WO2007014433A1 - Polysaccharide synthases - Google Patents
Polysaccharide synthases Download PDFInfo
- Publication number
- WO2007014433A1 WO2007014433A1 PCT/AU2006/001107 AU2006001107W WO2007014433A1 WO 2007014433 A1 WO2007014433 A1 WO 2007014433A1 AU 2006001107 W AU2006001107 W AU 2006001107W WO 2007014433 A1 WO2007014433 A1 WO 2007014433A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- seq
- cell
- nucleic acid
- glucan
- plant
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
- C12N15/8246—Non-starch polysaccharides, e.g. cellulose, fructans, levans
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/63—Introduction of foreign genetic material using vectors; Vectors; Use of hosts therefor; Regulation of expression
- C12N15/79—Vectors or expression systems specially adapted for eukaryotic hosts
- C12N15/82—Vectors or expression systems specially adapted for eukaryotic hosts for plant cells, e.g. plant artificial chromosomes (PACs)
- C12N15/8241—Phenotypically and genetically modified plants via recombinant DNA technology
- C12N15/8242—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits
- C12N15/8243—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine
- C12N15/8245—Phenotypically and genetically modified plants via recombinant DNA technology with non-agronomic quality (output) traits, e.g. for industrial processing; Value added, non-agronomic traits involving biosynthetic or metabolic pathways, i.e. metabolic engineering, e.g. nicotine, caffeine involving modified carbohydrate or sugar alcohol metabolism, e.g. starch biosynthesis
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/1048—Glycosyltransferases (2.4)
- C12N9/1051—Hexosyltransferases (2.4.1)
- C12N9/1059—Cellulose synthases (2.4.1.12; 2.4.1.29)
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12P—FERMENTATION OR ENZYME-USING PROCESSES TO SYNTHESISE A DESIRED CHEMICAL COMPOUND OR COMPOSITION OR TO SEPARATE OPTICAL ISOMERS FROM A RACEMIC MIXTURE
- C12P19/00—Preparation of compounds containing saccharide radicals
- C12P19/04—Polysaccharides, i.e. compounds containing more than five saccharide radicals attached to each other by glycosidic bonds
Definitions
- the present invention relates generally to polysaccharide synthases. More particularly, the present invention relates to (1 ,3;1 ,4)- ⁇ -D-glucan synthases.
- the various tissues of cereal grains have diverse functions during grain development, dormancy and after germination.
- the pericarp and seed coat tissues are concerned with the protection of the seed during development and during dormancy.
- these outer grain tissues have died and the tissue residues consist almost entirely of cell wall residues.
- the nucellar tissue between the seed coat and the aleurone surface is involved in transfer of nutrients to the developing grain, however, at maturity, this tissue has also collapsed to leave cell wall remnants.
- the thin walled cells of the starchy endosperm of mature grain are dead, but are packed with starch and storage protein.
- the thick-walled, nucleated, aleurone cells are alive at grain maturity, and are packed with protein bodies and lipid droplets.
- the scutellum which functions in delivering nutrients to the developing endosperm and, during germination, transfers digestion products of the endosperm reserves to the developing embryo.
- the different structure and function of each tissue type in the grain are determined, at least in part, by the cell wall composition of each of these cell types.
- Non-cellulosic polysaccharides are key components in the cell walls of cereal grain tissues and include, for example, (1 ,3;1 ,4)- ⁇ -D-glucans, heteroxylans (mainly arabinoxylans), glucomannans, xyloglucans, pectic polysaccharides and callose. These non-cellulosic polysaccharides usually constitute less than 10% of the overall weight of the grain, but nevertheless are key determinants of grain quality.
- non-cellulosic polysaccharides and other wall components have not been described, it is generally considered that in the wall, microfibrils of cellulose are embedded in a matrix phase of non-cellulosic polysaccharides and protein. Wall integrity is maintained predominantly through extensive non-covalent interactions, especially hydrogen bonding, between the matrix phase and microfibrillar constituents. In the walls of some grain tissues covalent associations between heteroxylans, lignin and proteins are present. The extent of covalent associations between components also varies with the wall type and genotype.
- Non-celiu!osic polysaccharides especially heteroxylans and (1 ,3;1 ,4)- ⁇ -D- glucans, constitute a relatively high proportion of the walls of the aleurone and starchy endosperm, and probably also of the scutellum. In these tissues, cellulose contents are correspondingly lower.
- the generally low cellulose content of these walls together with the fact that they contain no lignin, are thought to be related to a limited requirement for structural rigidity of walls in central regions of the grain, and to a requirement to rapidly depolymerize wall components following germination of the grain.
- cellulose and lignin contents are much higher and the concentrations of non-ceiiulosic polysaccharides are correspondingly lower.
- (1 ,3;1 ,4)- ⁇ -D-glucans also referred to as mixed-linkage or cereal ⁇ -glucans, are non-cellulosic polysaccharides which naturally occur in plants of the monocotyledon family Poaceae, to which the cereals and grasses belong, and in related families of the order Poales.
- non-cellulosic polysaccharides are important constituents of the walls of the starchy endosperm and aleurone cells of most cereal grains, where they can account for up to 70% - 90% by weight of the walls.
- Barley, oat and rye grains are rich sources of (1 ,3;1 ,4)- ⁇ -D-glucan, whereas wheat, rice and maize have lower concentations of this polysaccharide.
- the (1 ,3;1 ,4)- ⁇ -D-glucans are also relatively minor components of walls in vegetative tissues of cereals and grasses. Although present as a relatively minor component in vegetative tissues (1 ,3;1 ,4)- ⁇ -D-glucan) is still important in terms of, for example, the digestibility of vegetative tissue by animals and in the use of crop residues for bioethanol production.
- (1 ,3;1 ,4)- ⁇ -D-glucans are important in large-scale food processing activities that include brewing and stockfeed manufacture.
- the non-starchy polysaccharides of cereals, such as (1 ,3;1 ,4)- ⁇ -D-glucans have attracted renewed interest in recent years because of their potentially beneficial effects in human nutrition.
- (1 ,3;1 ,4)- ⁇ -D-glucan concentrations in grain are thought to be influenced by both genotype and environment.
- concentration of (1,3;1 ,4)- ⁇ -D- glucan in cereal grains depends on the genotype, the position of the grain on the spike and environmental factors such as planting location, climatic conditions during development and soil nitrogen.
- identification of the genes encoding (1 ,3;1 ,4)- ⁇ -D-glucan synthases would be desirable, as this would facilitate modulation of the level of (1 ,3;1 ,4)- ⁇ - D-glucan produced by a cell, and therefore, allow the qualities of grain or vegetative tissue to be altered. Therefore, in order to enable the modulation of the level of (1 ,3;1 ,4)- ⁇ -D-glucan in a cell and associated changes in grain or vegetative tissue quality, there is a clear need to identify genes that encode (1 ,3;1 ,4)- ⁇ -D-glucan synthases.
- the present invention is predicated, in part, on the identification of genes which encode the biosynthetic enzyme for (1 ,3,i ,4)- ⁇ -D-g!ucans, referred to herein as "(1 ,3;1 ,4)- ⁇ -D-glucan synthases”.
- the present invention provides, inter alia, methods and compositions for influencing the level and/or activity of (1 ,3;1,4)- ⁇ -D-glucan synthase in a cell and thereby the level of (1 ,3;1 ,4)- ⁇ -D-glucan produced by the cell.
- the present invention provides a method for influencing the level of (1 ,3;1 ,4)- ⁇ -D-glucan produced by a cell, the method comprising modulating the level and/or activity of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- the cell is a plant cell, more preferably a monocot plant cell and most preferably a cereal crop plant cell.
- the present invention provides a method for modulating the level and/or activity of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell, the method comprising modulating the expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in the cell.
- the present invention provides a method for modulating the level and/or activity of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell, the method comprising modulating the expression of a CsIF gene or functional homolog thereof in the cell.
- the present invention provides a method for producing (1 ,3;1 ,4)- ⁇ -D-glucan, the method comprising expressing a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in a cell.
- the present invention also provides (1 ,3;1 ,4)- ⁇ -D-glucan produced according to the method of the fourth aspect of the invention.
- the present invention provides a cell comprising any one or more of:
- the present invention provides a multicellular structure comprising one or more cells according to the sixth aspect of the invention.
- the cell is a plant cell and as such, the present invention includes a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue, comprising one or more plant cells according to the sixth aspect of the invention.
- the present invention provides a cereal plant comprising one or more cells according to the sixth aspect of the invention.
- the present invention provides cereal grain comprising one or more cells according to the sixth aspect of the invention.
- the present invention provides a cereal grain comprising an altered level of (1 ,3,i ,4)- ⁇ -D-glucan, wherein the grain comprises one or more cells comprising an altered level and/or activity of (1 ,3;1 ,4)- ⁇ -D- glucan synthase and/or altered expression of a (1 ,3;1 ,4)- ⁇ D-glucan synthase encoding nucleic acid molecule.
- the present invention also provides flour comprising:
- the present invention is predicated, in part, on the identification and isolation of nucleotide and amino acid sequences that encode (1 ,3;1 ,4)- ⁇ -D-glucan synthases.
- the present invention provides an isolated nucleic acid molecule that encodes a (1 ,3;1 ,4)- ⁇ -D-glucan synthase.
- the present invention also provides an isolated nucleic acid molecule comprising one or more of:
- SEQ ID NO: 5 SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 ;
- SEQ ID NO: 3 SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 under low stringency, more preferably medium stringency and most preferably high stringency conditions;
- nucleotide sequence which encodes the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12.
- the present invention provides a genetic construct or vector comprising an isolated nucleic acid molecule of the eleventh aspect of the invention.
- the present invention extends to a cell comprising the isolated nucleic acid molecule of the tenth or eleventh aspects of the invention or genetic construct of the twelfth aspect of the invention.
- the present invention provides a multicellular structure which comprises one or more of the cells of the thirteenth aspect of the invention.
- the present invention also provides amino acid sequences for (1 ,3;1 ,4)- ⁇ -D-glucan synthases.
- the present invention provides an isolated polypeptide comprising an amino acid sequence encoding a (1 ,3;1 ,4)- ⁇ -D- glucan synthase protein.
- the present invention provides an isolated polypeptide comprising one or more of: (i) the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12; (ii) an amino acid sequence comprising at least 50% identity to the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12;
- the isolated polypeptide of the present invention comprises an amino acid sequence defining a "(1 ,3;1 ,4)- ⁇ -D-glucan synthase" as hereinbefore defined.
- the sixteenth aspect of the invention also provides fragments of isolated polypeptides including (1 ,3;1 ,4)- ⁇ -D-glucan synthase epitopes.
- the isolated polypeptides and (1 ,3;1 ,4)- ⁇ -D-glucan synthase epitope-bearing polypeptides of the sixteenth aspect of the invention are useful, for example, in the generation of antibodies that bind to the isolated (1 ,3;1 ,4)- ⁇ -D-glucan synthase proteins
- the present invention provides an antibody or an epitope binding fragment thereof, raised against an isolated (1 ,3;1 ,4)- ⁇ -D-glucan synthase protein as hereinbefore defined or an epitope thereof.
- SEQ ID NO: Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:).
- the SEQ ID NOs: correspond numerically to the sequence identifiers ⁇ 400 > 1 (SEQ ID NO: 1), ⁇ 400 > 2 (SEQ ID NO: 2), etc.
- a summary of the sequence identifiers is provided in Table 1.
- a sequence listing is provided at the end of the specification.
- Figure 1 shows a region on chromosome 7 of rice which is syntenous to a region of barley chromosome 2H, where a cluster of six cellulose synthase-like (CsI) genes was detected within an interval of 119 Kb, corresponding to the 21.59-21.72 Mb region of the chromosome.
- CsI cellulose synthase-like
- Figure 2 shows a vector map of the pAJ22 vector used to express CsIF genes in Arabidopsis.
- Figure 3 is a Southern Blot showing Xba ⁇ and Seal digested DNA derived from transformed Arabidopsis plants, which has been probed with fragments from OsCslF2, OsCslF ⁇ and OsCslF8. The hybridizing fragments for these are marked on the figure as F2, F4 and F8.
- Track Numbers 1 to 14 are plant lines A2, A3, A7, A12, A16, A18, A21 , A23, A28, A29, A31 , A33, A41 and A42, respectively, while track 15 shows DNA derived from a wild-type Columbia plant.
- Figure 4 is a Southern Blot showing Xba ⁇ digested DNA derived from transformed Arabidopsis plants, which has been probed with a fragment of the BAR gene.
- Track Numbers 1 to 14 are plant lines A2, A3, A7, A12, A16, A18, A21 , A23, A28, A29, A31 , A33, A41 and A42, respectively, while track 15 shows DNA derived from a wild-type Columbia plant.
- Figure 5 shows normalized mRNA levels, as determined by Q-PCR, in the leaves of 14-day old transgenic Arabidopsis plant which express one or more of OsCslF2, OsCslF4 or OsCslF ⁇ .
- Figure 6 shows a ClustalW multiple sequence alignment of CsIF amino acid sequences derived from Barley (Hordeum vulgare) and Rice (Oryza sativa).
- Figure 7 shows transmission electron micrographs illustrating the detection of (1 ,3;1 ,4)- ⁇ -D-glucan in cell walls of several transgenic Arabidopsis plants with specific monoclonal antibodies.
- Panel A shows the detection of (1 ,3;1 ,4)- ⁇ -D- glucan in transformed Arabidopsis lines A28 and A29.
- Panel B walls from the epidermal layers of leaves from transgenic Arabidopsis line A18 are shown to accumulate (1 ,3;1 ,4)- ⁇ -D-glucan over a period of about fourteen days.
- Panel C shows a representative section of WT Arabidopsis leaf epidermal cell wall where minimal or no background labelling is commonly observed.
- Figure 8 shows the nucleotide sequence identity, protein sequence identity and protein sequence similarity between CsIF sequences derived from Rice (Oryza sativa) and Barley (Hordeum vulgare)
- Figure 9 is a phylogenetic tree showing the relationship of complete and partial CsIF amino acid sequences derived from Barley (Hordeum vulgare) and Rice (Oryza sativa).
- Figure 10 shows the location of HvCslF2, 4, 5 and 6 genes on chromosome 2H of the Steptoe x Morex (SxM 2H) Bin map. Key markers (as Figure 1 ) are shown on the right-hand side and distances from the top of the chromosome in centimorgans are indicated on the ieft-hand side.
- Figure 11 shows a map of the pMDC32 vector
- Figure 12 shows the results of the QPCR analysis of hygromycin transcript levels in control and transgenic barley plants
- Figure 13 shows the results of the QPCR analysis of HvCsIFI transcript levels in control and transgenic barley plants.
- FIG. 14 shows the results of the QPCR analysis of HvCslF4 transcript levels in control and transgenic barley plants
- FIG. 15 shows the results of the QPCR analysis of HvCslF ⁇ transcript levels in control and transgenic barley plants
- Figure 17 shows G98-10 with both primary and secondary antibodies omitted from the labeling procedure, photographed at 7 seconds exposure under the I3 filter.
- Figure 18 shows transgenic plants (A 1 B 1 C 1 D) compared with control plants (E and F) all photographed at 7 seconds exposure under the 13 filter:
- E) WT control showing fluorescence signal from endogenous (1 ,3;1 ,4)-(3-D-g!ucans;
- F) transgene control G89-1 showing fluorescence from endogenous (1 ,3;1 ,4)- ⁇ -D- glucans.
- Figure 19 shows transmission electron micrographs.
- Panel A shows a representative epidermal cell wall of the transgenic control G89-1 , showing labeling of endogenous levels of (1 ,3;1 ,4)- ⁇ -D-glucan.
- Panel B shows a representative epidermal cell wall of the transgenic G98-10 showing significantly heavier labeling of (1 ,3;1 ,4)- ⁇ -D-glucan in the walls of these plants.
- Panel C shows a representative epidermal cell wall of transgenic G103-5 showing significantly heavier labeling of (1 ,3;1 ,4)- ⁇ -D-glucan in the walls of these plants.
- Figure 20 shows transmission electron micrographs.
- Panel A is a representative sclerenchyma fibre cell wall from the transgenic control G89-1 showing labeling of endogenous levels of (1 ,3;1 ,4)- ⁇ -D-glucan.
