AU2006275315B2 - Polysaccharide synthases - Google Patents

Abstract

The present invention relates generally to polysaccharide synthases. More particularly, the present invention relates to (1,3;1,4)-beta-D-glucan synthases. The present invention provides, among other things, methods for influencing the level of (1,3;1,4)-beta-D-glucan produced by a cell and nucleic acid and amino acid sequences which encode (1,3;1,4)-beta-D-glucan synthases.

Description

WO 2007/014433 PCT/AU2006/001107 POLYSACCHARIDE SYNTHASES 5 FIELD OF THE INVENTION The present invention relates generally to polysaccharide synthases. More 10 particularly, the present invention relates to (1,3;1,4)-p-D-glucan synthases. BACKGROUND OF THE INVENTION 15 The various tissues of cereal grains have diverse functions during grain development, dormancy and after germination. For example, the pericarp and seed coat tissues are concerned with the protection of the seed during development and during dormancy. However, by 20 grain maturity, these outer grain tissues have died and the tissue residues consist almost entirely of cell wall residues. The nucellar tissue between the seed coat and the aleurone surface is involved in transfer of nutrients to the developing grain, however, at maturity, this tissue has also collapsed to leave cell wall remnants. The thin walled cells of the starchy endosperm of mature 25 grain are dead, but are packed with starch and storage protein. In contrast, the thick-walled, nucleated, aleurone cells are alive at grain maturity, and are packed with protein bodies and lipid droplets. At the interface of the starchy endosperm lies the scutellum, which functions in delivering nutrients to the developing endosperm and, during germination, transfers digestion products of 30 the endosperm reserves to the developing embryo. The different structure and function of each tissue type in the grain are determined, at least in part, by the cell wall composition of each of these cell WO 2007/014433 PCT/AU2006/001107 -2 types. Non-cellulosic polysaccharides are key components in the cell walls of cereal grain tissues and include, for example, (1,3;1,4)-p-D-glucans, heteroxylans 5 (mainly arabinoxylans), glucomannans, xyloglucans, pectic polysaccharides and callose. These non-cellulosic polysaccharides usually constitute less than 10% of the overall weight of the grain, but nevertheless are key determinants of grain quality. 10 Although the precise physical relationships between individual non-cellulosic polysaccharides and other wall components have not been described, it is generally considered that in the wall, microfibrils of cellulose are embedded in a matrix phase of non-cellulosic polysaccharides and protein. Wall integrity is maintained predominantly through extensive non-covalent interactions, 15 especially hydrogen bonding, between the matrix phase and microfibrillar constituents. In the walls of some grain tissues covalent associations between heteroxylans, lignin and proteins are present. The extent of covalent associations between components also varies with the wall type and genotype. 20 Non-cellulosic polysaccharides, especially heteroxylans and (1,3;1,4)-p-D glucans, constitute a relatively high proportion of the walls of the aleurone and starchy endosperm, and probably also of the scutellum. In these tissues, cellulose contents are correspondingly lower. The generally low cellulose content of these walls, together with the fact that they contain no lignin, are 25 thought to be related to a limited requirement for structural rigidity of walls in central regions of the grain, and to a requirement to rapidly depolymerize wall components following germination of the grain. In contrast, in the cell walls of the pericarp-seed coat, which provides a 30 protective coat for the embryo and endosperm and which is not mobilized during germination, cellulose and lignin contents are much higher and the concentrations of non-cellulosic polysaccharides are correspondingly lower.

WO 2007/014433 PCT/AU2006/001107 -3 (1,3;1,4)-p-D-glucans, also referred to as mixed-linkage or cereal P-glucans, are non-cellulosic polysaccharides which naturally occur in plants of the monocotyledon family Poaceae, to which the cereals and grasses belong, and 5 in related families of the order Poales. These non-cellulosic polysaccharides are important constituents of the walls of the starchy endosperm and aleurone cells of most cereal grains, where they can account for up to 70% - 90% by weight of the walls. 10 Barley, oat and rye grains are rich sources of (1,3;1,4)-p-D-glucan, whereas wheat, rice and maize have lower concentations of this polysaccharide. The (1,3;1,4)--D-glucans are also relatively minor components of walls in vegetative tissues of cereals and grasses. Although present as a relatively minor 15 component in vegetative tissues (1,3;1,4)-p-D-glucan) is still important in terms of, for example, the digestibility of vegetative tissue by animals and in the use of crop residues for bioethanol production. (1,3;1,4)-p-D-glucans are important in large-scale food processing activities that 20 include brewing and stockfeed manufacture. Moreover, the non-starchy polysaccharides of cereals, such as (1,3;1,4)-P-D-glucans, have attracted renewed interest in recent years because of their potentially beneficial effects in human nutrition. 25 However, despite this interest, major gaps remain in our knowledge of the genes and enzymes that control non-cellulosic polysaccharide biosynthesis, including (1,3;1,4)-p-D-glucan biosynthesis, in cereal grain. (1,3;1,4)-p-D-glucan concentrations in grain are thought to be influenced by both 30 genotype and environment. For example, the concentration of (1,3;1,4)-p-D glucan in cereal grains depends on the genotype, the position of the grain on WO 2007/014433 PCT/AU2006/001107 -4 the spike and environmental factors such as planting location, climatic conditions during development and soil nitrogen. However, the genes that contribute to (1,3;1,4)-P-D-glucan content in grain have 5 not yet been identified. The identification of genes encoding (1,3;1,4)-p-D-glucan synthases through traditional biochemical approaches has been seriously hampered by an inability to purify the enzymes to homogeneity. (1,3;1,4)-p-D-glucan synthases are 10 membrane-bound and, therefore, are difficult to solubilise in an active form. In addition, (1,3;1,4)-P-D-glucan synthases rapidly lose activity following disruption of cells, and are likely to be present at very low abundance in the cell, Despite numerous attempts, purification of (1,3;1,4)-p-D-glucan synthases to homogeneity has not been achieved and, as a result, there are no reports of 15 amino acid sequences obtained from the enzymes themselves. The inability to obtain even partial amino acid sequences from the purified (1,3;1,4)-p-D-glucan synthase enzyme has also prevented the identification and isolation of genes encoding (1,3;1,4)-p-D-glucan synthases. 20 However, identification of the genes encoding (1,3;1,4)-P-D-glucan synthases would be desirable, as this would facilitate modulation of the level of (1,3;1,4)-p D-glucan produced by a cell, and therefore, allow the qualities of grain or vegetative tissue to be altered. Therefore, in order to enable the modulation of the level of (1,3;1,4)-p-D-glucan in a cell and associated changes in grain or 25 vegetative tissue quality, there is a clear need to identify genes that encode (1,3;1,4)-J-D-glucan synthases. Reference to any prior art in this specification is not, and should not be taken as, an acknowledgment or any form of suggestion that this prior art forms part 30 of the common general knowledge in any country.

