WO2007070936A1

WO2007070936A1 - Zinc transporter

Info

Publication number: WO2007070936A1
Application number: PCT/AU2006/001927
Authority: WO
Inventors: Chunyuan Huang
Original assignee: The Australian Centre For Plant Functional Genomics Pty Ltd
Priority date: 2005-12-19
Filing date: 2006-12-19
Publication date: 2007-06-28

Abstract

The present invention relates generally to molecules which are differentially expressed in organisms in response to varying Zinc concentrations. More particularly, the present invention relates to Zinc transporter proteins, and associated nucleic acid sequences. The present invention is predicated, in part, on the identification of polypeptides and their corresponding nucleic acids which are expressed in response to Zn deficiency in an organism. As such, the present invention also provides, among other things, Zn transporter polypeptides, their encoding nucleic acids, and methods for their use.

Description

ZINC TRANSPORTER

FIELD OF THE INVENTION

The present invention relates generally to molecules which are differentially expressed in organisms in response to varying Zinc concentrations. More particularly, the present invention relates to Zinc transporter proteins, and associated nucleic acid sequences.

BACKGROUND OF THE INVENTION

Zinc (Zn) is an essential micronutrient for plants and other organisms. It is involved in a variety of biochemical processes and consequently plants must maintain adequate intracellular concentrations of Zn to support their normal growth and development. Large areas of the world's cropping lands have soils that are low in available Zn, which limits crop yields and results in a low Zn concentration in the harvested product. Moreover, low Zn can reduce the nutritive value of the grain to humans and of pasture to grazing animals.

The distribution of Zn in soils is heterogeneous, even following the addition of Zn fertilizer, because of the spatial and temporal variation in the availability of Zn. This results in roots being exposed to varying concentrations of available Zn, from inadequate to sufficient, as they grow through the soil. To cope with this variability, plants need to adjust their capacity to take up and recycle Zn to maintain adequate levels of Zn for normal growth. Zinc mobility within plants is relatively low and so plants have a limited ability to redistribute Zn within the root system to buffer themselves against variable supplies. Higher plants have evolved mechanisms of mineral acquisition and utilization to cope with the variation in nutrient supply, and Zn transporters play a crucial role in Zn homeostasis.

Accordingly, it would be desirable to identify the nucleotide and amino acid sequences which encode Zn transporters. The identification of such sequences would allow, among other things, the introduction, removal or modulation of Zn transport activity in a range of cells and/or organisms, including plant cells and plants.

Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part of the common general knowledge in any country.

SUMMARY OF THE INVENTION

The present invention is predicated, in part, on the identification of polypeptides (and their corresponding nucleic acids) which are expressed in response to Zn deficiency in an organism.

In an exemplary embodiment of the invention, a polypeptide has been isolated from barley (Hordeum vulgare), the expression of which is induced by Zn- deficiency in the plant. This polypeptide has been designated HvZIP7, and comprises the amino acid sequence set forth in SEQ ID NO: 2. The nucleic acid sequence which encodes the HvZIP7 polypeptide has also been determined. This nucleotide sequence is designated as HvZIP7 and comprises the nucleotide sequence set forth in SEQ ID NO: 1 .

Accordingly, in a first aspect, the present invention provides an isolated nucleic acid comprising a nucleotide sequence selected from the list consisting of: (i) a nucleotide sequence which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; (ii) a nucleotide sequence which encodes a functional homolog of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2;

(iii) a nucleotide sequence which is the complement or reverse complement of the nucleotide sequence referred to at (i) or (ii); and

(iv) a fragment of the nucleotide sequence referred to at any of (i), (ii) or (iii).

The nucleotide sequences of the first aspect of the invention are also referred to herein as "ZIP7 nucleic acids" or "ZIP7 nucleic acid sequences".

In specific embodiments, the isolated ZIP7 nucleic acid comprises a nucleic acid selected from the list consisting of:

(i) a nucleic acid comprising the nucleotide sequence set forth in

SEQ ID NO: 1 ;

(ii) a nucleic acid comprising a nucleotide sequence which is at least 78% identical to the nucleotide sequence set forth in SEQ ID NO:

1 ;

(iii) a nucleic acid which hybridizes to a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 1 under stringent conditions; (iv) a nucleic acid comprising a nucleotide sequence which is the complement or reverse complement of any one of (i) to (iii); and (v) a fragment of any of (i), (ii), (iii) or (iv).

Generally, the ZIP7 nucleic acids of the present invention encode Zn transporter polypeptides. - A -

In a second aspect, the present invention contemplates an isolated nucleic acid comprising a nucleotide sequence which encodes a Zn-responsive transcriptional control sequence, wherein said transcriptional control sequence is derived from a ZIP7 gene; or a functionally active fragment or variant of said isolated Zn-responsive transcriptional control sequence.

In a third aspect, the present invention provides a nucleic acid construct or vector comprising the nucleic acid of the first aspect of the invention and/or the transcriptional control sequence of the second aspect of the invention.

In a fourth aspect, the present invention provides a genetically modified cell comprising an introduced nucleic acid selected from the list consisting of:

(i) an isolated ZIP7 nucleic acid as described herein;

(ii) a Zn-responsive transcriptional control sequence as described herein; and

(iii) a nucleic acid construct or vector as described herein.

Furthermore, in a fifth aspect, the present invention provides a multicellular structure comprising one or more cells of the fourth aspect of the invention.

In a sixth aspect, the present invention provides a polypeptide selected from the list consisting of:

(i) a polypeptide comprising the amino acid sequence set forth in SEQ

ID NO: 2; (ii) polypeptide which is a functional homolog of (i), as defined herein; and (iii) a fragment of (i) or (ii).

The polypeptides of the invention are also referred to herein as ZIP7 polypeptides.

In a seventh aspect, the present invention provides an antibody or an epitope binding fragment thereof, raised against either a ZIP7 polypeptide or a polypeptide comprising a ZIP7 epitope.

In an eighth aspect, the present invention provides a method for modulating the rate, level and/or pattern of Zn uptake in a cell, the method comprising modulating the activity and/or expression of a ZIP7 polypeptide, or a functional homolog thereof, in a cell.

In one embodiment, the level and/or activity of the ZIP7 polypeptide is modulated by modulating the expression of a ZIP7 nucleic acid in the cell. In another embodiment, the expression of a ZIP7 nucleic acid is modulated by genetic modification of the cell.

In a ninth aspect, the present invention provides a cell with an altered rate, level and/or pattern of Zn uptake. In one embodiment, the cell of the ninth aspect of the invention is produced according to the method of the eighth aspect of the invention.

In a tenth aspect, the present invention also provides a multicellular structure, comprising one or more cells of the ninth aspect of the invention.

In an eleventh aspect, the present invention provides a method for diagnosing Zn deficiency in an organism, the method comprising:

(i) determining the level and/or pattern of expression of a ZIP7 nucleic acid in one or more cells of said organism; and/or

(ii) determining the level and/or pattern of expression of a ZIP7 polypeptide in one or more cells of said organism; wherein elevated expression of said nucleic acid or said polypeptide is indicative of Zn deficiency in said organism.

In a twelfth aspect, the present invention provides a method for treating Zn deficiency in an organism, the method comprising: (i) diagnosing a Zn deficiency in the plant according to the method of the eleventh aspect of the invention; and (ii) administering a Zn-containing substance to said organism.

Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers.

Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers < 400 > 1 (SEQ ID NO :1 ), < 400 > 2 (SEQ ID NO : 2), etc. A summary of the sequence identifiers is provided in Table 1 . A sequence listing is provided at the end of the specification.

TABLE 1 - Summary of Sequence Identifiers

Sequence Identifier Sequence

SEQ ID NO: 1 HvZIP7 nucleotide sequence

SEQ ID NO: 2 HvZIP7 amino acid sequence

SEQ ID NO: 3 ZIPF1 primer nucleotide sequence

SEQ ID NO: 4 ZIPR1 primer nucleotide sequence

SEQ ID NO: 5 ZIPF2 primer nucleotide sequence

SEQ ID NO: 6 ZIPR2 primer nucleotide sequence

SEQ ID NO: 7 ZIPF3 primer nucleotide sequence

SEQ ID NO: 8 ZIPR3 primer nucleotide sequence

DESCRIPTION OF EXEMPLARY EMBODIMENTS

It is to be understood that the following description is for the purpose of describing particular embodiments only and is not intended to be limiting with respect to the above description.

The present invention is predicated, in part, on the identification of polypeptides (and their corresponding nucleic acids) which are expressed in response to Zn deficiency in an organism. As described herein, the polypeptides of the invention are putative Zn transporter molecules.

In an exemplary embodiment of the invention, a polypeptide has been isolated from Hordeum vulgare, the expression of which is induced by Zn-deficiency in the plant. This polypeptide has been designated HvZIP7, and comprises the amino acid sequence set forth in SEQ ID NO: 2. The nucleic acid sequence which encodes the HvZIP7 polypeptide has also been determined. This nucleotide sequence is designated as HvZIP7 and comprises the nucleotide sequence set forth in SEQ ID NO: 1 .

Accordingly, in a first aspect, the present invention provides an isolated nucleic acid comprising a nucleotide sequence selected from the list consisting of:

(i) a nucleotide sequence which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; (ii) a nucleotide sequence which encodes a functional homolog of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2;

In the present invention, "isolated" refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide. An "isolated" nucleic acid molecule should also be understood to include a synthetic nucleic acid molecule, including those produced by chemical synthesis using known methods in the art or by in-vitro amplification (eg. polymerase chain reaction and the like).

The isolated nucleic acid molecules of the present invention may be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, the isolated nucleic acid molecules of the invention can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single- stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions. In addition, the isolated nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. The isolated nucleic acid molecules may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically, or metabolically modified forms.

As set out above, the present invention contemplates a nucleic acid that comprises a nucleotide sequence which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2, or a nucleic acid that comprises a nucleotide sequence which encodes a functional homolog of polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2. In one embodiment a "functional homolog" of a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 includes any polypeptide, wherein the expression of the polypeptide is induced by Zn-deficiency in a plant. In another embodiment, the functional homolog may be any polypeptide having Zn transporter activity (as described hereafter).

Notwithstanding the above, the functional homolog may comprise, for example, a polypeptide which has one or more amino acid insertions, deletions or substitutions relative to the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; a mutant form or allelic variant of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; an ortholog of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; an analog of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; and the like.

In one embodiment, a "functional homolog" of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2 also comprises at least 78% amino acid sequence identity, at least 80% amino acid sequence identity, at least 85% amino acid sequence identity, at least 90% amino acid sequence identity or at least 95%, 96%, 97%, 98%, 99% or 100% amino acid sequence identity to SEQ ID NO: 2.

When comparing amino acid sequences, the compared sequences should be compared over a comparison window of at least 50 amino acid residues, at least 100 amino acid residues, at least 200 amino acid residues, at least 300 amino acid residues or over the full length of any of SEQ ID NO: 2. The comparison window may comprise additions or deletions (ie. gaps) of about

20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19. 3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15, 1998).

(i) a nucleic acid comprising the nucleotide sequence set forth in

SEQ ID NO: 1 ; (ii) a nucleic acid comprising a nucleotide sequence which is at least

78% identical to the nucleotide sequence set forth in SEQ ID NO: 1 ;

(iii) a nucleic acid which hybridizes to a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 1 under stringent conditions;

(iv) a nucleic acid comprising a nucleotide sequence which is the complement or reverse complement of any one of (i) to (iii); and (v) a fragment of any of (i), (ii), (iii) or (iv).

As set out above, the nucleic acid referred to at (ii) comprises a nucleotide sequence having at least 78% nucleotide sequence identity to SEQ ID NO: 1. In other embodiments, the nucleic acid referred to at (ii) comprises at least 80% nucleotide sequence identity, at least 85% nucleotide sequence identity, at least 90% nucleotide sequence identity or at least 95%, 96%, 97%, 98%, 99% or 100% nucleotide sequence identity to SEQ ID NO: 1.

When comparing nucleic acid sequences to any of SEQ ID NO: 1 to calculate a percentage identity, the compared nucleotide sequences should be compared over a comparison window of at least 100 nucleotide residues, at least 200 nucleotide residues, at least 500 nucleotide residues, at least 1000 nucleotide residues or the full length of SEQ ID NO: 1. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19.3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994- 1998, Chapter 15, 1998).