- Panel B shows a representative sclerenchyma fibre cell wall from the transgenic G98-10 showing heavier labeling of the (1 ,3;1 ,4)- ⁇ -D-glucan.
- Panel C shows a representative sclerenchyma fibre cell wall from the transgenic G103-5 showing heavier labeling of the (1 ,3;1 ,4)- ⁇ -D-glucan.
- the present invention is predicated, in part, on the identification of genes which encode the biosynthetic enzyme for (1 ,3;1 ,4)- ⁇ -D-glucans, referred to herein as "(1 ,3;1 ,4)- ⁇ -D-glucan synthases".
- “(1 ,3;1 ,4)- ⁇ -D-glucans” should be understood to include linear, unbranched polysaccharides in which ⁇ -D-glucopyranosyl monomers are polymerized through both (1-»4)- and (1-»3)-linkages.
- the ratio of (1 ⁇ 4)- to (1-»3)-linkages, in naturally occurring (1 ,3;1 ,4)- ⁇ -D- glucans is generally in the range 2.2-2.6:1 , although the ratio may also be outside of this range.
- the ratio is 1.15:1.
- the two types of linkages are not arranged in regular, repeating sequences. Single (1->3)-linkages are separated by two or more (1->4)-linkages. Regions of two or three adjacent (1-»4)-linkages predominate, but again there is no regularity in the arrangement of these units.
- the linkage sequence does not depend on preceding linkages further away than two glucose units and follows a second order Markov chain distribution. Moreover, up to 10 % of the chain may consist of longer stretches of 5 to 20 adjacent (1-»4)-linkages.
- cereal (1 ,3;1 ,4)- ⁇ -D-glucans may be considered as (1 ⁇ 3)- ⁇ -linked copolymers of cellotriosyl (G4G4G Re d), cellotetraosyl (G4G4G4G Red ) units and longer (1->4)- ⁇ -D-oligoglucosyl units.
- the ratio of tri- to tetra-saccharide units in endogenous (1 ,3;1 ,4)- ⁇ -D-glucans varies between cereal species. For example, in wheat the ratio is 3.0-4.5:1 , in barley 2.9-3.4:1 , in rye 2.7:1 and in oats 1.8-2.3:1. Furthermore, the observed ratios may also vary according to the temperature and conditions of (1 ,3;1 ,4)- ⁇ - D-glucan extraction.
- the average molecular masses reported for cereal (1 ,3;1 ,4)- ⁇ -D-glucans range from 48,000 (DP -300) to 3,000,000 (DP -1850), depending on the cereal species, cell wall type, extraction procedure and the method used for molecular mass determination. They are invariably polydisperse with respect to molecular mass and this is illustrated by a weight average to number average molecular mass ratio (MJM n ) of 1.18 for barley (1 ,3;1 ,4)- ⁇ -D-glucan. Certain barley (1 ,3;1 ,4)- ⁇ -D-glucans are also covalently-associated with small amounts of protein and have estimated molecular masses of up to 40,000,000.
- the extractability of (1 ,3;1 ,4)- ⁇ -D-glucans from walls of cereal grains is a function of their degree of self-association and their association with other wall polysaccharides and proteins.
- extractability depends on the molecular mass and linkage distribution in the (1 ,3;1 ,4)- ⁇ -D-glucan chains. Extensive association with other polymers and very high molecular masses render the (1 ,3;1 ,4)- ⁇ -D-glucans more difficult to extract from grain.
- a portion of the (1 ,3;1 ,4)- ⁇ -D-glucan from barley, oat and rye flours may be extracted by water at pH 7.0 and 4O 0 C. Further fractions can be solubilized at higher temperatures.
- the proportion of total (1 ,3;1 ,4)- ⁇ -D-glucan that is water-soluble at 4O 0 C varies within and between species.
- waxy (high amylose) barleys have a higher proportion of water-soluble (1 ,3;1 ,4)- ⁇ -D-glucan than normal barleys.
- Alkali-extracted barley (1 ,3;1 ,4)- ⁇ -D-glucan fractions have higher molecular masses, higher ratios of (1->4): (1-»3) linkages, more contiguously linked (1— >4)-linked segments and higher tri-: tetra-saccharide ratios than their water-extractable counterparts.
- Other extractants such as dimethylsulphoxide, hot perchloric acid, trichloroacetic acid, N- methylmorpholino-N-oxide and dimethylacetamide-LiCI, may also be used to solubilize (1 ,3;1 ,4)- ⁇ -D-glucans, but these extractants may cause some depolymerisation or degradation of the polymer.
- the (1 ,3;1 ,4)- ⁇ -D-glucans are oftensoluble at neutral pH and room temperature. However, upon cooling, (1 ,3;1 ,4)- ⁇ -D-glucans can aggregate and precipitate.
- the present invention is predicated, in part, on the identification of the biosynthetic enzyme, and encoding gene, that catalyses the synthesis of (1 ,3;1 ,4)- ⁇ -D-glucan. As used herein, this enzyme is referred to herein as "(1 ,3;1 ,4)- ⁇ -D-glucan synthase".
- the present invention arises, in part, from an analysis of expressed sequence tag libraries and other sequence databases including cellulose synthase (CesA) genes. More particularly, it was noted in these analyses that the CesA genes were in fact members of a much larger super-family of genes, which included both the CesA genes and the cellulose synthase-like (CsI) gene family.
- CsA cellulose synthase
- CsIA-CsIH The CsI genes have been sub-divided into eight groups, designated CsIA-CsIH.
- CsIA genes from guar and Arabidopsis, which encodes (1-»4)- ⁇ -D-mannan synthases.
- genes encoding (1 ,3;1 ,4)- ⁇ -D-glucan synthases might be members of the CsI gene family.
- CsI gene families in most vascular plants are very large and have been divided into several groups, designated CsIA to CsIH.
- CsIA to CsIH the CsI gene families in most vascular plants are very large and have been divided into several groups, designated CsIA to CsIH.
- CsIA to CsIH the CsI gene families in most vascular plants are very large and have been divided into several groups, designated CsIA to CsIH.
- CsIA to CsIH the CsIA to CsIH.
- the present invention used a genetic approach to identify the nucleotide sequences, and corresponding amino acid sequences, that encode (1 ,3;1 ,4)- ⁇ - D-glucan synthase.
- (1 ,3;1 ,4)- ⁇ -D-glucan synthases are encoded by members of the CsIF gene family.
- the present invention provides, inter alia, methods and compositions for influencing the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell and thereby the level of (1 ,3;1 ,4)- ⁇ -D-glucan produced by the cell.
- the present invention provides a method for influencing the level of (1 ,3;1 ,4)- ⁇ -D-glucan produced by a cell, the method comprising modulating the level and/or activity of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- the "cell” may be any suitable eukaryotic or prokaryotic cell.
- a “cell” as referred to herein may be a eukaryotic cell including a fungal cell such as a yeast cell or mycelial fungus cell; an animal cell such as a mammalian cell or an insect cell; or a plant cell.
- the cell may also be a prokaryotic cell such as a bacterial cell including an £. co// cell, or an archaea cell.
- the cell is a plant cell, more preferably a vascular plant cell, including a monocotyledonous or dicotyledonous angiosperm plant cell or a gymnosperm plant cell.
- the plant is a monocotyledonous plant cell.
- the monocotyledonous plant cell is a cereal crop plant cell.
- the term "cereal crop plant” includes members of the Poales (grass family) that produce edible grain for human or animal food.
- Examples of Poales cereal crop plants which in no way limit the present invention include wheat, rice, maize, millets, sorghum, rye, triticale, oats, barley, teff, wild rice, spelt and the like.
- the term cereal crop plant should also be understood to include a number of non-Poales species that also produce edible grain and are known as the pseudocereals, such as amaranth, buckwheat and quinoa.
- cereal crop plants are particularly preferred monocotyledonous plants
- the other monocotyledonous plants are also preferred, such as other non-cereal plants of the Poales, specifically including pasture grasses such as Lolium spp.
- the present invention is predicated, in part, on modulating the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell.
- (1 ,3;1 ,4)- ⁇ -D-glucan synthase should be regarded as any protein which catalyses the synthesis of (1 ,3;1 ,4)- ⁇ -D-glucan and, optionally, catalyses the polymerisation of glucopyranosyl monomers.
- the (1 ,3;1 ,4)- ⁇ -D-glucan synthase comprises the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34, or an amino acid sequence which is at least 40% identical thereto.
- the (1 ,3;1 ,4)- ⁇ -D-glucan synthase comprises at least 50% amino acid sequence identity, yet more preferably at least 60% amino acid sequence identity, even more preferably at least 70% amino acid sequence identity, and even more preferably at least 80% amino acid sequence identity and most preferably at least 90% amino acid sequence identity to any SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34.
- the (1 ,3;1 ,4)- ⁇ -D-glucan synthase comprises the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34.
- the compared sequences should be compared over a comparison window of at least 100 amino acid residues, more preferably at least 200 amino acid residues, yet more preferably at least 400 amino acid residues, even more preferably at least 800 amino acid residues and most preferably over the full length of any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34.
- the comparison window may comprise additions or deletions (i. e.
- Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et a/. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19. 3 of Ausubel et al. ("Current Protocols in Molecular Biology” John Wiley & Sons Inc, 1994-1998, Chapter 15,1998).
- the (1 ,3;1 ,4)- ⁇ -D-glucan synthase is encoded by a CsIF gene or a functional homolog thereof (as defined later).
- the modulation of the "level" of the (1 ,3;1 ,4)- ⁇ -D-glucan synthase should be understood to include modulation of the level of (1 ,3;1 ,4)- ⁇ - D-glucan synthase transcripts and/or polypeptides in the cell. Modulation of the
- activity of the (1 ,3;1 ,4)- ⁇ -D-glucan synthase should be understood to include modulation of the total activity, specific activity, half-life and/or stability of the (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- moduleating with regard to the level and/or activity of the (1 ,3;1 ,4)- ⁇ -D ⁇ glucan synthase is intended decreasing or increasing the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- decreasing is intended, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the level or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- increasing is intended, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20 fold, 50-fold, 100-fold increase in the level of activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- Moduleating also includes introducing a (1 ,3;1 ,4)- ⁇ -D-glucan synthase into a cell which does not normally express the introduced enzyme, or the substantially complete inhibition of (1 ,3;1 ,4)- ⁇ -D-glucan synthase activity in a cell that normally has such activity.
- the level of (1 ,3;1 ,4)- ⁇ -D-glucan produced by a cell is increased by increasing the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- the level of (1 ,3;1 ,4)- ⁇ -D- glucan produced by a cell is decreased by decreasing the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell.
- the methods of the present invention contemplates any means known in the art by which the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell may be modulated.
- the level and/or activity of the (1 ,3;1 ,4)- ⁇ -D-glucan synthase is modulated by modulating the expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in the cell.
- the present invention provides a method for modulating the level and/or activity of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell, the method comprising modulating the expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in the cell.
- (1,3;1 ,4)- ⁇ -D-glucan synthase is encoded by members of the CsIF gene family. Therefore, in a preferred embodiment, the (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid is a CsIF gene or a functional homolog thereof.
- the present invention provides a method for modulating the level and/or activity of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase in a cell, the method comprising modulating the expression of a CsIF gene or functional homolog thereof in the cell.
- CsIF gene or functional homolog thereof should be understood to include to a nucleic acid molecule which:
- (i) encodes a (1 ,3;1 ,4)- ⁇ -D-glucan synthase as defined herein; and (ii) preferably, comprises at least 50% nucleotide sequence identity to the nucleotide sequence set forth in any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33; and/or (iii) preferably, hybridises to a nucleic acid molecule comprising the nucleotide sequence set forth in any of SEQ ID NO: 1 , SEQ ID NO: 3,
- SEQ ID NO: 25 SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33 under stringent conditions.
- the CsIF gene functional homolog thereof comprises a nucleotide sequence which is at least 54% identical to any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33
- the CsIF gene or functional homolog thereof comprises a nucleotide sequence which is at least 70% identical to any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33 and most preferably the CsIF gene or functional homolog thereof comprises a nucleotide sequence which is at least 85% identical to any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ
- the CsIF gene or functional homolog thereof comprises the nucleotide sequence set forth in any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33.
- the compared nucleotide sequences should be compared over a comparison window of at least 300 nucleotide residues, more preferably at least 600 nucleotide residues, yet more preferably at least 1200 nucleotide residues, even more preferably at least 2400 nucleotide residues and most preferably over the full length of SEQ ID NO: 1.
- the comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences.
- Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19. 3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15,1998).
- the CsIF gene or functional homolog thereof may also comprise a nucleic acid, which hybridises to a nucleic acid molecule comprising the nucleotide sequence set forth in any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21 , SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33, under stringent conditions.
- stringent hybridisation conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least 30 c C. Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Stringent hybridisation conditions may be low stringency conditions, more preferably medium stringency conditions and most preferably high stringency conditions.
- Exemplary moderate stringency conditions include hybridisation in 40 to 45% formamide, 1.0 M NaCI, 1 % SDS at 37°C, and a wash in 0.5x to IxSSC at 55 to 60 0 C.
- Exemplary high stringency conditions include hybridisation in 50% formamide, 1 M NaCI, 1 % SDS at 37°C, and a wash in 0. IxSSC at 60 to 65°C.
- wash buffers may comprise about 0.1 % to about 1 % SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.
- the T m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T m is reduced by about 1 °C for each 1 % of mismatching; thus, T m , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of different degrees of complementarity. For example, sequences with >90% identity can be hybridised by decreasing the T m by about 10 0 C. Generally, stringent conditions are selected to be about 5°C lower than the thermal melting point (T m ) for the specific sequence and its complement at a defined ionic strength and pH.
- high stringency conditions can utilize a hybridization and/or wash at, for example, 1 , 2, 3, or 4 C C lower than the thermal melting point (T m ); medium stringency conditions can utilize a hybridization and/or wash at, for example, 6, 7, 8, 9, or 10 0 C lower than the thermal melting point (T m ); low stringency conditions can utilize a hybridization and/or wash at, for example, 11 , 12, 13, 14, 15, or 2O 0 C lower than the thermal melting point (T m ).
- T m thermal melting point
- the CsIF gene or functional homolog thereof may also comprise a genomic nucleotide sequence from an organism which may include one or more non- protein-coding regions or one or more intronic regions.
- Exemplary genomic nucleotide sequences which comprise a CsIF gene including the Hordeum vulgare genomic nucleotide sequences set forth in any of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18.
- the present invention provides methods for modulating the expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in a cell.
- the present invention contemplates any method by which the expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid molecule in a cell may be modulated.
- the term "modulating" with regard to the expression of the (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid is intended decreasing or increasing the transcription and/or translation of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid.
- incrementing is intended, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the transcription and/or translation of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid.
- increasing is intended, for example a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or greater increase in the transcription and/or translation of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid.
- Modulating also comprises introducing expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid not normally found in a particular cell; or the substantially complete inhibition (eg. knockout) of expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in a cell that normally has such activity.
- Methods for modulating the expression of a particular nucleic acid molecule in a cell are known in the art and the present invention contemplates any such method.
- Exemplary methods for modulating the expression of a (1 ,3;1 ,4)- ⁇ -D- glucan synthase encoding nucleic acid include: genetic modification of the cell to upregulate or downregulate endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase expression; genetic modification by transformation with a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid; administration of a nucleic acid molecule to the cell which modulates expression of an endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in the cell; and the like.
- the expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid is modulated by genetic modification of the cell.
- genetic modification should be understood to include any genetic modification that effects an alteration in the expression of a (1 ,3;1 ,4)- ⁇ - D-glucan synthase encoding nucleic acid in the genetically modified cell relative to a non-genetically modified form of the cell.
- Exemplary types of genetic modification contemplated herein include: random mutagenesis such as transposon, chemical, UV and phage mutagenesis together with selection of mutants which overexpress or underexpress an endogenous (1 ,3;1 ,4)- ⁇ -D- glucan synthase encoding nucleic acid; trasient or stable introduction of one or more nucleic acid molecules into a cell which direct the expression and/or overexpression of (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in the cell; inhibition of an endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase by site-directed mutagenesis of an endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid; introduction of one or more nucleic acid molecules which inhibit the expression of an endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid
- the nucleic acid may be introduced using any method known in the art which is suitable for the cell type being used, for example, those described in Sambrook and Russell (Molecular Cloning - A Laboratory Manual, 3 rd Ed., Cold Spring Harbor Laboratory Press, 2000).
