WO2007049050A2 - Modulateurs therapeutiques du gpr40 - Google Patents

Modulateurs therapeutiques du gpr40 Download PDF

Info

Publication number
WO2007049050A2
WO2007049050A2 PCT/GB2006/003998 GB2006003998W WO2007049050A2 WO 2007049050 A2 WO2007049050 A2 WO 2007049050A2 GB 2006003998 W GB2006003998 W GB 2006003998W WO 2007049050 A2 WO2007049050 A2 WO 2007049050A2
Authority
WO
WIPO (PCT)
Prior art keywords
chained
straight
groups
branched alkyl
alkyl groups
Prior art date
Application number
PCT/GB2006/003998
Other languages
English (en)
Other versions
WO2007049050A3 (fr
Inventor
Christer Owman
Björn OLDE
Daniel RÖME
Olov Sterner
Original Assignee
Heptahelix Ab
Goddard, Christopher
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Heptahelix Ab, Goddard, Christopher filed Critical Heptahelix Ab
Publication of WO2007049050A2 publication Critical patent/WO2007049050A2/fr
Publication of WO2007049050A3 publication Critical patent/WO2007049050A3/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/185—Acids; Anhydrides, halides or salts thereof, e.g. sulfur acids, imidic, hydrazonic or hydroximic acids
    • A61K31/19—Carboxylic acids, e.g. valproic acid
    • A61K31/195—Carboxylic acids, e.g. valproic acid having an amino group
    • A61K31/196—Carboxylic acids, e.g. valproic acid having an amino group the amino group being directly attached to a ring, e.g. anthranilic acid, mefenamic acid, diclofenac, chlorambucil
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/426—1,3-Thiazoles
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/33—Heterocyclic compounds
    • A61K31/395—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins
    • A61K31/41—Heterocyclic compounds having nitrogen as a ring hetero atom, e.g. guanethidine or rifamycins having five-membered rings with two or more ring hetero atoms, at least one of which being nitrogen, e.g. tetrazole
    • A61K31/425—Thiazoles
    • A61K31/427—Thiazoles not condensed and containing further heterocyclic rings