As set out above, the invention also contemplates a nucleic acid which hybridises to a nucleic acid comprising the nucleotide sequence set forth in any of SEQ ID NO: 1 under stringent conditions. As used herein, "stringent" hybridisation conditions will be those in which the salt concentration is less than about 1 .5 M Na ion, typically about 0.01 to 1 .0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least 30⁰C. Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Stringent hybridisation conditions may be low stringency conditions, medium stringency conditions or high stringency conditions. Exemplary low stringency conditions include hybridisation with a buffer solution of 30 to 35% formamide, 1 M NaCI, 1 % SDS (sodium dodecyl sulphate) at 37°C., and a wash in 1 x to 2xSSC (20xSSC=3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55O. Exemplary moderate stringency conditions include hybridisation in 40 to 45% formamide, 1 .0 M NaCI, 1% SDS at 37^<€., and a wash in 0.5x to IxSSC at 55 to 60⁰C. Exemplary high stringency conditions include hybridisation in 50% formamide, 1 M NaCI, 1 % SDS at 37°C., and a wash in O.ixSSC at 60 to 65O. Optionally, wash buffers may comprise about 0.1 % to about 1 % SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours.

Specificity of hybridisation is also affected by post-hybridization wash conditions, the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the T_m can be approximated from the equation of Meinkoth and Wahl (Anal. Biochem. 138: 267-284, 1984), ie. T_m =81 .5⁰C +16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The T_m is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. T_m is reduced by about 1 °C for each 1 % of mismatching; thus, T_n, , hybridization, and/or wash conditions can be adjusted to hybridize to sequences of different degrees of complementarity. For example, sequences with >90% identity can be hybridised by decreasing the T_n, by about 10⁰C. Generally, stringent conditions are selected to be about 5⁰C lower than the thermal melting point (T_n,) for the specific sequence and its complement at a defined ionic strength and pH. However, high stringency conditions can utilize a hybridization and/or wash at, for example, 1 , 2, 3, or 4°C lower than the thermal melting point (T_n,); medium stringency conditions can utilize a hybridization and/or wash at, for example, 6, 7, 8, 9, or 10⁰C lower than the thermal melting point (T_m); low stringency conditions can utilize a hybridization and/or wash at, for example, 1 1 , 12, 13, 14, 15, or 20⁰C lower than the thermal melting point (T_n,). Using the equation, hybridization and wash compositions, and desired T_n, , those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a T_n, of less than 45⁰C (aqueous solution) or 32 °C (formamide solution), the SSC concentration may be increased so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (Laboratory Techniques in Biochemistry and Molecular Biology-Hybridization with Nucleic Acid Probes, Pt I, Chapter 2, Elsevier, New York, 1993), Ausubel et ai, eds. (Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-lnterscience, New York, 1995) and Sambrook et al. [Molecular Cloning: A Laboratory Manual, 2^nd ed., Cold Spring Harbor Laboratory Press, Plainview, NY, 1989). The ZIP7 nucleic acids of the present invention may be derived from any source. For example, the ZIP7 nucleic acids may be derived from an organism, such as a plant. Suitable plants include, for example, monocotyledonous angiosperms (monocots), dicotyledonous angiosperms (dicots), gymnosperms and the like.

Exemplary dicots which may be used in accordance with the present invention include, for example, Arabidopsis spp., Nicotiana spp., Medicago spp., soyabean, canola, oil seed rape, sugar beet, mustard, sunflower, potato, safflower, cassava, yams, sweet potato, other Brassicaceae such as Thellungiella halophila, among others.

In one embodiment, the plant is a monocot, in another embodiment a cereal crop plant and in another embodiment a barley plant. As used herein, the term "cereal crop plant" includes members of the Poales (grass family) that produce edible grain for human or animal food. Examples of Poales cereal crop plants which in no way limit the present invention include barley, wheat, rice, maize, millets, sorghum, rye, triticale, oats, teff, wild rice, spelt and the like. However, the term cereal crop plant should also be understood to include a number of non-Poales species that also produce edible grain and are known as the pseudocereals, such as amaranth, buckwheat and quinoa.

Alternatively, the ZIP7 nucleic acid may be a synthetic nucleic acid.

As set out above, the present invention also contemplates fragments of the isolated ZIP7 nucleic acids of the first aspect of the invention.

"Fragments" of a nucleotide sequence may be at least 10 nucleotides (nt), at least 20 nt, at least 50 nt, or at least 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, or 600 nt in length. These fragments have numerous uses that would be evident to one of skill in the art and include, but are not limited to, diagnostic probes and primers. Of course, larger fragments, such as those of greater than 600 nt in length may also be useful, as are fragments corresponding to most, if not all, of the nucleotide sequences SEQ ID NO: 1. By a fragment at least 10 nt in length, for example, is intended fragments which include 10 or more contiguous bases from, for example, the nucleotide sequence of SEQ ID NO: 1 .

In a further embodiment, the ZIP7 nucleic acid of the present invention encodes a Zn transporter polypeptide. As referred to herein, a "Zn transporter" refers to any polypeptide which is involved in the uptake and/or translocation of Zn in an organism or a cell, tissue, organ or part thereof. Generally, the term "Zn transporter" refers to a polypeptide which is involved in the uptake of Zn in plant roots and/or the translocation of Zn from one plant tissue from another, for example from the roots to another tissue of a plant, such as, for example, the foliage, flower and/or seed of a plant. In a further embodiment, the Zn transporter is a plasma membrane-bound Zn transporter and/or comprises one or more transmembrane amino acid domains.

The term "transcriptional control sequence" should be understood to include any nucleic acid sequence which effects the transcription, translation and/or post-translational modification of an operably connected nucleic acid or the transcript or protein encoded thereby. A control sequence may include, but is not limited to any of, a leader, polyadenylation sequence, propeptide sequence, promoter, enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator. Typically, a control sequence at least includes a promoter. The term "promoter" as used herein, describes any nucleic acid which confers, activates or enhances expression of a nucleic acid molecule in a cell. As set out above, the transcriptional control sequence of the present invention comprises a "Zn-responsive" transcriptional control sequence. As referred to herein, the term "Zn-responsive" should be understood to mean that the level and/or rate of transcription effected by the transcriptional control sequence is modulatable in response to Zn concentration. In one embodiment, the Zn responsive transcriptional control sequence is Zn-repressible, that is the level and/or rate of transcription effected by the transcriptional control sequence reduces with increasing Zn concentration.

In a further embodiment, the transcriptional control sequence of the present invention is substantially non-responsive to one or more other metal ions. For example, in a yet further embodiment, the transcriptional control sequence of the present invention is substantially non-responsive to manganese (Mn).

As set out above, the transcriptional control sequence is "derived from a ZIP7 gene". As such, in one embodiment, the transcriptional control sequence of the present invention is derived from a transcriptional control sequence which is naturally operably connected to a gene in an organism which includes a ZIP7 nucleic acid (as defined herein). In further embodiments, the transcriptional control sequence is derived from a transcriptional control sequence which is naturally operably connected to a ZIP7 gene in a plant, a monocot plant, a cereal crop plant or a barley plant.

For the purposes of the present specification, a transcriptional control sequence is regarded as "operably connected" to a given gene or other nucleotide sequence when the transcriptional control sequence is able to promote, inhibit or otherwise modulate the transcription of the gene or other nucleotide sequence.

The second aspect of the invention also contemplates functionally active fragments and variants of the Zn-responsive transcriptional control sequences describθd herein. As referred to herein, a "functionally active fragment or variant" refers to a fragment or variant of the Zn-responsive transcriptional control sequence which substantially retains Zn-responsiveness.

For example, "Functionally active fragments" of the transcriptional control sequence of the invention may be of any length wherein the transcriptional control sequence retains Zn-responsiveness. "Variants" of the transcriptional control sequence of the invention include, for example, transcriptional control sequences derived from orthologous genomic sequences, mutant transcriptional control sequences, synthetic variants, analogs and the like which retain the ability to control transcription of an operably connected nucleic acid in a Zn-responsive manner. For example, the term "variant" should be considered to specifically include transcriptional control sequences derived from nucleotide sequences which encode proteins orthologous to SEQ ID NO: 2; mutants of the transcriptional control sequence; variants of the transcriptional control sequence wherein one or more of the nucleotides within the sequence has been substituted, added or deleted; and the like.

The vector or construct of the invention may further comprise one or more of: an origin of replication for one or more hosts; a selectable marker gene which is active in one or more hosts; and/or one or more transcriptional control sequences.

As used herein, the term "selectable marker gene" includes any gene that confers a phenotype on a cell in which it is expressed, to facilitate the identification and/or selection of cells which are transfected or transformed with a genetic construct of the invention. "Selectable marker genes" include any nucleotide sequences which, when expressed by a cell, confer a phenotype on the cell that facilitates the identification and/or selection of these transformed cells. A range of nucleotide sequences encoding suitable selectable markers are known in the art. Exemplary nucleotide sequences that encode selectable markers include: antibiotic resistance genes such as ampicillin-resistance genes, tetracycline- resistance genes, kanamycin-resistance genes, the AURI-C gene which confers resistance to the antibiotic aureobasidin A, neomycin phosphotransferase genes (eg. nptl and nptll) and hygromycin phosphotransferase genes (eg. hpt); herbicide resistance genes including glufosinate, phosphinothricin or bialaphos resistance genes such as phosphinothricin acetyl transferase encoding genes (eg. baή, glyphosate resistance genes including 3-enoyl pyruvyl shikimate 5- phosphate synthase encoding genes (eg. aroA), bromyxnil resistance genes including bromyxnil nitrilase encoding genes, sulfonamide resistance genes including dihydropterate synthase encoding genes (eg. sul) and sulfonylurea resistance genes including acetolactate synthase encoding genes; enzyme- encoding reporter genes such as GUS and chloramphenicolacetyltransferase (CAT) encoding genes; fluorescent reporter genes such as the green fluorescent protein-encoding gene; and luminescence-based reporter genes such as the luciferase gene, amongst others.

Furthermore, it should be noted that the selectable marker gene may be a distinct open reading frame in the construct or may be expressed as a fusion protein with another polypeptide.

As set out above, the nucleic acid construct or vector may also comprise one or more transcriptional control sequences. In one embodiment, at least one transcriptional control sequence is operably connected to the nucleic acid sequence of the first aspect of the invention in the promoter. In a further embodiment, the one or more transcriptional control sequences at least includes a promoter. A promoter may regulate the expression of an operably connected nucleotide sequence constitutively, or differentially, with respect to the cell, tissue, organ or developmental stage at which expression occurs, in response to external stimuli such as physiological stresses, pathogens, or metal ions, amongst others, or in response to one or more transcriptional activators. As such, the promoter used in accordance with the methods of the present invention may include, for example, a constitutive promoter, an inducible promoter, a tissue-specific promoter or an activatable promoter.

The present invention contemplates the use of any promoter which is active in a cell of interest. As such, a wide array of promoters which are active in any of bacteria, fungi, animal cells or plant cells would be readily ascertained by one of ordinary skill in the art. However, in some embodiments of the invention, plant cells are used. Therefore, in these embodiments, plant-active constitutive, inducible, tissue-specific or activatable promoters may be used.

Plant constitutive promoters typically direct expression in nearly all tissues of a plant and are largely independent of environmental and developmental factors. Examples of constitutive promoters that may be used in accordance with the present invention include plant viral derived promoters such as the Cauliflower Mosaic Virus 35S and 19S (CaMV 35S and CaMV 19S) promoters; bacterial plant pathogen derived promoters such as opine promoters derived from Agrobactehum spp., eg. the Agrobacterium-όeήveό nopaline synthase (nos) promoter; and plant-derived promoters such as the rubisco small subunit gene (rbcS) promoter, the plant ubiquitin promoter (Pubi) and the rice actin promoter (Pact).

"Inducible" promoters include, but are not limited to, chemically inducible promoters and physically inducible promoters. Chemically inducible promoters include promoters which have activity that is regulated by chemical compounds such as alcohols, antibiotics, steroids, metal ions or other compounds. Examples of chemically inducible promoters include: alcohol regulated promoters (eg. see European Patent 637 339); tetracycline regulated promoters (eg. see US Patent 5,851 ,796 and US Patent 5,464,758); steroid responsive promoters such as glucocorticoid receptor promoters (eg. see US Patent 5,512,483), estrogen receptor promoters (eg. see European Patent Application 1 232 273), ecdysone receptor promoters (eg. see US Patent 6,379,945) and the like; metal-responsive promoters such as metallothionein promoters (eg. see US Patent 4,940,661 , US Patent 4,579,821 and US 4,601 ,978); and pathogenesis related promoters such as chitinase or lysozyme promoters (eg. see US Patent 5,654,414) or PR protein promoters (eg. see US Patent 5,689,044, US Patent 5,789,214, Australian Patent 708850, US Patent 6,429,362).