WO 2007/014433 PCT/AU2006/001107 SUMMARY OF THE INVENTION The present invention is predicated, in part, on the identification of genes which encode the biosynthetic enzyme for (1,3;1,4)-p-D-glucans, referred to herein as 5 "(1,3;1,4)-p-D-glucan synthases". In accordance with the present invention, it has been revealed that (1,3;1,4)-p D-glucan synthases are encoded by members of the Cs/F gene family. 10 As a result of the identification of the nucleotide sequences, and corresponding amino acid sequences that encode (1,3;1,4)-p-D-glucan synthases, the present invention provides, inter alia, methods and compositions for influencing the level and/or activity of (1,3;1,4)-p-D-glucan synthase in a cell and thereby the level of (1,3;1,4)-p-D-glucan produced by the cell. 15 Therefore, in a first aspect, the present invention provides a method for influencing the level of (1,3;1,4)-p-D-glucan produced by a cell, the method comprising modulating the level and/or activity of a (1,3;1,4)-p-D-glucan synthase in the cell. 20 In one particularly preferred embodiment, the cell is a plant cell, more preferably a monocot plant cell and most preferably a cereal crop plant cell. In a second aspect, the present invention provides a method for modulating the 25 level and/or activity of a (1,3;1,4)-p-D-glucan synthase in a cell, the method comprising modulating the expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in the cell. In a third aspect, the present invention provides a method for modulating the 30 level and/or activity of a (1,3;1,4)-p-D-glucan synthase in a cell, the method comprising modulating the expression of a Cs/F gene or functional homolog thereof in the cell.

WO 2007/014433 PCT/AU2006/001107 In a fourth aspect, the present invention provides a method for producing (1,3;1,4)-p-D-glucan, the method comprising expressing a (1,3;1,4)--D-glucan synthase encoding nucleic acid in a cell. 5 In a fifth aspect, the present invention also provides (1,3;1,4)-p-D-glucan produced according to the method of the fourth aspect of the invention. In a sixth aspect, the present invention provides a cell comprising any one or 10 more of: (i) a modulated level of (1,3;1,4)-p-D-glucan relative to a wild type cell of the same taxon; (ii) a modulated level and/or activity of (1,3;1,4)-p-D-glucan synthase 15 relative to a wild type cell of the same taxon; (iii) modulated expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid relative to a wild type cell of the same taxon. Furthermore, in a seventh aspect, the present invention provides a multicellular 20 structure comprising one or more cells according to the sixth aspect of the invention. As mentioned above, in one preferred embodiment of the invention, the cell is a plant cell and as such, the present invention includes a whole plant, plant 25 tissue, plant organ, plant part, plant reproductive material or cultured plant tissue, comprising one or more plant cells according to the sixth aspect of the invention. In a more preferred embodiment, the present invention provides a cereal plant comprising one or more cells according to the sixth aspect of the invention. In a particularly preferred embodiment, the present invention provides 30 cereal grain comprising one or more cells according to the sixth aspect of the invention.

