 佛罗里达大学研究基金会有限公司 | 小干扰rna基因治疗 |
| JP2008511678A (ja) * | 2004-09-02 | 2008-04-17 | イェール ユニバーシティ | マイクロrnaによるオンコジーンの調節 |
-
2006
- 2006-11-21 WO PCT/AU2006/001741 patent/WO2007056826A1/en not_active Ceased
- 2006-11-21 CA CA002630932A patent/CA2630932A1/en not_active Abandoned
- 2006-11-21 WO PCT/AU2006/001750 patent/WO2007056829A1/en not_active Ceased
- 2006-11-21 US US11/602,804 patent/US20070269815A1/en not_active Abandoned
- 2006-11-21 CA CA002630952A patent/CA2630952A1/en not_active Abandoned
- 2006-11-21 AU AU2006315099A patent/AU2006315099C1/en not_active Ceased
- 2006-11-21 EP EP06817512A patent/EP1951736A4/en not_active Withdrawn
- 2006-11-21 EP EP06817516A patent/EP1951263A4/en not_active Withdrawn
- 2006-11-21 JP JP2008541543A patent/JP2009516518A/ja not_active Ceased
- 2006-11-21 JP JP2008541541A patent/JP5078904B2/ja not_active Expired - Fee Related
- 2006-11-21 AU AU2006315102A patent/AU2006315102A1/en not_active Abandoned
-
2008
- 2008-05-21 US US12/124,590 patent/US20090239816A1/en not_active Abandoned
- 2008-05-21 US US12/124,629 patent/US8097715B2/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2003070912A2 (en) * | 2001-06-06 | 2003-08-28 | Sirna Therapeutics, Inc. | RNA INTERFERENCE MEDIATED INHIBITION OF EPIDERMAL GROWTH FACTOR RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
Non-Patent Citations (45)
| Title |
|---|
| ALTSCHUL ET AL., J MOL. BIOL, vol. 215, 1990, pages 403 - 410 |
| ALTSCHUL ET AL., NUCLEIC ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| ANDERSON J. ET AL.: "Bispecific Short Hairpin siRNA Constructs Targeted to CD4, CXCR4, and CCR5 Confer HIV-1 Resistance", OLIGONUCLEOTIDES, vol. 13, 2003, pages 303 - 312, XP002313468 * |
| ASUBEL F M ET AL.: "Current Protocols in Molecular Biology", 1989, JOHN WILEY & SONS |
| ATSCHUL ET AL., J MOLEC. BIOL., vol. 215, 1990, pages 403 |
| CARILLO ET AL., SIAM J APPLIED MATH., vol. 48, 1988, pages 1073 |
| CZAUDERNA ET AL., NUCLEIC ACIDS RES, vol. 31, 2003, pages 2705 - 16 |
| DUNN ET AL., EXP EYE RES, vol. 62, 1996, pages 155 - 69 |
| FRIER ET AL., PROC. NAT. ACAD. SCI. USA, vol. 83, 1986, pages 9373 - 9377 |
| FUNATSU ET AL., OPHTHALMOLOGY, vol. 112, 2005, pages 806 - 16 |
| GARRETT ET AL., J GENE MED, vol. 3, 2001, pages 373 - 83 |
| HAUPENTHAL, J., BIOCHEM PHARMACOL, vol. 71, 2006, pages 702 - 710 |
| HOFACKER, NUCLEIC ACIDS RES., vol. 31, 2003, pages 3429 - 31 |
| HORNUNG, V. ET AL., NAT MED, vol. 11, 2005, pages 263 - 270 |
| HOSSBACH ET AL., RNA BIOLOGY, vol. 3, 2006, pages 82 - 89 |
| HUTVAGNER, FEBS LETTERS, vol. 579, 2005, pages 5850 - 5857 |
| JING, Q. ET AL., CELL, vol. 120, 2005, pages 623 - 34 |
| JOUSSEN ET AL., AM J PATHOL, vol. 160, 2002, pages 501 - 9 |
| JUDGE, A.D. ET AL., NAT MED, vol. 11, 2005, pages 263 - 270 |
| KARLIN ET AL., PROC. NATL. ACAD SCI. USA, vol. 87, 1990, pages 2264 - 2268 |
| KARLIN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 5873 - 5877 |
| KELEMEN, B.R., BIOCHEMISTRY, vol. 39, 2000, pages 14487 - 14494 |
| KHVOROVA ET AL., CELL, vol. 115, 2003, pages 209 - 16 |
| KUWABARA, T. ET AL., CELL, vol. 116, 2004, pages 779 - 93 |