In another embodiment, the inducible promoter may be a Zn-responsive promoter. In one embodiment the Zn-responsive promoter comprises a transcriptional control sequence derived from a ZIP7 gene, as defined herein.

The inducible promoter may also be a physically regulated promoter which is regulated by non-chemical environmental factors such as temperature (both heat and cold), light and the like. Examples of physically regulated promoters include heat shock promoters (eg. see US Patent 5,447858, Australian Patent 732872, Canadian Patent Application 1324097); cold inducible promoters (eg. see US Patent 6,479,260, US Patent 6,184,443 and US Patent 5,847,102); light inducible promoters (eg. see US Patent 5,750,385 and Canadian Patent 132 1563); light repressible promoters (eg. see New Zealand Patent 508103 and US Patent 5,639,952).

"Tissue specific promoters" include promoters which are preferentially or specifically expressed in one or more specific cells, tissues or organs in an organism and/or one or more developmental stages of the organism. It should be understood that a tissue specific promoter may be either constitutive or inducible. Examples of plant tissue specific promoters include: root specific promoters such as those described in US Patent Application 2001047525; fruit specific promoters including ovary specific and receptacle tissue specific promoters such as those described in European Patent 316 441 , US Patent 5,753,475 and European Patent Application 973 922; and seed specific promoters such as those described in Australian Patent 612326 and European Patent application 0 781 849 and Australian Patent 746032.

The promoter may also be a promoter that is activatable by one or more transcriptional activators, referred to herein as an "activatable promoter". For example, the activatable promoter may comprise a minimal promoter operably connected to an Upstream Activating Sequence (UAS), which comprises, inter alia, a DNA binding site for one or more transcriptional activators.

As referred to herein the term "minimal promoter" should be understood to include any promoter that incorporates at least an RNA polymerase binding site and, optionally a TATA box and transcription initiation site and/or one or more CAAT boxes. In one embodiment wherein the cell is a plant cell, the minimal promoter may be derived from the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter. The CaMV 35S derived minimal promoter may comprise, for example, a sequence that substantially corresponds to positions -90 to +1 (the transcription initiation site) of the CaMV 35S promoter (also referred to as a -90 CaMV 35S minimal promoter), -60 to +1 of the CaMV 35S promoter (also referred to as a -60 CaMV 35S minimal promoter) or -45 to +1 of the CaMV 35S promoter (also referred to as a -45 CaMV 35S minimal promoter).

As set out above, the activatable promoter may comprise a minimal promoter fused to an Upstream Activating Sequence (UAS). The UAS may be any sequence that can bind a transcriptional activator to activate the minimal promoter. Exemplary transcriptional activators include, for example: yeast derived transcription activators such as Gal4, PdM , Gcn4 and Ace1 ; the viral derived transcription activator, VP16; Hap1 (Hach et al., J Biol Chem 278: 248- 254, 2000); Gaf1 (Hoe et al., Gene 215(2): 319-328, 1998); E2F (Albani et al., J Biol Chem 275: 19258-19267, 2000); HAND2 (Dai and Cserjesi, J Biol Chem 277: 12604-12612, 2002); NRF-1 and EWG (Herzig et al., J Cell Sci 1 13: 4263- 4273, 2000); P/CAF (Itoh et al., Nucl Acids Res 28: 4291 - 4298, 2000); MafA (Kataoka ef al., J Biol Chem 277: 49903-49910, 2002); human activating transcription factor 4 (Liang and Hai, J Biol Chem 272: 24088 - 24095, 1997); BcH O (Liu et al., Biochem Biophys Res Comm 320(1 ): 1 -6, 2004); CREB-H (Omori et al., Nucl Acids Res 29: 2154 - 2162, 2001 ); ARR1 and ARR2 (Sakai et al., Plant J 24(6): 703-71 1 , 2000); Fos (Szuts and Bienz, Proc Natl Acad Sci USA 97: 5351 -5356, 2000); HSF4 (Tanabθ et al., J Biol Chem 214: 218AS - 27856, 1999); MAML1 (Wu et al., Nat Genet 26: 484-489, 2000).

In one embodiment, the UAS comprises a nucleotide sequence that is able to bind to at least the DNA-binding domain of the GAL4 transcriptional activator. UAS sequences, which can bind transcriptional activators that comprise at least the GAL4 DNA binding domain, are referred to herein as UAS_G. In another embodiment, the UAS_G comprises the sequence S'-CGGAGTACTGTCCTCCGAG-S' or a functional homolog thereof.

As referred to herein, a "functional homolog" of the UASG sequence should be understood to refer to any nucleotide sequence which can bind at least the GAL4 DNA binding domain and which may comprise a nucleotide sequence having at least 50% identity, at least 65% identity, at least 80% identity or at least 90% identity with the UAS_G nucleotide sequence.

The UAS sequence in the activatable promoter may comprise a plurality of tandem repeats of a DNA binding domain target sequence. For example, in its native state, UAS_G comprises four tandem repeats of the DNA binding domain target sequence. As such, the term "plurality" as used herein with regard to the number of tandem repeats of a DNA binding domain target sequence should be understood to include, for example, at least 2 tandem repeats, at least 3 tandem repeats or at least 4 tandem repeats. As mentioned above, the control sequences may also include a terminator. The term "terminator" refers to a DNA sequence at the end of a transcriptional unit which signals termination of transcription. Terminators are 3'-non-translated DNA sequences generally containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'-end of a primary transcript. As with promoter sequences, the terminator may be any terminator sequence which is operable in the cells, tissues or organs in which it is intended to be used. Examples of suitable terminator sequences which may be useful in plant cells include: the nopaline synthase (nos) terminator, the CaMV 35S terminator, the octopine synthase (ocs) terminator, potato proteinase inhibitor gene (pin) terminators, such as the pinll and pinlll terminators and the like.

The present invention extends to all genetic constructs essentially as described herein. These constructs may further include nucleotide sequences intended for the maintenance and/or replication of the genetic construct in prokaryotes or eukaryotes and/or the integration of the genetic construct or a part thereof into the genome of a eukaryotic or prokaryotic cell.

In one embodiment, the vector or construct is adapted to be at least partially transferred into a plant cell via Agrobacterium-meά\a\.eά transformation. Accordingly, in another embodiment, the construct according to the twelfth aspect of the invention comprises left and/or right T-DNA border sequences.

Suitable T-DNA border sequences would be readily ascertained by one of skill in the art. However, the term "T-DNA border sequences" should be understood to include, for example, any substantially homologous and substantially directly repeated nucleotide sequences that delimit a nucleic acid molecule that is transferred from an Agrobacterium sp. cell into a plant cell susceptible to Agrobacterium-meύ\a.Xeό transformation. By way of example, reference is made to the paper of Peralta and Ream {Proc. Natl. Acad. Sci. USA, 82(15): 51 12- 51 16, 1985) and the review of Gelvin (Microbiology and Molecular Biology Reviews, 67(1 ): 16-37, 2003).

In one embodiment, the vector or construct is adapted to be transferred into a plant via Agrobacterium-meύ\aXeti transformation, the present invention also contemplates any suitable modifications to the genetic construct which facilitate bacterial mediated insertion into a plant cell via bacteria other than Agrobacterium sp., as described in Broothaerts ef al. {Nature 433: 629-633, 2005).

Those skilled in the art will be aware of how to produce the constructs described herein and of the requirements for obtaining the expression thereof, when so desired, in a specific cell or cell-type under the conditions desired. In particular, it will be known to those skilled in the art that the genetic manipulations required to perform the present invention may require the propagation of a genetic construct described herein or a derivative thereof in a prokaryotic cell such as an E. coli cell or a plant cell or an animal cell. Exemplary methods for cloning nucleic acid molecules are described in Sambrook et al. (2000, supra)

In a fourth aspect, the present invention provides a genetically modified cell comprising an introduced nucleic acid selected from the list consisting of: (i) an isolated ZiPl nucleic acid as described herein; (ii) a Zn-responsive transcriptional control sequence as described herein; and/or

(iii) a nucleic acid construct or vector as described herein.

As referred to herein, a "genetically modified cell" comprises a cell that is genetically modified with respect to the wild type of the cell. As such, a genetically modified cell may be a cell which has itself been genetically modified and the progeny of such a cell.

The nucleic acid may be introduced using any method known in the art which is suitable for the cell type being used, for example, those described in Sambrook and Russell (Molecular Cloning - A Laboratory Manual, 3^rd Ed., Cold Spring Harbor Laboratory Press, 2000).

In embodiments of the invention, wherein the cell is a plant cell, suitable methods for introduction of a nucleic acid molecule may include, for example: Agrobacterium-meύ\a.Xeό transformation, microprojectile bombardment based transformation methods and direct DNA uptake based methods. Roa-Rodriguez et al. (Agrobacterium -mediated transformation of plants, 3^rd Ed. CAMBIA Intellectual Property Resource, Canberra, Australia, 2003) review a wide array of suitable /Igrokacfemvm-mediated plant transformation methods for a wide range of plant species. Microprojectile bombardment may also be used to transform plant tissue and methods for the transformation of plants, particularly cereal plants, and such methods are reviewed by Casas et a/. [Plant Breeding Rev. 13: 235-264, 1995). Direct DNA uptake transformation protocols such as protoplast transformation and electroporation are described in detail in Galbraith et al. (eds.), Methods in Cell Biology Vol. 50, Academic Press, San Diego, 1995). In addition to the methods mentioned above, a range of other transformation protocols may also be used. These include infiltration, electroporation of cells and tissues, electroporation of embryos, microinjection, pollen-tube pathway, silicon carbide- and liposome mediated transformation. Methods such as these are reviewed by Rakoczy-Trojanowska (Cell. MoI. Biol. Lett. 7: 849-858, 2002). A range of other plant transformation methods may also be evident to those of skill in the art.

The introduced nucleic acid may be single stranded or double stranded. The nucleic acid may be transcribed into mRNA and translated into a protein; may encode a non-translated RNA such as an RNAi construct, cosuppression construct, antisense RNA, tRNA, miRNA, siRNA, ntRNA and the like; or may act directly in the cell. The introduced nucleic acid may be an unmodified DNA or RNA or a modified DNA or RNA which may include modifications to the nucleotide bases, sugar or phosphate backbones but which retain functional equivalency to a nucleic acid. The introduced nucleic acid may optionally be replicatθd in the cell; integrated into a chromosome or any extrachromosomal elements of the cell; and/or transcribed by the cell. Also, the introduced nucleic acid may be either homologous or heterologous with respect to the host cell. That is, the introduced nucleic acid may be derived from a cell of the same species as the genetically modified cell (ie. homologous) or the introduced nucleic may be derived from a different species (ie. heterologous). The transgene may also be a synthetic transgene.

The introduced nucleic acid referred to above may be maintained in the cell as a DNA molecule, as part of an episome (eg. a plasmid, cosmid, artificial chromosome or the like) or it may be integrated into the genomic DNA of a cell.

As used herein, the term "genomic DNA" should be understood in its broadest context to include any and all DNA that makes up the genetic complement of a cell. As such, the genomic DNA of a cell should be understood to include chromosomes, mitochondrial DNA, plastid DNA, chloroplast DNA, endogenous plasmid DNA and the like. As such, the term "genomically integrated" contemplates chromosomal integration, mitochondrial DNA integration, plastid DNA integration, chloroplast DNA integration, endogenous plasmid integration, and the like.

The isolated nucleic acid molecule may be operably connected to a promoter such that a cell may express a ZIP7 nucleic acid sequence.

The term "cell", as used herein, should be understood to include any cell type, including bacteria, archaea and eukaryotic cells including, for example, animal, plant and fungal cells. The cell may include, for example, a plant cell, a monocot plant cell, a cereal crop plant cell or a barley cell.

Furthermore, in a fifth aspect, the present invention provides a multicellular structure comprising one or more cells of the fourth aspect of the invention. As referred to herein, a "multicellular structure" includes any aggregation of one or more cells. As such, a multicellular structure specifically encompasses tissues, organs, whole organisms and parts thereof. Furthermore, a multicellular structure should also be understood to encompass multicellular aggregations of cultured cells such as colonies, plant calli, suspension cultures and the like.

As mentioned above, in one embodiment of the invention, the cell is a plant cell and as such, the present invention includes a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue (eg. callus or suspension culture), comprising one or more plant cells according to the fourth aspect of the invention.