Definitions

  • the invention relates to chemical compounds, pharmaceutical compositions, and to methods of making them. It also relates to methods of using these compounds and compositions to treat and manufacture medicaments to treat diabetes and cancers, such as breast cancer and prostate cancer. Specifically, the invention relates to compositions comprising thiazoladinediones and fenamates and their properties as ligands of fatty acid receptors.
  • Lipids are dietary components that perform the well-characterized metabolic function of providing energy to the cell.
  • lipids also serve both as extracellular chemical messenger receptor ligands and intracellular messengers that receive chemical signals generated by lipid ligands.
  • Fatty acid receptors can act as "nutritional sensors.” These fatty acid receptors, like the odorant receptors, can sense external chemical signals in the physiological environment and elicit a biological response from an effector cell.
  • FFAs free fatty acids
  • the first receptors to be associated with the signalling function of lipids were the intracellular nuclear peroxisomal proliferator-activated receptors (PPAR) FFA receptors, which serve as transcription factors. FFAs have also been reported to activate members of the G-protein- coupled receptor (GPCR) superfamily present on the cell surface.
  • PPAR nuclear peroxisomal proliferator-activated receptors
  • GPCRs that bind to FFA ligands display a range of ligand specificity, patterns of expression, and function.
  • GPR40 and GPRl 20 are activated by medium to long-chain free fatty acids, and short-chain fatty acids activate GPR41 and GPR43 (Kotarsky et at, Hirasawa et at, Nilsson et at, Brown et at).
  • Each GPR displays a characteristic tissue distribution.
  • GPR40 is preferentially expressed in pancreatic beta cells and other cells and tissues associated with the pathophysiology of type 2 diabetes (Salehi et al).
  • the pathogenesis of type 2 diabetes is characterized by beta cell dysfunction and progressive insulin resistance with compensatory hyperinsulinemia, marked by declining insulin secretion and increasing hyperglycemia.
  • the long-term adaptation of the beta cell mass to rising glucose concentration is achieved mainly by increasing the number of beta cells through hyperplasia and neogenesis (Bonner- Weir).
  • Type 2 diabetes is also characterized by elevated plasma levels of long-chain FFAs, which further impair beta cell secretion.
  • FFAs provide essential fuel to the beta cell, but they become toxic when chronically present at elevated levels.
  • short-term exposure of beta cells to dietary fatty acids potentiates glucose-induced insulin release, while long term exposure impairs insulin secretion and induces lipotoxicity (Unger).
  • High levels of FFAs have been implicated in several lipotoxic effects, including loss of beta cell mass by apoptosis, inhibition of the insulin gene expression, and increasing insulin resistance in peripheral tissues (Nakamichi et al. ; Shimabukuro et at).
  • GPR40(-/-) knockout mice are protected against obesity-induced hyperinsulinemia, hypertriglyceridemia, hepatic steatosis, increased hepatic glucose output, hyperglycemia, and glucose intolerance, all of which are conditions present in diabetes (Steneberg et ah). GPR40 mediates these pathological conditions, thus blocking this receptor in individuals that express the receptor is predicted to treat or prevent these conditions. Thus, there is a need for agents that modulate the target receptor GPR40 for the prevention and treatment of diabetes.
  • the invention provides certain compounds which are useful in therapy, in the manufacture of medicaments for the treatment of diabetes and/or cancer, in methods of treatment of diabetes and/or cancer using such compounds, in pharmaceutical compositions containing those compounds and as modulators of GRP40.
  • the compounds are typically antidiabetic and anticancer compounds that specifically bind to GPR40 and have the formula:
  • a 1 is an optional unsubstituted benzene or naphthalene carbocyclic aromatic or a heterocyclic aromatic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain at least one nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (preferred groups being quinoline, isoquinoline, benzoxazole, chroman, benzene, indole, pyridine, and naphthylene); or
  • a 1 is a carbo-aromatic group selected from benzene, with up to four substituents, and napthalene substituted with up to six substituents, wherein said substituents are independently chosen from C 1 -C 6 straight-chained or branched alkyl groups , halogen, OH, CN, CF 3 andNR a R b, and may be in any position of the ring; R 3 and R b are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 3 ;
  • R 3 is chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight- chained or branched acyl groups, CN, and COR 4 ;
  • R 4 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups;
  • R] is H; an unsubstituted aromatic or non-aromatic carbocyclic or heterocyclic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom; or R 1 is an aromatic or non-aromatic carbocyclic or heterocyclic group substituted with up to six substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, halogen, OH, CN, CF 3 , and NR 5 R 6 in any position of the ring;
  • R 5 and R 6 are independently chosen from H, Cj-C 6 straight-chained, or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 7 ;
  • R 7 is H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups CN, or COR 8 ;
  • Rg is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups
  • X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; halogen; NR 9 R 10 ;
  • R 9 and R 10 are independently selected from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups; OH; and OR 11 ;
  • R 11 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 2 -C 6 straight-chained or branched acyl groups; or CN; COR 12 ; R 12 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 1 -C 6 straight-chained or branched alkoxy groups;
  • Z 1 is N, S, O, R 14 or OR 14 ;
  • R 14 is C 1 -C 6 straight-chained or branched alkyl groups; or Z 1 is any carbo- or heterocycle both aromatic and non-aromatic; or Z 1 is any carbo- or heterocycle both non- and aromatic preceded or succeeded by a C 1 -C 6 straight-chained or branched alkyl chain; or
  • Z 1 is any of the previous structures fused to the adjacent aromatic ring.
  • the alkyl, acyl, and alkoxy groups defined above and throughout this text can be substituted -with up to three substituents chosen from halogen, OH, OCH 3 , OCH 2 CH 3 , CN, CF 3 , NH 2 , NHCH 3 and N(CHj) 2 where context allows.
  • group Al may be a non-aromatic cyclic group such as cyclohexane or decalin.
  • a preferred subset of the useful compounds described above includes the following compounds of formula (II): These compounds are useful in all aspects of the invention.
  • L is a linker group selected from methyl, methylquinoline, methylisoquinoline, methylbenzoxazole, methylchroman, methylbenzeneoxy, methylindole, methylpyridine and methybiaphthyleneoxy, each unsubstituted, or optionally substituted with one or more C 1- C 6 alkyl, halo, OH, CN, CF 3 and/or NH 2 groups, methyl, methylbenzeneoxy and methybiaphthyleneoxy being preferred ;
  • Q is a hydrocarbon chain selected from C 3 to C 14 n-alkyl or C 3 to C ⁇ n-alkenyl groups, each optionally substituted one or more methyl, ethyl and/or halo group; and T is a tail group selected from H, OR 15 and COOR 15 , where R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, fluorobenzyl, trifluoromethylbenzyl.
  • R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, fluorobenzyl, trifluoromethylbenzyl.
  • the invention also provides that the compound described above can be an agonist, a partial agonist, or an antagonist of GPR40.
  • the invention provides the compound described above, wherein the compound is HH2.1, HH3.1, HH5.2, or HH5.3, as described hereinafter.
  • the invention also provides the compound described above, wherein the compound is HH 6.1, HH6.2, HH6.3, HH6.4, HH9.2, HH9.3, or HH9.4, as described hereinafter.
  • the invention further provides a pharmaceutical composition, which comprises a compound described above in an amount sufficient to produce an antidiabetic effect or anticancer effect and a pharmaceutically acceptable carrier.
  • a pharmaceutical composition which comprises a compound described above in an amount sufficient to produce an antidiabetic effect or anticancer effect and a pharmaceutically acceptable carrier.
  • the invention provides a compound as described above for use in therapy.
  • the invention provides an antidiabetic and anticancer compound that binds to GPR40 having the formula
  • a 1 and A 2 are independently selected from an unsubstituted benzene (6 carbons by definition) or naphthalene (10 carbons in two fused rings by definition) carbo- or heterocyclic aromatic group with one ring containing 5 or 6 atoms or two fused rings
  • a 1 are independently selected from a benzene or napthalene carbo-aromatic group substituted with up to four (benzene) or six (naphthalene) substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups , halogen, OH, CN, CF 3 and NR 1 R 2 in any position of the ring;