| LEIRDAL M. ET AL.: "Gene silencing in mammalian cells by preformed small RNA duplexes", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 295, 2002, pages 744 - 748, XP002953281 * |
| LEONTIS ET AL., NUCLEIC ACIDS RESEARCH, vol. 30, 2002, pages 3497 - 3531 |
| LOAKES, NUCLEIC ACIDS RESEARCH, vol. 29, 2001, pages 2437 - 2447 |
| LU ET AL., INVEST OPHTHALMOL VIS SCI, vol. 40, 1999, pages 1808 - 12 |
| LUO; CHANG, BIOCHEM. BIOPHYS. RES. COMMUN., vol. 318, 2004, pages 303 - 10 |
| MATSUOKA ET AL., BR J OPHTHALMOL, vol. 88, 2004, pages 809 - 15 |
| MORRIS, K.V. ET AL., SCIENCE, vol. 305, 2004, pages 1289 - 89 |
| MYERS ET AL., CABIOS, vol. 4, 1988, pages 11 - 17 |
| NEEDLEMAN; WUNSCH, J. MOL. BIOL., vol. 48, 1970, pages 444 - 453 |
| RAKOCZY ET AL., ANTISENSE NUCLEIC ACID DRUG DEV, vol. 6, 1996, pages 207 - 13 |
| REHMSMEIER ET AL., RNA, vol. 10, 2004, pages 1507 - 17 |
| SAMBROOK ET AL.: "Molecular Cloning, A laboratory manual", 1989, COLD SPRING HARBOR PRESS |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY |
| SCHWARZ ET AL., CELL, vol. 115, 2003, pages 199 - 208 |
| See also references of EP1951736A4 * |
| SIOUD, M., J MOL BIOL, vol. 348, 2005, pages 1079 - 1090 |
| SMITH; WATERMAN, J MOL BIOL., vol. 147, no. 1, 1981, pages 195 - 7 |
| TURNER ET AL., COLD SPRING HARB SYMP QUANT BIOL., vol. 52, 1987, pages 123 - 33 |
| TURNER ET AL., J. AM. CHEM. SOC., vol. 109, 1987, pages 3783 - 3785 |
| WITMER ET AL., PROG RETIN EYE RES, vol. 22, 2003, pages 1 - 29 |
| YEH ET AL., INVEST OPHTHALMOL VIS SCI, vol. 45, 2004, pages 2368 - 73 |
Cited By (15)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2008053019A3 (en) * | 2006-11-02 | 2009-01-22 | Dsm Ip Assets Bv | Method for reducing the expression of a gene in a filamentous fungal cell |
| WO2008109105A3 (en) * | 2007-03-06 | 2009-03-19 | Flagship Ventures | Methods and compositions for improved therapeutic effects with sirna |
| US8399248B2 (en) | 2007-05-03 | 2013-03-19 | Merck Sharp & Dohme Corp. | Methods of using MIR34 as a biomarker for TP53 functional status |
| EP2152722A4 (en) * | 2007-05-03 | 2011-12-28 | Rosetta Inpharmatics Llc | COMPOSITIONS COMPRISING MIR34 THERAPEUTIC AGENTS FOR TREATING CANCER |
| US8378088B2 (en) | 2007-05-03 | 2013-02-19 | Merck Sharp & Dohme Corp. | Compositions comprising MIR34 therapeutic agents for treating cancer |
| WO2008138066A1 (en) * | 2007-05-15 | 2008-11-20 | Johnson & Johnson Research Pty Limited | Suppression of viruses involved in respiratory infection or disease |
| WO2009035539A3 (en) * | 2007-09-05 | 2009-05-22 | Nt Omics Inc | Long interfering nucleic acid duplexes targeting multiple rna targets |
| US9777278B2 (en) | 2007-09-05 | 2017-10-03 | Biomics Biotechnologies Co., Ltd | Long interfering nucleic acid duplexes targeting multiple RNA targets |
| US8513209B2 (en) | 2007-11-09 | 2013-08-20 | The Board Of Regents, The University Of Texas System | Micro-RNAS of the MIR-15 family modulate cardiomyocyte survival and cardiac repair |
| US9078919B2 (en) | 2007-11-09 | 2015-07-14 | The Board Of Regents, The University Of Texas System | Micro-RNAs of the miR-15 family modulate cardiomyocyte survival and cardiac repair |
| US9163235B2 (en) | 2012-06-21 | 2015-10-20 | MiRagen Therapeutics, Inc. | Inhibitors of the miR-15 family of micro-RNAs |