In a sixth aspect, the present invention provides a polypeptide selected from the list consisting of: (i) a polypeptide comprising the amino acid sequence set forth in SEQ

ID NO: 2; (ii) a polypeptide which is a functional homolog of (i), as defined herein; and

(iii) a fragment of (i) or (ii).

In some embodiments, the ZIP7 polypeptides of the present invention comprise Zn transporter polypeptides, as hereinbefore defined.

As used herein, the term "polypeptide" should be understood to include any length polymer of amino acids. As such the term "polypeptide" should be understood to encompass, for example, peptides, polypeptides and proteins.

The ZIP7 polypeptides of the present invention may be composed of amino acids joined to each other by peptide bonds or modified peptide bonds, ie., peptide isosteres, and may contain amino acids other than the 20 gene- encoded amino acids. The isolated polypeptides of the present invention may be modified by either natural processes, such as post-translational processing, or by chemical modification techniques which are well known in the art.

Modifications can occur anywhere in the isolated polypeptide, including the peptide backbone, the amino acid side-chains and/or the termini. It will be appreciated that the same type of modification may be present in the same or varying degrees at several sites in a given isolated polypeptide. Also, an isolated polypeptide of the present invention may contain many types of modifications.

The polypeptides of the invention may be branched, for example, as a result of ubiquitination, and/or they may be cyclic, with or without branching. Cyclic, branched, and branched cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods.

Modifications include acetylation, acylation, ADP-ribosylation, amidation, covalent attachment of flavin, covalent attachment of a heme moiety, covalent attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross- linking, cyclization, disulfide bond formation, demethylation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxylation, glycosylation, GPI anchor formation, hydroxylation, iodination, methylation, myristoylation, oxidation, PEGylation, proteolytic processing, phosphorylation, prenylation, racemization, selenoylation, sulfation, transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination. (See, for instance, Proteins- Structure And Molecular Properties 2^nd Ed., Creighton (ed.), W. H. Freeman and Company, New York, 1993); Posttranslational Covalent Modification Of Proteins, Johnson (Ed.), Academic Press, New York, 1983; Seifter et al., Meth Enzymol 182: 626-646, 1990); Rattan et al., Ann NY Acad Sci 663: 48- 62,1992.).

As set out above, the present invention also provides polypeptide fragments. Polypeptide fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or region.

The polypeptide fragments may be at least 3, 4, 5, 6, 8, 9, 10, 1 1 , 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 1 10, 120, 130, 140, 150, 200, 250 or 300 amino acids in length. In one embodiment, the fragment comprises an amino acid sequence which is a fragment of the sequence set forth in SEQ ID NO: 2.

In another embodiment, the fragment comprises ZIP7 polypeptide functional activity. However, even if the fragment does not retain one or more biological functions of a ZIP7 polypeptide, other functional activities may still be retained.

For example, fragments may retain the ability to induce the production of, and/or bind to, antibodies which recognize a complete or mature form of a ZIP7 polypeptide. A peptide, polypeptide or protein fragment which has the ability to induce and/or bind to antibodies which recognize the complete or mature forms of an isolated ZIP7 polypeptide is referred to herein as a "ZIP7 epitope".

A ZIP7 epitope may comprise as few as three or four amino acid residues, but may also include, for example, at least 5 amino acids or at least 10 amino acid residues. Whether a particular ZIP7 polypeptide fragment retains such immunologic activities can readily be determined by methods known in the art. As such, in some embodiments, a Zl P7 polypeptide fragment may be, for example, a polypeptide comprising one or more ZIP7 epitopes.

A polypeptide comprising one or more ZIP7 epitopes may be produced by any conventional means for making polypeptides including, for example, synthetic and recombinant methods known in the art. In one embodiment, ZIP7 epitope containing polypeptide may be synthesized using known methods of chemical synthesis. For instance, Houghten has described a simple method for the synthesis of large numbers of peptides (Houghten, Proc. Natl. Acad. Sci. USA 82: 5131 -5135, 1985).

The isolated polypeptides and fragments thereof of the present invention may also be useful, for example, in the generation of antibodies that bind to ZIP7 polypeptides.

Such antibodies are useful, for example, in the detection and localization of ZIP7 polypeptides and in affinity purification of ZIP7 polypeptides. The antibodies may also routinely be used in a variety of qualitative or quantitative immunoassays using methods known in the art. For example see Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press 2^nd Ed., 1988).

Accordingly, in a seventh aspect, the present invention provides an antibody or an epitope binding fragment thereof, raised against either a ZIP7 polypeptide or a polypeptide comprising a ZIP7 epitope.

The antibodies of the present invention include, but are not limited to, polyclonal, monoclonal, multispecific, chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library and epitope-binding fragments of any of the above.

The term "antibody", as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin molecules, i.e., molecules that contain an antigen-binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGI , lgG2, lgG3, lgG4, IgAI and lgA2) or subclass of immunoglobulin molecule. The antibodies of the present invention may be monospecific, bispecific, trispecific, or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the present invention or may be specific for both a polypeptide of the present invention as well as for a heterologous epitope, such as a heterologous polypeptide or solid support material. For example, see PCT publications WO 93/17715; WO 92/08802; WO 91 /00360; WO 92/05793; Tutt et ai, J. Immunol. 147: 60-69, 1991 ; US Patents 4,474,893; 4,714,681 ; 4,925,648; 5,573,920; 5,601 ,819; and Kostelny et ai J. Immunol. 148: 1547-1553, 1992).

In one embodiment, the antibodies of the present invention may act as agonists or antagonists of a ZIP7 polypeptide. In further embodiments, the antibodies of the present invention may be used, for example, to purify, detect, and target the polypeptides of the present invention, including both in vitro and in vivo diagnostic and therapeutic methods. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of ZIP7 polypeptide in biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988).

The term "antibody", as used herein, should also be understood to encompass derivatives that are modified, eg. by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the antibody from binding to a ZIP7 polypeptide or an epitope thereof. For example, the antibody derivatives include antibodies that have been modified, eg., by glycosylation, acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Furthermore, any of numerous chemical modifications may also be made using known techniques. These include specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin, etc. Additionally, the derivative may contain one or more non- classical amino acids. Antibodies may be generated using methods known in the art, such as in vivo immunization, in vitro immunization, and phage display methods. For example, see Bittle et al. (J. Gen. Virol. 66: 2347-2354, 1985).

If in vivo immunization is used, animals may be immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid. For example, peptides containing cysteine residues may be coupled to a carrier using a linker such as maleimidobenzoyl-N- hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde.

For example, polyclonal antibodies to a ZIP7 polypeptide or a polypeptide comprising one or more ZIP7 epitopes can be produced using methods known in the art. For example, animals such as rabbits, rats or mice may be immunized with either free or carrier-coupled peptides. For instance, intraperitoneal and/or intradermal injection of emulsions containing about 100 micrograms of peptide or carrier protein may be used to induce the production of sera containing polyclonal antibodies specific for the antigen. Various adjuvants may also be used to increase the immunological response, depending on the host species, for example, Freund's (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art. Several booster injections may be needed, for example, at intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example, by ELISA assay using free peptide adsorbed to a solid surface. The titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antibodies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods known in the art.

As another example, monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof. For example, monoclonal antibodies can be produced using hybridoma techniques including those known in the art and taught, for example, in Harlow et al., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed., 1988) and Hammerling et al., in: Monoclonal Antibodies and T-CeII Hybridomas (Elsevier, NY, 1981 ). The term "monoclonal antibody" as used herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody" refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced.

Methods for producing and screening for specific antibodies using hybridoma technology are known in the art. For example, mice can be immunized with a polypeptide of the invention or a cell expressing such peptide. Once an immune response is detected, eg., antibodies specific for the antigen are detected in the mouse serum, the mouse spleen is harvested and splenocytes isolated. The splenocytes are then fused to any suitable myeloma cells, for example cells from cell line SP20, which is available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the invention. Ascites fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoma clones.

Antibody fragments which recognize one or more ZIP7 epitopes may also be generated by known techniques. For example, Fab and F(ab')2 fragments may be produced by proteolytic cleavage of immunoglobulin molecules, using enzymes such as papain (to produce Fab fragments) or pepsin (to produce F(ab')2 fragments). F(ab')2 fragments contain the variable region, the light chain constant region and the CH1 domain of the heavy chain.

The antibodies of the present invention can also be generated using various phage display methods known in the art. In phage display methods, functional antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized, for example, to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used in these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene III or gene VIII protein.

Examples of phage display methods that can be used to make the antibodies of the present invention include those disclosed by Brinkman ef al. (J. Immunol. Methods 182: 41 -50, 1995), Ames et al. (J. Immunol. Methods 184: 177-186, 1995), Kettleborough ef al. (Eur. J. Immunol. 24: 952-958, 1994), Persic ef al. (Gene 187: 9-18, 1997), Burton ef al. {Advances in Immunology 57: 191 -280, 1994); PCT publications WO 90/02809; WO 91/10737; WO 92/01047; WO 92/18619; WO 93/1 1236; WO 95/15982; WO 95/20401 ; and US Patents 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821 ,047; 5,571 ,698; 5,427,908; 5,516,637; 5,780,225; 5,658,727; 5,733,743 and 5,969,108.

After phage selection, the antibody coding regions from the phage can be isolated and used to generate whole antibodies or any other desired antigen binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria. For example, techniques to recombinantly produce Fab, Fab' and F(ab')2 fragments can also be employed using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al. (BioTechniques 12(6): 864-869, 1992); and Sawai et al. [AJRI 34:26-34, 1995); and Better etal. {Science 240: 1041 -1043, 1988).

Examples of techniques which can be used to produce single-chain Fvs and antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et al. {Methods in Enzymology 203: 46-88, 1991 ); Shu et al. {Proc. Natl. Acad. Sd. USA 90: 7995-7999, 1993); and Skerra et al. {Science 240: 1038- 1040, 1988).

In an eighth aspect, the present invention provides a method for modulating the rate, level and/or pattern of Zn uptake in a cell, the method comprising modulating the activity and/or expression of a ZIP7 polypeptide, or a functional homolog thereof, in the cell.

As set out above, the "cell" may be any suitable eukaryotic or prokaryotic cell. As such, a "cell" as referred to herein may be a eukaryotic cell including a fungal cell such as a yeast cell or mycelial fungus cell; an animal cell such as a mammalian cell or an insect cell; or a plant cell. Alternatively, the cell may also be a prokaryotic cell such as a bacterial cell (eg. an E. coli cell), or an archaea cell.

The cell may be, for example, a plant cell, a vascular plant cell, including a monocotyledonous or dicotyledonous angiosperm plant cell or a gymnosperm plant cell. In a further embodiment, the plant cell is a monocotyledonous plant cell.

In one embodiment, the monocotyledonous plant cell is a cereal crop plant cell, as previously defined.

As set out above, the present invention is predicated, in part, on modulating the level and/or activity of a ZIP7 polypeptide in a cell. As referred to herein, modulation of the "level" of a ZIP7 polypeptide should be understood to include an increase or decrease in the level or amount of a ZIP7 polypeptide in the cell. Similarly, modulation of the "activity" of a ZIP7 polypeptide should be understood to include an increase or decrease in, for example, the total activity, specific activity, half-life and/or stability of a Zl P7 polypeptide in the cell.

By "decreasing" is intended, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the level or activity of a ZIP7 polypeptide in the cell. By "increasing" is intended, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20 fold, 50-fold, 100-fold increase in the level of activity of a ZIP7 polypeptide in the cell.

"Modulating" should also be understood to include introducing a ZIP7 polypeptide into a cell which does not normally express the introduced enzyme, or the substantially complete inhibition of ZIP7 polypeptide activity in a cell that normally has such activity.

The present invention contemplates any means by which the level and/or activity of a ZIP7 polypeptide in a cell may be modulated. This includes, for example, methods such as the application of agents which modulate ZIP7 polypeptide activity in a cell, including the application of a ZIP7 polypeptide agonist or antagonist; the application of agents which mimic ZIP7 polypeptide activity in a cell; modulating the expression of a ZIP7 nucleic acid which encodes a ZIP7 polypeptide in the cell; or effecting the expression of an altered or mutated ZIP7 nucleic acid in a cell such that a ZIP7 polypeptide with increased or decreased specific activity, half-life and/or stability is expressed by the cell. In one embodiment, the level and/or activity of the ZIP7 polypeptide is modulated by modulating the expression of a ZIP7 nucleic acid in the cell.