- suitable methods for introduction of a nucleic acid molecule may include: Agrobacterium-med ⁇ a ⁇ ed transformation, microprojectile bombardment based transformation methods and direct DNA uptake based methods.
- Roa-Rodriguez et ah Agrobacterium-mediated transformation of plants, 3 rd Ed. GAMBIA Intellectual Property Resource, Canberra, Australia, 2003
- Microprojectile bombardment may also be used to transform plant tissue and methods for the transformation of plants, particularly cereal plants, and such methods are reviewed by Casas et a/. (Plant Breeding Rev.
- Direct DNA uptake transformation protocols such as protoplast transformation and electroporation are described in detail in Galbraith et al. (eds.), Methods in Cell Biology Vol. 50, Academic Press, San Diego, 1995).
- a range of other transformation protocols may also be used. These include infiltration, electroporation of cells and tissues, electroporation of embryos, microinjection, pollen-tube pathway, silicon carbide- and liposome mediated transformation. Methods such as these are reviewed by Rakoczy-Trojanowska (Ce//. MoI. Biol. Lett. 7: 849-858, 2002).
- a range of other plant transformation methods may also be evident to those of skill in the art.
- the introduced nucleic acid may be single stranded or double stranded.
- the nucleic acid may be transcribed into mRNA and translated into (1 ,3;1 ,4)- ⁇ -D- glucan synthase or another protein; may encode for a non-translated RNA such as an RNAi construct, cosuppression construct, antisense RNA, tRNA, miRNA, siRNA, ntRNA and the like; or may act directly in the cell.
- the introduced nucleic acid may be an unmodified DNA or RNA or a modified DNA or RNA which may include modifications to the nucleotide bases, sugar or phosphate backbones but which retain functional equivalency to a nucleic acid.
- the introduced nucleic acid may optionally be replicated in the cell; integrated into a chromosome or any extrachromosomal elements of the cell; and/or transcribed by the cell.
- the introduced nucleic acid may be either homologous or heterologous with respect to the host cell. That is, the introduced nucleic acid may be derived from a cell of the same species as the genetically modified cell (ie. homologous) or the introduced nucleic may be derived from a different species (ie. heterologous).
- the transgene may also be a synthetic transgene.
- the present invention contemplates increasing the level of (1 ,3;1 ,4)- ⁇ -D-glucan produced by a cell, by introducing a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid into the cell. More preferably, the (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid comprises a CsIF gene or functional homolog thereof.
- the present invention also provides methods for down-regulating expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in a cell.
- the identification of (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid sequences facilitates methods such as knockout or knockdown of an endogenous (1 ,3;1 ,4)- ⁇ -D- glucan synthase encoding nucleic acid in a cell using methods such as:
- PTGS post-transcriptional gene silencing
- RNAi of a (1 ,3;1 ,4)- ⁇ -D- glucan synthase encoding nucleic acid in a cell
- RNA directed against a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid for an example of dsRNA mediated gene silencing see
- RNA directed against a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid for an example of siRNA or hairpin RNA mediated gene silencing in plants see Lu ef a/., Nucl. Acids Res. 32(21): e171 ; doi:10.1093/nar/gnh170, 2004).
- the present invention also facilitates the downregulation of a (1 ,3;1 ,4)- ⁇ -D- glucan synthase encoding nucleic acid in a cell via the use of synthetic oligonucleotides such as siRNAs or microRNAs directed against a (1 ,3;1 ,4)- ⁇ -D- glucan synthase encoding nucleic acid which are administered to a cell (for examples of synthetic siRNA mediated silencing see Caplen et al., Proc. Natl. Acad. Sci. USA 98: 9742-9747, 2001 ; Elbashir et al., Genes Dev.
- the introduced nucleic acid may also comprise a nucleotide sequence which is not directly related to a (1 ,3;1 ,4)- ⁇ -D- glucan synthase sequence but, nonetheless, may directly or indirectly modulate the expression of (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid in a cell.
- Examples include nucleic acid molecules that encode transcription factors or other proteins which promote or suppress the expression of an endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid molecule in a cell; and other non-translated RNAs which directly or indirectly promote or suppress endogenous (1 ,3;1 ,4)- ⁇ -D-glucan synthase expression and the like.
- control sequences should be understood to include all components known in the art, which are necessary or advantageous for the transcription, translation and or post- translational modification of the operably connected nucleic acid or the transcript or protein encoded thereby. Each control sequence may be native or foreign to the operably connected nucleic acid.
- the control sequences may include, but are not limited to, a leader, polyadenylation sequence, propeptide sequence, promoter, enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator.
- a control sequence at least includes a promoter.
- promoter describes any nucleic acid which confers, activates or enhances expression of a nucleic acid molecule in a cell. Promoters are generally positioned 5' (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations, it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, ie. the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function.
- the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, ie. the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur.
- a promoter may regulate the expression of an operably connected nucleotide sequence constitutively, or differentially with respect to the cell, tissue, organ or developmental stage at which expression occurs, in response to external stimuli such as physiological stresses, pathogens, or metal ions, amongst others, or in response to one or more transcriptional activators.
- the promoter used in accordance with the methods of the present invention may include a constitutive promoter, an inducible promoter, a tissue-specific promoter or an activatable promoter.
- the present invention contemplates the use of any promoter which is active in a cell of interest.
- any promoter which is active in any of bacteria, fungi, animal cells or plant cells would be readily ascertained by one of ordinary skill in the art.
- plant cells are used. Therefore, plant-active constitutive, inducible, tissue-specific or activatable promoters are particularly preferred.
- Plant constitutive promoters typically direct expression in nearly all tissues of a plant and are largely independent of environmental and developmental factors.
- Examples of constitutive promoters that may be used in accordance with the present invention include plant viral derived promoters such as the Cauliflower Mosaic Virus 35S and 19S (CaMV 35S and CaMV 19S) promoters; bacterial plant pathogen derived promoters such as opine promoters derived from Agrobacte ⁇ um spp., eg.
- the /Agrabacfem/m-derived nopaline synthase ⁇ nos) promoter and plant-derived promoters such as the rubisco small subunit gene ⁇ rbcS) promoter, the plant ubiquitin promoter (Pubi) and the rice actin promoter (Pact).
- plant-derived promoters such as the rubisco small subunit gene ⁇ rbcS) promoter, the plant ubiquitin promoter (Pubi) and the rice actin promoter (Pact).
- “Inducible” promoters include, but are not limited to, chemically inducible promoters and physically inducible promoters.
- Chemically inducible promoters include promoters which have activity that is regulated by chemical compounds such as alcohols, antibiotics, steroids, metal ions or other compounds. Examples of chemically inducible promoters include: alcohol regulated promoters (eg. see European Patent 637 339); tetracycline regulated promoters (eg. see US Patent 5,851 ,796 and US Patent 5,464,758); steroid responsive promoters such as glucocorticoid receptor promoters (eg. see US Patent 5,512,483), estrogen receptor promoters (eg.
- the inducible promoter may also be a physically regulated promoter which is regulated by non-chemical environmental factors such as temperature (both heat and cold), light and the like.
- physically regulated promoters include heat shock promoters (eg. see US Patent 5,447858, Australian Patent 732872, Canadian Patent Application 1324097); cold inducible promoters (eg. see US Patent 6,479,260, US Patent 6,084,08, US Patent 6,184,443 and US Patent 5,847,102); light inducible promoters (eg. see US Patent 5,750,385 and Canadian Patent 132 1563); light repressible promoters (eg. see New Zealand Patent 508103 and US Patent 5,639,952).
- heat shock promoters eg. see US Patent 5,447858, Australian Patent 732872, Canadian Patent Application 1324097
- cold inducible promoters eg. see US Patent 6,479,260, US Patent 6,084,08, US Patent 6,184,443 and US Patent 5,847,102
- tissue specific promoters include promoters which are preferentially or specifically expressed in one or more specific cells, tissues or organs in an organism and/or one or more developmental stages of the organism. It should be understood that a tissue specific promoter may be either constitutive or inducible.
- plant tissue specific promoters include: root specific promoters such as those described in US Patent Application 2001047525; fruit specific promoters including ovary specific and receptacle tissue specific promoters such as those described in European Patent 316 441 , US Patent 5,753,475 and European Patent Application 973 922; and seed specific promoters such as those described in Australian Patent 612326 and European Patent application 0 781 849 and Australian Patent 746032.
- the tissue specific promoter is a seed and/or grain specific promoter.
- Exemplary seed or grain specific promoters include puroindoline-b gene promoters (for example see Digeon et al., Plant MoI. Biol. 39: 1101-1112, 1999); Pbf gene promoters (for example see Mena et ah, Plant J. 16: 53-62, 1998); GSi. ⁇ gene promoters (for example see Muhitch et al., Plant ScL 163: 865-872, 2002); glutelin Gt1 gene promoters (for example see Okita et al., J. Biol. Chem.
- Chi26 gene promoters for example see Leah et al., Plant J. 6: 579-589, 1994
- GIu- D1-1 gene promoters for example see Lamacchia et al., J. Exp. Bot. 52: 243- 250, 2001 ; Zhang et al., Theor. Appl. Genet. 106: 1139-1146, 2003
- Hor3-1 gene promoters for example see Sorensen et al., MoI. Gen. Genet. 250: 750- 760, 1996; Horvath et al., Proc. Natl. Acad.
- the seed specific promoter is an endosperm specific promoter.
- the promoter may also be a promoter that is activatable by one or more transcriptional activators, referred to herein as an "activatable promoter".
- the activatable promoter may comprise a minimal promoter operably connected to an Upstream Activating Sequence (UAS), which comprises, inter alia, a DNA binding site for one or more transcriptional activators.
- UAS Upstream Activating Sequence
- the term "minimal promoter” should be understood to include any promoter that incorporates at least an RNA polymerase binding site and, preferably a TATA box and transcription initiation site and/or one or more CAAT boxes. More preferably, when the cell is a plant cell, the minimal promoter may be derived from the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter.
- CaMV 35S Cauliflower Mosaic Virus 35S
- the CaMV 35S derived minimal promoter may comprise a sequence that corresponds to positions -90 to +1 (the transcription initiation site) of the CaMV 35S promoter (also referred to as a -90 CaMV 35S minimal promoter), -60 to +1 of the CaMV 35S promoter (also referred to as a -60 CaMV 35S minimal promoter) or -45 to +1 of the CaMV 35S promoter (also referred to as a -45 CaMV 35S minimal promoter).
- the activatable promoter may comprise a minimal promoter fused to an Upstream Activating Sequence (UAS).
- UAS Upstream Activating Sequence
- the UAS may be any sequence that can bind a transcriptional activator to activate the minimal promoter.
- Exemplary transcriptional activators include, for example: yeast derived transcription activators such as Gal4, Pdr ⁇ , Gcn4 and Ace1 ; the viral derived transcription activator, VP16; Hap1 (Hach et a/., J Biol Chem 278: 248- 254, 2000); Gaf1 (Hoe et al., Gene 215(2): 319-328, 1998); E2F (Albani et al., J Biol Chem 275: 19258-19267, 2000); HAND2 (Dai and Cserjesi, J Biol Chem 277: 12604-12612, 2002); NRF-1 and EWG (Herzig et a/., J Cell Sc/ 113: 4263
- the UAS comprises a nucleotide sequence that is able to bind to at least the DNA-binding domain of the GAL4 transcriptional activator.
- UAS sequences which can bind transcriptional activators that comprise at least the GAL4 DNA binding domain, are referred to herein as UASQ.
- the UAS G comprises the sequence 5'-CGGAGTACTGTCCTCCGAG-3' or a functional homolog thereof.
- a "functional homolog" of the UAS G sequence should be understood to refer to any nucleotide sequence which can bind at least the GAL4 DNA binding domain and which preferably comprises a nucleotide sequence having at least 50% identity, more preferably at least 65% identity, even more preferably at least 80% identity and most preferably at least 90% identity with the UAS G nucleotide sequence.
- the UAS sequence in the activatable promoter may comprise a plurality of tandem repeats of a DNA binding domain target sequence.
- UAS G comprises four tandem repeats of the DNA binding domain target sequence.
- the term "plurality" as used herein with regard to the number of tandem repeats of a DNA binding domain target sequence should be understood to include at least 2 tandem repeats, more preferably at least 3 tandem repeats and even more preferably at least 4 tandem repeats.
- control sequences may also include a terminator.
- terminator refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3'-non-translated DNA sequences generally containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'-end of a primary transcript.
- the terminator may be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used.
- Suitable terminator sequences which may be useful in plant cells include: the nopaline synthase (nos) terminator, the CaMV 35S terminator, the octopine synthase (ocs) terminator, potato proteinase inhibitor gene (pin) terminators, such as the pinll and pinlll terminators and the like.
- the method of the present invention for modulating the level of (1,3;1 ,4)- ⁇ -D-glucan in a cell by modulating the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in the cell, has several industrial applications.
- (1 ,3;1 ,4)- ⁇ -D-glucans are known to form viscous solutions.
- the viscosity-generating properties of soluble cereal (1 ,3;1 ,4)- ⁇ -D-glucans are critical determinants in many aspects of cereal processing.
- incompletely degraded (1 ,3;1 ,4)- ⁇ -D-glucans from malted barley and cereal adjuncts can contribute to wort and beer viscosity and are associated with problems in wort separation and beer filtration (eg. see Bamforth, Brew. Dig.
- the present invention may be applied to reduce the level of (1 ,3;1 ,4)- ⁇ -D-glucan in barley grain, by reducing the level and/or activity of (1 ,3;1 ,4)- ⁇ -D-glucan synthase in one or more cells of the barley grain, to increase its suitability for beer production.
- Soluble cereal (1 ,3;1 ,4)- ⁇ -D-glucans are also considered to have antinutritive effects in monogastric animals such as pigs and poultry.
- the "antinutritive" effects have been attributed to the increased viscosity of gut contents, which slows both the diffusion of digestive enzymes and the absorption of degradative products of enzyme action. This, in turn, leads to slower growth rates.
- high (1 ,3;1 ,4)- ⁇ -D-glucan concentrations are associated with 'sticky' faeces, which are indicative of the poor digestibility of the (1 ,3;1 ,4)- ⁇ -D-glucans and which may present major handling and hygiene problems for producers. Therefore, in another embodiment, the present invention may be applied to reducing the level of (1 ,3;1 ,4)- ⁇ -D-glucan in one or more cells of a plant used for animal feed, to improve the suitability of the plant as animal feed.
- cereal (1 ,3;1 ,4)- ⁇ -D-glucans are important components of dietary fibre in human and animal diets.
- dietary fibre should be understood to include the edible parts of plants or analogous carbohydrates that are resistant to digestion and absorption in the human small intestine with complete or partial fermentation in the large intestine.
- Dietary fibre includes polysaccharides (specifically including (1 ,3;1 ,4)- ⁇ -D-glucans), oligosaccharides, lignin and associated plant substances.
- dietary fibres promote beneficial physiological effects including general bowel health, laxation, blood cholesterol attenuation, and/or blood glucose attenuation.
- the present invention may be applied to increasing the dietary fibre content of an edible plant or edible plant part, by increasing the level of (1 ,3;1 ,4)- ⁇ -D-glucan in the plant, or part therof.
- the edible plant or edible part of a plant is a cereal crop plant or part thereof.
- (1 ,3;1 ,4)- ⁇ -D-glucans in common with a number of other polysaccharides, in particular (1-»3)- ⁇ -D-glucans, are also thought to modify immunological responses in humans by a process that is mediated through binding to receptors on cells of the reticuloendothelial system (leucocytes and macrophages). In addition, they may have the capacity to activate the proteins of the human complement pathway, a system that is invoked as a first line of defence before circulating antibodies are produced.
- the method of the first aspect of the present invention also facilitates the production of (1 ,3;1 ,4)- ⁇ -D-glucan in a recombinant expression system.
- a (1 ,3;1 ,4)- ⁇ -D-glucan may be recombinantly produced by introducing a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleotide sequence as described herein, under the control of a promoter, into a cell, wherein the celi subsequently expresses the (1 ,3;1 ,4)- ⁇ -D-glucan synthase and produces (1 ,3;1 ,4)- ⁇ -D-glucan.