  • a 1 and A 2 are independently selected from a substituted or unsubstituted 5- membered carbo- or heterocyclic aromatic ring;
  • R 1 and R 2 are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 3 ;
  • R 1 is a heterocycle, -SO 3 H, -PO 3 H 2 , -NO 2 , carboxylic acid, or a cyclic or acyclic derivative thereof; or
  • R 3 is chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight- chained or branched acyl groups, CN, and COR 4 ;
  • R 4 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups;
  • R 1 is an unsubstituted aromatic or non-aromatic carbocyclic or heterocyclic group with one ring containing 5 or 6 atoms or two fused rings containing 8 or 10 atoms and which may contain one or several nitrogen, oxygen and/or sulfur atoms located either isolated in the ring system or next to another heteroatom (examples of preferred systems are benzene, naphthalene, cyclohexane, decalin, pyridine and indole; or
  • R 1 is an aromatic or non-aromatic carbocyclic or heterocyclic group substituted with up to six substituents chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, halogen, OH, CN, CF 3 , and NRjR 2 in any position of the ring;
  • R 5 and R 6 are independently chosen from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups, OH, and OR 7 ;
  • R 7 is H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups CN, or COR 8 ;
  • R 8 is H, C 1 -C 6 straight-chained or branched alkyl groups, or C 1 -C 6 straight-chained or branched alkoxy groups,
  • X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; halogen; NRpR 10 ;
  • X 1 is H, any substituent both free or fused resulting in a heterocycle with the adjacent aromatic ring any chain consisting of any combination of C, N, O or S exceeding 2 in length;
  • R 9 and R 10 are independently selected from H, C 1 -C 6 straight-chained or branched alkyl groups, C 2 -C 6 straight-chained or branched acyl groups; OH; and OR 11 ;
  • R 11 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 2 -C 6 straight-chained or branched acyl groups; or CN; COR 12 ; and
  • R 12 is H, C 1 -C 6 straight-chained or branched alkyl groups or C 1 -C 6 straight-chained or branched alkoxy groups.
  • the invention also provides that the compound described above can be a partial agonist of GPR40.
  • the invention provides the compound described above, wherein the compound is chosen from tolfenamic acid, mefenamic acid, meclofenamic acid, flufenamic acid, diclofenac, N-phenylanthranilic acid, N-(3-nitropheny) anthranilic acid, and N-(2- nitrophenyl) anthranilic acid, and derivatives thereof.
  • the invention further provides a pharmaceutical composition, which comprises a compound described above in an amount sufficient to produce an antidiabetic effect or anticancer effect and a pharmaceutically acceptable carrier thereof.
  • the invention provides a method of treating diabetes or cancer, which comprises administering to a mammal an amount of any of the compounds described above, or a combination thereof, in an amount effective for treating diabetes or cancer.
  • the compound can be administered to a mammal for veterinary use, or preferably to a human, by an oral, topical, sublingual, intravenous, intraperitoneal, intramuscular, subcutaneous, intranasal, or intradermal route.
  • "diabetes” applies preferably to type 2 diabetes.
  • the invention provides for the use of a compound of formulae I, II and/or III as described herein as a modulator of GPR40, use of such compounds as partial agonists of GPR40, and pharmaceutical compositions comprising such a compound and at least one pharmaceutically acceptable carrier or excipient.
  • FIG. 1 depicts a method for the preparation of glitazone derivatives.
  • FIG. 2 depicts a method for the preparation of aliphatic thiazolidinediones.
  • FIG. 3 depicts Fenamate Structures.
  • Fenamates for example (A) meclofenamic acid, (B) flufenamic acid, and (C) mefenamic acid, are differentiated by their aryl substituents.
  • FIG. 4 depicts the results of an oral glucose tolerance test, blood glucose, for Compound ciglitazone.
  • FIG. 5 depicts the results of an oral glucose tolerance test, AUC, for Compound ciglitazone.
  • FIG. 6 depicts the results of plasma insulin measurements at time 15 minutes during the oral glucose tolerance test for Compound ciglitazone.
  • FIG. 7 depicts the results of an oral glucose tolerance test, blood glucose, for Compound HH 2.1 in Table 1.
  • FIG. 8 depicts the results of an oral glucose tolerance test, AUC, for Compound
  • FIG. 9 depicts the results of plasma insulin measurements at time 15 minutes during the oral glucose tolerance test for Compound HH 2.1 in Table 1.
  • FIG. 10 depicts the results of an oral glucose tolerance test, blood glucose, for Compound HH 9.4 in Table 1.
  • FIG. 11 depicts the results of an oral glucose tolerance test, AUC, for Compound HH 9.4 in Table 1.
  • a “receptor” is a polypeptide that binds to a specific ligand.
  • “Modulate” refers to the production, either directly or indirectly, of an increase or a decrease, a stimulation, inhibition, interference, or blockage in a measured activity when compared to a suitable control.
  • a “modulator” of a polypeptide or polynucleotide or an “agent” are terms used interchangeably herein to refer to a substance that affects, for example, increases, decreases, stimulates, inhibits, interferes with, or blocks a measured activity of the polypeptide or polynucleotide, when compared to a suitable control.
  • An "agonist” is a substance that mimics or enhances the function of an active molecule.
  • an "antagonist” is a molecule that interferes with the activity or binding of another molecule such as an agonist, for example, by competing for the one or more binding sites of an agonist, but does not induce an active response.
  • Treatment covers any administration or application of remedies for disease in a mammal, including a human, and includes inhibiting the disease, arresting its development, or relieving the disease, for example, by causing regression, or restoring or repairing a lost, missing, or defective function; or stimulating an inefficient process.
  • “Prophylaxis,” as used herein, includes preventing a disease from occurring or recurring in a subject that may be predisposed to the disease. Treatment and prophylaxis can be administered to an organism, or to a cell in vivo, in vitro, or ex vivo. The cell can subsequently be administered to the subj ect.
  • a “pharmaceutically acceptable carrier” refers to a non-toxic solid, semisolid, or liquid filler, diluent, encapsulating material, formulation auxiliary, or excipient of any conventional type.
  • a pharmaceutically acceptable carrier is non-toxic to recipients at the dosages and concentrations employed and is compatible with other ingredients of the formulation.
  • the invention encompasses each intervening value between the upper and lower limits of the range to at least a tenth of the lower limit's unit, unless the context clearly indicates otherwise. Further, the invention encompasses any other stated intervening values. Moreover, the invention also encompasses ranges excluding either or both of the upper and lower limits of the range, unless specifically excluded from the stated range.
  • Cx-Cy is used herein to indicate an organic hydrocarbon moiety having between x and y carbon atoms (inclusive) and is used to indicate all possible isomers of such moieties unless indicated otherwise, hi particular, C 1 -C 6 is used herein (unless otherwise stated, e.g.
  • n-alkyl group to indicate all isomers including any of methyl, ethyl, n-propyl, iso-propyl, n-butyl, iso-butyl, sec-butyl, t-butyl, n-pentyl, isopentyl, sec-pentyl, neopentyl, tert-pentyl, n-hexyl, isohexyl, sec-hexyl, tert-hexyl, neo-hexyl etc.
  • all alkenyl groups include all isomeric positions of double bonds, and all cis/trans isomers unless otherwise indicated.
  • Thiazolidinediones are antidiabetic pharmaceuticals intended primarily for therapy of type 2 diabetes (Bloomgarden).
  • the antidiabetic effects of TZDs have been classified into two general actions: adipogenesis with adipose tissue remodeling and insulin sensitization.
  • Adipogenesis and adipose tissue remodeling have been linked to PPAR ⁇ activation (Furnsinn et al).
  • PPAR ⁇ activation Frnsinn et al
  • Novel therapeutic agents of the TZD class thus can affect one or more different intracellular pathways to achieve a therapeutic effect.
  • TZDs control hyperglycemia by targeting these fundamental defects manifest in the disease state. They protect pancreatic beta cells against free fatty acid-induced lipotoxicity. They improve insulin sensitivity and beta cell function, both when used as monotherapeutic agents and in combination with other antidiabetic agents.
  • the TRIPOD TRoglitazone In the Prevention Of Diabetes
  • TZDs activate GPR40 that is recombinantly expressed in human HeLa cells (U.S.
  • GPR40 activation has been shown to mediate fatty acid- stimulated insulin secretion from pancreatic beta cells (Salehi; Steneberg et al).