The term "modulating" with regard to the expression of a ZIP7 nucleic acid may include decreasing or increasing the transcription and/or translation of a ZIP7 nucleic acid. By "decreasing" is intended, for example, a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91 %, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the transcription and/or translation of a ZIP7 nucleic acid. By "increasing" is intended, for example a 1 %, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or greater increase in the transcription and/or translation of a ZIP7 nucleic acid. Modulating also comprises introducing expression of a ZIP7 nucleic acid not normally found in a particular cell; or the substantially complete inhibition (eg. knockout) of expression of a Z\P7 nucleic acid in a cell that normally has such activity.

The present invention contemplates any means by which the expression of a ZIP7 nucleic acid may be modulated. For example, exemplary methods for modulating the expression of a ZIP7 nucleic acid include, for example: genetic modification of the cell to upregulate or downregulate endogenous ZIP7 nucleic acid expression; genetic modification by transformation with a ZIP7 nucleic acid; administration of a nucleic acid molecule to the cell which modulates expression of an endogenous ZIP7 nucleic acid in the cell; and the like.

In one embodiment, the expression of a ZIP7 nucleic acid is modulated by genetic modification of the cell. The term "genetically modified", as used herein, should be understood to include any genetic modification that effects an alteration in the expression of a ZIP7 nucleic acid in the genetically modified cell relative to a non-genetically modified form of the cell. Exemplary types of genetic modification include: random mutagenesis such as transposon, chemical, UV and phage mutagenesis together with selection of mutants which overexpress or underexpress an endogenous ZIP7 nucleic acid; transient or stable introduction of one or more nucleic acid molecules into a cell which direct the expression and/or overexpression of ZIP7 nucleic acid in the cell; inhibition of an endogenous ZIP7 polypeptide by site-directed mutagenesis of an endogenous ZIP7 nucleic acid; introduction of one or more nucleic acid molecules which inhibit the expression of an endogenous ZIP7 nucleic acid in the cell, eg. a cosuppression construct or an RNAi construct; and the like.

In another embodiment, the present invention contemplates increasing the level of ZIP7 polypeptide in a cell, by introducing and/or upregulating a ZIP7 nucleic acid into the cell. In one embodiment, the introduced ZIP7 nucleic acid may be placed under the control of a transcriptional control sequence such as a native ZIP7 promoter or a heterologous promoter.

However, in further embodiments the present invention also provides methods for down-regulating expression of a ZIP7 nucleic acid in a cell.

For example, with the identification of ZIP7 nucleic acid sequences, the present invention also facilitates methods such as knockout or knockdown of an endogenous ZIP7 nucleic acid in a cell using methods including, for example:

(i) insertional mutagenesis of a ZIP7 nucleic acid in a cell including knockout or knockdown of a ZIP7 nucleic acid in a cell by homologous recombination with a knockout construct (for an example of targeted gene disruption in plants see Terada et al., Nat. Biotechnol. 20: 1030-1034, 2002);

(ii) post-transcriptional gene silencing (PTGS) or RNAi of a ZIP7 nucleic acid in a cell (for review of PTGS and RNAi see Sharp, Genes Dev.

15(5): 485-490, 2001 ; and Hannon, Nature 418: 244-51 , 2002);

(iii) transformation of a cell with an antisense construct directed against a ZIP7 nucleic acid (for examples of antisense suppression in plants see van der Krol et al., Nature 333: 866-869; van der Krol et al.,

BioTechniques 6: 958-967; and van der Krol et al., Gen. Genet. 220: 204-212); (iv) transformation of a cell with a co-suppression construct directed against a ZIP7 nucleic acid (for an example of co-suppression in plants see van der Krol et al., Plant Cell 2(4): 291 -299); (v) transformation of a cell with a construct encoding a double stranded

RNA directed against a ZIP7 nucleic acid (for an example of dsRNA mediated gene silencing see Waterhouse et al., Proc. Natl. Acad. Sci.

USA 95: 13959-13964, 1998); and

(vi) transformation of a cell with a construct encoding an si RNA or hairpin RNA directed against a ZIP7 nucleic acid (for an example of siRNA or hairpin RNA mediated gene silencing in plants see Lu ef al., Nucl.

Acids Res. 32(21 ): e171 ; doi:10.1093/nar/gnh170, 2004).

The present invention also facilitates the downregulation of a ZIP7 nucleic acid in a cell via the use of synthetic oligonucleotides, for example, siRNAs or microRNAs directed against a ZIP7 nucleic acid (for examples of synthetic siRNA mediated silencing see Caplen et ai, Proc. Natl. Acad. Sci. USA 98:

9742-9747, 2001 ; Elbashir et al., Genes Dev. 15: 188-200, 2001 ; Elbashir et al.,

Nature 41 1 : 494-498, 2001 ; Elbashir et al., EMBO J. 20: 6877-6888, 2001 ; and Elbashir et al., Methods 26: 199-213, 2002).

In addition to the examples above, the introduced nucleic acid may also comprise a nucleotide sequence which is not directly related to a ZIP7 nucleic acid but, nonetheless, may directly or indirectly modulate the expression of a ZIP7 nucleic acid in a cell. Examples include nucleic acid molecules that encode transcription factors or other proteins which promote or suppress the expression of an endogenous ZIP7 nucleic acid molecule in a cell; and other non-translated RNAs which directly or indirectly promote or suppress endogenous ZIP7 polypeptide expression and the like. In order to effect expression of an introduced nucleic acid in a genetically modified cell, where appropriate, the introduced nucleic acid may be operably connected to one or more control sequences, as previously described.

In a ninth aspect, the present invention provides a cell with an altered rate, level and/or pattern of Zn uptake in a cell.

In one embodiment, the cell of the ninth aspect of the invention is produced according to the method of the eighth aspect of the invention.

In a tenth aspect, the present invention also provides a multicellular structure, as hereinbefore defined, wherein the multicellular structure comprises one or more cells of the ninth aspect of the invention.

(i) determining the level and/or pattern of expression of the nucleic acid of ZIP7 nucleic acid in one or more cells of said organism; and/or (ii) determining the level and/or pattern of expression of a ZIP7 polypeptide in one or more cells of said organism; wherein elevated expression of said nucleic acid or said polypeptide is indicative of Zn deficiency in said organism.

Methods for determining the level and/or pattern of expression of a nucleic acid or polypeptide are known in the art. Exemplary methods of the detection of RNA expression include methods such as quantitative reverse-transcriptase PCR (eg. see Burton et al., Plant Physiology 134: 224-236, 2004), in-situ hybridization (eg. see Linnestad et al., Plant Physiology 1 18: 1 169-1 180, 1998); northern blotting (eg. see Mizuno et al., Plant Physiology 132: 1989- 1997, 2003); and the like. Exemplary methods for the expression of a polypeptide include Western blotting (eg. see Fido et al., Methods MoI Biol. 49: 423-37, 1995); ELISA (eg. see Gendloff et ah, Plant Molecular Biology 14: 575-583); immunomicroscopy (eg. see Asghar et al, Protoplasma 177: 87-94, 1994) and the like.

In one embodiment, the method of the eleventh aspect of the invention is adapted to diagnosing Zn deficiency in a plant. In further embodiments, the method of the eleventh aspect of the invention is adapted to diagnosing Zn deficiency in, for example, a monocot plant or a cereal crop plant. In some embodiments, the plant is a non-genetically modified or wild-type plant.

In a twelfth aspect, the present invention provides a method for treating Zn deficiency in an organism, the method comprising:

(i) diagnosing a Zn deficiency in the plant according to the method of the eleventh aspect of the invention; and (ii) administering a Zn-containing substance to said organism.

As would be evident to one of skill in the art, the Zn-containing substance must comprise a least a portion of bioavailable Zn, which the organism can take up and utilise.

In one embodiment, the method of the twelfth aspect of the invention may also adapted to treating Zn deficiency in a plant, including, for example, a monocot plant or a cereal crop plant.

Zn sulfate is one most commonly used Zn source for plants, due to its high water solubility. However, other Zn containing compounds, as shown in Table 2, may also be used.

TABLE 2 - Zn-containing compounds suitable for soil application Name Formula Content (% Zn)

Zinc sulfate ZnSO₄ . H₂O 36

ZnSO₄ . 7 H₂O 23 Zinc carbonate ZnCO₃ 52-56

Zinc chloride ZnCI₂ 48-50

Zinc chelate Na₂Zn-EDTA 14

Na₂Zn-HEDTA 9

Zinc oxide ZnO 60-80

The Zn containing substance may be applied either to the soil, for example as a Zinc sulfate or Zinc sulfate/sand mix broadcast. Alternatively, Zn may also be applied as a foliar spray, for example a 0.5% ZnSO₄ solution may be used.

Finally, reference is made to standard textbooks of molecular biology that contain methods for carrying out basic techniques encompassed by the present invention, including DNA restriction and ligation for the generation of the various genetic constructs described herein. See, for example, Maniatis ef a/., Molecular Cloning: A Laboratory Manual (Cold Spring Harbor Laboratory Press, New York, 1982) and Sambrook et al. (2000, supra).

The present invention is further described by the following non-limiting examples:

BRIEF DESCRIPTION OF THE FIGURES

Figure 1 shows the effect of Zn resupply on growth and Zn concentrations of plants treated with two rates of Zn. Barley plants were grown with 0.5 μM Zn (+Zn) or 0.005 μM Zn (-Zn) for 13 days, and then the plants of both Zn treatments were grown with the same concentration of Zn (0.5 μM) for additional 10 days. Plants were harvested at D 13, D 15, D19 and D23, respectively. Standard errors (n=4) are shown as vertical bars.

Figure 2 shows the effect of Zn resupply on Zn uptake rates of plants treated with two rates of Zn. Barley plants were grown with 0.5 μM Zn (+Zn) or 0.005 μM Zn (-Zn) for 13 days, and then the plants of both Zn treatments were supplied with 0.5 μM Zn for additional 10 days. Plants were harvested at D13, D15, D19 and D23, respectively. The uptake rate is calculated with the equation of Williams (Aust J Sci Res B1 : 333-361 ,1948). Standard errors (n=4) are shown as vertical bars.

Figure 3 shows the effect of Zn resupply on shoot/root ratios of plants treated with two rates of Zn. Barley plants were grown with 0.5 μM Zn (+Zn) or 0.005 μM Zn (-Zn) for 13 days, and then the plants of both Zn treatments were supplied with 0.5 μM Zn for additional 10 days. Plants were harvested at D13, D15, D19 and D23, respectively. A, shoot:ratios of dry matter. B, shoot:root ratios of Zn content. Standard errors (n=4) are shown as vertical bars.

Figure 4 shows the deduced amino acid sequence of HvZIP7 and its alignment with closely-related ZIP proteins from other plant species. Identical amino acids are indicated with dark shading, and similar amino acids are indicated with light shading. Transmembrane domains are shown as lines above the sequences.

The highly conserved histidine and serine residues in the fourth transmembrane domain and histidine and glutamate residues in the fifth transmembrane domain are indicated with asterisks below. The conservation of histidine residues in the histidine-rich region between transmembrane domains III and IV in barley

(HvZIP7) and rice (OsZIP7) is indicated with a thick line below and asterisks above the histidine residue. Species designations and corresponding Genbank accession numbers are: Hordeum vulgare (HvZI P7, SEQ ID NO: 2), Oryza sativa (OsZIP7, AK071272), Medicago truncatula (MtZIP5, AY339057), Thlaspi caerulescens (TcZNTI , AF133267), and Arabidopsis thaliana (AtZ I P4, U95973;

AtZIP9, AF369912).

Figure 5 shows a maximum parsimony phylogenetic tree for the HvZIP7 amino acid sequence (SEQ ID NO: 2) and a range of other ZIP proteins. Species designations and GenBank accession numbers for corresponding ZIP genes are: Hv, Hordeum vulgare (HvZIP7: SEQ ID NO: 2); Os, Oryza sativa (OsZIPI : AY302058, OsZIP2: AY302059, OsZIP3: AY323915, OsZIP4: AB126089, OsZIP5: AB126087, OsZIP6: AB126088, OsZIP7: AB126090); At, Arabidopsis thaliana (AtZIPI : AAC24197, AtZIP2: AAC24198, AtZIP3: AAC24199, AtZIP4: AAB65480, AtZIP5: AAL38432, AtZIP6: AAL38433, AtZIP7: AAL38434, AtZIPδ: AAL83293, AtZIP9: AAL38435, AtZIPI O: AAL38436, AtZIP1 1 : AAL67953, AtZIPI 2: AAL38437); Mt, Medicago trυncatυla (MtZIPI : AY339054, MtZIP2: AAG09635, MtZIP3: AY339055, MtZIP4: AY339056, MtZIP5: AY339057, MtZIP6: AY339058, MtZIP7: AY339059); Tc, Thlaspi caerulescens (TcZNTI : AAF61374).