| US20160145611A1 (en) * | 2013-01-08 | 2016-05-26 | Benitec Biopharma Limited | Age-related macular degeneration treatment |
| US10000753B2 (en) * | 2013-01-08 | 2018-06-19 | Benitec Biopharma Limited | Age-related macular degeneration treatment |
| US10337009B2 (en) | 2014-12-15 | 2019-07-02 | Bonac Corporation | Single-stranded nucleic acid molecule for inhibiting TGF-β1 expression |
| WO2022269356A3 (en) * | 2021-06-23 | 2023-05-25 | Versameb Ag | Compositions and methods for modulating expression of genes |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2630952A1 (en) | 2007-05-24 |
| EP1951736A4 (en) | 2009-12-16 |
| AU2006315099A1 (en) | 2007-05-24 |
| EP1951263A4 (en) | 2009-11-18 |
| EP1951736A1 (en) | 2008-08-06 |
| US20090192103A1 (en) | 2009-07-30 |
| AU2006315102A1 (en) | 2007-05-24 |
| US20070269815A1 (en) | 2007-11-22 |
| CA2630932A1 (en) | 2007-05-24 |
| US8097715B2 (en) | 2012-01-17 |
| JP2009516518A (ja) | 2009-04-23 |
| JP2009516517A (ja) | 2009-04-23 |
| JP5078904B2 (ja) | 2012-11-21 |
| AU2006315099C1 (en) | 2013-01-10 |
| EP1951263A1 (en) | 2008-08-06 |
| AU2006315099B2 (en) | 2012-07-05 |
| US20090239816A1 (en) | 2009-09-24 |
| WO2007056829A1 (en) | 2007-05-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2007056826A1 (en) | Multitargeting interfering rnas and methods of their use and design | |
| US7687475B2 (en) | RNA interference in respiratory epithelial cells | |
| US8318921B2 (en) | Triggered RNAi | |
| JP2022078069A (ja) | 二本鎖RNAによるα-1アンチトリプシンの特異的阻害のための方法及び組成物 | |
| US8962582B2 (en) | PKR activation via hybridization chain reaction | |
| US8497364B2 (en) | Triggered RNAi | |
| KR101012595B1 (ko) | 작은 간섭 rna 및 이를 포함하는 b형 간염 바이러스 치료용 약학 조성물 | |
| US20090176727A1 (en) | Double-stranded rna structures and constructs, and methods for generating and using the same | |
| US20040248296A1 (en) | HIV therapeutic | |
| US20070104688A1 (en) | Small interfering RNA mediated transcriptional gene silencing in mammalian cells | |
| CA2493949A1 (en) | Modified small interfering rna molecules and methods of use | |
| AU2003284323A2 (en) | Double-stranded RNA structures and constructs, and methods for generating and using the same | |
| JP2009511023A (ja) | ハンチントン病の治療のためのgに富むポリヌクレオチド | |
| US20120301449A1 (en) | Rna interference target for treating aids | |
| US20060293267A1 (en) | Dual functional oligonucleotides for use as anti-viral agents | |
| KR20170058979A (ko) | 헌팅턴병 일배체형에 대한 대립 유전자-특이적 치료 | |
| US20100286238A1 (en) | Suppression of viruses involved in respiratory infection or disease |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2006817512 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2630932 Country of ref document: CA Ref document number: 2008541541 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006315099 Country of ref document: AU |
|
| ENP | Entry into the national phase |
Ref document number: 2006315099 Country of ref document: AU Date of ref document: 20061121 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006315099 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006817512 Country of ref document: EP |