WO 2007/014433 PCT/AU2006/001107 -7 Therefore, in an eighth aspect, the present invention provides a cereal grain comprising an altered level of (1,3;1,4)-p-D-glucan, wherein the grain comprises one or more cells comprising an altered level and/or activity of (1,3;1,4)-p-D glucan synthase and/or altered expression of a (1,3;1,4)-p-D-glucan synthase 5 encoding nucleic acid molecule. In a ninth aspect, the present invention also provides flour comprising: (i) flour produced by the milling of the grain of the eighth aspect of the 10 invention; and (ii) optionally, flour produced by the milling of one or more other grains. As set out above, the present invention is predicated, in part, on the identification and isolation of nucleotide and amino acid sequences that encode 15 (1,3;1,4)-p-D-glucan synthases. Therefore, in a tenth aspect, the present invention provides an isolated nucleic acid molecule that encodes a (1,3;1,4)-p-D-glucan synthase. 20 In an eleventh aspect, the present invention also provides an isolated nucleic acid molecule comprising one or more of: (i) the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 25 11; (ii) a nucleotide sequence which is at least 50% identical to the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11; (iii) a nucleotide sequence which hybridises to a nucleic acid molecule 30 comprising the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and WO 2007/014433 PCT/AU2006/001107 SEQ ID NO: 11 under low stringency, more preferably medium stringency and most preferably high stringency conditions; (iv) a nucleotide sequence which encodes the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID 5 NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12. (v) a nucleotide sequence which is the complement of any one of (i) to (iv); (vi) a nucleotide sequence which is the reverse complement of any one of (i) to (iv); 10 (vii) a fragment of any one of (i) to (vi). In a twelfth aspect, the present invention provides a genetic construct or vector comprising an isolated nucleic acid molecule of the eleventh aspect of the invention. 15 In a thirteenth aspect, the present invention extends to a cell comprising the isolated nucleic acid molecule of the tenth or eleventh aspects of the invention or genetic construct of the twelfth aspect of the invention. 20 In a fourteenth aspect, the present invention provides a multicellular structure which comprises one or more of the cells of the thirteenth aspect of the invention. As set out above, the present invention also provides amino acid sequences for 25 (1,3;1,4)-p-D-glucan synthases. Accordingly, in a fifteenth aspect, the present invention provides an isolated polypeptide comprising an amino acid sequence encoding a (1,3;1,4)-p-D glucan synthase protein. 30 In a sixteenth aspect, the present invention provides an isolated polypeptide comprising one or more of: WO 2007/014433 PCT/AU2006/001107 (i) the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12; 5 (ii) an amino acid sequence comprising at least 50% identity to the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12; (iii) an amino acid sequence encoded by the nucleotide sequence set 10 forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11; and/or (iv) a fragment of any one of (i), (ii) or (iii). In a preferred embodiment, the isolated polypeptide of the present invention 15 comprises an amino acid sequence defining a "(1,3;1,4)-p-D-glucan synthase" as hereinbefore defined. As set out above, the sixteenth aspect of the invention also provides fragments of isolated polypeptides including (1,3;1,4)-p-D-glucan synthase epitopes. 20 The isolated polypeptides and (1,3;1,4)-p-D-glucan synthase epitope-bearing polypeptides of the sixteenth aspect of the invention are useful, for example, in the generation of antibodies that bind to the isolated (1,3;1,4)-p-D-glucan synthase proteins 25 Accordingly, in a seventeenth aspect, the present invention provides an antibody or an epitope binding fragment thereof, raised against an isolated (1,3;1,4)-p-D-glucan synthase protein as hereinbefore defined or an epitope thereof. 30 Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be WO 2007/014433 PCT/AU2006/001107 -10 understood to imply the inclusion of a stated element or integer or group of elements or integers but not the exclusion of any other element or integer or group of elements or integers. 5 Nucleotide and amino acid sequences are referred to herein by a sequence identifier number (SEQ ID NO:). The SEQ ID NOs: correspond numerically to the sequence identifiers < 400 > 1 (SEQ ID NO: 1), < 400 > 2 (SEQ ID NO: 2), etc. A summary of the sequence identifiers is provided in Table 1. A sequence listing is provided at the end of the specification. 10 TABLE 1 - Summary of Sequence Identifiers SEQ ID NO: 1 HvCsIF1 coding region nucleotide sequence SEQ ID NO: 2 HvCsIF1 amino acid sequence SEQ ID NO: 3 HvCsIF2 coding region nucleotide sequence SEQ ID NO: 4 HvCsIF2 amino acid sequence SEQ ID NO: 5 HvCsIF3 coding region nucleotide sequence SEQ ID NO: 6 HvCsIF3 amino acid sequence SEQ ID NO: 7 HvCsIF4 coding region nucleotide sequence SEQ ID NO: 8 HvCsIF4 amino acid sequence SEQ ID NO: 9 HvCsIF5 coding region nucleotide sequence SEQ ID NO: 10 HvCsIF5 amino acid sequence SEQ ID NO: 11 HvCsIF6 coding region nucleotide sequence SEQ ID NO: 12 HvCsIF6 amino acid sequence SEQ ID NO: 13 HvCsIF1 genomic nucleotide sequence SEQ ID NO: 14 HvCsIF2 genomic nucleotide sequence SEQ ID NO: 15 HvCsIF3 genomic nucleotide sequence SEQ ID NO: 16 HvCsIF4 genomic nucleotide sequence SEQ ID NO: 17 HvCsIF5 genomic nucleotide sequence SEQ ID NO: 18 HvCsIF6 genomic nucleotide sequence SEQ ID NO: 19 OsCsiFl nucleotide sequence SEQ ID NO: 20 OsCsIF1 amino acid sequence SEQ ID NO: 21 OsCsIF2 nucleotide sequence SEQ ID NO: 22 OsCsIF2 amino acid sequence SEQ ID NO: 23 OsCsIF3 nucleotide sequence WO 2007/014433 PCT/AU2006/001107 - 11 SEQ ID NO: 24 OsCslF3 amino acid sequence SEQ ID NO: 25 OsCsIF4 nucleotide sequence SEQ ID NO: 26 OsCslF4 amino acid sequence SEQ ID NO: 27 OsCsIF5 nucleotide sequence SEQ ID NO: 28 OsCsIF5 amino acid sequence SEQ ID NO: 29 OsCsIF7 nucleotide sequence SEQ ID NO: 30 OsCsIF7 amino acid sequence SEQ ID NO: 31 OsCsIF8 nucleotide sequence SEQ ID NO: 32 OsCsIF8 amino acid sequence SEQ ID NO: 33 OsCsIF9 nucleotide sequence SEQ ID NO: 34 OsCslF9 amino acid sequence SEQ ID NO: 35 OsF2BII5 oligonucleotide primer SEQ ID NO: 36 OsF2ML3 oligonucleotide primer SEQ ID NO: 37 OsF3B115 oligonucleotide primer SEQ ID NO: 38 OsF3ML3 oligonucleotide primer SEQ ID NO: 39 OsF4H5 oligonucleotide primer SEQ ID NO: 40 OsF4S3 oligonucleotide primer SEQ ID NO: 41 OsF8H5 oligonucleotide primer SEQ ID NO: 42 OsF8S3 oligonucleotide primer SEQ ID NO: 43 GAPDH At oligonucleotide primer (forward) SEQ ID NO: 44 GAPDH At oligonucleotide primer (reverse) SEQ ID NO: 45 Tubulin At oligonucleotide primer (forward) SEQ ID NO: 46 Tubulin At oligonucleotide primer (reverse) SEQ ID NO: 47 Actin At oligonucleotide primer (forward) SEQ ID NO: 48 Actin At oligonucleotide primer (reverse) SEQ ID NO: 49 Cyclophilin At oligonucleotide primer (forward) SEQ ID NO: 50 Cyclophilin At oligonucleotide primer (reverse) SEQ ID NO: 51 OsCsIF2 oligonucleotide primer (forward) SEQ ID NO: 52 OsCsIF2 oligonucleotide primer (reverse) SEQ ID NO: 53 OsCsIF3 oligonucleotide primer (forward) SEQ ID NO: 54 OsCsIF3 oligonucleotide primer (reverse) SEQ ID NO: 55 OsCsIF4 oligonucleotide primer (forward) SEQ ID NO: 56 OsCsIF4 oligonucleotide primer (reverse) SEQ ID NO: 57 OsCsIF8 oligonucleotide primer (forward) SEQ ID NO: 58 OsCsIF8 oligonucleotide primer (reverse) SEQ ID NO: 59 HvFD5END oligonucleotide primer SEQ ID NO: 60 HvFDRQ oligonucleotide primer WO 2007/014433 PCT/AU2006/001107 - 12 SEQ ID NO: 61 HvFC5N oligonucleotide primer SEQ ID NO: 62 HvFC3N oligonucleotide primer SEQ ID NO: 63 HvFH5 oligonucleotide primer SEQ ID NO: 64 HvFF3N oligonucleotide primer SEQ ID NO: 65 Hyg oligonucleotide primer (forward) SEQ ID NO: 66 Hyg oligonucleotide primer (reverse) SEQ ID NO: 67 HvCsIF1 oligonucleotide primer (forward) SEQ ID NO: 68 HvCsIF1 oligonucleotide primer (reverse) SEQ ID NO: 69 HvCsIF4 oligonucleotide primer (forward) SEQ ID NO: 70 HvCsIF4 oligonucleotide primer (reverse) SEQ ID NO: 71 HvCsIF6 oligonucleotide primer (forward) SEQ ID NO: 72 HvCslF6 oligonucleotide primer (reverse) BRIEF DESCRIPTION OF THE FIGURES 5 Figure 1 shows a region on chromosome 7 of rice which is syntenous to a region of barley chromosome 2H, where a cluster of six cellulose synthase-like (Cs/) genes was detected within an interval of 119 Kb, corresponding to the 21.59-21.72 Mb region of the chromosome. 10 Figure 2 shows a vector map of the pAJ22 vector used to express CsIF genes in Arabidopsis. Figure 3 is a Southern Blot showing Xbal and Scal digested DNA derived from transformed Arabidopsis plants, which has been probed with fragments from 15 OsCsIF2, OsCsIF4 and OsCsIF8. The hybridizing fragments for these are marked on the figure as F2, F4 and F8. Track Numbers 1 to 14 are plant lines A2, A3, A7, A12, A16, A18, A21, A23, A28, A29, A31, A33, A41 and A42, respectively, while track 15 shows DNA derived from a wild-type Columbia plant. 20 Figure 4 is a Southern Blot showing Xbal digested DNA derived from transformed Arabidopsis plants, which has been probed with a fragment of the WO 2007/014433 PCT/AU2006/001107 -13 BAR gene. Track Numbers 1 to 14 are plant lines A2, A3, A7, A12, A16, A18, A21, A23, A28, A29, A31, A33, A41 and A42, respectively, while track 15 shows DNA derived from a wild-type Columbia plant. 5 Figure 5 shows normalized mRNA levels, as determined by Q-PCR, in the leaves of 14-day old transgenic Arabidopsis plant which express one or more of OsCsIF2, OsCsIF4 or OsCsIF8. Figure 6 shows a ClustalW multiple sequence alignment of CsIF amino acid 10 sequences derived from Barley (Hordeum vulgare) and Rice (Oryza sativa). Figure 7 shows transmission electron micrographs illustrating the detection of (1,3;1,4)-p-D-glucan in cell walls of several transgenic Arabidopsis plants with specific monoclonal antibodies. Panel A shows the detection of (1,3;1,4)-p-D 15 glucan in transformed Arabidopsis lines A28 and A29. In Panel B, walls from the epidermal layers of leaves from transgenic Arabidopsis line A18 are shown to accumulate (1,3;1,4)-p-D-glucan over a period of about fourteen days. Finally, Panel C shows a representative section of WT Arabidopsis leaf epidermal cell wall where minimal or no background labelling is commonly observed. 20 Figure 8 shows the nucleotide sequence identity, protein sequence identity and .protein sequence similarity between CsIF sequences derived from Rice (Oryza sativa) and Barley (Hordeum vulgare) 25 Figure 9 is a phylogenetic tree showing the relationship of complete and partial CsIF amino acid sequences derived from Barley (Hordeum vulgare) and Rice (Oryza sativa). Figure 10 shows the location of HvCsIF2, 4, 5 and 6 genes on chromosome 2H 30 of the Steptoe x Morex (SxM 2H) Bin map. Key markers (as Figure 1) are shown on the right-hand side and distances from the top of the chromosome in centimorgans are indicated on the left-hand side.