  • TZD compounds compete with the GPR40 agonists oleic and linoleic acid. They display a biphasic dose response curve, indicating they are partial agonists. Yuan et al. have shown that the TZD rosiglitazone blocks acute fatty acid-stimulated insulin secretion from rat pancreatic islets.
  • some novel TZD compounds can modulate fatty acid-stimulated insulin secretion, for example, by inhibiting fatty acid activation of GPR40.
  • the present invention provides TZD compounds, which act as modulators, for example, partial agonists, of GPR.40 and which are capable of modulating insulin secretion at therapeutically relevant concentrations.
  • TZDs While currently known TZDs can be effective anti-diabetic agents, they are not effective in some applications requiring anti-diabetic therapy. For example, TZDs increased the insulin sensitivity of approximately two-thirds of patients at high risk for type 2 diabetes, but had no prophylactic or therapeutic effect on the remaining one-third (Snitker et al). Novel TZDs with a demonstrated effect on the GPR40 receptor can provide therapeutic compounds for patients with needs that are not met with currently available compounds.
  • the novel compounds of the invention, which are directed against GPR40 were designed, for example, by combining aspects of fatty acid structure with different thiazolidinedione-based scaffolds. The resulting set of compounds was tested on GPR40 reporter cells as described in more detail in Example 9. The synthesized compounds were screened both for their ability to directly stimulate GPR40 and to antagonize oleic acid activation of GPR40, using rosiglitazone as a positive control.
  • Some of the screened compounds demonstrated both an ability to directly stimulate GPR40 and an ability to antagonize oleic acid activation of GPR40 at lower concentrations, as demonstrated by their ability to block oleic acid-stimulated phosphatidylinositol (PI) hydrolysis in transfected HEK293 cells.
  • These compounds are partial GPR40 agonists. They are shown in Table 1.
  • a group of compounds exemplified by HH5.2, HH5.3, HH2.1, and HH3.1 require a chain length exceeding six to achieve significant activation of the receptor. Increasing their chain length beyond 10 reduces receptor activation.
  • this invention provides compounds in which the chain length is 4 to 18, preferably 5, or 6 to 10.
  • chain length is used to indicate the total number of atoms beyond the “linker” moiety, such as the methylnaphthyleneoxy group to the furthest point in the molecule.
  • the above preference for chain length can be represented by the number of consecutive CH 2 groups in the molecule. This is believed to represents the "lipid" character of the molecule and thus be relevant to blocking of FFA effects.
  • known TZDs typically have a "tail" portion containing no more than two consecutive CH 2 groups.
  • the molecules of the present invention contain at least 3 consecutive CH 2 groups in the molecule (e.g. 3 to 14). This may particularly preferably be as part of the L and/or Q groups in formula II.
  • the group Q may thus preferably be a C 3 to C 14 n-alkyl or C 3 to C 14 n-alkenyl group, although the lower limits of these may be C 4 or C 5 and the upper limits more preferably C 10 or C 8 .
  • Al is present and is selected from benzene, naphthalene, cyclohexane, decalin, pyridine and indole, optionally substituted with up to four groups independently elected from H, C 1 -C 6 alkyl groups , Cl, F, Br, OH, CN, CF 3 , NR 3 R b , wherein R 3 and R b are as defined above.
  • H, methyl, ethyl , Cl, F, Br, OH amd NH 2 substituents are preferable and most suitable Al groups are benzene and naphthalene.
  • R 1 is H in many preferred compounds.
  • X 1 is H; C 1 -C 6 straight-chained or branched alkyl groups; F, Cl, Br or NH 2 , especially
  • Y 1 is CH 2 ; O; R 13 ; OR 13; R 13 COOor OR 13 COO, wherein R 13 is methyl, ethyl, n- propyl, iso-propyl or C 4 -C 8 n-alkyl.
  • R 13 is methyl, ethyl, n- propyl, iso-propyl or C 4 -C 8 n-alkyl.
  • the alkyl chain formed by Y 1 and/or Z 1 is preferably 3 to 14 carbons.
  • Z 1 is O, R 14 or OR 14, wherein R 13 is methyl, ethyl, n-propyl, iso-propyl, n-butyl, n- pentyl or n-hexyl.
  • the TZD compound of formula (I) is preferably a compound of formula (II);
  • L is a linker group selected from methyl, methylquinoline, methylisoquinoline, methylbenzoxazole, methylchroman, methylbenzeneoxy, and methylnaphthyleneoxy, each unsubstituted, or optionally substituted with one or more C 1- C 6 alkyl, halo, OH, CN, CF 3 and/or NH 2 groups;
  • Q is a hydrocarbon chain selected from C 3 to C 14 n-alkyl or C 3 to C 14 n-alkenyl groups, each optionally substituted one or more methyl, ethyl and/or halo group;
  • T is a tail group selected from H, OR 15 and COOR 15 , where R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, fluorobenzyl, trifluoromethylbenzyl.
  • Q is a C 2 to C 11 n-alkyl chain or a C 4 to C 11 n-alkenyl chain having one or two double bonds, especially C 3 to Cn, most preferably C 4 to C 8 .
  • These groups may be unsubstituted or substituted with one or more methyl, ethyl, Cl 5 F and/or Br group ; and T is H, OMe or OEt.
  • formula II the following are preferable both individually and in combination:;
  • L is methylnapthyleneoxy, unsubstituted, or substituted with one or more methyl, ethyl, halo, OH or CF 3 groups;
  • Q is C 2 to C 6 n-alkyl chain or a C 3 to C 6 n-alkenyl chain having one or two double bonds, especially C 3 to C 6 , most preferably C 4 to C 5 .
  • These groups may be unsubstituted or substituted with one or more methyl, ethyl, Cl, F and/or Br group; and
  • T is OR 15 COOR 15 ; and R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, preferably R 15 is H, methyl or ethyl.
  • L is methylbenzeneoxy, unsubstituted, or substituted with one or more methyl, ethyl, halo, OH or CF 3 groups;
  • Q is C 2 to C 6 n-alkyl chain or a C 3 to C 6 n-alkenyl chain having one or two double bonds, especially C 3 to C 6 , most preferably C 4 to C 5 .
  • These groups may be unsubstituted or substituted with one or more methyl, ethyl, Cl, F and/or Br group; and T is OR 15 COOR 15 ; and R 15 is H, methyl, ethyl, n-propyl, iso-propyl, n-butyl, t-butyl or benzyl, preferably R 15 is H, methyl or ethyl.
  • Q, or L and Q together where L is methyl preferably form an n-alkyl chain of 3 to 14 carbons, preferably 4 to 10 carbons and especially 4 to 8 or 5 to 8 carbons.
  • the maximum number of non-hydrogen atoms between group L and the end of the molecule furthest from the thiazolidinedione ring should be 4 to 18 atoms, preferably 5 to 12 atoms (e.g. 6 to 12 atoms) and more preferably 6 to 10 atoms.
  • the "chain length" and number of CH 2 groups of the exemplified compounds is listed below as examples of suitable compounds in this aspect of the invention:
  • Table 1 below provides common TZD compounds and TZD compounds which were identified using the screening methods described herein and in U.S. Application 20040019109.
  • Table 1 lists the name of each structure (Substance Name) and provides the chemical formula of the agonists and antagonists of exemplary claimed compounds (Structure),
  • Table 1 lists the effective concentration at which 50% inhibition is observed for each compound (pEC 50 ).
  • Table 1 also lists the relative efficacy of each compound compared to (Relative Efficacy) and the relative ability of each compound to inhibit oleic acid stimulation of GPR40 (Relative Inhibition).
  • Table 1 lists the experimental standard error of the mean (SEM).
  • Fenamates share a common structure based on N-arylanthranilic acid and are differentiated by their aryl substituents, as exemplified by meclofenamic acid (FIG. 3A), flufenamic acid (FIG. 3B) 5 and mefenamic acid (FIG. 3C).
  • Fenamates were originally described as NSAID-type anti-inflammatory agents primarily used as first-line therapeutic agents for treating arthritis. Fenamates act by blocking arachidonic acid metabolism through the cyclooxygenase enzyme. Some fenamates are also known to inhibit arachidonic acid lipoxygenase, resulting in decreased synthesis of the inflammatory mediators leukotrienes.
  • fenamates display a biphasic dose response curve when competing with oleic or linoleic acid, indicating they are partial agonists of GPR40.
  • the present invention provides the results of an evaluation of N-arylanthranilic acids, including N- phenylanthranilic acid as scaffolds for designing GPR40 ligands.
  • Table 2 provides common fenamate compounds and fenamate compounds which were identified using the screening methods described herein and in U.S. Application 20040019109.
  • Table 2 lists the name of each structure (Substance Name) and provides the chemical formula of the agonists and antagonists of exemplary claimed compounds (Structure).
  • Table 2 lists the effective concentration at which 50% inhibition is observed for each compound (pEC 50 ).
  • Table 2 also lists the relative efficacy of each compound compared to (Relative Efficacy) and the relative ability of each compound to inhibit oleic acid stimulation of GPR40 (Relative Inhibition).
  • Table 2 lists the experimental standard error of the mean (SEM). Table 2