- recombinant expression systems that may be used to express a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid are known in the art.
- Exemplary recombinant expression systems include: bacterial expression systems such as E. coli expression systems (reviewed in Baneyx, Curr. Opin. Biotechnol. 10: 411-421 , 1999; eg. see also Gene expression in recombinant microorganisms, Smith (Ed.), Marcel Dekker, Inc. New York, 1994; and Protein Expression Technologies: Current Status and Future Trends, Baneyx (Ed.), Chapters 2 and 3, Horizon Bioscience, Norwich, UK, 2004), Bacillus spp. expression systems (eg.
- Chinese Hamster Ovary (CHO) cell based expression systems eg. see Protein Expression Technologies: Current Status and Future Trends, supra, chapter 9
- insect cell cultures including baculovirus expression systems (eg. see Protein Expression Technologies: Current Status and Future Trends, supra, chapter 8; Kost and Condreay, Curr. Opin. Biotechnol.
- the present invention provides a method for producing (1 ,3;1 ,4)- ⁇ -D-glucan, the method comprising expressing a (1 ,3;1 ,4)- ⁇ - D-glucan synthase encoding nucleic acid in a cell.
- the cell is a cell from a recombinant expression system as hereinbefore defined.
- the (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid is a CsIF gene or functional homolog thereof.
- the present invention also provides (1 ,3;1 ,4)- ⁇ -D-glucan produced according to the method of the fourth aspect of the invention.
- the present invention also provides a cell comprising any one or more of:
- the cell of the sixth aspect of the invention is produced according to the methods of the first, second or third aspects of the present invention as described herein.
- the cell is a plant cell, more preferably a monocot plant cell and most preferably a cereal crop plant cell.
- the present invention provides a multicellular structure comprising one or more cells according to the sixth aspect of the invention.
- a "multicellular structure” includes any aggregation of one or more cells. As such, a multicellular structure specifically encompasses tissues, organs, whole organisms and parts thereof. Furthermore, a multicellular structure should also be understood to encompass multicellular aggregations of cultured cells such as colonies, plant calli, suspension cultures and the like.
- the cell is a plant cell and as such, the present invention includes a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue, comprising one or more plant cells according to the sixth aspect of the invention.
- the present invention provides a cereal plant comprising one or more cells according to the sixth aspect of the invention.
- the present invention provides cereal grain comprising one or more cells according to the sixth aspect of the invention.
- the present invention provides a cereal grain comprising an altered level of (1 ,3;1 ,4)- ⁇ -D-glucan, wherein the grain comprises one or more cells comprising an altered level and/or activity of (1 ,3;1 ,4)- ⁇ -D- glucan synthase and/or altered expression of a (1 ,3;1 ,4)- ⁇ -D-glucan synthase encoding nucleic acid molecule.
- the grain of the eighth aspect of the invention may have an increased level of (1 ,3;1 ,4)- ⁇ -D-glucan compared to wild type grain from the same species.
- the grain may have a decreased level of (1 ,3;1 ,4)- ⁇ -D-glucan compared to wild type grain from the same species.
- the present invention also provides flour comprising:
- the flour produced by the milling of the grain of the eighth aspect of the invention may comprise, for example approximately 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% by weight of the flour of the ninth aspect of the invention.
- milling contemplates any method known in the art for milling grain, such as those described by Brennan et al. (Manual of Flour and Husk Milling, Brennan et al. (Eds.), AgriMedia, ISBN: 3-86037-277-7).
- the flour produced by the milling of the grain of the eighth aspect of the invention used in the flour of the ninth aspect of the invention comprises an increased level of (1 ,3;1 ,4)- ⁇ -D-giucan compared to wild type flour.
- the "flour produced by the milling of one or more other grains” may be flour produced by milling grain derived from any cereal plant, as hereinbefore defined.
- This component of the flour of the eighth aspect of the invention may, for example, comprise 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% by weight.
- the flour produced by the milling of one or more other grains is a wheat flour and, therefore, the flour of the ninth aspect of the invention may be suitable for producing bread, cakes, biscuits and the like.
- the present invention is predicated, in part, on the identification and isolation of nucleotide and amino acid sequences that encode (1 ,3;1 ,4)- ⁇ -D-glucan synthases.
- the present invention provides an isolated nucleic acid molecule that encodes a (1 ,3;1,4)- ⁇ -D-glucan synthase.
- isolated refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered “by the hand of man” from its natural state.
- an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be “isolated” because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide.
- An “isolated” nucleic acid molecuie should also be understood to include a synthetic nucleic acid molecule, including those produced by chemical synthesis using known methods in the art or by in-vitro amplification (eg. polymerase chain reaction and the like).
- the isolated nucleic acid molecules of the present invention may be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA.
- the isolated nucleic acid molecules of the invention can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single- stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions.
- the isolated nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA.
- the isolated nucleic acid molecules may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons.
- “Modified” bases include, for example, tritylated bases and unusual bases such as inosine.
- polynucleotide embraces chemically, enzymatically, or metabolically modified forms.
- the present invention also provides an isolated nucleic acid molecule comprising one or more of:
- SEQ ID NO: 3 SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 ;
- nucleotide sequence which is at least 50% identical to the nucleotide sequence set forth in any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 ;
- nucleotide sequence which hybridises to a nucleic acid molecule comprising the nucleotide sequence set forth in any of SEQ ID NO: 1 , SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 under low stringency, more preferably medium stringency and most preferably high stringency conditions;
- the term "at least 50% identical” should be understood to also include nucleotide sequence percentage identities greater than 50%.
- the term “at least 50% identical” preferably encompasses at least 60% identity, at least 70% identity, at least 80% identity, at least 90% identity and at least 95% identity.
- the isolated nucleic acid molecule or fragment thereof comprises a nucleotide sequence encoding a (1 ,3;1 ,4)- ⁇ -D-glucan synthase, as herein before defined.
- the isolated nucleic acid molecule comprises a nucleotide sequence defining a CsIF gene, or functional homolog thereof, as hereinbefore defined.
- the eleventh aspect of the invention provides fragments of a nucleotide sequence.
- “Fragments" of a nucleotide sequence should be at least 15 nucleotides (nt), and more preferably at least 20 nt, still more preferably at least 30 nt, and even more preferably, at least 40, 50, 100, 150, 200, 250, 300, 325, 350, 375, 400, 450, 500, 550, or 600 nt in length.
- These fragments have numerous uses that include, but are not limited to, diagnostic probes and primers.
- fragments such as those of 601-3000 nt in length are aiso useful according to the present invention as are fragments corresponding to most, if not all, of the nucleotide sequences SEQ ID NO: 1.
- fragments at least 20 nt in length for example, is intended fragments which include 20 or more contiguous bases from, for example, the nucleotide sequence of SEQ ID NO: 1.
- the polynucleotide fragments of the invention encode a polypeptide, having (1 ,3;1 ,4)- ⁇ -D-glucan synthase functional activity as defined herein.
- Polypeptides or proteins encoded by these polynucleotides are also encompassed by the invention.
- the present invention provides a genetic construct or vector comprising an isolated nucleic acid molecule of the eleventh aspect of the invention.
- the vector or construct of the twelfth aspect of the invention preferably further comprises one or more of: an origin of replication for one or more hosts; a selectable marker gene which is active in one or more hosts; or one or more control sequences which enable transcription of the isolated nucleic acid molecule in a cell.
- selectable marker gene includes any gene that confers a phenotype on a cell, in which it is expressed, to facilitate the identification and/or selection of cells which are transfected or transformed with a genetic construct of the invention.
- Selectable marker genes include any nucleotide sequences which, when expressed by a cell, confer a phenotype on the cell that facilitates the identification and/or selection of these transformed cells.
- a range of nucleotide sequences encoding suitable selectable markers are known in the art.
- Exemplary nucleotide sequences that encode selectable markers include: antibiotic resistance genes such as ampicillin-resistance genes, tetracycline- resistance genes, kanamycin-resistance genes, the AURI-C gene which confers resistance to the antibiotic aureobasidin A, neomycin phosphotransferase genes (eg. nptl and nptll) and hygromycin phosphotransferase genes (eg.
- herbicide resistance genes including glufosinate, phosphinothricin or bialaphos resistance genes such as phosphinothricin acetyl transferase encoding genes (eg. bar), glyphosate resistance genes including 3-enoyl pyruvyl shikimate 5- phosphate synthase encoding genes (eg. aroA), bromyxnil resistance genes including bromyxnil nitrilase encoding genes, sulfonamide resistance genes including dihydropterate synthase encoding genes (eg.
- sul and sulfonylurea resistance genes including acetolactate synthase encoding genes; enzyme- encoding reporter genes such as GUS and chloramphenicolacetyltransferase (CAT) encoding genes; fluorescent reporter genes such as the green fluorescent protein-encoding gene; and luminescence-based reporter genes such as the luciferase gene, amongst others.
- enzyme- encoding reporter genes such as GUS and chloramphenicolacetyltransferase (CAT) encoding genes
- fluorescent reporter genes such as the green fluorescent protein-encoding gene
- luminescence-based reporter genes such as the luciferase gene, amongst others.
- the selectable marker gene may be a distinct open reading frame in the construct or may be expressed as a fusion protein with the (1 ,3;1 ,4)- ⁇ -D-glucan synthase protein.
- the twelfth aspect of the invention extends to all genetic constructs essentially as described herein, which include further nucleotide sequences intended for the maintenance and/or replication of the genetic construct in prokaryotes or eukaryotes and/or the integration of the genetic construct or a part thereof into the genome of a eukaryotic or prokaryotic cell.
- the construct of the twelfth aspect of the invention is adapted to be at least partially transferred into a plant cell via Agrobacterium- mediated transformation.
- the construct according to the twelfth aspect of the invention comprises left and/or right T-DNA border sequences. Suitable T-DNA border sequences would be readily ascertained by one of skill in the art.
- the term "T-DNA border sequences" should be understood to encompass any substantially homologous and substantially directly repeated nucleotide sequences that delimit a nucleic acid molecule that is transferred from an Agrobactehum sp. cell into a plant cell susceptible to Agrobacte ⁇ um- mediated transformation.
- the construct of the twelfth aspect of the invention is adapted to be transferred into a plant via Agrobactehum-me ⁇ laXe ⁇ transformation
- the present invention also contemplates any suitable modifications to the genetic construct which facilitate bacterial mediated insertion into a plant cell via bacteria other than Agrobacterium sp., as described in Broothaerts et al. (Nature 433: 629-633, 2005).
- the present invention provides a cell comprising the isolated nucleic acid molecule of the tenth or eleventh aspects of the invention or genetic construct of the twelfth aspect of the invention.
- the isolated nucleic acid molecule of the tenth or eleventh aspects of the invention or genetic construct of the twelfth aspect of the invention may be introduced into a cell via any means known in the art.
- the isolated nucleic acid molecule or construct referred to above may be maintained in the cell as a DNA molecule, as part of an episome (eg. a plasmid, cosmid, artificial chromosome or the like) or it may be integrated into the genomic DNA of the cell.
- an episome eg. a plasmid, cosmid, artificial chromosome or the like
- genomic DNA should be understood in it's broadest context to include any and all DNA that makes up the genetic complement of a cell.
- genomic DNA of a cell should be understood to include chromosomes, mitochondrial DNA, plastic! DNA, chloroplast DNA, endogenous plasmid DNA and the like.
- genetically integrated contemplates chromosomal integration, mitochondrial DNA integration, plastid DNA integration, chloroplast DNA integration, endogenous plasmid integration, and the like.
- the isolated nucleic acid molecule is operabiy connected to, inter alia, a promoter such that the cell may express the isolated nucleic acid molecule.
- the cell of the thirteenth aspect of the invention may be any prokaryotic or eukaryotic cell.
- the cell may be a prokaryotic cell such as a bacterial cell including an E. coli cell or an Agrobacterium spp. cell, or an archaea cell.
- the cell may also be a eukaryotic cell including a fungal cell such as a yeast cell or mycelial fungus cell; an animal cell such as a mammalian cell or an insect cell; or a plant cell.
- the cell is a plant cell.
- the plant cell is a monocot plant cell.
- the plant cell is a cereal plant cell.
- the present invention provides a multicellular structure, as hereinbefore defined, comprising one or more of the cells of the thirteenth aspect of the invention.
- the cell is a plant cell and as such, the present invention should be understood to specifically include a whole plant, plant tissue, plant organ, plant part, plant reproductive material, or cultured plant tissue, comprising one or more cells of the thirteenth aspect of the invention.
- the present invention provides a cereal plant or part thereof, comprising one or more cells of the thirteenth aspect of the invention.
- the fourteenth aspect of the invention provides cereal grain comprising one or more cells of the thirteenth aspect of the invention.
- the present invention also provides amino acid sequences for (1 ,3;1 ,4)- ⁇ -D-glucan synthases.
- the present invention provides an isolated polypeptide comprising an amino acid sequence encoding a (1 ,3;1 ,4)- ⁇ -D- glucan synthase protein. Accordingly, the present invention provides an isolated (1 ,3;1 ,4)- ⁇ -D-glucan synthase protein.
- polypeptide should be understood to include any length polymer of amino acids. As such the term “polypeptide” should be understood to encompass peptides, polypeptides and proteins.
- the present invention provides an isolated polypeptide comprising one or more of: (i) the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: S, SEQ ID NO: 10 and SEQ ID NO: 12; (ii) an amino acid sequence comprising at least 50% identity to the amino acid sequence set forth in any of SEQ ID NO; 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO- 10 and SEQ ID NO: 12;
- the term "at least 50% Identical” should be understood to also Include percentage amino acid sequence identities greater than 50%.
- the term “al least 50% identical” preferably encompasses at least 60% identity, at least 70% identity, at least 80% identity, at least 90% identity and at least 95% identity.
- the isolated polypeptide of the present invention comprises an amino acid sequence defining a "(1 ,3;1,4)- ⁇ -D-glucan synthase" as hereinbefore defined.
- the isolated polypeptides of the sixteenth aspect may be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, ie., peptide isosteres, and may contain amino acids other than the 20 gene- encoded amino acids
- the isolated polypeptides of the present invention may be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art. Such modifications are well described in basic texts and in more detailed monographs, as well as in the literature. Modifications can occur anywhere in the isolated polypeptide, including the peptide backbone, the amino acid side-chains and/or the termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites In a given isolated polypeptide. Also, an isolated polypeptide of the present invention may contain many types of modifications.
- the proteins may be branched, for example, as a result of ubiquitination, and/or they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods.
- Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, govalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross- llnklng, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylatlon, iodination, methylation, myristoylation, oxidation, PEGylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylatfon, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquit
- the sixteenth aspect of the invention also provides fragments of isolated polypeptides.
- Polypeptide fragments may be "free-standing/' or comprised within a larger polypeptide of which the fragment forms a part or region, most preferably as a single continuous region.
- the protein fragments can be at least 3, 4, 5, 6, 8, 9, 10, 11 , 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 110, 120, 130, 140, or 150 amino acids in length.
- the fragment comprises an amino acid sequence which is a part of the sequence set forth in SEQ ID NO: 2,
- the fragment comprises (1 ,3;1,4) ⁇ -D-glucan synthase functional activity,
- the fragments may lack (1,3;1,4)- ⁇ -D-glucan synthase functional activity but retain the ability to induce and/or bind to antibodies which recognize the complete or mature forms of an isolated (1 ,3;1 ,4)- ⁇ -D-glucan synthase protein.
- a peptide, polypeptide or protein fragment which has the ability to Induce and/or bind to antibodies which recognize the complete or mature forms of the isolated (1 ,3;1 ,4)- ⁇ -D-glucan synthase protein is referred to herein as a "(1 ,3;1,4)- ⁇ -D-glucan synthase epitope".
- a (1 ,3;1 ,4)- ⁇ -D-glucan synthase epitope may comprise as few as three or four amino acid residues, preferably at least 5 amino acids and more preferably at least 10 amino acid residues. Whether a particular epitope of an isolated (1 ,3;1,4 ⁇ . ⁇ -D-gIucan synthase protein retains such immunologic activities can readily be determined by methods known in the art. As such, one preferred (1 ,3;1 ,4 ⁇ - ⁇ -D-glucan synthase protein fragment is a polypeptide comprising one or more (1 ,3;1 ,4) ⁇ -D -glucan synthase epitopes.