WO 2007/014433 PCT/AU2006/001107 - 14 Figure 11 shows a map of the pMDC32 vector Figure 12 shows the results of the QPCR analysis of hygromycin transcript 5 levels in control and transgenic barley plants Figure 13 shows the results of the QPCR analysis of HvCsIF1 transcript levels in control and transgenic barley plants. 10 Figure 14 shows the results of the QPCR analysis of HvCsIF4 transcript levels in control and transgenic barley plants Figure 15 shows the results of the QPCR analysis of HvCs/F6 transcript levels in control and transgenic barley plants 15 Figure 16 shows leaf autofluorescence under UV to demonstrate cell morphology. ab = abaxial surface, ad = adaxial surface, bs = bundle sheath cell, bul = bulliform cell, e = epidermal cell, m = mesophyll cell, p= phioem, scl sclerenchyma fibre, st = stomate, x = xylem. 20 Figure 17 shows G98-10 with both primary and secondary antibodies omitted from the labeling procedure, photographed at 7 seconds exposure under the 13 filter. 25 Figure 18 shows transgenic plants (A,B,C,D) compared with control plants (E and F) all photographed at 7 seconds exposure under the 13 filter: A) G98-10 and B) G98-24, both showing increased fluorescence in the epidermal cells and the sclerenchyma fibre cells on the leaf tip, when compared with control sections; C) G103-5 showing increased fluorescence in all cell types when 30 compared with the control sections; D) G99-12 showing increased fluorescence in stomata and vascular tissue when compared with the control sections; E) WT control showing fluorescence signal from endogenous (1,3;1,4)-p-D-glucans;

F)

WO 2007/014433 PCT/AU2006/001107 -15 transgene control G89-1 showing fluorescence from endogenous (1,3;1,4)-p-D glucans. Figure 19 shows transmission electron micrographs. Panel A shows a 5 representative epidermal cell wall of the transgenic control G89-1, showing labeling of endogenous levels of (1,3;1,4)-p-D-glucan. Panel B shows a representative epidermal cell wall of the transgenic G98-10 showing significantly heavier labeling of (1,3;1,4)-p-D-glucan in the walls of these plants. Panel C shows a representative epidermal cell wall of transgenic G103-5 10 showing significantly heavier labeling of (1,3;1,4)-p-D-glucan in the walls of these plants. Figure 20 shows transmission electron micrographs. Panel A is a representative sclerenchyma fibre cell wall from the transgenic control G89-1 showing labeling 15 of endogenous levels of (1,3;1,4)-p-D-glucan. Panel B shows a representative sclerenchyma fibre cell wall from the transgenic G98-10 showing heavier labeling of the (1,3;1,4)-p-D-glucan. Panel C shows a representative sclerenchyma fibre cell wall from the transgenic G103-5 showing heavier labeling of the (1,3;1,4)-p-D-glucan. 20 DESCRIPTION OF PREFERRED EMBODIMENTS It is to be understood that following description is for the purpose of describing 25 particular embodiments only and is not intended to be limiting with respect to the above description. The present invention is predicated, in part, on the identification of genes which encode the biosynthetic enzyme for (1,3;1,4)-p-D-glucans, referred to herein as 30 "(1,3;1,4)-p-D-glucan synthases".