  • tolfenamic acid, mefenamic acid, and meclofenamic acid all activated GPR40. Flufenamic acid, diclofenac, and N-phenylanthranilic acid did not activate GPR40. N-(3-nitropheny) anthranilic and N-(2-nitrophenyl) anthranilic acid activated GPR40 to a lesser extent than tolfenamic acid, mefenamic acid, and meclofenamic acid.
  • Tolfenamic acid, mefenamic acid and meclofenamic acid were less potent than some of the most potent known fatty acid activators of GPR40 but displayed potencies within a therapeutic range. All of the tested compounds which demonstrated the ability to activate the human GPR40 receptor also displayed antagonistic properties, as determined by their ability to block oleic acid-stimulated PI hydrolysis in transfected HEK293 cells. This indicates they are partial agonists of GPR40. This also indicates that the N-phenylanthranilic acid scaffold has intrinsic antagonistic properties.
  • the general structure of the fenamate compounds of the invention, which interact with GPR40, is shown in formula (III) above.
  • FIG. 1 depicts a method for the preparation of glitazone derivatives.
  • Either 4-hydroxybenzyl alcohol (1) or 6-hydroxy-2-hydroxymethyl naphthalene (2) (e.g. by reduction from 6-hydroxy-2-carboxylic acid) were combined with the corresponding bromide ester (3).
  • the mixture was refluxed overnight with 1,8- dizabicyclo[5.4.0]undec-7-ene (DBU), as shown in (a), and extracted to obtain the pure ether (4).
  • DBU 1,8- dizabicyclo[5.4.0]undec-7-ene
  • This ether (4) was mixed with pyridinium chlorochromate adsorbed onto alumina and evaporated to the aldehyde (5), as shown in (b).
  • This aldehyde (5) was refluxed with thiazolidinedione (6) and precipitated to produce the olefin (7), as shown in (e).
  • This olefin (7) was reduced by hydrogenation to produce the glitazone (8), as shown in (d).
  • FIG. 2 depicts a method for the preparation of aliphatic thiazolidinediones.
  • a carboxylic acid (9) was mixed with its corresponding thionyl chloride and refluxed. Bromine was added, as shown in (a) to produce the corresponding ⁇ -brominated methyl ester (10), which was in turn refluxed with thiourea, acidified, extracted, and evaporated, as shown in (6), to the desired product (11).
  • Diabetes and cancer treatment is achieved when the compounds of the present invention are administered to a subject requiring such treatment as an effective oral, parenteral, or intravenous dose of from 0.01 to 300 mg/kg of body weight per day. It is to be understood, however, that for any particular subject, specific dosage regimens should be adjusted according to the individual need and the professional judgment of the person administering or supervising the administration of the compound. It is to be further understood that the dosages set forth herein are exemplary.
  • the present compounds are particularly effective in the treatment of carcinomas such as adenocarcinomas.
  • Colorectal cancer is a cancer particularly suitable for treatment with the present compounds.
  • Effective amounts of the compounds of the present invention can be administered to a subject by any one of several methods, for example, orally as in capsules or tablets, parenterally in the form of sterile solutions or suspensions, and in some cases intravenously in the form of sterile solutions.
  • the compounds of the present invention while effective themselves, can be formulated and administered in the form of their pharmaceutically acceptable addition salts for purposes of stability, convenience of crystallization, increased solubility, and the like.
  • Preferred pharmaceutically acceptable addition salts include salts of mineral acids, for example, hydrochloric acid, sulfuric acid, nitric acid, and the like; salts of monobasic carboxylic acids, for example, acetic acid, propionic acid, and the like; salts of dibasic carboxylic acids, for example, maleic acid, fumaric acid, and the like; and salts of tribasic carboxylic acids, such as carboxysuccinic acid, citric acid, and the like.
  • Effective quantities of the compounds of the invention can be administered orally, for example, with an inert diluent or with an edible carrier. They can be enclosed in gelatin capsules or compressed into tablets.
  • compounds of the invention can be incorporated with an excipient and used in the form of tablets, troches, capsules, elixirs, suspensions, syrups, wafers, chewing gums, and the like. These preparations should contain at least 0.5% of active compound of the invention, but can be varied depending upon the particular form and can conveniently be between 4% to about 70% of the weight of the unit. The amount of active compound in such a composition is such that a suitable dosage will be obtained.
  • compositions and preparations according to the present invention are prepared so that an oral dosage unit form contains between 1.0-300 milligrams of the active compound of the invention.
  • Tablets, pills, capsules, troches, and the like can also contain the following ingredients: a binder, such as microcrystalline cellulose, gum tragacanth, or gelatin; an excipient, such as starch or lactose; a disintegrating agent such as alginic acid, Primogel, corn starch, and the like; a lubricant such as magnesium stearate or Sterotes; a glidant such as colloidal silicon dioxide; and a sweetening agent such as sucrose; or saccharin, or a flavoring agent, such as peppermint, methyl salicylate, or orange flavoring.
  • a binder such as microcrystalline cellulose, gum tragacanth, or gelatin
  • an excipient such as starch or lactose
  • a disintegrating agent such as alginic acid, Primogel, corn star
  • the dosage unit form When the dosage unit form is a capsule, it can contain, in addition to materials of the above type, a liquid carrier such as a fatty oil.
  • a liquid carrier such as a fatty oil.
  • Other dosage unit forms can contain various materials that modify the physical form of the dosage unit, for example, as coatings.
  • tablets or pills can be coated with sugar, shellac, or other enteric coating agents.
  • a syrup can contain, in addition to the active compounds, sucrose as a sweetening agent and certain preservatives, dyes, colorings, and flavors. Materials used in preparing these various compositions should be pharmaceutically pure and non-toxic in the amounts used.
  • the active compound of the invention can be incorporated into a solution or suspension. These preparations should contain at last 0.1% of active compound, but can be varied between 0.5 and about 50% of the weight thereof. The amount of active compounds in such compositions is such that a suitable dosage will be obtained. Preferred compositions and preparations according to the present invention are prepared so that a parenteral dosage unit contains between 0.5 to 100 milligrams of active compound.
  • Solutions or suspensions can also include the following components: a sterile diluent, such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents; antibacterial agents, such as benzyl alcohol or methyl parabens; antioxidants, such as ascorbic acid or sodium bisulfite; chelating agents, such as ethylenediaminetetraacetic acid; buffers, such as acetates, citrates, or phosphates, and agents for the adjustment of tonicity, such as sodium chloride or dextrose.
  • a sterile diluent such as water for injection, saline solution, fixed oils, polyethylene glycols, glycerine, propylene glycol, or other synthetic solvents
  • antibacterial agents such as benzyl alcohol or methyl parabens
  • antioxidants such as ascorbic acid or sodium bisulfite
  • chelating agents such as ethylenediamine
  • the compounds of the present invention are capable of sustained release in mammals for a period of several days or from about one to four weeks when formulated and administered as depot preparations, as for example, when injected in a properly selected pharmaceutically acceptable oil.
  • the preferred oils are of vegetable origin, such as sesame oil, cottonseed oil, corn oil, coconut oil, soybean oil, olive oil and the like, or they are synthetic esters of fatty acids and polyfunctional alcohols, such as glycerol or propyleneglycol.
  • the depot compositions of the present invention are prepared by dissolving a highly lipophilic ester, amide or carbamate of the instant invention in a pharmaceutically acceptable oil under sterile conditions.
  • the oil is selected so as to obtain a release of the active ingredient over a desired period of time.
  • the appropriate oil can easily be determined ⁇ by consulting the literature, or without undue experimentation by one skilled in the art.
  • An appropriate dose of a compound in accordance with this embodiment of the invention is from about 0.01 to 10 mg/kg of body weight per injection.
  • the depot formulations of this invention are administered as unit dose preparations comprising about 0.5 to 5.0 ml of a 0.1 to 20% weight/weight solution of compound in the oil. It is to be understood that the doses set forth herein are exemplary only and that they do not, to any extent, limit the scope or practice of the invention. VI. EXAMPLES
  • Ciglitazone was synthesized as described by Takeda Yakuhin Kogyo Kabushiki Kaisha in EP 0 008 203 Al.
  • Darglitazone was synthesized as described by Pfizer Int. in EP 0 332 332 Al.