Figure 6 shows the effect of Zn resupply on the level of HvZIP7 transcripts and Zn concentrations in plants treated with two rates of Zn. Barley plants were grown with 0.5 μM Zn (+Zn) or 0.005 μM Zn (-Zn) for 13 days, and then the plants of both Zn treatments were supplied with 0.5 μM Zn for additional 10 days. Plants were harvested at D13, D15, D19 and D23, respectively. The levels of HvZIP7 transcripts were obtained by quantitative real time PCR (qPCR). Three replicates were used for qPCR and four replicates for Zn concentrations. Standard errors are shown as vertical bars.

Figure 7 shows the relationship between the mean Zn concentration and level of HvZIP7 transcripts levels in the shoots and roots from plants harvested at D13, D15, and D19.

Figure 8 shows the effect of Mn supply on the level of HvZIP7 transcripts in the roots. Barley plants were grown in the soil supplemented with 15 mg Mn kg^"1 soil (-Mn) or 100 mg Mn kg^"1 dry soil for 28 days. The detail of plant growth and

Mn nutrition was described by Huang et al. {Plant Physiol. 124: 415-422, 2000).

The levels of HvZIP7 transcripts were obtained by quantitative real time PCR with three replicates.

Figure 9 shows the effect of Zn resupply on Mn and Cu concentrations in plants treated with two rates of Zn. Barley plants were grown with 0.5 μM Zn (+Zn) or 0.005 μM Zn (-Zn) for 13 days and then grown in a complete nutrient solution containing 0.5 μM Zn for an additional 10 days. The concentrations of Mn, Cu, Fe and P in the nutrient solution were 0.4 μM, 0.1 μM, 10 μM and 100 μM, respectively. Plants were harvested at D13, D15, D19 and D23, respectively. Standard errors (n=4) are shown as vertical bars.

Figure 10 shows Zn accumulation in suspension cells of six HvZIP7- overexpressing transgenic barley lines after treatment with two rates of Zn.

Figure 1 1 shows an electrophoresis gel indicating the results of PCR analysis of two cell lines derived from pMDC32/HvZIP7.

EXAMPLE 1 Materials and Methods

(i) Plant materials

The two-row barley (Hordeum vulgare L) genotype Lofty Nijo, which exhibits sensitivity to Zn deficiency, was used for the experiment. Seeds were surface- sterilized with 70% ethanol for one min, 3% hypochlorite for 5 min, rinsed with deionized water and incubated in petri dishes for two days at room temperature. Seeds with emerged radicles were put into a seedling cup which was placed in the lid of a black plastic container. Each container contained four seedling cups and was filled with one litre of nutrient solution. Each cup contained 3 plants for the first two harvests at 13 days after seed imbibition (D13) and D15 or 2 plants for the last two harvests at D19 and D23. The basal nutrients were as follows (in μM); Ca(NOa)₂, 1000; NH₄H₂PO₄, 100; MgSO₄, 250; KCI, 50; H₃BO₃, 12.5; Fe- HEDTA, 10; MnSO₄, 0.4; CuSO₄, 0.1 ; NiSO₄, 0.1 and MoO₃, 0.1 . 2-[N- morpholino] ethane-sulfonic acid-KOH of 2 mM was used to buffer pH to 6.0. There were two Zn treatments, -Zn (0.005 μM Zn supplied as ZnSO₄) and +Zn (0.5 μM Zn). At 13 days after imbibition, Zn-deficient plants were resupplied with adequate Zn (0.5 μM ZnSO₄). Macronutrients and micronutrients were supplied at half and full strength, respectively until day 10, and all nutrients at full strength thereafter. The nutrient solution was aerated continuously and replaced at day 10, 13, 15, and 19. The pH of the solution was maintained at pH 6.0 during the experiment.

Plants were grown in a growth room at 20/15⁵C day/night temperature and a photoperiod of 14 hr day/10 hr night at 300 μmol m^"2 s^"1 photosynthetic photon flux density at the plant level. At each harvest, two sets of plants were removed from each container. One set was separated into roots and shoots, frozen immediately in liquid nitrogen and stored at -80 ⁰C for the transcript analysis and gene cloning. The other set, was used to measure dry matter and nutrient concentrations. The roots were rinsed briefly in deionized water, excess water was blotted on fresh laboratory tissues, the roots and shoots were separated, and oven-dried at 65 ⁵C for 48 hr. The dry plant samples were used for mineral element analysis by inductively coupled plasma spectrophotometer (as described by Zarcinas et al., Commun Soil Sci Plant Anal λ 8: 131-146, 1987).

(ii) Zn uptake rates

Zn uptake rates per unit root dry matter (U; μg nutrient g^"1 root DM^"1 day) were calculated according to Williams (1948, supra).

where R₁ and R₂ are initial and final root weights; M₁ and M₂ are the initial and final total plant nutrient contents, and I₁ and X₂ are the two harvest times.

(iii) Statistical analysis

The experiment was set up as a completely randomised design with four replications. Results were analysed using the GENSTAT statistical software package (Windows Version) and differences between means were tested using Least Significant Difference (LSD) test at P=O.05.

(iv) Expression analysis of HvZIP7

Total RNA samples from both shoots and roots of the two Zn treatments were prepared using Trizol reagent according to the manufacturer's instructions (Invitrogen, Palo Alto, CA). Total RNA was treated with DNase I using the DNA free kit (Ambion, Austin, TX) to remove contamination of genomic DNA, and then RNA integrity was checked on agarose gel. Samples of cDNA were prepared from total RNA of 2 μg using SuperScriptTM III reverse transcriptase, according to manufacturer's instructions (Invitrogen, Palo Alto, CA). The reaction was incubated at 50 °C for 45 min and at 70 °C for 15 min to inactivate the enzyme.

The transcript levels of HvZIP7 and four control genes (barley α-tubulin, heat shock protein 70, cyclophilin and glyceraldehydes-3-phosphate dehydrogenase) were determined by real-time quantitative RT-PCR on Rotor 2000 Real Time Cycler (Corbett Research, Sydney) as described by Burton et al. (2004, supra). The conserved nucleotides between a barley EST (GenBank accession no. BU993064) and OsZiP7 (GenBank accession no. AK071272) were used to design a primer pair, ZIPF1 (5' TGGAAGGCATCCTCGACTCTG; SEQ ID NO: 3) and ZIPR1 (5' CAATCAGATGGACACAGGCACAT; SEQ ID NO: 4) for amplification of HvZIP7.

(v) HvZIP7 cloning

Two non-overlapping partial barley cDNAs (Genbank accession number: BE603012 and BU993064) with high identity to OsZIP7 were used in primer design to obtain the complete coding sequence of HvZIP7. The forward primer

ZIPF2 (5' CATGATGATCGGTGTAGCAG; SEQ ID NO: 5) was located in BE603012 and the reverse primer ZIPR2 (5' AGTTCAGGCCCAGACTGC; SEQ ID NO: 6) was in BU993064. RT-PCR with the two primers was used to amplify the sequence from a total RNA sample derived from a Zn-deficient barley plant. A single PCR product of 1 165 bp was obtained and sequenced.

EXAMPLE 2 Plant growth and Zn nutrition in response to Zn resupply

At day 13 after seed imbibition (D13), a small but significant reduction in dry matter was observed in the shoots of plants grown at low Zn (Figure 1 A), and there was no difference in dry matter of roots between two Zn treatments (Figure 1 B). The Zn concentration in the shoots of -Zn treated plants at D13 was 6 μg g^"1 dry weight (Figure 1 C), which is well below that required for normal growth (ie. 20 μg g^"1 dry weight). The Zn concentration in the roots of the -Zn treated plants at D13 was 1 1 μg g^"1 dry weight, which was higher than that in the shoots (Figure 1 D). After the resupply of Zn at D13, the differences in dry matter production of shoots and roots between two Zn treatments remained in all three subsequent harvests (Figure 1A, B). The concentrations of Zn in the shoots of +Zn treated plants were relatively constant, and above the critical level for Zn in all harvests (Figure 1 C). The Zn concentration in the shoots of the -Zn treated plants increased sharply following the resupply of Zn, reaching a level equal to that in the +Zn treated plants two days after Zn resupply (D15), and achieving a peak value at D19 approximately 170% higher than that in the shoots of +Zn treated plants. After D19, the Zn concentration decreased, but was still greater than the +Zn treatment (Figure 1 C). The changes in Zn concentrations of roots showed a trend similar to that of shoots although the Zn concentration of the roots in -Zn treated plants increased more slowly than that in the shoots, and was below or equal to that in the roots of the control (Figure 1 D). The Zn concentration in the roots of -Zn treated plants at D15 was approximately 60% of that in +Zn treatment (Figure 1 D). The Zn uptake rate of -Zn treated plants was approximately twice that of +Zn treated plants between D13 and D15 (Figure 2). The Zn uptake rate in -Zn treated plants reduced slightly in the period of D15-19, and fell to a level similar to that of +Zn treated plants in the period of D19-23 (Figure 2).

EXAMPLE 3

Effect of Zn resupply on partitioning of dry matter and Zn between shoots and roots

The mean shoot:root dry matter ratio of -Zn treated plants was lower than that of +Zn treated plants at D13 and D15, whereas no differences in the shoot:root dry matter ratios were found between the two Zn treatments at D19 and D23 (Figure 3A). This indicates that more dry matter is allocated to the roots than to the shoots of the Zn-deficient plants. The shoot:root ratio of the - Zn plants was relatively stable, whereas the shoot:root ratio of +Zn plants fell during the course of the experiment. The values for the two Zn treatments converged at the final harvest (Figure 3A). The falling shoot:root ratio of the +Zn plants indicates a developmentally-related change in dry matter partitioning. In contrast, after Zn was resupplied to the -Zn treatment there was an increase in plant growth but the shoot:root ratio remained stable. This suggests that the proportional increase in shoot and root growth was similar.

When grown with adequate Zn throughout the experiment, there was a relatively constant partitioning of Zn to the shoots (shoot:root ratio of Zn content, 2.3-2.6) (Figure 3B). By contrast, Zn-deficient plants initially had proportionally more Zn in roots, but after being resupplied with Zn the Zn shoot:root ratio increased rapidly and exceeded the control (Figure 3B). The preferential partitioning of Zn to the shoots occurred only in the -Zn plants (Figure 3B), which led to a much higher concentration of Zn in the shoots of the -Zn plants than in the shoots of the +Zn plants (Figure 1 B) because there was a relatively constant partitioning of dry matter in the -Zn plants after resupply of Zn (Figure 3A).

EXAMPLE 4

Expression of HvZIP7 in response to Zn resupply

No ZIP genes from barley have yet been described to play a role in Zn homeostasis. By using available ZIP gene sequences of rice, a number of barley EST sequences homologous to rice ZIP genes were identified. Transcripts analyses showed that one of the barley ZIP genes corresponding to the uncharacterized OsZ/P7 gene at rice chromosome 5 (GenBank accession no: AC136519) was highly responsive to Zn deficiency. This barley gene was designated HvZIP7. By using two partial cDNA sequences of HvZIP7 and reverse transcription-polymerase chain reaction (RT-PCR), the complete open reading frame of /-Λ/Z/P7 was obtained.

There were eight putative transmembrane spanning domains in HvZIP7 as with many other ZIP proteins (see Figure 4), and a variable cytoplasmic loop containing a histidine-rich region between transmembrane domains III and IV (Figure 4), which may serve as a metal binding site. Although the number and spacing of the histidine residues in this region were variable among all six proteins, the HvZIP7 protein sequence was more similar to that of OsZIP7 than other ZIP proteins (Figure 4). The conservation of HS residues in domain IV and HE residues in domain V also were present in the HvZIP7 protein (Figure 4). These histidine and charged residues may be involved in cation transport across the membrane. HvZIP7 is likely to be a plasma membrane protein predicted by WOLF PSORT.