- a polypeptide comprising one or more (1 ,3;1 ,4)- ⁇ -D-glucan synthase epitopes may be produced by any conventional means for making polypeptides including synthetic and recombinant methods known in the art.
- (1,3;1 ,4)- ⁇ -D-glucan synthase epitope-bearing polypeptides may be synthesized using known methods of chemical synthesis. For instance, Houghten has described a simple method for the synthesis of large numbers of peptides (Houghten, Proc. Natl. Acad. Sci. USA 82: 5131-5135, 1985).
- the isolated polypeptides and (1 ,3;1 ,4)- ⁇ -D-glucan synthase eprtope-bearing polypeptides of the sixteenth aspect of the invention are useful, for example, in the generation of antibodies that bind to the isolated (1,3;1.4)- ⁇ -D-glucan synthase proteins of the invention.
- Such antibodies are useful, inter alia, in the detection and localization of (1 ,3;1 ,4)- ⁇ -D-glucan synthase proteins and in affinity purification of (1 ,3;1,4)- ⁇ -o- giucan synthase proteins.
- the antibodies may also routinely be used in a variety of qualitative or quantitative immunoassays using methods known in the art. For example see Harlow et al., Ant ibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press 2 nd Ed., 1988).
- the present invention provides an antibody or an epitope binding fragment thereof, raised against an isolated (1 ,3;1 ,4)- ⁇ -D-glucan synthase protein as hereinbefore defined or an epitope thereof.
- the antibodies of the present invention include, but are not limited to, polyclonal, monoclonal, multispecrflc, chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library and epitope-binding fragments of any of the above.
- antibody refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen-binding site that immunospecifically binds an antigen.
- the immunoglobulin molecules of the invention can be of any type (e.g., lgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGI , lgG2, lg G3, IgG4, IgAI and lgA2) or subclass of immunoglobulin molecule.
- the antibodies of the present invention may be monospecific, bispeolfic, Irispedfic, or of greater muitispecificity.
- Multispec ⁇ fic antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material,
- a heterologous epitope such as a heterologous polypeptide or solid support material
- the antibodies of the present invention may act as agonists or antagonists of (1,3;1 ,4)- ⁇ -D-gIucan synthase.
- the antibodies of the present invention may be used, for example, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods.
- the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of (1 r 3;1 ,4)- ⁇ -D-glucan synthase in biological samples. See, e.g., Harlow et a/., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).
- antibody should be understood to encompass derivatives that are modified, eg. by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from binding to (1 ,3;1 ,4)- ⁇ -D-glucan synthase or an epitope thereof
- the antibody derivatives include antibodies that have been modified, eg., by glycosylatlon, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc.
- any of numerous chemical modifications may also be made using known techniques.
- the derivative may oontain one or more non-classical amino acids.
- Antibodies may be generated using methods known in the art, such as in vivo immunization, in vitro immunization, and phage display methods. For example, see BittIe ef al (J. Gen. Virol, 66: 2347-2354, 1955).
- animals may be immunized with free peptide; however, anti-pept ⁇ de antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid.
- KLH keyhole limpet hemacyanin
- peptides containing cysteine residues may be coupled to a carrier using a. linker such as maleimidobenzoyl-N- hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde.
- Animals such as rabbits, rats and mice are immunized with either free or carrier- coupled poptidcs, for instance, by intraperitoneal and/or intradermal injection of emulsions containing about 100 micrograms of peptide or carrier protein and Freund's adjuvant.
- emulsions containing about 100 micrograms of peptide or carrier protein and Freund's adjuvant.
- booster injections may be needed, for example, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELtSA assay using free peptide adsorbed to a solid surface.
- the titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known in the art.
- polyclonal antibodies to a (1,3;1 ,4)- ⁇ -D-glucan synthase protein or a polypeptide comprising one or more (1,3;1 ,4)- ⁇ -D-glucan synthase epitopes can be produced by various procedures well known in the art.
- a polypeptide of the invention can be administered to various host animals Including, but not limited to, rabbits, mice, rats, etc. to induce the production of sera containing polyclonal antibodies specific for the antigen.
- adjuvants may be used to Increase the immunological response, depending on the host species, for example, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, ail emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parv ⁇ m.
- BCG Bacille Calmette-Guerin
- Corynebacterium parv ⁇ m Such adjuvants are also well known in the art.
- monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof.
- monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed , 1988) and Hammeriing et a/., in: Monoclonal Antibodies and T-Cell Hybridomas (Elsevier, NY, 1981).
- the term “monoclonal antibody” as used herein is not limited to antibodies produced through hybridoma technology.
- the term “monoclonal antibody” refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.
- mice can be immunized with a polypeptide of the invention or a cell expressing such peptide.
- an lmrnune response Is detected e.g., antibodies specific for the antigen are detected in the mouse serum
- the mouse spleen is harvested and splenocytes Isolated,
- the splenocytes are then fused by well-known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC.
- Hybridomas are selected and cloned by limited dilution.
- hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention.
- Ascites fluid which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.
- Antibody fragments which recognize one or more (1 ,3;1,4)- ⁇ -D-glucan synthase epitopes may also be generated by known techniques.
- Fab and F(ab r )2 fragments may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments).
- F(ab')2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain.
- the antibodies of the present invention can also be generated using various phage display methods known in the art, in phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them.
- phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g , human or murine).
- Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead.
- Phages used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.
- phage display methods that can be used to make the antibodies of the present invention include those disclosed by Br ⁇ nkman ef al. (J. Immunol. Methods 182: 41-50, 1995), Ames et al. (J. Immunol Methods 184: 177-186, 1995), Kettleborough et al, (Eur. J. Immunol. 24: 952-958, 1994), Persic et si.
- the antibody coding regions from the phage can be isolated and used to generate whole antibodies or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria.
- techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et a/. (BioTechniq ⁇ es 12(6): 864-869, 1992); and Sawai et a/. (A JRI 34:26-34, 199S); and Better et a/. (Science 240: 1041-1043, 1988).
- Quantitative trait loci mapping and comparatives genomics has been used to Identify genes involved in cell wall biosynthesis in maize (Zea mays). Because of the central role played by (1,3;1,4)- ⁇ -D-glucans in malting and brewing quality, QTL analyses of grain (1,3;1,4)- ⁇ -D-glucan content are available. As shown in Figure 1 , the QTU that has the largest effect on grain (1,3;1 ,4)- ⁇ -D-glucan content was located an barley chromosome 2H, between the AdhB and ABG019 markers.
- a syntenous region was located on chromosome 7 of rice, where a cluster of six cellulose synthase-like (Csf) genes was detected within an interval of 119 Kb, corresponding to the 21.59-21.72 Mb region of the chromosome (Fig. 1).
- Csf cellulose synthase-like
- OsCsFI SEQ ID NO: 19
- OsCslF2 SEQ ID NO: 21
- QsCslF3 SEQ ID NlO: 23
- OsCslF4 SEQ ID NO: 25
- OsCsIF8 SEQ ID NO: 31
- OsCsfF9 SEQ ID NO: 33.
- Other known genes in this interval of rice chromosome 7 include truncated OsCsIF genes that might represent pseudogenes.
- OsCSslF5 SEQ ID NO: 27
- OsCslF7 SEQ ID NO: 29
- the comparative genomics approach enabled the identification of the CsIF group of genes as potential candidate genes for (1,3;1 ,4)- ⁇ -D-glucan synthases in cereals. It is noteworthy that the CsIF group of Ce/ genes is only found in monocotyledons, which is consistent wfth the exclusive occurrence of (1 ,3)1 ,4)- ⁇ -D-glucans In cell walls of the Poales.
- Tissues were collected from mature rice plants (Oryzae sativa cv Nippon Bare) grown at 28oC day and 22oC night temperatures under high humidity, a photointensity of 300umol/m/s and an 11/13 hour day/night regime. Material was also collected from five day-old seedlings germinated at 28oC in the dark on damp filter paper in Petri dishes.
- DNA sequences for the markers under the QTLs for barley (1 ,3;1,4 ⁇ - ⁇ -D-g!ucan were obtained from the GrainGenes database (http://wheatpvv.usda.gov). Additional markers from within the corresponding chromosomal locations on the Barley-Consensus2 (Qi et a/., Genome 39: 379-394, 1996) and Barley- Consensus2003 (Karakousis et a/., Australian Journal of Agricultural Research 54: 1173-1185, 2003) maps were also included in the investigation.
- the syntenic chromosomal location(s) for the markers on the rice genome were determined by BLASTN analyses at the GRAMENE website (http://www,gramene.org). Syntenic regions were examined for gene annotations of enzymes encoding for synthesis of cell wall polysaccharides, A thorough analysis of the region on rico chromosome 7 that corresponded to the QTL peak for (1 ,3;1 ,4)- ⁇ -D-glucan on barley chromosome 2H was carried out and six co-located CsIF genes were identified for further analyses.
- the rice CsIFI ,2,3,4,8 genes were successfully amplified from cDNA by PCR and cloned into the pAJ22 binary vector, behind the 35S promoter, as shown in Figure 2.
- the plasmid vectors were subsequently inserted into Agrobacterfum tumefaciens, which was used to transform Arabidopsis by standard floral dip procedures (Clough and Bent, Plant J. 16: 735, 1998).
- Agrobacterfum tumefaciens which was used to transform Arabidopsis by standard floral dip procedures.
- transformation was performed not only with single gene constructs;, but also with various combinations of the OsCsIF genes.
- RNA was isolated from selected transgenic plants to check for the presence of the transgene(s) and to monitor transcription of the transgencs by real-time, quantitative PCR (Q- PCR; as described by Durlon et a/. (2004, supra).
- OsCsIF genes Transcription of the OsCsIF genes in 14-day old leaves of the transgenic lines was also confirmed. Normalized mRNA levels are shown for selected transgenic plants in Fig. 5, where large differences tn transcriptional activity of the transgenes are evident between plant lines and where similarly large differences are observed between Individual OsCsIF genes in lines carrying more than one transgene. For example, in lines transformed with the OsCslF2, OsCs/F4 and OsCsIF8 genes, OsCslF4 transcripts were usually the highest in abundance. The results showed that the 35S promoter was clearly driving high level transcription in many lines.
- Arabidopsis plants were grown in Arabidopsis soil mix at 23oC in a growth chamber under either long 12/12 hr day/night or short 8/16 hr day/night conditions. Seed collected from transgenic plants was dried, cleaned, vernalised for 2 days at 4oC and sown onto solid MS media containing 25mg/l Bialophos for selection. Survivors were transplanted into soil at the five leaf stage and grown in growth rooms under the conditions described above.
- the binary vector pAJ22 (Fig. 2) was kindly supplied by Dr. Andrew Jacobs (University of Sydney) and is based on the pAMPAT-MCS backbone (accession no. AV436765), It contains a double 35S promoter with a pNOS terminator region, separated by a modified multiple cloning site that incorporates a triple HA epitope, which was not used In this instance.
- Full- length PCR products corresponding to the rice OsCstF cDNAs amplified as described above were cloned Into the TEASY vector (Promega). Clones carrying an insert of the correct size were digested with the appropriate restriction enzymes (Table 2) and an enzyme to cut the TEASY backbone into two segments.
- the reactions were separated by agarose gel electrophoresis, the CsIF fragments were excised and purified using the QIAquick (QIAGEN) gel extraction kit according to the manufacturer's Instructions.
- the binary vector pAJ22 was digested with the corresponding pair of restriction enzymes and the CsIF fragment was ligated into the pAJ22 vector.
- Plasmid DNA was extracted from positive clones using the QIAquick miniprep kit and inserts were sequenced using BigDye 3.1 chemistry (ABI) on an Applied Biosystems ABI3700 capillary sequencer.
- Plasmid DNA preparations containing verified inserts were transformed into Agrobacterium tumefaciens cv GV3101 via electroporation using the method of Mersereau et al. (Gene 90: 149, 1990) and positive colonies were selected on media containing 25mg/l rifampicin, 48mg/l carbenicillin and 50mg/l kanamycin.
- Arabidopsis transformants were generated by the floral dip method of Clough and Bent (Plant J. 16: 735, 1998).
- Genomic DNA was extracted from young leaves and flower buds using the Qiagen miniprep plant kit. Approximately 5 ⁇ g genomic DNA per plant was digested with the relevant restriction enzymes and separated on a 1% agarose TAE gel. DNA was transferred to Highbond+ membranes. Membranes were pre-hybridised and hybridised and probe fragments were labelled using the Rediprime labelling kit (Amersham, High Wycome, UK) following the manufacturer's instructions.
- RNA extractions and cDNA syntheses were carried out as described in Burton et al. (Plant Physiol. 134: 224-236, 2004). Samples of cDNA from appropriate tissues were used as templates to amplify full-length CsIF sequences, using Elongase Taq polymerase (Invitrogen) by PCR. Primer pairs, as listed in Table 2, were used in the PCR, following a standard recipe suggested by the manufacturer.
- DMSO Dimethylsulphoxide
- PCR was performed for 40 cycles as follows; 94oC for 30 sec, 50oC to 58oC (depending on the T m of individual primers) for 30 sec and 68oC for 3 min.
- the primers contained restriction sites at each end, as indicated in Table 2, to facilitate cloning of the amplified fragment into the binary vector.
- the raw expression data for the exogenous CsIF genes in each cDNA was scaled by dividing the raw expression value by the normalisation factor for the particular cDNA.
- Transgenic Arabidopsis lines in which OsCsIF transcript levels were highest were chosen for further analysis, in particular with respect to the deposition of (1 ,3;1 ,4)- ⁇ -D-glucan in cell walls.
- immunocytochemical methods involving monoclonal antibodies specific for (1 ,3;1 ,4)- ⁇ -D-glucans and electron microscopy were used to screen transgenic lines for the presence of the polysaccharide in the Arabidopsis lines.
- the antibody used does not bind with cellooligosaccharides or the (1-»3)- ⁇ -D-glucan, callose. Inhibition studies showed that it binds relatively weakly to (1 ,3;1 ,4)- ⁇ -D-oligoglucosides.
- Pieces of 14- and 28-day old leaves were sectioned for monoclonal antibody probing, and the antibody was routinely checked by pre-incubating tissue sections with commercially available barley (1 ,3;1 ,4)- ⁇ -D-glucan. Pre-incubation with the polysaccharide blocks the binding of gold-labelled secondary antibody. (1 ,3;1 ,4)- ⁇ -D-glucan was detected in cell walls of several transgenic Arahidopsis plants with the specific monoclonal antibodies, such as Arabidopsis lines A28, A29 and A18, as shown in Figure 7.
- panel B walls from the epidermal layers of leaves from transgenic Arabidopsis line A18 are shown to accumulate (1 ,3;1 ,4)- ⁇ -D-glucan over a period of about fourteen days. The polysaccharide was not detected in other tissues of this line.
- Panel C shows a representative control panel of a section of WT Arabidopsis leaf epidermal cell wall where minimal or no background labelling is commonly observed.
- Arabidopsis leaves were fixed in 4% (v/v) glutaraldehyde (EM Grade) in phosphate-buffered saline (PBS), pH 7.2, and stored at 4°C. Samples were washed three times in PBS and post-fixed in a 2% osmium tetroxide solution in PBS for 1 h at room temperature. After three rinses in MiIIiQ water the samples were dehydrated in a graded ethanol series and slowly infiltrated with LR White resin over several days. Individual leaves were placed in gelatin capsules, which were filled with fresh resin and polymerized overnight at 65 0 C.
- PBS phosphate-buffered saline
- Sections (80 nm) of Arabidopsis leaves were prepared on a Leica Ultracut R microtome using a diamond knife and collected on 100 and 200 mesh, Formvar coated gold grids. The ultrathin sections were blocked for 30 min in 1 % bovine serum albumin in PBS before incubation in murine monoclonal antibodies raised against barley (1 ,3;1 ,4)- ⁇ -D-glucan (diluted 1 :500; Biosupplies Australia, Parkville, VIC 3052, Australia) for 1 hr at room temperature and overnight at 4°C.
- the grids were washed twice in PBS and three times in blocking buffer before a 1 h incubation in 18 nm Colloidal Gold-AffiniPure Goat-Anti Mouse IgG + IgM (H+L) (Jackson ImmunoResearch Laboratories, Inc., PA, USA). All grids were washed twice in PBS and several times in MiIIiQ water before staining in 2% aqueous uranyl acetate followed by triple lead citrate stain. The sections were viewed on a Philips BioTwin Transmission Electron Microscope and images captured on a Gatan Multiscan CCD Camera.