  • Englitazone was synthesized as described by Pfizer Inc. in WO 86/07056.
  • Isaglitazone was synthesized as described by Mitsubishi Kasei Corporation in EP 0 604 983 AL
  • Pioglitazone was synthesized as described by Takeda Chemical Industries, Ltd. in EP 0 193 256 Al. Rosiglitazone was synthesized as described by the Beecham Group PLC in EP 0 309 228 Al.
  • Troglitazone was synthesized as described in Japanese Patent 60-51189.
  • HHO.1 tolfenamic acid
  • HH0.2 mefenamic acid was synthesized as described by Whitehouse et al (1962); Winder et al (1962); and by Parke, Davis & Co. in BE612424.
  • HH0.3 was synthesized as described by Whitehouse et al (1962); Winder et al (1962); and by Parke, Davis & Co. in BE612424.
  • step 1 in the preparation of glitazone derivatives involved the synthesis of the aromatic ether.
  • 4-hydroxybenzyl alcohol (1) or 6-hydroxy-2-naphthalenecarboxylic acid (2) (synthesized as described below), and 1.8 mole of the corresponding bromide ester (3) in acetonitrile 1.3 mole of 1,8- dizabicyclo[5.4.0]undec-7-ene were added, and this solution was refluxed overnight.
  • chloroform was added, and this solution was extracted with 0.05 M aqueous hydrochloric acid.
  • the organic phase was then extracted with brine and dried over magnesium sulfate.
  • the residue after evaporation was purified by flash chromatography with toluene and ethyl acetate to obtain the pure ether (4).
  • Step 2 in the preparation involved the oxydation of the alcohol.
  • Pyridinium chlorochromate (1.5 mole) was adsorbed onto neutral alumina in a 1 :25 ratio of pyridinium chlorochromate to alumina.
  • the resulting powder was mixed with the ether (4) at a temperature ranging between 0°C and 5°C and allowed to react at room temperature for one hour.
  • enough ethylic ether was added to make a slurry, which was filtered through a short plug of neutral alumina and washed with an ether solvent until the washings showed no more than a trace of the ether (4).
  • the solvent was evaporated to produce an aldehyde (5).
  • Step 3 involved condensation with thiazolidinedione.
  • An equimolar mixture of the aldehyde (5) and thiazolidinedione (6) was dissolved in toluene containing one drop of piperidine and one drop of acetic acid. The mixture was refluxed for four hours and then allowed to stand overnight at room temperature. The olefin solid that precipitated (7) was filtered, washed with ether, and dried.
  • Step 4 involved reduction of the olefin.
  • a solution of the olefin (7) dissolved in 1,4- dioxane was hydrogenated in the presence of 10% palladium over carbon at 60 psi for 50 hours at room temperature.
  • the mixture was filtered through a bed of celite and the filtrate evaporated to produce glitazone (8).
  • glitazone (8) was mixed with 15 moles of sodium hydroxide and dissolved in ethanol. This mixture was refluxed for 1.5 hours; then cooled to room temperature. Hydrochloric acid (2N) was then added until the glitazone was essentially completely precipitated. This precipitate was filtered, washed with water, and vacuum dried.
  • step 1 of the preparation of aliphatic thiazolidinediones involves the synthesis of ⁇ -brominated methyl esters.
  • a mixture of five moles of a thionyl chloride and the corresponding carboxylic acid (9) was refluxed for one hour, then allowed to cool.
  • One mole of bromine was added, and this mixture was stirred at 70°C for 16 hours.
  • two milliliters of methanol were added dropwise and the mixture was allowed to react for 30 minutes. The methanol was evaporated and the excess of thionyl chloride was co-evaporated with heptane to produce the corresponding ⁇ -brominated methyl ester (10).
  • Step 2 of the preparation of aliphatic thiazolidinediones involved the synthesis of the thiazolidinedione ring.
  • Thiourea (1.3 moles) was dissolved in ethanol and the ⁇ - brominated methyl ester (10) was added. This mixture was refluxed for two hours, allowed to cool, and acidified with 2N hydrochloric acid. This mixture was refluxed for 15 hours. After the mixture cooled, water was added, and the mixture extracted with chloroform. The organic layer was washed with water and dried over magnesium sulfate. The solvent was then evaporated to afford the desired product (11).
  • the reporter cell line Hffll-GPR40 (which stably expresses human GPR40) was constructed using the host reporter cell line HfTl 1 and the pIRESpuroGPR40, essentially as previously described by Kotarsky et at, 2003 and Kotarsky et at, 2001.
  • HEK293 cells were grown in DMEM with Glutamax-1 supplemented with 3% FBS and 0.5% penicillin/streptomycin.
  • mice GPR40 open reading frame (Genbank accession number AB095745) was amplified by a polymerase chain reaction (PCR) using the forward primer 5 1 GCCAAGCTTACCATGGACCTGCCCCCACAGCTCTCCTTCG 3' [SEQ ID No:l] and the reverse primer 5'
  • GGCGAATTCCTACTTCTGAATTGTTCCTCTTT GAGTC 3' [SEQ ID No.2] and subcloned into the pEAK12 expression vector (Edge BioSystems, Gaithersburg, MD).
  • the amplified and subcloned GPR40 was transfected into HEK293 cells using Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to the manufacturer's instructions. The cells were transfected for six hours and the cells were assayed 48-72 hours later.
  • Example 9 Reporter Assay Hffll and Hffll-GPR40 reporter cells were seeded at a density of 1.6 x 10 4 cells per well in 96 well plates in 100 ⁇ l medium.
  • test substances diluted in phosphate buffered saline (PBS) without Ca 2+ or Mg 2+ were added to the wells. After another eight hours, the incubation was interrupted by the removal of the medium. Lysis buffer (10 ( ⁇ l per well) were added and the plates were stored at -80°C until analysis. Luciferase activity was measured with a luciferase assay kit (BioThema, Sweden) according to the manufacturer's instructions. All samples were run in triplicate and repeated two to six times. The luminescence assays were performed with a BMG Lumistar Galaxy luminometer as previously described.
  • PBS phosphate buffered saline
  • Receptor activation also was assayed by measuring phosphatidyl insositol (PI) hydrolysis essentially as described by Chengalvala et ah, 1999. Briefly, inositol phosphates were radioactively labeled by conventional methods and cell lysates containing the labeled inositol phosphates were applied to 96 well plates containing Dowex AGl -X 8 resin. Inositol phosphates bound to the resin were eluted with ammonium formate/formic acid. The amount of radioactivity in the eluate corresponded to the amount of labeled inositol phosphate. This assay for PI hydrolysis resulting from G-protein coupled receptor activation can be performed in a high-throughput manner.
  • Example 10 Experimental protocol
  • One objective is to determine any effects in vivo of compounds on the GPR40 receptor (testing three dose levels) as determined by the amelioration of glucose tolerance in glucose intolerant male diet-induced obese (DIO) mice.
  • Effects of insulin levels can also be measured if considered necessary after terminating the acute glucose tests (measurement not included in budget).
  • Animals Forty C57 mice from the Charles River, Germany are used in the present study. At 5 weeks of age the animals are shipped to the research facility.
  • HF high-fat
  • mice are housed under a 12:12 L/D cycle (lights on at 03:00 AM and lights off at 15:00 PM) and in temperature and humidity controlled rooms.
  • mice are left on the diet for at least 12 weeks before experiment are commenced. Animals are control weighted every second week. Experimental OGTT
  • mice are dosed with compound - --(-S ⁇ - ⁇ l ⁇ -.pr; see-below)-.- At-time-point- ⁇ -bloed-glucose-is-measured-again-and-glucose-is— - administered by oral gavage (lg/kg glucose (using a 250mg/ml glucose solution)) and blood glucose is then measured at time points 15, 30, 60, 90 and 120 minutes.
  • a 5OMI blood sample eye or tail blood is collected for potential later insulin determination.
  • Group A Vehicle 10% DMSO in PBS
  • Group B Compound 1 (3 mg/kg)
  • Group C Compound 1 (30 mg/kg)
  • Group D Compound 1 (300 mg/kg)
  • Compound is dissolved in DMSO and diluted with PBS to contain 10% DMSO in the final solution. Compound is dosed at T- 15 in a 500 ⁇ l volume administered intraperitoneally (i.p.)- Dose preparation
  • the animals are subjected to three oral glucose tolerance tests with a 7 day drug free interval. During the 7 drug free days, animals have free access to food and water.
  • Oral Glucose Tolerance Test (OGTT) Oral Glucose Tolerance Test
  • Selected compounds have been tested in the obese mouse model. They represent molecules from both the fenamate and thiazolidinedione groups. The animals have tolerated the three dose levels without adverse symptoms. The compounds tested induce pronounced and consistent time-related and dose-related changes in the glucose tolerance tests, as well as in plasma insulin concentrations measured 15 min after the glucose administration.
  • Oral glucose tolerance was analyzed following administration of all compounds. Plasma insulin (at time +15 min after oral glucose) was measured with compounds 1 and 2. In the statistical analysis, the AUC stands for "area under (glucose) curve".