WO 2007/014433 PCT/AU2006/001107 -16 "(1,3;1,4)-p-D-glucans" should be understood to include linear, unbranched polysaccharides in which P-D-glucopyranosyl monomers are polymerized through both (1--4)- and (1 -3)-linkages. 5 The ratio of (1->4)- to (1->3)-linkages, in naturally occurring (1,3;1,4)-p-D glucans, is generally in the range 2.2-2.6:1, although the ratio may also be outside of this range. For example, in the (1,3;1,4)-p-D-glucan from sorghum endosperm the ratio is 1.15:1. The two types of linkages are not arranged in regular, repeating sequences. Single (1->3)-linkages are separated by two or 10 more (1-*4)-linkages. Regions of two or three adjacent (1-*4)-linkages predominate, but again there is no regularity in the arrangement of these units. The linkage sequence does not depend on preceding linkages further away than two glucose units and follows a second order Markov chain distribution. Moreover, up to 10 % of the chain may consist of longer stretches of 5 to 20 15 adjacent (1->4)-linkages. Thus, cereal (1,3;1,4)-p-D-glucans may be considered as (1 -*3)-p-linked copolymers of cellotriosyl (G4G4GRed), cellotetraosyl (G4G4G4GRed) units and longer (1->4)-P-D-OligOglucOSyI units. The ratio of tri- to tetra-saccharide units in endogenous (1,3;1,4)-P-D-glucans 20 varies between cereal species. For example, in wheat the ratio is 3.0-4.5:1, in barley 2.9-3.4:1, in rye 2.7:1. and in oats 1.8-2.3:1. Furthermore, the observed ratios may also vary according to the temperature and conditions of (1,3;1,4)-p D-glucan extraction. 25 The average molecular masses reported for cereal (1,3;1,4)-p-D-glucans range from 48,000 (DP -300) to 3,000,000 (DP -1850), depending on the cereal species, cell wall type, extraction procedure and the method used for molecular mass determination. They are invariably polydisperse with respect to molecular mass and this is illustrated by a weight average to number average molecular 30 mass ratio (M,/Mn) of 1.18 for barley (1,3;1,4)-p-D-glucan. Certain barley WO 2007/014433 PCT/AU2006/001107 -17 (1,3;1,4)-p-D-glucans are also covalently-associated with small amounts of protein and have estimated molecular masses of up to 40,000,000. The extractability of (1,3;1,4)-p-D-glucans from walls of cereal grains is a 5 function of their degree of self-association and their association with other wall polysaccharides and proteins. In particular, extractability depends on the molecular mass and linkage distribution in the (1,3;1,4)-p-D-glucan chains. Extensive association with other polymers and very high molecular masses render the (1,3;1,4)-p-D-glucans more difficult to extract from grain. 10 For example, a portion of the (1,3;1,4)-p-D-glucan from barley, oat and rye flours may be extracted by water at pH 7.0 and 400C. Further fractions can be solubilized at higher temperatures. The proportion of total (1,3;1,4)-p-D-glucan that is water-soluble at 400C varies within and between species. For example, 15 waxy (high amylose) barleys have a higher proportion of water-soluble (1,3;1,4) p-D-glucan than normal barleys. (1,3;1,4)-p-D-glucans extracted from barley at 400C have a slightly lower tri-/tetrasaccharide ratio (1.7:1) than those extracted at 650C (2.0:1). Complete extraction of cereal (1,3;1,4)-p-D-glucans from grain requires the use of alkaline extractants such as 4 M NaOH or aqueous 20 Ba(OH) 2 , containing NaBH 4 to prevent alkali-induced degradation from the reducing terminus, Alkali-extracted barley (1,3;1,4)-p-D-glucan fractions have higher molecular masses, higher ratios of (1->4): (1->3) linkages, more contiguously linked (1->4)-linked segments and higher tri-: tetra-saccharide ratios than their water-extractable counterparts. Other extractants, such as 25 dimethylsulphoxide, hot perchloric acid, trichloroacetic acid, N methylmorpholino-N-oxide and dimethylacetamide-LiCI, may also be used to solubilize (1,3;1,4)-p-D-glucans, but these extractants may cause some depolymerisation or degradation of the polymer. Once extracted with hot water or alkali, the (1,3;1,4)-p-D-glucans are oftensoluble at neutral pH and room 30 temperature. However, upon cooling, (1,3;1,4)-p-D-glucans can aggregate and precipitate.

WO 2007/014433 PCT/AU2006/001107 -18 As mentioned above, the present invention is predicated, in part, on the identification of the biosynthetic enzyme, and encoding gene, that catalyses the synthesis of (1,3;1,4)-p-D-glucan. As used herein, this enzyme is referred to 5 herein as "(1,3;1,4)-p-D-glucan synthase". The present invention arises, in part, from an analysis of expressed sequence tag libraries and other sequence databases including cellulose synthase (CesA) genes. More particularly, it was noted in these analyses that the CesA genes 10 were in fact members of a much larger super-family of genes, which included both the CesA genes and the cellulose synthase-like (Csl) gene family. However, despite significant research effort, the particular functions of individual Cs/ genes are largely unknown. The Cs! genes have been sub-divided into eight 15 groups, designated CsIA-Cs/H. However, the only Cs/ gene for which a specific biochemical function has been defined are Cs/A genes from guar and Arabidopsis, which encodes (1-*4)-p-D-mannan synthases. Given the similarities in structures of cellulose and (1,3;1,4)-p-D-glucan, the 20 present inventors postulated that genes encoding (1,3;1,4)-p-D-glucan synthases might be members of the Cs! gene family. However, the Cs! gene families in most vascular plants are very large and have been divided into several groups, designated Cs/A to Cs/H. In Arabidopsis 25 tha/iana there are 29 known Cs! genes and in rice about 37. Overall, the Arabidopsis genome is believed to contain more than 700 genes involved in cell wall metabolism. However, in general, the specific functions of these genes are poorly understood. For example, the specific functions of only two of more than 170 genes involved in pectin biosynthesis have been defined. Furthermore, in 30 contrast to the CesA genes, it has proved difficult to define the functions of the Cs genes. In fact, of the multiple Cs/ genes in higher plants, only the Cs/A group has been assigned a function.

WO 2007/014433 PCT/AU2006/001107 - 19 The present invention used a genetic approach to identify the nucleotide sequences, and corresponding amino acid sequences, that encode (1,3;1,4)-p D-glucan synthase. In accordance with the present invention, it has been 5 revealed that (1,3;1,4)-p-D-glucan synthases are encoded by members of the CsIF gene family. As a result of the identification of the nucleotide sequences, and corresponding amino acid sequences that encode (1,3;1,4)-p-D-glucan synthases, the present 10 invention provides, inter alia, methods and compositions for influencing the level and/or activity of (1,3;1,4)-p-D-glucan synthase in a cell and thereby the level of (1,3;1,4)-p-D-glucan produced by the cell. Therefore, in a first aspect, the present invention provides a method for 15 influencing the level of (1,3;1,4)-p-D-glucan produced by a cell, the method comprising modulating the level and/or activity of a (1,3;1,4)-p-D-glucan synthase in the cell. The "cell" may be any suitable eukaryotic or prokaryotic cell. As such, a "cell" as 20 referred to herein may be a eukaryotic cell including a fungal cell such as a yeast cell or mycelial fungus cell; an animal cell such as a mammalian cell or an insect cell; or a plant cell. Alternatively, the cell may also be a prokaryotic cell such as a bacterial cell including an E. coli cell, or an archaea cell. 25 Preferably, the cell is a plant cell, more preferably a vascular plant cell, including a monocotyledonous or dicotyledonous angiosperm plant cell or a gymnosperm plant cell. In an even more preferred embodiment, the plant is a monocotyledonous plant cell. 30 In one particularly preferred embodiment, the monocotyledonous plant cell is a cereal crop plant cell.