- the protein sequences were aligned and compared using the default parameters for the bl2seq pairwise alignment program at NCBI http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi.
- the EMBOSS pairwise alignment algorithms http://www.ebi.ac.uk/emboss/align/ with the water(local) method was used.
- the QTL that has the largest effect on grain (1 ,3;1 ,4)- ⁇ -D-glucan content is located on barley chromosome 2H, between the Adh8 and ABG019 markers , markers, as mapped in the Steptoe x Morex doubled haploid (DH) population by Han etal. ⁇ Theor. Appl. Genet. 91: 921 , 1995).
- Specific gene fragments of the six barley CsIF cDNAs generated by PCR were radiolabeled and used as probes on DNA from a set of wheat barley addition lines (Islam and the Clipper X Sahara barley DH populations to establish firstly their chromosomal location and then to fine map the genes.
- Loci were positioned using the Map Manager QTX software (Manly ef al.,
- the plasmid vectors were subsequently inserted into Agrobacterium tumefaciens, which was used to transform the barley cultivar Golden Promise by standard transformation procedures (Tingay et al. Plant J. 11 : 1369-1376, 1997; Matthews et al. Mo/. Breeding 7: 195-202, 2001 )
- the QPCR results for transcription of the selectable marker gene, hygromycin, using the primers shown in Table 5, are shown in Figure 12.
- HvCsIF genes Transcription of the three HvCsIF genes was also examined in these plants using the pimers given in Table 5. Normalized mRNA levels are shown for HvCsIFI, HvCslF4 and HvCslF ⁇ across the whole transgenic population and the control plants. Plants transformed with 35S:HvCslF1 are designated G98 and overexpression of the HvCsIFI gene in these lines is evident at significant levels above that of the endogenous gene in the WTC, G89, G99 and G103 groups ( Figure 13). Particularly high levels of transcripts are seen in plants 98- 10, 98-11 and 98-24 ( Figure 13).
- Plants transformed with 35S:HvCslF4 are designated G 103 and overexpression of the HvCslF4 gene in these lines is evident at significant levels above that of the endogenous gene in the WTC, G89, G98 and G99 groups ( Figure 14). The highest level of transcript is seen in plant 103-5 ( Figure 14). Finally, plants transformed with 35S:HvCslF6 are designated G99 and overexpression of the HvCslF ⁇ gene in these lines is evident at significant levels above that of the endogenous gene in the WTC, G89, G98 and G103 groups ( Figure 15), with the highest number of transcripts seen in lines 99-6 and 99-11 ( Figure 15).
- the binary vector pMDC32 was obtained from Dr Mark Curtis, University of Zurich (http://www.unizh.ch/botinst/Devo Website/curtisvector/index 2.html) and is a Gateway-enabled (Invitrogen) binary vector carrying the hygromycin resistance gene and the CaMV 35S promoter suitable for use in barley transformation experiments where gene over-expression is desired (Curtis and Gossniklaus, Plant Phys 133: 462-469, 2003) Full-length PCR products corresponding to the barley HvCsIF cDNAs amplified with the primers given in Table 4 were sequenced using BigDye 3.1 chemistry (ABI) on an Applied Biosystems ABI3700 capillary sequencer.
- FHG micro-nutrients supplemented with 30 g/L maltose, 1 mg/L thiamine-HCI, 0.25 g/L myo-inositol, 1 g/L casein hydrolysate, 0.69 g/L L- proline, 10 ⁇ M CuSO 4 , 2.5 mg/L Dicamba (3,6-dichloro-o-anisic acid), and was solidified with 3.5 g/L PhytagelTM (Sigma Chemicals, St. Louis, MO, USA). Agrobacterium suspension (50 ⁇ l) was aliquotted onto the scutella, and the Petri dish was held at a 45° angle to drain away excess bacterial suspension.
- the explants were turned over and dragged across the surface of the medium to the edge of the Petri dish.
- the scutella were transferred to a fresh plate of callus induction medium and cultured cut side-up for three days in the dark at 22- 24 0 C. Following co-cultivation, the scutella were removed to fresh callus induction medium containing 95 ⁇ M hygromycin B (Becton Dickinson Biosciences, Palo Alto, CA, USA) and cultured in the dark. The entire callus of an individual scutellum was transferred to fresh selection medium every fortnight for a further six weeks. At the end of the callus selection period, the callus derived from each treated scutellum was transferred to shoot regeneration medium.
- This medium was based on the FHG recipe of Wan and Lemaux (1994, supra). It contained FHG macro- and micro-nutrients, 1 mg/L thiamine-HCI, 1 mg/L benzylaminopurine, 0.25 g/L myo-inositol, 0.73 g/L L- glutamine, 62 g/L maltose, 10 ⁇ M CuSO 4 , 38 ⁇ M hygromycin B, and was solidified with 3.5 g/L PhytagelTM. The cultures were exposed to light (16 h day/8 h night photo-period) for three to four weeks at 22-24 0 C.
- the regenerated shoots were excised from the callus and transferred to culture boxes (Magenta Corporation, Chicago, IL 1 USA) that contained hormone-free callus induction medium, supplemented with 95 ⁇ M hygromycin B to induce root formation.
- the tissue culture-derived plants that grew vigorously were established in soil and grown to maturity (Singh et al. Plant Cell, Tissue and Organ Culture 49:121-127 1997). All the media contained 150 mg/L Timentin ® (SmithKline Beecham, Pty. Ltd., Melbourne, Australia) to inhibit the growth of Agrohacteri ⁇ m tumefaciens following co-cultivation.
- Reactions were performed in a RG 3000 Rotor-Gene Real Time Thermal Cycler (Corbett Research, Sydney, Australia) as follows; 15 min at 95° followed by 45 cycles of 20 sec at 95°, 30 sec at 55°, 30 sec at 72° and 15 sec at the optimal acquisition temperature (AT) described in Table 5.
- a melt curve was obtained from the product at the end of the amplification by heating from 70° to 99°.
- the optimal cycle threshold (CT) was determined from the dilution series and the raw expression data was derived. The mean expression level and standard deviation for each set of three replicates for each cDNA was calculated.
- the raw expression data for the HvCsIF genes was scaled using the approach of Vandesompele et al. ⁇ Genome Biol. 3: 1-11 , 2002).
- the normalisation factor derived from the best three of four barley control genes was generated using the Genorm software. (Vandesompele et al., 2002, supra).
- the raw expression data for the exogenous CsIF genes in each cDNA was scaled by dividing the raw expression value by the normalisation factor for the particular cDNA.
- Hv CsIFI HvFD5END GGAGAGCGCGTGCATTGAGGACG SEQ ID NO: 59
- Leaf sections were screened for the presence of the polysaccharide in the barley lines using an immunocytochemical method in which a monoclonal antibody specific for (1 ,3;1 ,4)- ⁇ -D-glucan (as described in Example 3) is detected by a fluorophore-conjugated secondary antibody and observed by light microscopy.
- antibody-labeled sections taken from the transgenic G98 and G103 plants display an increased intensity of signal, where the walls of the epidermal cells and sclerenchyma fibre cells are much more heavily labelled.
- the sclerenchyma cells have thickened secondary cell walls and Trethewey and Harris (2002, supra) detected only sparse labelling at the TEM level in these cells from wild type seedlings.
- the labelling pattern displayed by G99 plants, such as G99-12 ( Figure 18D) varies from that shown by the wild type and transgenic controls and from the G98 and G 103 plants.
- Barley leaf pieces were fixed in 0.25% (v/v) glutaraldehyde, 4% (v/v) paraformaldehyde (EM Grade), and 4% sucrose in phosphate-buffered saline (PBS), pH 7.2, and stored at 4°C overnight. Samples were washed three times in PBS, dehydrated in a graded ethanol series and slowly infiltrated with paraffin over several days. Blocks were trimmed and sectioned at 6 ⁇ m.
- Sections were dewaxed in xylene and rehydrated progressively through 100%, 90% and 70% ethanol solutions. After two rinses with 1 x phosphate buffered saline (PBS) the sections were incubated with 0.05M glycine for 20 mins to inactivate residual aldehyde groups. Sections were blocked in incubation buffer (1 % bovine serum albumin (BSA) in 1 x PBS ) for 2 x 10 mins to prevent non- specific binding. Slides were drained and the specific primary antibody, BG1 (BioSupplies, Melbourne, Australia) was added at a dilution of 1 :50 and left to incubate for one hour in a humidity chamber.
- BSA bovine serum albumin
- Unbound primary antibody was removed by rinsing with incubation buffer for 3 x 10 mins and the secondary antibody, Alexa Fluor® 488 goat anti-mouse IgG (Molecular Probes, Eugene, USA), was added. Slides were wrapped in aluminium foil to exclude light and incubated for 2 hours at room temperature. Unbound secondary antibody was removed by rinsing 3 x 10 mins with incubation buffer before a few drops of mountant (90% glycerol: 10% water) were applied and sections cover-slipped. Controls were included which omitted either the primary antibody, the secondary antibody or both antibodies.
- Transgenic barley lines as described in Examples 7 and 8, in which the HvCsIFI, 4 or 6 transcript levels driven by the 35S promoter were highest, were chosen for further analysis, with respect to the deposition of (1,3;1 ,4)- ⁇ -D- glucan in the cell walls.
- Leaf pieces representative of the plant groups described in Example 7 were harvested, fixed and embedded in LR white resin. Mounted sections were treated with the specific monoclonal antibody which binds to (1 ,3;1 ,4)-D-D- glucan and colloidal gold and examined on the transmission electron microscope.
- FIG. 19A A labeled epidermal cell wall of the control G89 is shown in Figure 19A.
- Equivalent epidermal cell walls of the transgenics G98-10 and G103-5 are shown in Figure 19B (G98-10) and 19C (G103-5), where the increased amount of labeling is clearly evident.
- Figure 2OA shows the wall of a sclerenchyma fibre cell in the G89 control which is lightly labeled.
- Pieces of barley plantlet leaves were fixed in 0.25% glutaraldehyde, 4% (v/v) paraformaldehyde (EM Grade) and 4% sucrose in phosphate-buffered saline (PBS), pH 7.2, and stored at 4°C.overnight. After three rinses in MiIIiQ water the samples were dehydrated in a graded ethanol series and slowly infiltrated with LR White resin over several days. Individual leaf pieces were placed in gelatin capsules, which were filled with fresh resin and polymerized overnight at 65 0 C.
- Sections (80 nm) of barley leaves were prepared on a Leica Ultracut R microtome using a diamond knife and collected on 100 and 200 mesh, Formvar coated gold grids. The ultrathin sections were blocked for 30 min in 1 % bovine serum albumin in PBS before incubation in murine monoclonal antibodies raised against barley (1 ,3;1 ,4)- ⁇ -D-glucan (diluted 1 :500; Biosupplies Australia, Parkville, VIC 3052, Australia) for 1 hr at room temperature and overnight at 4°C.
- the grids were washed twice in PBS and three times in blocking buffer before a 1 h incubation in 18 nm Colloidal Gold-AffiniPure Goat-Anti Mouse IgG + IgM (H+L) (Jackson ImmunoResearch Laboratories, Inc., PA, USA). All grids were washed twice in PBS and several times in MiIIiQ water before viewing on a Philips BioTwin Transmission Electron Microscope and images captured on a Gatan Multiscan CCD Camera.