The expression of HvZIP7 was highly responsive to Zn deficiency, and thus it was used to monitor Zn deficiency responses in the Zn resupply experiment (data not shown). A low level of HvZIP7 transcripts (approximately 0.05 x 10⁶ normalized copies μg^"1 RNA) was detected in the shoots of +Zn treated plants at D13, and similar levels also were present at both D15 and D19 (Figure 6A). The level of HvZIP7 transcripts was strongly induced in the shoots of the -Zn plants at D13 before resupply of Zn and increased to 19.7 times that in the shoots of +Zn treated plants (Figure 6A). The level of HvZIP7 transcripts in the shoots of -Zn treated plants rapidly declined after resupply of Zn, and fell below that in the +Zn treatment two days after resupply of Zn and remained low at D19 (Figure 6A). A low level of HvZIP7 transcripts similar to those in the shoots also was detected in the roots of +Zn treated plants at three harvests (Figure 6B). An enhanced level of HvZiP7 transcripts (4.3 fold that in the roots of +Zn treated plants) was observed in the roots of -Zn treated plants at D13. The level of HvZIP7 transcripts in the roots of -Zn treated plants was reduced after resupply of Zn, but was 2.7 fold higher than that in the +Zn roots two days after resupply of Zn (Figure 6B). A similar level of HvZIP7 transcripts was observed in the roots of both Zn treatments at D19 (Figure 6B). These results showed that the expression of HvZIP7 in both shoots and roots was closely linked to Zn resupply, and the repression of the induced HvZIP7 expression in the roots was much slower than that in the shoots after resupply of Zn (Figure 6A, B).

To reveal the relationship between tissue Zn concentrations and the transcript levels of HvZIP7, Zn concentrations in plant fresh weight were calculated to better represent Zn concentrations in cells of both shoots and roots by removing the difference in water content between shoot and root tissues. As shown in Figure 6C, D, Zn concentrations of roots on a fresh weight basis were slightly lower than those of shoots in the +Zn plants. By contrast, Zn concentrations of roots calculated in dry weight basis were much higher than those of shoots in the +Zn plants (Figure 1 C, D). The fresh weight-based Zn concentration of shoots in the -Zn plants was similar to that in the +Zn plants two days after resupply of Zn (D15), whereas the fresh weight-based Zn concentration of roots in the -Zn plants were much lower than that of shoots in the -Zn plants (Figure 6C, D). The fresh weight-based Zn concentration of both shoots and roots in the -Zn plants was equal to or higher than that in the +Zn plants six days after resupply of Zn (D19 in Figure 6). The reduction in the level of HvZIP7 transcripts in the roots and shoots of the -Zn plants were closely linked to the fresh weight-based Zn concentrations in the plant tissue (Figure 6). Zinc concentration and the level of HvZIP7 transcripts in both shoots and roots were strongly correlated (Figure 7). The overlapping values of roots and shoots in the plot suggest that HvZIP7 has a similar sensitivity to Zn concentrations in both shoot and root tissues. In addition, there is a very narrow range of Zn concentrations (2.0 - 2.5 μg Zn g^"1 fresh weight), over which the level of transcript changes. The critical level of Zn for barley growth, 20 μg Zn g^"1 on a dry weight basis, falls within this range of Zn concentrations in a fresh weight basis (Figure 7). We also examined HvZiP7 expression in the roots of Mn-sufficient and Mn-deficient plants, and saw no response of HvZIP7\o Mn deficiency (Figure 8).

EXAMPLE 5 Mn, Cu, Fe and P nutrition in response to Zn resupply

There was no effect of Zn deficiency on Mn concentrations in both shoots and roots of Zn-deficient plants compared with those found in +Zn plants at D13 (Figure 9A, B). A sharp increase in Mn concentrations was observed in the roots of both Zn treatments after resupply of Zn for two days (D15), and the Mn concentrations in both Zn treatments gradually fell after D15 (Figure 9B). The Mn concentrations in the roots of -Zn plants were higher than those in +Zn plants after resupply of Zn (Figure 9B). The concentrations of Mn in the shoots of the -Zn plants were only marginally higher than those found in the +Zn plants despite the sharp increase of Mn concentrations in the roots (Figure 9A, B).

The Cu concentration in the roots of the -Zn plants at D13 was higher than that in the +Zn plants (Figure 9D). The resupply of Zn did not reduce the accumulation of Cu in the roots during the first two days (D15), but reduced Cu concentrations in subsequent harvests (Figure 9D). Despite the elevated Cu accumulation in the roots of the -Zn plants, Cu concentrations in the shoots of the -Zn plants were relatively constant after resupply of Zn and only slightly higher than those in the +Zn plants (Figure 9C).

The concentrations of Fe were also examined for the effect of Zn deficiency although barley plants employ specific Fe(III) phytosiderophore transporters for Fe uptake. As shown in Figure 9E and F, there was no difference in Fe concentrations of both shoots and roots between -Zn and +Zn plants at D13. After resupplying Zn, the concentration of Fe in the roots of the -Zn plants gradually increased, reached a peak at D19 and declined at D23 (Figure 9F), whereas the Fe concentration in the roots of +Zn plants was relatively constant during the course of the experiment (Figure 9F). In contrast, the concentrations of Fe in the shoots of both Zn treatments were relatively constant and lower than those in the roots (Figure 9E, F). The concentrations of Fe in the shoots of the -Zn plants were slightly higher than those in the +Zn plants after resupply of Zn despite higher concentrations of Fe in the roots (Figure 9E, F).

Phosphate concentrations in the shoots of +Zn plants were adequate and relatively constant during the course of the experiment (Figure 9G). The concentration of P was higher in the shoots of -Zn plants than that in the +Zn plants at D13 before resupply of Zn, continued rising after resupply of Zn, peaked at D19, and fell at D23 (Figure 9G). In contrast, the concentrations of P in the roots of both Zn treatments were lower than those in the shoots during the course of the experiment (Figure 9H). A slight increase in the concentration of P was found in the roots of -Zn plants at D15, two days after resupply of Zn, and the concentrations of P in the roots were slightly higher in the -Zn plants than those in the control (Figure 9H). EXAMPLE 6 Sequence comparisons of the HvZIP7 amino acid sequence and HvZIP7 nucleic acid sequence with known sequences

The HvZIP7 amino acid sequence (SEQ ID NO: 2) was aligned with known ZIP polypeptide amino acid sequences using Vector NTI (Version 8, InforMax, Bethesda). The reference sequences used for comparison were Oryza sativa (OsZI P7, AK071272), Medicago truncatula (MtZIPδ, AY339057), Thlaspi caerulescens (TcZNTI, AF 133267), and Arabidopsis thaliana (AtZI P4, U95973; AtZIP9, AF369912). After alignment a percentage identity was calculated between each of the known sequences and the HvZIP7 amino acid sequence. The resultant percentage identities are shown in Table 3.

TABLE 3 - Identity values (%) of HvZIP7 protein with six related protein sequences

OsZIP7 AtZIP9 AtZIP4 TcZNTI MtZIP5

HvZI P7 77.8 42.9 50.5 49.3 47.5

As shown in Figure 5, a maximum parsimony phylogenetic tree was constructed using the HvZIP7 amino acid sequence (SEQ ID NO: 2) and a range of amino acid sequences encoding ZIP proteins from other plant species. Bootstrap values given at internal nodes indicate the percentage of the occurrence of these nodes in 100 replicates of the data set. Maximum parsimony and bootstrap analysis of aligned sequences were conducted with the Phylip package, and the resulting tree visualized using the Treeview program.

The HvZIP7 nucleic acid sequence (SEQ ID NO: 1 ) was also aligned and compared Vector NTI (Version 8, InforMax, Bethesda). The resultant percentage identities for the nucleic acid sequences are shown in Table 4. TABLE 4 - Nucleotide identity values (%) of HvZIP7 coding sequences with six closely-related ZIP genes

OsZIP7 AtZIP9 AtZIP4 TcZNTI MtZIP5

HvZI P7 77.5 48.8 56.7 55.6 52.2

EXAMPLE 7 An adaptive mechanism present in Zn-deficient plants for maximizing Zn uptake

When plants were grown under low Zn supply, they were smaller and had a low concentration of Zn compared to the plants grown under the adequate Zn supply (Figure 1 ). Within two days after resupply of Zn, the Zn concentration in the shoots of the -Zn plants was equivalent to that in the shoots of the +Zn plants, but the Zn concentration in the roots of the -Zn plants was below that of the +Zn plants. Six days after resupplying Zn, the -Zn plants were able to increase the Zn concentration in the shoots to 1.7 fold that in the control plants (Figure 1 C) while they retained a Zn concentration similar to the control in the roots (Figure 1 D). By contrast, Zn concentrations in both shoots and roots of the Zn-sufficient plants were relatively constant during the course of the experiment and similar (Figure 1 C, D). The shoot:root partitioning of Zn in the -Zn plants did not follow the shoot:root partitioning of dry matter (Figure 3A, B), which indicates that the partitioning of Zn is independent of that of dry matter but is linked to a mechanism specifically associated with Zn homeostasis in the Zn- deficient plant. This mechanism allows Zn-deficient plants to maximize Zn uptake once Zn is available by allocating a high proportion of the Zn to the shoot and maintaining a relatively low concentration of Zn in the root. This extends the period over which a high rate of Zn uptake can occur by not immediately down-regulating the expression of Zn transporters in the roots to a basal level (Figure 2 and Figure 6B, D). These results indicate that the Zn- deficient plants not only had a much enhanced capacity to acquire Zn from soil solution once it was available but also to translocate the acquired Zn from the root to the shoot and accumulate it in the shoots. As a consequence, there was an increase in Zn reserves in the shoots which could help to buffer plant Zn requirement against the fluctuating supply of Zn from soil.

EXAMPLE 8 Potential functions of HvZIP7

The predicted protein sequence reveals that HvZIP7 is most closely related to OsZIP7 o\ rice as well as to several ZIP proteins (MtZIPS, AtZIP9, AtZIP4 and TcZNTI) from dicotyledonous plant species (Figure 5). Yeast complementation experiments have shown that MtZIPS and TcZNTI could transport Zn, but AtZIP4 could transport Cu instead of Zn.

The expression levels of HvZIP7 were low and relatively constant in both shoots and roots of Zn-adequate plants, whereas the expression levels in both shoots and roots are strongly induced by Zn deficiency (Figure 6A, B), which is similar to the expression profiles of AtZIP4 and AtZIPQ. The expression profiles of OsZIP7, MtZIPS and TcZNTI are different from those of HvZIP7. OSZIP7 and MtZIPS were expressed in both shoots and roots, and their expression in the shoots was largely induced by Zn deficiency but a little change was found in their roots (as described in lshimaru et al., J Exp Bot 56: 3207-3214, 2005 for OsZIP7 and in Lόpez-Millan et al., Plant MoI Biol 54: 583-596, 2004 for MtZIP5). TcZNTI was expressed predominantly in the roots of Thlaspi caerulescens, a Zn hyperaccumulator, but hardly responsive to Zn (as described by Assuncao et al., Plant Cell Environ 24: 217-226, 2001 ). In addition, the up-regulation of HvZIP7 by Zn deficiency (Figure 6A, B) is linked specifically to Zn status in both roots and shoots (Figure 7) and not to Mn deficiency in the roots (Figure 8). Nor did the expression of AtZIPA and AtZIPQ in both shoots and roots of Arabidopsis respond to Cu and Fe deficiency (as described in Wintz et al, J Biol Chem 278: 47644-47653, 2003) despite AtZIP4 being able to transport Cu in yeast instead of Zn (see Grotz et al., Proc Natl Acad Sci USA 95: 7220-7224, 1998). These results suggest that HvZI P7 is a Zn transporter. As HvZIP7 was expressed in both shoots and roots and the protein is predicted to target to the plasma membrane, it may function in the translocation of Zn in both roots and shoots.

EXAMPLE 9 Transport activities enhanced by Zn deficiency are specific for Zn

Heterologous expression studies of plant several ZIP proteins in yeast mutants suggest that ZIP proteins have wide substrate specificities with limited selectivity (see Grotz et al., 1998, supra; Pence et ah, Proc Natl Acad Sci USA 97: 4956-4960, 2000; Ramesh et al. Plant Physiol 133: 126-134, 2003; Lόpez- Millan ef al., 2004, supra). These ZIP proteins mediate influx of various metal ions such as Zn, Fe, Mn and Cd from outside the cell into the cytoplasm in yeast. Fe deficiency resulted in high concentrations of Mn, Zn and Co ions in the roots of Arabidopsis plants (see Vert ef al., Plant Cell 14: 1223-1233, 2002) and Cd in the roots of pea plants (see Cohen et al., Plant Physiol 1 16: 1063- 1072, 1998), and Zn deficiency led to high concentration of Fe, Cu and Mn in the roots of barley plants (Welch and Norvell, Plant Physiol 101 : 627-631 , 1993), suggesting that ZIP proteins may be able to mediate influx of these cations into the plant roots.