Landscapes

  • Health & Medical Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Epidemiology (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Animal Behavior & Ethology (AREA)
  • General Health & Medical Sciences (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)

Abstract

Des acides gras libres et leurs récepteurs régulent les voies métaboliques de cellules dans des états normaux et pathologiques. Des agents, qui modulent la fixation des acides gras libres à leurs récepteurs, peuvent être utilisés pour traiter et prévenir des troubles du métabolisme cellulaire. Des thiazolidinediones et des fénamates sont fournis et peuvent être utilisés comme modulateurs du récepteur GPR40 des acides gras libres pour traiter des troubles métaboliques, tels que le diabète de type 2 et des cancers.
PCT/GB2006/003998 2005-10-27 2006-10-27 Modulateurs therapeutiques du gpr40 WO2007049050A2 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US73056205P 2005-10-27 2005-10-27
US60/730,562 2005-10-27

Publications (2)

Publication Number Publication Date
WO2007049050A2 true WO2007049050A2 (fr) 2007-05-03
WO2007049050A3 WO2007049050A3 (fr) 2007-12-21

Family

ID=37719364

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/GB2006/003998 WO2007049050A2 (fr) 2005-10-27 2006-10-27 Modulateurs therapeutiques du gpr40

Country Status (1)

Country Link
WO (1) WO2007049050A2 (fr)

Cited By (14)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US8030354B2 (en) 2007-10-10 2011-10-04 Amgen Inc. Substituted biphenyl GPR40 modulators
US8299117B2 (en) 2010-06-16 2012-10-30 Metabolex Inc. GPR120 receptor agonists and uses thereof
US8309600B2 (en) 2008-12-18 2012-11-13 Metabolex Inc. GPR120 receptor agonists and uses thereof
US8586607B2 (en) 2008-07-28 2013-11-19 Syddansk Universitet Compounds for the treatment of metabolic diseases
WO2014011926A1 (fr) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comportant des statines, des biguanides et d'autres agents pour réduire un risque cardiométabolique
US8748462B2 (en) 2008-10-15 2014-06-10 Amgen Inc. Spirocyclic GPR40 modulators
WO2015097713A1 (fr) 2013-11-14 2015-07-02 Cadila Healthcare Limited Nouveaux composés hétérocycliques
US10064850B2 (en) 2007-04-11 2018-09-04 Omeros Corporation Compositions and methods for prophylaxis and treatment of addictions
CN109422643A (zh) * 2017-09-04 2019-03-05 任洁 新型降血糖化合物
US10710986B2 (en) 2018-02-13 2020-07-14 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US10774071B2 (en) 2018-07-13 2020-09-15 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US10899735B2 (en) 2018-04-19 2021-01-26 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US11236085B2 (en) 2018-10-24 2022-02-01 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US11241420B2 (en) 2007-04-11 2022-02-08 Omeros Corporation Compositions and methods for prophylaxis and treatment of addictions

Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001047520A1 (fr) * 1999-12-24 2001-07-05 Smithkline Beecham P.L.C. Derives de thiazolidinedione utilises dans le traitement du diabete sucre de type 2
US6541493B1 (en) * 1998-11-20 2003-04-01 Mitsubishi Chemical Corporation Crystals of 5-[{6-(2-fluorobenzyl)oxy-2-naphthyl}methyl]-2,4-thiazolidinedione
US20040019109A1 (en) * 2002-07-24 2004-01-29 Christer Owman Methods of identifying compounds that affect a fatty acid cell-surface receptor
WO2005015990A1 (fr) * 2003-08-18 2005-02-24 Betagenon Ab Nouveau modele animal de diabetes de type 2

Patent Citations (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US6541493B1 (en) * 1998-11-20 2003-04-01 Mitsubishi Chemical Corporation Crystals of 5-[{6-(2-fluorobenzyl)oxy-2-naphthyl}methyl]-2,4-thiazolidinedione
WO2001047520A1 (fr) * 1999-12-24 2001-07-05 Smithkline Beecham P.L.C. Derives de thiazolidinedione utilises dans le traitement du diabete sucre de type 2
US20040019109A1 (en) * 2002-07-24 2004-01-29 Christer Owman Methods of identifying compounds that affect a fatty acid cell-surface receptor
WO2005015990A1 (fr) * 2003-08-18 2005-02-24 Betagenon Ab Nouveau modele animal de diabetes de type 2