- transgene includes a single transgene as well as two or more transgenes
- plant cell includes a single cell as well as two or more cells
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Genetics & Genomics (AREA)
- Engineering & Computer Science (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Zoology (AREA)
- Wood Science & Technology (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Molecular Biology (AREA)
- General Engineering & Computer Science (AREA)
- Biomedical Technology (AREA)
- Microbiology (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Nutrition Science (AREA)
- Physics & Mathematics (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Cell Biology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Medicinal Chemistry (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
- Peptides Or Proteins (AREA)
- Enzymes And Modification Thereof (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Polysaccharides And Polysaccharide Derivatives (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| JP2008524314A JP2009502180A (ja) | 2005-08-03 | 2006-08-03 | 多糖シンターゼ |
| EP06774788A EP1920057A4 (en) | 2005-08-03 | 2006-08-03 | POLYSACCHARIDE synthases |
| NZ565631A NZ565631A (en) | 2005-08-03 | 2006-08-03 | Polysaccharide synthases |
| CA2617594A CA2617594C (en) | 2005-08-03 | 2006-08-03 | Polysaccharide synthases |
| US11/997,667 US20080307549A1 (en) | 2005-08-03 | 2006-08-03 | Polysaccharide Synthases |
| AU2006275315A AU2006275315B2 (en) | 2005-08-03 | 2006-08-03 | Polysaccharide synthases |
| US14/465,679 US9708623B2 (en) | 2005-08-03 | 2014-08-21 | Polysaccharide synthases |
| US15/621,132 US10190130B2 (en) | 2005-08-03 | 2017-06-13 | Polysaccharide synthases |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2005904155A AU2005904155A0 (en) | 2005-08-03 | Polysaccharide synthases | |
| AU2005904155 | 2005-08-03 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/997,667 A-371-Of-International US20080307549A1 (en) | 2005-08-03 | 2006-08-03 | Polysaccharide Synthases |
| US14/465,679 Division US9708623B2 (en) | 2005-08-03 | 2014-08-21 | Polysaccharide synthases |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2007014433A1 true WO2007014433A1 (en) | 2007-02-08 |
Family
ID=37708496
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/AU2006/001107 Ceased WO2007014433A1 (en) | 2005-08-03 | 2006-08-03 | Polysaccharide synthases |
Country Status (6)
| Country | Link |
|---|---|
| US (3) | US20080307549A1 (https=) |
| EP (1) | EP1920057A4 (https=) |
| JP (2) | JP2009502180A (https=) |
| CA (1) | CA2617594C (https=) |
| NZ (1) | NZ565631A (https=) |
| WO (1) | WO2007014433A1 (https=) |
Cited By (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010098378A1 (ja) * | 2009-02-27 | 2010-09-02 | 独立行政法人農業・食品産業技術総合研究機構 | オオムギのβ-グルカン欠失遺伝子、合成遺伝子及びその利用 |
| EP2222853A4 (en) * | 2007-12-24 | 2011-04-13 | Univ Melbourne | POLYSACCHARIDE SYNTHESIS (H) |
| US11690341B2 (en) | 2017-12-28 | 2023-07-04 | Carlsberg A/S | Cereal plants with improved cell wall properties |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20080307549A1 (en) * | 2005-08-03 | 2008-12-11 | Adelaide Research & Innovation Pty Ltd. | Polysaccharide Synthases |
| JP6068831B2 (ja) * | 2012-05-14 | 2017-01-25 | サッポロビール株式会社 | 植物原料液及び飲料並びにこれらに関する方法 |
Citations (57)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US608408A (en) | 1898-08-02 | Gustave koch | ||
| US4474893A (en) | 1981-07-01 | 1984-10-02 | The University of Texas System Cancer Center | Recombinant monoclonal antibodies |
| US4579821A (en) | 1981-11-23 | 1986-04-01 | University Patents, Inc. | Control of DNA sequence transcription |
| US4601978A (en) | 1982-11-24 | 1986-07-22 | The Regents Of The University Of California | Mammalian metallothionein promoter system |
| US4714681A (en) | 1981-07-01 | 1987-12-22 | The Board Of Reagents, The University Of Texas System Cancer Center | Quadroma cells and trioma cells and methods for the production of same |
| EP0316441A1 (en) | 1987-05-26 | 1989-05-24 | Calgene, Inc. | Fruit-specific transcriptional factors |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US4925648A (en) | 1988-07-29 | 1990-05-15 | Immunomedics, Inc. | Detection and treatment of infectious and inflammatory lesions |
| US4940661A (en) | 1984-05-17 | 1990-07-10 | Genentech, Inc. | Metallothionein transcription control sequences and use thereof |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| WO1991000360A1 (en) | 1989-06-29 | 1991-01-10 | Medarex, Inc. | Bispecific reagents for aids therapy |
| AU612326B2 (en) | 1986-07-31 | 1991-07-11 | Calgene, Inc. | Seed specific transcriptional regulation |
| WO1991010737A1 (en) | 1990-01-11 | 1991-07-25 | Molecular Affinities Corporation | Production of antibodies using gene libraries |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| WO1992005793A1 (en) | 1990-10-05 | 1992-04-16 | Medarex, Inc. | Targeted immunostimulation with bispecific reagents |
| WO1992008802A1 (en) | 1990-10-29 | 1992-05-29 | Cetus Oncology Corporation | Bispecific antibodies, method of production, and uses thereof |
| WO1992018619A1 (en) | 1991-04-10 | 1992-10-29 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| WO1992022324A1 (en) | 1991-06-14 | 1992-12-23 | Xoma Corporation | Microbially-produced antibody fragments and their conjugates |
| WO1993011236A1 (en) | 1991-12-02 | 1993-06-10 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| CA1321563C (en) | 1986-06-23 | 1993-08-24 | David Alan Hodgson | Light inducible promoter |
| WO1993017715A1 (en) | 1992-03-05 | 1993-09-16 | Board Of Regents, The University Of Texas System | Diagnostic and/or therapeutic agents, targeted to neovascular endothelial cells |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| CA1324097C (en) | 1986-02-06 | 1993-11-09 | Robert E. Kingston | Inducible heat shock and amplification system |
| EP0637339A1 (en) | 1992-04-13 | 1995-02-08 | Zeneca Limited | Dna constructs and plants incorporating them |
| WO1995015982A2 (en) | 1993-12-08 | 1995-06-15 | Genzyme Corporation | Process for generating specific antibodies |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| WO1995020401A1 (en) | 1994-01-31 | 1995-08-03 | Trustees Of Boston University | Polyclonal antibody libraries |
| US5447858A (en) | 1984-04-13 | 1995-09-05 | Mycogen Plant Sciences, Inc. | Heat shock promoter and gene |
| US5464758A (en) | 1993-06-14 | 1995-11-07 | Gossen; Manfred | Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters |
| US5512483A (en) | 1993-05-21 | 1996-04-30 | Mcgill University | Expression vectors responsive to steroid hormones |
| US5516637A (en) | 1994-06-10 | 1996-05-14 | Dade International Inc. | Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage |
| US5573920A (en) | 1991-04-26 | 1996-11-12 | Surface Active Limited | Antibodies, and methods for their use |
| US5601819A (en) | 1988-08-11 | 1997-02-11 | The General Hospital Corporation | Bispecific antibodies for selective immune regulation and for selective immune cell binding |
| US5639952A (en) | 1989-01-05 | 1997-06-17 | Mycogen Plant Science, Inc. | Dark and light regulated chlorophyll A/B binding protein promoter-regulatory system |
| EP0781849A1 (en) | 1995-07-05 | 1997-07-02 | Sapporo Breweries Ltd. | Tissue-specific promoter |
| US5654414A (en) | 1988-03-08 | 1997-08-05 | Novartis Finance Corporation | Chemically inducible promoter of a cucumber chitinase/lysozyme gene |
| US5698426A (en) | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
| US5733743A (en) | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5750753A (en) | 1996-01-24 | 1998-05-12 | Chisso Corporation | Method for manufacturing acryloxypropysilane |
| US5750385A (en) | 1985-01-17 | 1998-05-12 | Calgene, Inc. | Methods and compositions for regulated transcription and expression of heterologous genes |
| US5780225A (en) | 1990-01-12 | 1998-07-14 | Stratagene | Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
| US5789214A (en) | 1988-03-08 | 1998-08-04 | Novartis Finance Corporation | Method of inducing gene transcription in a plant |
| US5821047A (en) | 1990-12-03 | 1998-10-13 | Genentech, Inc. | Monovalent phage display |
| US5847102A (en) | 1995-04-10 | 1998-12-08 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Agriculture | Cold induced promoter from winter Brassica napus |
| US5851796A (en) | 1995-06-07 | 1998-12-22 | Yale University | Autoregulatory tetracycline-regulated system for inducible gene expression in eucaryotes |
| AU708850B2 (en) | 1996-07-23 | 1999-08-12 | Novartis Ag | Chemically-inducible arabidopsis PR-1 promoter |
| EP0973922A2 (en) | 1998-02-06 | 2000-01-26 | Calgene LLC | Strawberry fruit promoters for gene expression |
| US6184443B1 (en) | 1994-10-21 | 2001-02-06 | Danisco A/S | Cold-inducible and tuber-specific promoter sequence from potato α-amylase gene |
| AU732872B2 (en) | 1996-08-15 | 2001-05-03 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Spatial and temporal control of gene expression using a heat shock protein promoter in combination with local heat |
| US20010047525A1 (en) | 2000-01-21 | 2001-11-29 | Bruce Wesley B. | Novel root-preferred promoter elements and methods of use |
| AU746032B2 (en) | 1997-09-30 | 2002-04-11 | Regents Of The University Of California, The | Production of proteins in plant seeds |
| US6379945B1 (en) | 1995-05-26 | 2002-04-30 | Zeneca Limited | Gene switch |
| US6429362B1 (en) | 1998-02-26 | 2002-08-06 | Pioneer Hi-Bred International, Inc. | Maize PR-1 gene promoters |
| EP1232273A2 (en) | 1999-11-12 | 2002-08-21 | The Rockefeller University | Chemical inducible promoters used to obtain transgenic plants with a silent marker |
| NZ508103A (en) | 1999-03-12 | 2002-08-28 | Suntory Ltd | Photoinhibitory promoter |
| US6479260B1 (en) | 1997-11-20 | 2002-11-12 | Takara Shuzo Co., Ltd. | Cold-inducible expression vector |
Family Cites Families (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20110131679A2 (en) * | 2000-04-19 | 2011-06-02 | Thomas La Rosa | Rice Nucleic Acid Molecules and Other Molecules Associated with Plants and Uses Thereof for Plant Improvement |
| US20080307549A1 (en) * | 2005-08-03 | 2008-12-11 | Adelaide Research & Innovation Pty Ltd. | Polysaccharide Synthases |
-
2006
- 2006-08-03 US US11/997,667 patent/US20080307549A1/en not_active Abandoned
- 2006-08-03 WO PCT/AU2006/001107 patent/WO2007014433A1/en not_active Ceased
- 2006-08-03 JP JP2008524314A patent/JP2009502180A/ja active Pending
- 2006-08-03 EP EP06774788A patent/EP1920057A4/en not_active Ceased
- 2006-08-03 CA CA2617594A patent/CA2617594C/en active Active
- 2006-08-03 NZ NZ565631A patent/NZ565631A/en not_active IP Right Cessation
-
2013
- 2013-03-06 JP JP2013043706A patent/JP2013165713A/ja active Pending
-
2014
- 2014-08-21 US US14/465,679 patent/US9708623B2/en not_active Expired - Fee Related
-
2017
- 2017-06-13 US US15/621,132 patent/US10190130B2/en active Active
Patent Citations (64)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US608408A (en) | 1898-08-02 | Gustave koch | ||
| US4474893A (en) | 1981-07-01 | 1984-10-02 | The University of Texas System Cancer Center | Recombinant monoclonal antibodies |
| US4714681A (en) | 1981-07-01 | 1987-12-22 | The Board Of Reagents, The University Of Texas System Cancer Center | Quadroma cells and trioma cells and methods for the production of same |
| US4579821A (en) | 1981-11-23 | 1986-04-01 | University Patents, Inc. | Control of DNA sequence transcription |
| US4601978A (en) | 1982-11-24 | 1986-07-22 | The Regents Of The University Of California | Mammalian metallothionein promoter system |
| US5447858A (en) | 1984-04-13 | 1995-09-05 | Mycogen Plant Sciences, Inc. | Heat shock promoter and gene |
| US4940661A (en) | 1984-05-17 | 1990-07-10 | Genentech, Inc. | Metallothionein transcription control sequences and use thereof |
| US5750385A (en) | 1985-01-17 | 1998-05-12 | Calgene, Inc. | Methods and compositions for regulated transcription and expression of heterologous genes |
| US5753475A (en) | 1985-01-17 | 1998-05-19 | Calgene, Inc. | Methods and compositions for regulated transcription and expression of heterologous genes |
| CA1324097C (en) | 1986-02-06 | 1993-11-09 | Robert E. Kingston | Inducible heat shock and amplification system |
| CA1321563C (en) | 1986-06-23 | 1993-08-24 | David Alan Hodgson | Light inducible promoter |
| AU612326B2 (en) | 1986-07-31 | 1991-07-11 | Calgene, Inc. | Seed specific transcriptional regulation |
| US5258498A (en) | 1987-05-21 | 1993-11-02 | Creative Biomolecules, Inc. | Polypeptide linkers for production of biosynthetic proteins |
| EP0316441A1 (en) | 1987-05-26 | 1989-05-24 | Calgene, Inc. | Fruit-specific transcriptional factors |
| US4946778A (en) | 1987-09-21 | 1990-08-07 | Genex Corporation | Single polypeptide chain binding molecules |
| US5789214A (en) | 1988-03-08 | 1998-08-04 | Novartis Finance Corporation | Method of inducing gene transcription in a plant |
| US5654414A (en) | 1988-03-08 | 1997-08-05 | Novartis Finance Corporation | Chemically inducible promoter of a cucumber chitinase/lysozyme gene |
| US5689044A (en) | 1988-03-08 | 1997-11-18 | Novartis Corporation | Chemically inducible promoter of a plant PR-1 gene |
| US4925648A (en) | 1988-07-29 | 1990-05-15 | Immunomedics, Inc. | Detection and treatment of infectious and inflammatory lesions |
| US5601819A (en) | 1988-08-11 | 1997-02-11 | The General Hospital Corporation | Bispecific antibodies for selective immune regulation and for selective immune cell binding |
| US5223409A (en) | 1988-09-02 | 1993-06-29 | Protein Engineering Corp. | Directed evolution of novel binding proteins |
| US5571698A (en) | 1988-09-02 | 1996-11-05 | Protein Engineering Corporation | Directed evolution of novel binding proteins |
| US5403484A (en) | 1988-09-02 | 1995-04-04 | Protein Engineering Corporation | Viruses expressing chimeric binding proteins |
| WO1990002809A1 (en) | 1988-09-02 | 1990-03-22 | Protein Engineering Corporation | Generation and selection of recombinant varied binding proteins |
| US5639952A (en) | 1989-01-05 | 1997-06-17 | Mycogen Plant Science, Inc. | Dark and light regulated chlorophyll A/B binding protein promoter-regulatory system |
| WO1991000360A1 (en) | 1989-06-29 | 1991-01-10 | Medarex, Inc. | Bispecific reagents for aids therapy |
| WO1991010737A1 (en) | 1990-01-11 | 1991-07-25 | Molecular Affinities Corporation | Production of antibodies using gene libraries |
| US5780225A (en) | 1990-01-12 | 1998-07-14 | Stratagene | Method for generating libaries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
| US5427908A (en) | 1990-05-01 | 1995-06-27 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5580717A (en) | 1990-05-01 | 1996-12-03 | Affymax Technologies N.V. | Recombinant library screening methods |
| US5969108A (en) | 1990-07-10 | 1999-10-19 | Medical Research Council | Methods for producing members of specific binding pairs |
| WO1992001047A1 (en) | 1990-07-10 | 1992-01-23 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| US5698426A (en) | 1990-09-28 | 1997-12-16 | Ixsys, Incorporated | Surface expression libraries of heteromeric receptors |
| WO1992005793A1 (en) | 1990-10-05 | 1992-04-16 | Medarex, Inc. | Targeted immunostimulation with bispecific reagents |
| WO1992008802A1 (en) | 1990-10-29 | 1992-05-29 | Cetus Oncology Corporation | Bispecific antibodies, method of production, and uses thereof |
| US5821047A (en) | 1990-12-03 | 1998-10-13 | Genentech, Inc. | Monovalent phage display |