It is noteworthy that all the metal ions mentioned above were in the roots of either Fe- or Zn- deficient plants. In contrast, in the present study Zn deficiency had no impact on Mn, Cu and Fe concentrations in both shoots and roots of the Zn-deficient plants prior to resupply of Zn except for Cu in the roots (Figure 9A- F). Resupplying Zn did decrease Cu concentrations in roots of the -Zn plants two days after Zn resupply (Figure D), but increased the Mn concentration of roots in the first two days and the Fe concentration of roots in the initial six days (Figure 9B, F). It is evident that the accumulation of Mn and Fe in the roots of the -Zn plants is not due to the enhanced transport activities by Zn deficiency, but the high accumulation of Cu in the roots of the -Zn plants could be a result of the transport activities enhanced by Zn deficiency. Zn resupply had a limited effect on the concentrations of Mn and Fe as well as Cu in the shoots (Figure 9A, C, E) in comparison to Zn concentrations in the shoots (Figure 7C), which indicates that the enhanced transport activities by Zn deficiency is relatively specific for Zn ions.

In the present study, the increased accumulation of Cu in the barley roots of the -Zn plants could be localized either apoplastically or symplastically, or both. If

Cu ions accumulate in the apoplastic space of the roots, it is not due to the enhanced transport activities caused by Zn deficiency. Only Cu ions that are inside the plasma membrane of the root cells can result from the enhanced transport activities under Zn deficiency. If the latter is the case for the high accumulation of Cu in the roots of -Zn plants (Figure 9D), a specific filter with relatively strict substrate specificity is active in the -Zn plants to restrict the translocation of Cu from roots to shoots.

EXAMPLE 10

Short-term Zn deficiency leading to an irreversible effect on plant growth

The retardation of growth in 13 days-old seedlings was observed as a result of inadequate Zn supply for a short period and the retardation could not be fully alleviated by supplementation of Zn (Figure 1 A, B). Therefore, a constant supply of Zn to crop plants is important to reduce the adverse effect of Zn deficiency on plant growth and yield. EXAMPLE 1 1 Conclusion

The present study reveals that Zn-deficient barley plants were able to accumulate a high concentration of Zn in the shoots compared to that in Zn- adequate plants when sub-micro molar Zn was present in the nutrient solution. The results suggest the existence of a novel adaptive mechanism in the Zn- deficient barley plants which allows plants to maximize Zn uptake through differential tissue distribution of Zn. This mechanism keeps the Zn concentration in the roots relatively low, which maintains the high expression of Zn transporters and permits the roots of Zn-deficient plants to scavenge more Zn from soil when the roots enter the soil zone high in available Zn and to accumulate additional Zn in the shoots. The accumulation of Zn ions in the shoots could buffer against temporary shortfalls in Zn supply when the roots re- enter the soil zone low in available Zn.

EXAMPLE 12 Zn uptake in barley overexpressing HvZIP7

Suspension cultures of six transgenic barley lines, four transformed with HvRPS27 (ribosomal protein S27 gene) and two with pMDC32/HvZIP7 were grown in a liquid medium containing either 1 μM ZnSO₄ or 25 μM ZnSO₄ for three days. The cells lines expressing HvRPS27 were used as a negative control the S27 protein was not a known Zn transporter. As shown in figure 10, Zn concentrations in the suspension cells of the four lines derived from HvRPS27 (HvRPS27_1 to HvRPS27_4) were approximately 20 mg kg^"1 dry weight when they were treated with 1 μM ZnSO₄, and rose to approximately 40 mg kg^"1 dry weight when Zn supply was increased to 25 μM. However, Zn concentrations in the two cell lines overexpressing HvZIP7 (HvZIP7_1 and HvZIP7_2) were more than 40 mg kg^"1 dry weight when 1 μM ZnSO₄ was supplied, and above 80 mg kg^"1 dry weight when 25 μM ZnSO₄ was supplied. A genomic analysis of two transgenic cell lines carrying HvZIP7 driven by the CaMVS35 promoter was also conducted using polymerase chain reaction. A PCR product of 1 ,350 bp was visible in genomic DNA derived from HvZIP7_1 and HvZIP7_2, which is similar to the positive control (plasmid DNA of pMDC32/HvZIP7), but it is not visible in the control line, GP (golden promise) and the HvRPS27_3 line (Figure 1 1 ). These results suggest that the constitutive expression of HvZIP7 can increase Zn accumulation in the suspension cells.

Materials and methods

Immature embryos of the cultivar Golden Promise were isolated and infected with Agrobacterium tumefaciens strain AGL1 , carrying the binary vector pMDC32/HvZIP7 as described by Matthews et al. (Molecular Breeding 7: 195- 202, 2001 ). pMDC32/HvZIP7 included a hygromycin resistance gene and HvZIP7 coding sequence driven by the CaMVS35 promoter. After 3-4 rounds of selection in a solid hygromycin medium, calli were grown in a liquid medium without hygromycin for 4 weeks. The resultant suspension cultures were grown in the same liquid medium with either 1 μM or 25 μM Zn for three days. The cells were harvested for Zn analysis using inductively coupled plasma spectrophotometry according to the method of Zarcinas et al. (Commun Soil Sci Plant AnaH 8: 131-146, 1987).

Genomic DNA was isolated from suspension cells and the full length of the transgene HvZIP7 was amplified with the primers ZIPF3 (5' CTGGTACCATGGTGATCGGTGTAGCAG; SEQ ID NO: 7) and ZIPR3 (5' ATGATAATCATCGCAAGACCG; SEQ ID NO: 8).

Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of the steps or features.

Also, it must be noted that, as used herein, the singular forms "a", "an" and "the" include plural aspects unless the context already dictates otherwise. Thus, for example, reference to "a nucleotide sequence of interest" includes a single nucleotide sequence as well as two or more nucleotide sequences; "a plant cell" includes a single cell as well as two or more cells; and so forth.

Claims

THE CLAIMS DEFINING THE INVENTION ARE AS FOLLOWS

1 . An isolated nucleic acid comprising a nucleotide sequence selected from the list consisting of: (i) a nucleotide sequence which encodes a polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; (ii) a nucleotide sequence which encodes a functional homolog of the polypeptide comprising the amino acid sequence set forth in SEQ ID NO: 2; (iii) a nucleotide sequence which is the complement or reverse complement of the nucleotide sequence referred to at (i) or (ii); and (iv) a fragment of the nucleotide sequence referred to at any of (i), (ii) or (iii).

2. The isolated nucleic acid of claim 1 wherein the isolated nucleic acid comprises a nucleic acid selected from the list consisting of:

(i) a nucleic acid comprising the nucleotide sequence set forth in

78% identical to the nucleotide sequence set forth in SEQ ID NO:

1 ; (iii) a nucleic acid which hybridizes to a nucleic acid comprising the nucleotide sequence set forth in SEQ ID NO: 1 under stringent conditions;

3. The isolated nucleic acid of claim 1 or 2 wherein said isolated nucleic acid is derived from a plant.

4. The isolated nucleic acid of claim 3 wherein said plant is a monocot plant.

5. The isolated nucleic acid of claim 4 wherein said plant is a cereal crop plant.

6. The isolated nucleic acid of claim 5 wherein said plant is a barley (Hordeum vulgare) plant.

7. The isolated nucleic acid of any one of claims 1 to 6 wherein said isolated nucleic acid molecule comprises a nucleic acid sequence which encodes a Zn transporter polypeptide.

8. An isolated nucleic acid comprising a nucleotide sequence which encodes a Zn-responsive transcriptional control sequence, wherein said transcriptional control sequence is derived from a native ZIP7 nucleic acid, or a functionally active fragment or variant of the isolated Zn-responsive transcriptional control sequence.

9. The isolated nucleic acid of claim 8 wherein said transcriptional control sequence is substantially non-responsive to one or more other metal ions.

10. The isolated nucleic acid of claim 8 or 9 wherein said transcriptional control sequence is substantially non-responsive to manganese ions.

1 1 . A nucleic acid construct or vector comprising the nucleic acid of any one of claims 1 to 10.

12. A genetically modified cell comprising an introduced nucleic acid selected from the list consisting of:

(i) the isolated nucleic acid of any one of claims 1 to 7; (ii) the isolated nucleic acid comprising a Zn-responsive transcriptional control sequence of any one of claims 8 to 10; and/or

(iii) the nucleic acid construct or vector of claim 1 1 .

13. The cell of claim 12 wherein said cell is a plant cell.

14. The cell of claim 13 wherein said cell is a monocotyledonous plant cell.

15. The cell of claim 14 wherein said cell is a cereal crop plant cell.

16. The cell of claim 15 wherein said cell is a barley (Hordeum vυlgare) cell.

17. A multicellular structure comprising one or more cells of any one of claims 12 to 16.

18. The multicellular structure of claim 17 wherein said multicellular structure comprises a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue.

19. The multicellular structure of claim 18 wherein said whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue comprises a monocot plant or a tissue, organ or part thereof.

20. The multicellular structure of claim 19 wherein said whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue comprises a cereal crop plant or a tissue, organ or part thereof.

21 . The multicellular structure of claim 20 wherein said whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant tissue comprises a barley (Hordeum vulgare) plant or a tissue, organ or part thereof.

22. A polypeptide selected from the list consisting of:

(i) a polypeptide comprising the amino acid sequence set forth in

SEQ ID NO: 2; (ii) a polypeptide which is a functional homolog of (i); and

(iii) a fragment of (i) or (ii).

23. The polypeptide of claim 22 wherein said polypeptide comprises a Zn transporter polypeptide.

24. The polypeptide of claim 22 or 23 wherein said polypeptide comprises one or more Zl P7 epitopes.

25. An antibody or an epitope binding fragment thereof, raised against the polypeptide of any one of claims 22 to 24.

26. A method for modulating the rate, level and/or pattern of Zn uptake in a cell, the method comprising modulating the activity and/or expression of a polypeptide of any one of claims 22 to 24 in said cell.

27. The method of claim 26 wherein the level and/or activity of the said polypeptide is modulated by modulating the expression of a nucleic acid of any one of claims 1 to 7 in said cell.

28. The method of claim 27 wherein modulation of the expression of said nucleic acid is effected by genetic modification of the cell.

29. The method of any one of claims 26 to 28 wherein said cell is a plant cell.

30. The method of claim 29 wherein said cell is a monocotyledonous plant cell.

31 . The method of claim 30 wherein said cell is a cereal crop plant cell.

32. The method of claim 31 wherein said cell is a barley (Hordeum vulgare) cell.

33. A cell with an altered rate, level and/or pattern of Zn uptake.

34. The cell of claim 33 wherein said cell is produced according to the method of any one of claims 26 to 32.

35. The cell of claim 33 or 34 wherein said cell is a plant cell.

36. The cell of claim 35 wherein said cell is a monocotyledonous plant cell.

37. The cell of claim 36 wherein said cell is a cereal crop plant cell.

38. The cell of claim 37 wherein said cell is a barley (Hordeum vυlgare) cell.

39. A multicellular structure comprising one or more cells of any one of claims 33 to 38.

40. A method for diagnosing Zn deficiency in an organism, the method comprising:

(i) determining the level and/or pattern of expression of the nucleic acid of the nucleic acid of any one of claims 1 to 7 in one or more cells of said organism; and/or

(ii) determining the level and/or pattern of expression of the polypeptide of claim 22 or 23 in one or more cells of said organism; wherein elevated expression of said nucleic acid or said polypeptide is indicative of Zn deficiency in said organism.

41 . The method of claim 40 wherein said organism is a plant.

42. The method of claim 41 wherein said organism is a monocot plant.

43. The method of claim 42 wherein said organism is a cereal crop plant.

44. The method of claim 43 wherein said organism is a barley (Hordeum vulgare) plant.

45. A method for treating Zn deficiency in an organism, the method comprising:

(i) diagnosing a Zn deficiency in the organism according to the method of any one of claims 40 to 44; and (ii) administering a Zn-containing substance to said organism.

46. The method of claim 45 wherein said organism is a plant.

47. The method of claim 46 wherein said organism is a monocot plant.

48. The method of claim 47 wherein said organism is a cereal crop plant.

49. The method of claim 48 wherein said organism is a barley (Hordeum vulgare) plant.