WO 2007/014433 PCT/AU2006/001107 - 20 As used herein, the term "cereal crop plant" includes members of the Poales (grass family) that produce edible grain for human or animal food. Examples of Poales cereal crop plants which in no way linit the present invention include wheat, rice, maize, millets, sorghum, rye, triticale, oats, barley, teff, wild rice, 5 spelt and the like. However, the term cereal crop plant should also be understood to include a number of non-Poales species that also produce edible grain and are known as the pseudocereals, such as amaranth, buckwheat and quinoa. 10 Although cereal crop plants are particularly preferred monocotyledonous plants, the other monocotyledonous plants are also preferred, such as other non-cereal plants of the Poales, specifically including pasture grasses such as Lolium spp. As set out above, the present invention is predicated, in part, on modulating the 15 level and/or activity of (1,3;1,4)--D-glucan synthase in a cell. "(1,3;1,4)-p-D-glucan synthase" should be regarded as any protein which catalyses the synthesis of (1,3;1,4)-p-D-glucan and, optionally, catalyses the polymerisation of glucopyranosyl monomers. 20 Preferably, the (1,3;1,4)-p-D-glucan synthase comprises the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34, or an amino acid 25 sequence which is at least 40% identical thereto. More preferably, the (1,3;1,4)-p-D-glucan synthase comprises at least 50% amino acid sequence identity, yet more preferably at least 60% amino acid sequence identity, even more preferably at least 70% amino acid sequence 30 identity, and even more preferably at least 80% amino acid sequence identity and most preferably at least 90% amino acid sequence identity to any SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID WO 2007/014433 PCT/AU2006/001107 -21 NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34. In a particularly preferred embodiment, the (1,3;1,4)-p-D-glucan synthase comprises the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 5 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34. When comparing amino acid sequences, the compared sequences should be compared over a comparison window of at least 100 amino acid residues, more 10 preferably at least 200 amino acid residues, yet more preferably at least 400 amino acid residues, even more preferably at least 800 amino acid residues and most preferably over the full length of any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 20, SEQ ID NO: 22, SEQ ID NO: 24, SEQ ID NO: 26, SEQ ID NO: 28, SEQ ID NO: 30, SEQ ID NO: 32 and SEQ ID NO: 34. The 15 comparison window may comprise additions or deletions (i. e. gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of 20 programs as, for example, disclosed by Altschul et a/. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in Unit 19. 3 of Ausubel et a!. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15,1998). 25 In a more preferred embodiment, the (1,3;1,4)-p-D-glucan synthase is encoded by a Cs!F gene or a functional homolog thereof (as defined later). As referred to herein, the modulation of the "level" of the (1,3;1,4)-p-D-glucan synthase should be understood to include modulation of the level of (1,3;1,4)-s 30 D-glucan synthase transcripts and/or polypeptides in the cell. Modulation of the "activity" of the (1,3;1,4)-p-D-glucan synthase should be understood to include WO 2007/014433 PCT/AU2006/001107 - 22 modulation of the total activity, specific activity, half-life and/or stability of the (1,3;1,4)-p-D-glucan synthase in the cell. By "modulating" with regard to the level and/or activity of the (1,3;1,4)-p-D 5 glucan synthase is intended decreasing or increasing the level and/or activity of (1,3;1,4)-p-D-glucan synthase in the cell. By "decreasing" is intended, for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the level or activity of (1,3;1,4)-p-D-glucan synthase in the cell. By "increasing" is intended, 10 for example, a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20 fold, 50-fold, 100-fold increase in the level of activity of (1,3;1,4)-p-D-glucan synthase in the cell. "Modulating" also includes introducing a (1,3;1,4)-p-D-glucan synthase into a cell which does not normally express the introduced enzyme, or the substantially complete inhibition of 15 (1,3;1,4)-p-D-glucan synthase activity in a cell that normally has such activity. In one preferred embodiment, the level of (1,3;1,4)-p-D-glucan produced by a cell is increased by increasing the level and/or activity of (1,3;1,4)-p-D-glucan synthase in the cell. In another preferred embodiment, the level of (1,3;1,4)-p-D 20 glucan produced by a cell is decreased by decreasing the level and/or activity of (1,3;1,4)-p-D-glucan synthase in the cell. The methods of the present invention contemplates any means known in the art by which the level and/or activity of (1,3;1,4)-p-D-glucan synthase in a cell may 25 be modulated. This includes methods such as the application of agents which modulate (1,3;1,4)-p-D-glucan synthase activity in a cell, such as the application of a (1,3;1,4)-s-D-glucan synthase agonist or antagonist; the application of agents which mimic (1,3;1,4)-p-D-glucan synthase activity in a cell; modulating the expression of a nucleic acid which encodes (1,3;1,4)-p-D-glucan synthase in 30 the cell; or effecting the expression of an altered or mutated (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in a cell such that a (1,3;1,4)-p-D-glucan WO 2007/014433 PCT/AU2006/001107 - 23 synthase with increased or decreased specific activity, half-life and/or stability is expressed by the cell. In a preferred embodiment, the level and/or activity of the (1,3;1,4)-p-D-glucan 5 synthase is modulated by modulating the expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in the cell. Therefore, in a second aspect, the present invention provides a method for modulating the level and/or activity of a (1,3;1,4)-p-D-glucan synthase in a cell, 10 the method comprising modulating the expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in the cell. As described herein, it has been identified that (1,3;1,4)-p-D-glucan synthase is encoded by members of the Cs/F gene family. Therefore, In a preferred 15 embodiment, the (1,3;1,4)-p-D-glucan synthase encoding nucleic acid is a Cs/F gene or a functional homolog thereof. Accordingly, in a third aspect, the present invention provides a method for modulating the level and/or activity of a (1,3;1,4)-p-D-glucan synthase in a cell, 20 the method comprising modulating the expression of a Cs/F gene or functional homolog thereof in the cell. As used herein, the term "Cs/F gene or functional homolog thereof' should be understood to include to a nucleic acid molecule which: 25 (i) encodes a (1,3;1,4)-p-D-glucan synthase as defined herein; and (ii) preferably, comprises at least 50% nucleotide sequence identity to the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 30 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33; and/or WO 2007/014433 PCT/AU2006/001107 - 24 (iii) preferably, hybridises to a nucleic acid molecule comprising the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 5 and SEQ ID NO: 33 under stringent conditions. More preferably, the Cs/F gene functional homolog thereof comprises a nucleotide sequence which is at least 54% identical to any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 10 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33, more preferably the Cs/F gene or functional homolog thereof comprises a nucleotide sequence which is at least 70% identical to any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 15 and SEQ ID NO: 33 and most preferably the Cs/F gene or functional homolog thereof comprises a nucleotide sequence which is at least 85% identical to any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33. 20 In a particularly preferred embodiment, the Cs/F gene or functional homolog thereof comprises the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ 25 ID NO: 33. When comparing nucleic acid sequences to any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33 30 to calculate a percentage identity, the compared nucleotide sequences should be compared over a comparison window of at least 300 nucleotide residues, more preferably at least 600 nucleotide residues, yet more preferably at least WO 2007/014433 PCT/AU2006/001107 - 25 1200 nucleotide residues, even more preferably at least 2400 nucleotide residues and most preferably over the full length of SEQ ID NO: 1. The comparison window may comprise additions or deletions (ie. gaps) of about 20% or less as compared to the reference sequence (which does not comprise 5 additions or deletions) for optimal alignment of the two sequences. Optimal alignment of sequences for aligning a comparison window may be conducted by computerized implementations of algorithms such the BLAST family of programs as, for example, disclosed by Altschul et al. (Nucl. Acids Res. 25: 3389-3402, 1997). A detailed discussion of sequence analysis can be found in 10 Unit 19. 