Non-Patent Citations (4)

* Cited by examiner, † Cited by third party
Title
BRAZIL M: "GPR40 NO LONGER AN ORPHAN" NATURE REVIEWS. DRUG DISCOVERY, NATURE PUBLISHING GROUP, BASINGSTOKE, GB, vol. 2, no. 5, May 2003 (2003-05), page 340, XP008030524 ISSN: 1474-1784 *
FLEMMER M ET AL: "MECHANISM OF ACTION OF THIAZOLIDINEDIONES" CURRENT OPINION IN INVESTIGATIONAL DRUGS, CURRENT DRUGS, LONDON, GB, vol. 2, no. 11, November 2001 (2001-11), pages 1564-1567, XP009013694 ISSN: 0967-8298 *
KOTARSKY K ET AL: "A human cell surface receptor activated by free fatty acids and thiazolidinedione drugs" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS 07 FEB 2003 UNITED STATES, vol. 301, no. 2, 7 February 2003 (2003-02-07), pages 406-410, XP002420519 ISSN: 0006-291X *
YONEZAWA T ET AL: "Existence of GPR40 functioning in a human breast cancer cell line, MCF-7" BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS 13 FEB 2004 UNITED STATES, vol. 314, no. 3, 13 February 2004 (2004-02-13), pages 805-809, XP002420520 ISSN: 0006-291X *

Cited By (19)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10064850B2 (en) 2007-04-11 2018-09-04 Omeros Corporation Compositions and methods for prophylaxis and treatment of addictions
US11241420B2 (en) 2007-04-11 2022-02-08 Omeros Corporation Compositions and methods for prophylaxis and treatment of addictions
US8030354B2 (en) 2007-10-10 2011-10-04 Amgen Inc. Substituted biphenyl GPR40 modulators
US8586607B2 (en) 2008-07-28 2013-11-19 Syddansk Universitet Compounds for the treatment of metabolic diseases
US8748462B2 (en) 2008-10-15 2014-06-10 Amgen Inc. Spirocyclic GPR40 modulators
US8309600B2 (en) 2008-12-18 2012-11-13 Metabolex Inc. GPR120 receptor agonists and uses thereof
US8598374B2 (en) 2008-12-18 2013-12-03 Metabolex, Inc. GPR120 receptor agonists and uses thereof
US8299117B2 (en) 2010-06-16 2012-10-30 Metabolex Inc. GPR120 receptor agonists and uses thereof
US8476308B2 (en) 2010-06-16 2013-07-02 Metabolex, Inc. GPR120 receptor agonists and uses thereof
WO2014011926A1 (fr) 2012-07-11 2014-01-16 Elcelyx Therapeutics, Inc. Compositions comportant des statines, des biguanides et d'autres agents pour réduire un risque cardiométabolique
WO2015097713A1 (fr) 2013-11-14 2015-07-02 Cadila Healthcare Limited Nouveaux composés hétérocycliques
US10246470B2 (en) 2013-11-14 2019-04-02 Cadila Healthcare Limited Heterocyclic compounds
US10011609B2 (en) 2013-11-14 2018-07-03 Cadila Healthcare Limited Heterocyclic compounds
CN109422643A (zh) * 2017-09-04 2019-03-05 任洁 新型降血糖化合物
US10710986B2 (en) 2018-02-13 2020-07-14 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US11555029B2 (en) 2018-02-13 2023-01-17 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US10899735B2 (en) 2018-04-19 2021-01-26 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US10774071B2 (en) 2018-07-13 2020-09-15 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors
US11236085B2 (en) 2018-10-24 2022-02-01 Gilead Sciences, Inc. PD-1/PD-L1 inhibitors

Also Published As

Publication number Publication date
WO2007049050A3 (fr) 2007-12-21

Similar Documents

Publication Publication Date Title
WO2007049050A2 (fr) Modulateurs therapeutiques du gpr40
CA2299760C (fr) Acides oxamiques contenant des groupes cyano et derives utilises comme ligands du recepteur de la thyroide
EP2116523B1 (fr) Composé rexinoïde ayant un groupe alcoxy
TWI460175B (zh) 包含ｄｇａｔ抑制劑及ｐｐａｒ－激動劑之藥物組合物
JP2003525217A (ja) 肥満治療用薬剤
JP5744886B2 (ja) シクロペンタンカルボキサミド誘導体、このような化合物を含む薬物及びそれらの使用
WO2017049177A1 (fr) Agonistes du récepteur x farnésoïde et leurs utilisations
EA022417B1 (ru) Арильные агонисты рецептора gpr120 и их применение
JPH05501540A (ja) Ｐｃｐレセプター・リガンドおよびその用途
US20210047337A1 (en) Triazolopyrimidines, their preparation and use
KR20170070140A (ko) 암을 치료하기 위한 방법
Kim et al. KR-62980: a novel peroxisome proliferator-activated receptor γ agonist with weak adipogenic effects
US20080269189A1 (en) Method for Avoiding Edema in the Treatment or Prevention of Ppary-Responsive Diseases, Including Cancer
JP2018524353A (ja) 可溶性エポキシド加水分解酵素およびペルオキシソーム増殖活因子活性化受容体の新規な二重調節因子を用いた糖尿病およびメタボリックシンドロームの治療
EP1572180B1 (fr) Utilisation d'acides alpha-phenylthiocarboxyliques ayant une activite de reduction du taux du glucose serique et du taux des lipides seriques
JP4813800B2 (ja) 糖尿病を治療するためのキヌレニン３−ヒドロキシラーゼ阻害剤
WO2004093910A1 (fr) Remede contre des maladies cerebrales neurodegeneratives utilisant un agoniste des ppar$g(d)
AU2014207347A1 (en) Isometheptene isomer
US6677298B2 (en) Regulators of PPARδ (β) and their use in the treatment of obesity and insulin resistance
WO2023066216A1 (fr) Composition pharmaceutique comprenant de la saponine stéroïdienne c21 et son utilisation
AU2001277926A1 (en) Regulators of PPARdelta(beta) and their use in the treatment of obesity and insulin resistance
WO2012112567A1 (fr) Inhibiteurs d'agbl2 à petite molécule
WO2005016255A2 (fr) Tetrahydroquinolines a substitution, acides phenylacetiques et benzoiques, comme composes modulateurs de recepteur du facteur nucleaire d'hepatocyte 4$g(a) (hnf-4$g(a) )
WO2003004484A1 (fr) Nouveaux composes aliphatiques, procede de synthese et leur procede d'utilisation
JPWO2010098125A1 (ja) レチノイドｘ受容体パーシャルアゴニスト化合物

Legal Events

Date Code Title Description
121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase in:

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 06808358

Country of ref document: EP

Kind code of ref document: A2