| WO1992018619A1 (en) | 1991-04-10 | 1992-10-29 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5658727A (en) | 1991-04-10 | 1997-08-19 | The Scripps Research Institute | Heterodimeric receptor libraries using phagemids |
| US5573920A (en) | 1991-04-26 | 1996-11-12 | Surface Active Limited | Antibodies, and methods for their use |
| WO1992022324A1 (en) | 1991-06-14 | 1992-12-23 | Xoma Corporation | Microbially-produced antibody fragments and their conjugates |
| WO1993011236A1 (en) | 1991-12-02 | 1993-06-10 | Medical Research Council | Production of anti-self antibodies from antibody segment repertoires and displayed on phage |
| WO1993017715A1 (en) | 1992-03-05 | 1993-09-16 | Board Of Regents, The University Of Texas System | Diagnostic and/or therapeutic agents, targeted to neovascular endothelial cells |
| US5733743A (en) | 1992-03-24 | 1998-03-31 | Cambridge Antibody Technology Limited | Methods for producing members of specific binding pairs |
| EP0637339A1 (en) | 1992-04-13 | 1995-02-08 | Zeneca Limited | Dna constructs and plants incorporating them |
| US5512483A (en) | 1993-05-21 | 1996-04-30 | Mcgill University | Expression vectors responsive to steroid hormones |
| US5464758A (en) | 1993-06-14 | 1995-11-07 | Gossen; Manfred | Tight control of gene expression in eucaryotic cells by tetracycline-responsive promoters |
| WO1995015982A2 (en) | 1993-12-08 | 1995-06-15 | Genzyme Corporation | Process for generating specific antibodies |
| WO1995020401A1 (en) | 1994-01-31 | 1995-08-03 | Trustees Of Boston University | Polyclonal antibody libraries |
| US5516637A (en) | 1994-06-10 | 1996-05-14 | Dade International Inc. | Method involving display of protein binding pairs on the surface of bacterial pili and bacteriophage |
| US6184443B1 (en) | 1994-10-21 | 2001-02-06 | Danisco A/S | Cold-inducible and tuber-specific promoter sequence from potato α-amylase gene |
| US5847102A (en) | 1995-04-10 | 1998-12-08 | Her Majesty The Queen In Right Of Canada As Represented By The Minister Of Agriculture | Cold induced promoter from winter Brassica napus |
| US6379945B1 (en) | 1995-05-26 | 2002-04-30 | Zeneca Limited | Gene switch |
| US5851796A (en) | 1995-06-07 | 1998-12-22 | Yale University | Autoregulatory tetracycline-regulated system for inducible gene expression in eucaryotes |
| EP0781849A1 (en) | 1995-07-05 | 1997-07-02 | Sapporo Breweries Ltd. | Tissue-specific promoter |
| US5750753A (en) | 1996-01-24 | 1998-05-12 | Chisso Corporation | Method for manufacturing acryloxypropysilane |
| AU708850B2 (en) | 1996-07-23 | 1999-08-12 | Novartis Ag | Chemically-inducible arabidopsis PR-1 promoter |
| AU732872B2 (en) | 1996-08-15 | 2001-05-03 | Government Of The United States Of America, As Represented By The Secretary Of The Department Of Health And Human Services, The | Spatial and temporal control of gene expression using a heat shock protein promoter in combination with local heat |
| AU746032B2 (en) | 1997-09-30 | 2002-04-11 | Regents Of The University Of California, The | Production of proteins in plant seeds |
| US6479260B1 (en) | 1997-11-20 | 2002-11-12 | Takara Shuzo Co., Ltd. | Cold-inducible expression vector |
| EP0973922A2 (en) | 1998-02-06 | 2000-01-26 | Calgene LLC | Strawberry fruit promoters for gene expression |
| US6429362B1 (en) | 1998-02-26 | 2002-08-06 | Pioneer Hi-Bred International, Inc. | Maize PR-1 gene promoters |
| NZ508103A (en) | 1999-03-12 | 2002-08-28 | Suntory Ltd | Photoinhibitory promoter |
| EP1232273A2 (en) | 1999-11-12 | 2002-08-21 | The Rockefeller University | Chemical inducible promoters used to obtain transgenic plants with a silent marker |
| US20010047525A1 (en) | 2000-01-21 | 2001-11-29 | Bruce Wesley B. | Novel root-preferred promoter elements and methods of use |
Non-Patent Citations (109)
| Title |
|---|
| "Baculovirus Expression Vectors: A Laboratory Manual", 1992, WH FREEMAN & CO. |
| "The Baculovirus Expression System: A Laboratory Manual", 1992, CHAPMAN & HALL |
| ALBANI ET AL., J BIOL CHEM, vol. 275, 2000, pages 19258 - 19267 |
| ALTSCHUL ET AL., NUCL. ACIDS RES., vol. 25, 1997, pages 3389 - 3402 |
| AMES ET AL., J. IMMUNOL. METHODS, vol. 184, 1995, pages 177 - 186 |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1994, JOHN WILEY & SONS INC, article "chapter 15" |
| AUSUBEL ET AL.: "Current Protocols in Molecular Biology", 1995, GREENE PUBLISHING AND WILEY-INTERSCIENCE, article "chapter 2" |
| BAMFORTH, BREW. DIG., vol. 69, no. 5, 1994, pages 12 - 16 |
| BANEYX, CURR. OPIN. BIOTECHNOL., vol. 10, 1999, pages 411 - 421 |
| BANEYX: "Protein Expression Technologies: Current Status and Future Trends", 2004, article "Chapters 2 and 3" |
| BANEYX: "Protein Expression Technologies: Current Status and Future Trends, supra", article "chapter 4" |
| BECKER M. ET AL.: "Biosynthesis of (1,3)(1,4)-beta-glucan and (1,3)-beta-glucan in barley (Hordeum vulgare L.)", PLANTA, vol. 195, 1995, pages 331 - 338, XP008077162 * |
| BETTER ET AL., SCIENCE, vol. 240, 1988, pages 1041 - 1043 |
| BITTLE ET AL., J. GEN. VIROL., vol. 66, 1985, pages 2347 - 2354 |
| BRENNAN ET AL.: "Manual of Flour and Husk Milling", AGRIMEDIA, ISBN: 3-86037-277-7 |
| BRINKMAN ET AL., J. IMMUNOL. METHODS, vol. 182, 1995, pages 41 - 50 |
| BROOTHAERTS ET AL., NATURE, vol. 433, 2005, pages 629 - 633 |
| BUCKERIDGE M.S. ET AL.: "Mixed Linkage (1-3),(1-4)-beta-D-Glucans of Grasses", CEREAL CHEMISTRY, vol. 81, no. 1, 2004, pages 115 - 127, XP003008820 * |
| BUCKHOLZ; GLEESON, BIO/TECHNOLOGY, vol. 9, no. 11, 1991, pages 1067 - 1072 |
| BURTON ET AL., ADVANCES IN IMMUNOLOGY, vol. 57, 1994, pages 191 - 280 |
| BURTON R.A. ET AL.: "Cellulose Synthase-Like Cs1F Genes Mediate the Synthesis of Cell Wall (1,3;1,4)-beta-D-Glucans", SCIENCE, vol. 311, 2006, pages 1940 - 1942, XP003008507 * |
| CAPLEN ET AL., PROC. NATL. ACAD. SCI. USA, vol. 98, 2001, pages 9742 - 9747 |
| CARPITA NICHOLAS C: "Structure and biogenesis of the cell walls of grasses", ANNUAL REVIEW OF _PLANT PHYSIOLOGY AND PLANT MOLECULAR BIOLOGY, 1996, pages 445 - 476 |
| CASAS ET AL., PLANT BREEDING REV., vol. 13, 1995, pages 235 - 264 |
| CEREGHINO; CREGG, FEMS MICROBIOLOGY REVIEWS, vol. 24, 2000, pages 45 - 66 |
| CREGG ET AL., BIOLTECHNOLOGY, vol. 11, 1993, pages 905 - 910 |
| CREGG ET AL., MOL. BIOTECHNOL., vol. 16, no. 1, 2000, pages 23 - 52 |
| CREIGHTON: "Proteins-Structure And Molecular Properties, 2nd ed.", 1993, W. H. FREEMAN AND COMPANY |
| DAI; CSERJESI, J BIOL CHEM, vol. 277, 2002, pages 12604 - 12612 |
| DIGEON ET AL., PLANT MOL. BIOL., vol. 39, 1999, pages 1101 - 1112 |
| DOBLIN M.S. ET AL.: "Cellulose Biosynthesis in Plants: From Genes to Rosettes", PLANT CELL PHYSIOLOGY, vol. 43, no. 12, 2002, pages 1407 - 1420, XP003008509 * |
| ELBASHIR ET AL., EMBO J., vol. 20, 2001, pages 6877 - 6888 |
| ELBASHIR ET AL., GENES DEV., vol. 15, 2001, pages 188 - 200 |
| ELBASHIR ET AL., METHODS, vol. 26, 2002, pages 199 - 213 |
| ELBASHIR ET AL., NATURE, vol. 411, 2001, pages 494 - 498 |
| GALBRAITH ET AL.: "Methods in Cell Biology", vol. 50, 1995, ACADEMIC PRESS |
| GELVIN, MICROBIOLOGY AND MOLECULAR BIOLOGY REVIEWS, vol. 67, no. 1, 2003, pages 16 - 37 |
| GIBEAUT D.M. ET AL.: "Synthesis of (1-3),(1-4)-beta-D-Glucan in the Golgi apparatus of maize coleoptiles", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, USA, vol. 90, 1993, pages 3850 - 3854, XP002276325 * |
| HACH ET AL., J BIOL CHEM, vol. 278, 2000, pages 248 - 254 |
| HAMMERLING ET AL.: "Monoclonal Antibodies and T-Cell Hybridomas", 1981, ELSEVIER |
| HANNON, NATURE, vol. 418, 2002, pages 244 - 51 |
| HARLOW ET AL.: "Antibodies: A Laboratory Manual, 2nd ed.", 1988, COLD SPRING HARBOR LABORATORY PRESS |
| HAZEN S.P. ET AL.: "Cellulose Synthase-Like Genes of Rice", PLANT PHYSIOLOGY, vol. 128, 2002, pages 336 - 340, XP003008506 * |
| HELLWIG ET AL., NAT BIOTECHNOL, vol. 22, 2004, pages 1415 - 1422 |
| HERZIG ET AL., J CELL SCI, vol. 113, 2000, pages 4263 - 4273 |
| HOE ET AL., GENE, vol. 215, no. 2, 1998, pages 319 - 328 |
| HORVATH ET AL., PROC. NATL. ACAD. SCI. USA, vol. 97, 2000, pages 1914 - 1919 |
| HOUGHTEN, PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 5131 - 5135 |
| HUSTON ET AL., METHODS IN ENZYMOLOGY, vol. 203, 1991, pages 46 - 88 |
| ITOH ET AL., NUCL ACIDS RES, vol. 28, 2000, pages 4291 - 4298 |
| JOHNSON: "Posttranslational Covalent Modification Of Proteins", 1983, ACADEMIC PRESS |
| KARAKOUSIS ET AL., AUSTRALIAN JOURNAL OF AGRICULTURAL RESEARCH, vol. 54, 2003, pages 1173 - 1185 |
| KATAOKA ET AL., J BIOL CHEM, vol. 277, 2002, pages 49903 - 49910 |
| KETTLEBOROUGH ET AL., EUR. J. IMMUNOL., vol. 24, 1994, pages 952 - 958 |
| KIESER ET AL.: "Practical Streptomyces Genetics", 2000, JOHN INNES FOUNDATION, article "Chapter 17" |
| KNUDSEN; MÜLLER, PLANTA, vol. 195, 1991, pages 330 - 336 |
| KOST; CONDREAY, CURR. OPIN. BIOTECHNOL., vol. 10, 1999, pages 428 - 433 |
| KOSTELNY ET AL., J. IMMUNOL., vol. 148, 1992, pages 1547 - 1553 |
| LAMACCHIA ET AL., J. EXP. BOT., vol. 52, 2001, pages 243 - 250 |
| LEAH ET AL., PLANT J, vol. 6, 1994, pages 579 - 589 |
| LIANG; HAI, J BIOL CHEM, vol. 272, 1997, pages 24088 - 24095 |
| LIU ET AL., BIOCHEM BIOPHYS RES COMM, vol. 320, no. 1, 2004, pages 1 - 6 |
| LIU ET AL., TRANSGENIC RES., vol. 12, 2003, pages 71 - 82 |
| LU ET AL., NUCL. ACIDS RES., vol. 32, no. 21, 2004, pages E171 |
| MEDHURST A ET AL.: "Towards determining a role in cell wall synthesis for the cellulose synthase-like D and F genes of barley", COMPARATIVE BIOCHEMISTRY AND PHYSIOLOGY, PART A MOLECULAR & INTEGRATIVE PHYSIOLOGY, vol. 141, no. 3, July 2005 (2005-07-01), pages S265 - S266 |
| MEINKOTH; WAHL, ANAL. BIOCHEM., vol. 138, 1984, pages 267 - 284 |
| MENA ET AL., PLANT J., vol. 16, 1998, pages 53 - 62 |
| MUHITCH ET AL., PLANT SCI., vol. 163, 2002, pages 865 - 872 |
| MULLINAX ET AL., BIOTECHNIQUES, vol. 12, no. 6, 1992, pages 864 - 869 |
| NANDI ET AL., PLANT SCI., vol. 163, 2002, pages 713 - 722 |
| OKITA ET AL., J. BIOL. CHEM., vol. 264, 1989, pages 12573 - 12581 |
| OMORI ET AL., NUCL ACIDS RES, vol. 29, 2001, pages 2154 - 2162 |
| PATEL ET AL., MOL. BREEDING, vol. 6, 2000, pages 113 - 123 |
| PERALTA; REAM, PROC. NATL. ACAD. SCI. USA, vol. 82, no. 15, 1985, pages 5112 - 5116 |
| PERSIC ET AL., GENE, vol. 187, 1997, pages 9 - 18 |
| QI ET AL., GENOME, vol. 39, 1996, pages 379 - 394 |
| RAKOCZY-TROJANOWSKA, CELL. MOL. BIOL. LETT., vol. 7, 2002, pages 849 - 858 |
| RATTAN ET AL., ANN NY ACAD SCI, vol. 663, 1992, pages 48 - 62 |
| ROA-RODRIGUEZ ET AL.: "CAMBIA Intellectual Property Resource", 2003, article "Agrobacterium-mediated transformation of plants" |
| ROUSTER ET AL., PLANT J., vol. 15, 1998, pages 435 - 440 |
| SAKAI ET AL., PLANT J, vol. 24, no. 6, 2000, pages 703 - 711 |
| SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual, 2nd ed.", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| SAMBROOK; RUSSELL: "Molecular Cloning - A Laboratory Manual, 3rd ed.", 2000, COLD SPRING HARBOR LABORATORY PRESS |
| SAWAI ET AL., AJRI, vol. 34, 1995, pages 26 - 34 |
| See also references of EP1920057A4 |
| SEIFTER ET AL., METH ENZYMOL, vol. 182, 1990, pages 626 - 646 |
| SHARP, GENES DEV., vol. 15, no. 5, 2001, pages 485 - 490 |
| SHU ET AL., PROC. NATL. ACAD. SCI. USA, vol. 90, 1993, pages 7995 - 7999 |
| SINDHU ET AL., PLANT SCI., vol. 130, 1997, pages 189 - 196 |
| SKERRA ET AL., SCIENCE, vol. 240, 1988, pages 1038 - 1040 |
| SMITH: "Gene expression in recombinant microorganisms", 1994, MARCEL DEKKER, INC |
| SORENSEN ET AL., MOL. GEN. GENET., vol. 250, 1996, pages 750 - 760 |
| SZUTS; BIENZ, PROC NATL ACAD SCI USA, vol. 97, 2000, pages 5351 - 5356 |
| TANABE ET AL., J BIOL CHEM, vol. 274, 1999, pages 27845 - 27856 |
| TERADA ET AL., NAT. BIOTECHNOL., vol. 20, 2002, pages 1030 - 1034 |
| TERADA ET AL., PLANT CELL PHYSIOL., vol. 41, 2000, pages 881 - 888 |
| TIJSSEN: "Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes", 1993, ELSEVIER, article "chapter 2" |
| TUTT ET AL., J. IMMUNOL., vol. 147, 1991, pages 60 - 69 |
| URBANOWICZ B.R. ET AL.: "Topology of Maize Mixed Linkage (1-3),(1-4)-beta-D-glucan Synthase at the Golgi Membrane", PLANT PHYSIOLOGY, vol. 134, 2004, pages 758 - 768, XP003008508 * |
| VAN DER KROL ET AL., BIOTECHNIQUES, vol. 6, pages 958 - 967 |
| VAN DER KROL ET AL., GEN. GENET., vol. 220, pages 204 - 212 |
| VAN DER KROL ET AL., NATURE, vol. 333, pages 866 - 869 |
| VAN DER KROL ET AL., PLANT CELL, vol. 2, no. 4, pages 291 - 299 |
| WATERHOUSE ET AL., PROC. NATL. ACAD. SCI. USA, vol. 95, 1998, pages 13959 - 13964 |
| WONG ET AL., PROC. NATL. ACAD. SCI. USA, vol. 99, 2002, pages 16325 - 16330 |
| WU ET AL., NAT GENET, vol. 26, 2000, pages 484 - 489 |
| YAO ET AL., ACTA PHYTOPHYSIOL. SIN., vol. 22, 1996, pages 431 - 436 |
| ZHANG ET AL., THEOR. APPL. GENET., vol. 106, 2003, pages 1139 - 1146 |
| ZHENG ET AL., PLANT J., vol. 4, 1993, pages 357 - 366 |
Cited By (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2222853A4 (en) * | 2007-12-24 | 2011-04-13 | Univ Melbourne | POLYSACCHARIDE SYNTHESIS (H) |
| US8618356B2 (en) | 2007-12-24 | 2013-12-31 | Monika Susanne Doblin | Polysaccharide synthases (H) |
| WO2010098378A1 (ja) * | 2009-02-27 | 2010-09-02 | 独立行政法人農業・食品産業技術総合研究機構 | オオムギのβ-グルカン欠失遺伝子、合成遺伝子及びその利用 |
| JP2010193847A (ja) * | 2009-02-27 | 2010-09-09 | National Agriculture & Food Research Organization | オオムギのβ−グルカン欠失遺伝子、合成遺伝子及びその利用 |
| US11690341B2 (en) | 2017-12-28 | 2023-07-04 | Carlsberg A/S | Cereal plants with improved cell wall properties |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2617594A1 (en) | 2007-02-08 |
| US20170342432A1 (en) | 2017-11-30 |
| JP2009502180A (ja) | 2009-01-29 |
| NZ565631A (en) | 2011-01-28 |
| CA2617594C (en) | 2016-08-02 |
| EP1920057A4 (en) | 2009-03-18 |
| US9708623B2 (en) | 2017-07-18 |
| EP1920057A1 (en) | 2008-05-14 |
| US10190130B2 (en) | 2019-01-29 |
| JP2013165713A (ja) | 2013-08-29 |
| US20080307549A1 (en) | 2008-12-11 |
| US20140366226A1 (en) | 2014-12-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP5695422B2 (ja) | デンプン代謝改変植物 | |
| US10190130B2 (en) | Polysaccharide synthases | |
| US20250092411A1 (en) | Methods for altering starch granule profile | |
| AU2008314508B2 (en) | Modulation of plant cell wall deposition | |
| US20140165231A1 (en) | Polysaccharide synthases (h) | |
| AU2006275315B2 (en) | Polysaccharide synthases | |
| AU2008204730B2 (en) | Boron transporter | |
| CN101356277A (zh) | 咖啡中与半乳甘露聚糖合成有关的核酸和蛋白质 | |
| WO2003014365A9 (en) | Plant glycogenin homologs and use thereof in starch modification | |
| AU2009295351B2 (en) | Modulation of plant cell wall deposition via HDZipI | |
| CN102822334A (zh) | 咖啡中半乳甘露聚糖含量的调节 | |
| WO2007070936A1 (en) | Zinc transporter | |
| Yang | A functional ortholog of the arabidopsis parvus/atgatl1 gene affects growth and development in the moss Physcomitrella patens | |
| AU2002355484A1 (en) | Plant glycogenin homologs and use thereof in starch modification |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 565631 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2008524314 Country of ref document: JP Ref document number: 2006275315 Country of ref document: AU Ref document number: 2617594 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006774788 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2006275315 Country of ref document: AU Date of ref document: 20060803 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006275315 Country of ref document: AU |
|
| WWP | Wipo information: published in national office |
Ref document number: 2006774788 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11997667 Country of ref document: US |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: 565631 Country of ref document: NZ |