3 of Ausubel et al. ("Current Protocols in Molecular Biology" John Wiley & Sons Inc, 1994-1998, Chapter 15,1998). As set out above, the Cs/F gene or functional homolog thereof may also comprise a nucleic acid, which hybridises to a nucleic acid molecule comprising 15 the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 19, SEQ ID NO: 21, SEQ ID NO: 23, SEQ ID NO: 25, SEQ ID NO: 27, SEQ ID NO: 29, SEQ ID NO: 31 and SEQ ID NO: 33, under stringent conditions. As used herein, "stringent" hybridisation conditions will be those in which the salt concentration is less than about 1.5 M Na ion, typically 20 about 0.01 to 1.0 M Na ion concentration (or other salts) at pH 7.0 to 8.3 and the temperature is at least 30 0 C. Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. Stringent hybridisation conditions may be low stringency conditions, more preferably medium stringency conditions and most preferably high stringency conditions. 25 Exemplary low stringency conditions include hybridisation with a buffer solution of 30 to 35% formamide, 1 M NaCl, 1% SDS (sodium dodecyl sulphate) at 37 0 C., and a wash in 1x to 2xSSC (20xSSC=3.0 M NaCI/0.3 M trisodium citrate) at 50 to 55"C. Exemplary moderate stringency conditions include hybridisation in 40 to 45% formamide, 1.0 M NaCl, 1% SDS at 37'C., and a wash in 0.5x to 30 1xSSC at 55 to 60*C. Exemplary high stringency conditions include hybridisation in 50% formamide, I M NaCl, 1% SDS at 37*C., and a wash in 0.1xSSC at 60 to 650C. Optionally, wash buffers may comprise about 0.1% to WO 2007/014433 PCT/AU2006/001107 - 26 about I% SDS. Duration of hybridization is generally less than about 24 hours, usually about 4 to about 12 hours. Specificity of hybridisation is typically the function of post-hybridization washes, 5 the critical factors being the ionic strength and temperature of the final wash solution. For DNA-DNA hybrids, the Tm can be approximated from the equation of Meinkoth and Wahl (Anal. Biochem. 138: 267-284, 1984), ie. Tm =81.5"C +16.6 (log M)+0.41 (% GC)-0.61 (% form)-500/L; where M is the molarity of monovalent cations, % GC is the percentage of guanosine and cytosine 10 nucleotides in the DNA, % form is the percentage of formamide in the hybridization solution, and L is the length of the hybrid in base pairs. The Tm is the temperature (under defined ionic strength and pH) at which 50% of a complementary target sequence hybridizes to a perfectly matched probe. Tm is reduced by about 10C for each 1% of mismatching; thus, Tm, hybridization, 15 and/or wash conditions can be adjusted to hybridize to sequences of different degrees of complementarity. For example, sequences with >90% identity can be hybridised by decreasing the Tm by about 10"C. Generally, stringent conditions are selected to be about 50C lower than the thermal melting point (Tm) for the specific sequence and its complement at a defined ionic strength 20 and pH. However, high stringency conditions can utilize a hybridization and/or wash at, for example, 1, 2, 3, or 4"C lower than the thermal melting point (Tm); medium stringency conditions can utilize a hybridization and/or wash at, for example, 6, 7, 8, 9, or 100C lower than the thermal melting point (Tm); low stringency conditions can utilize a hybridization and/or wash at, for example, 11, 25 12, 13, 14, 15, or 200C lower than the thermal melting point (Tm). Using the equation, hybridization and wash compositions, and desired Tm, those of ordinary skill will understand that variations in the stringency of hybridization and/or wash solutions are inherently described. If the desired degree of mismatching results in a Tm of less than 450C (aqueous solution) or 320C 30 (formamide solution), it is preferred to increase the SSC concentration so that a higher temperature can be used. An extensive guide to the hybridization of nucleic acids is found in Tijssen (Laboratory Techniques in Biochemistry and WO 2007/014433 PCT/AU2006/001107 - 27 Molecular Biology-Hybridization with Nucleic Acid Probes, Pt \, Chapter 2, Elsevier, New York, 1993), Ausubel et al., eds. (Current Protocols in Molecular Biology, Chapter 2, Greene Publishing and Wiley-Interscience, New York, 1995) and Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2 nd ed., Cold 5 Spring Harbor Laboratory Press, Plainview, NY, 1989). The CsIF gene or functional homolog thereof may also comprise a genomic nucleotide sequence from an organism which may include one or more non protein-coding regions or one or more intronic regions. Exemplary genomic 10 nucleotide sequences which comprise a CsIF gene including the Hordeum vulgare genomic nucleotide sequences set forth in any of SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17 and SEQ ID NO: 18. 15 As mentioned above, the present invention provides methods for modulating the expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in a cell. The present invention contemplates any method by which the expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid molecule in a cell may be modulated. 20 Preferably, the term "modulating" with regard to the expression of the (1,3;1,4) p-D-glucan synthase encoding nucleic acid is intended decreasing or increasing the transcription and/or translation of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid. By "decreasing" is intended, for example, a 1%, 5%, 10%, 20%, 25 30%, 40%, 50%, 60%, 70%, 80%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, 100% reduction in the transcription and/or translation of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid. By "increasing" is intended, for example a 1%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100%, 2-fold, 5-fold, 10-fold, 20-fold, 50-fold, 100-fold or greater increase 30 in the transcription and/or translation of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid. Modulating also comprises introducing expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid not normally found in a WO 2007/014433 PCT/AU2006/001107 - 28 particular cell; or the substantially complete inhibition (eg. knockout) of expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in a cell that normally has such activity. 5 Methods for modulating the expression of a particular nucleic acid molecule in a cell are known in the art and the present invention contemplates any such method. Exemplary methods for modulating the expression of a (1,3;1,4)-p-D glucan synthase encoding nucleic acid include: genetic modification of the cell to upregulate or downregulate endogenous (1,3;1,4)-p-D-glucan synthase 10 expression; genetic modification by transformation with a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid; administration of a nucleic acid molecule to the cell which modulates expression of an endogenous (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in the cell; and the like. 15 In one preferred embodiment, the expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid is modulated by genetic modification of the cell. The term "genetically modified", as used herein, should be understood to include any genetic modification that effects an alteration in the expression of a (1,3;1,4)-p D-glucan synthase encoding nucleic acid in the genetically modified cell relative 20 to a non-genetically modified form of the cell. Exemplary types of genetic modification contemplated herein include: random mutagenesis such as transposon, chemical, UV and phage mutagenesis together with selection of mutants which overexpress or underexpress an endogenous (1,3;1,4)-p-D glucan synthase encoding nucleic acid; trasient or stable introduction of one or 25 more nucleic acid molecules into a cell which direct the expression and/or overexpression of (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in the cell; inhibition of an endogenous (1,3;1,4)-p-D-glucan synthase by site-directed mutagenesis of an endogenous (1,3;1,4)-p-D-glucan synthase encoding nucleic acid; introduction of one or more nucleic acid molecules which inhibit the 30 expression of an endogenous (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in the cell, eg. a cosuppression construct or an RNAi construct; and the like.

WO 2007/014433 PCT/AU2006/001107 - 29 In one particularly preferred embodiment, the genetic modification comprises the introduction of a nucleic acid into a cell of interest. 5 The nucleic acid may be introduced using any method known in the art which is suitable for the cell type being used, for example, those described in Sambrook and Russell (Molecular Cloning - A Laboratory Manual, 3 rd Ed., Cold Spring Harbor Laboratory Press, 2000). 10 In preferred embodiments of the invention, wherein the cell is a plant cell, suitable methods for introduction of a nucleic acid molecule may include: Agrobacterium-mediated transformation, microprojectile bombardment based transformation methods and direct DNA uptake based methods. Roa-Rodriguez et al. (Agrobacterium-mediated transformation of plants, 3 rd Ed. CAMBIA 15 Intellectual Property Resource, Canberra, Australia, 2003) review a wide array of suitable Agrobacterium-mediated plant transformation methods for a wide range of plant species. Microprojectile bombardment may also be used to transform plant tissue and methods for the transformation of plants, particularly cereal plants, and such methods are reviewed by Casas et al. (Plant Breeding 20 Rev. 13: 235-264, 1995). Direct DNA uptake transformation protocols such as protoplast transformation and electroporation are described in detail in Galbraith et al. (eds.), Methods in Cell Biology Vol. 50, Academic Press, San Diego, 1995). In addition to the methods mentioned above, a range of other transformation protocols may also be used. These include infiltration, 25 electroporation of cells and tissues, electroporation of embryos, microinjection, pollen-tube pathway, silicon carbide- and liposome mediated transformation. Methods such as these are reviewed by Rakoczy-Trojanowska (Cell. Mol. Biol. Lett. 7: 849-858, 2002). A range of other plant transformation methods may also be evident to those of skill in the art. 30 The introduced nucleic acid may be single stranded or double stranded. The nucleic acid may be transcribed into mRNA and translated into (1,3;1,4)-3-D- WO 2007/014433 PCT/AU2006/001107 - 30 glucan synthase or another protein; may encode for a non-translated RNA such as an RNAi construct, cosuppression construct, antisense RNA, tRNA, miRNA, siRNA, ntRNA and the like; or may act directly in the cell. The introduced nucleic acid may be an unmodified DNA or RNA or a modified DNA or RNA 5 which may include modifications to the nucleotide bases, sugar or phosphate backbones but which retain functional equivalency to a nucleic acid. The introduced nucleic acid may optionally be replicated in the cell; integrated into a chromosome or any extrachromosomal elements of the cell; and/or transcribed by the cell. Also, the introduced nucleic acid may be either homologous or 10 heterologous with respect to the host cell. That is, the introduced nucleic acid may be derived from a cell of the same species as the genetically modified cell (ie. homologous) or the introduced nucleic may be derived from a different species (ie. heterologous). The transgene may also be a synthetic transgene. 15 In one particularly preferred embodiment, the present invention contemplates increasing the level of (1,3;1,4)-p-D-glucan produced by a cell, by introducing a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid into the cell. More preferably, the (1,3;1,4)-p-D-glucan synthase encoding nucleic acid comprises a Cs/F gene or functional homolog thereof. 20 By identifying the nucleotide sequences which encode (1,3;1,4)-p-D-glucan synthases, in further embodiments the present invention also provides methods for down-regulating expression of a (1,3;1,4)-P-D-glucan synthase encoding nucleic acid in a cell. 25 For example, the identification of (1,3;1,4)-p-D-glucan synthase encoding nucleic acid sequences, in accordance with the present invention, facilitates methods such as knockout or knockdown of an endogenous (1,3;1,4)-p-D glucan synthase encoding nucleic acid in a cell using methods such as: 30 (i) insertional mutagenesis of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in a cell including knockout or knockdown of a (1,3;1,4)- WO 2007/014433 PCT/AU2006/001107 - 31 p-D-glucan synthase encoding nucleic acid in a cell by homologous recombination with a knockout construct (for an example of targeted gene disruption in plants see Terada et al., Nat. Biotechnol. 20: 1030 1034, 2002); 5 (ii) post-transcriptional gene silencing (PTGS) or RNAi of a (1,3;1,4)-p-D glucan synthase encoding nucleic acid in a cell (for review of PTGS and RNAi see Sharp, Genes Dev. 15(5): 485-490, 2001; and Hannon, Nature-418: 244-51, 2002); (iii) transformation of a cell with an antisense construct directed against a 10 (1,3;1,4)-p-D-glucan synthase encoding nucleic acid (for examples of antisense suppression in plants see van der Krol et al., Nature 333: 866-869; van der Krol et al., BioTechniques 6: 958-967; and van der Krol et al., Gen. Genet. 220: 204-212); (iv) transformation of a cell with a co-suppression construct directed 15 against a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid (for an example of co-suppression in plants see van der Krol et a., Plant Cell 2(4): 291-299); (v) transformation of a cell with a construct encoding a double stranded RNA directed against a (1,3;1,4)-p-D-glucan synthase encoding 20 nucleic acid (for an example of dsRNA mediated gene silencing see Waterhouse et al., Proc. Nat/. Acad. Sci. USA 95: 13959-13964, 1998); and (vi) transformation of a cell with a construct encoding an siRNA or hairpin RNA directed against a (1,3;1,4)-p-D-glucan synthase encoding 25 nucleic acid (for an example of siRNA or hairpin RNA mediated gene silencing in plants see Lu et al., Nuc. Acids Res. 32(21): e171; doi:10.1093/nar/gnhl70, 2004). The present invention also facilitates the downregulation of a (1,3;1,4)-p-D 30 glucan synthase encoding nucleic acid in a cell via the use of synthetic oligonucleotides such as siRNAs or microRNAs directed against a (1,3;1,4)-p-D glucan synthase encoding nucleic acid which are administered to a cell (for WO 2007/014433 PCT/AU2006/001107 - 32 examples of synthetic siRNA mediated silencing see Caplen et al., Proc. Natl. A cad. Sc. USA 98: 9742-9747, 2001; Elbashir et al., Genes Dev. 15: 188-200, 2001; Elbashir et a., Nature 411: 494-498, 2001; Elbashir et al., EMBO J. 20: 6877-6888, 2001; and Elbashir et al., Methods 26: 199-213, 2002). 5 In addition to the examples above, the introduced nucleic acid may also comprise a nucleotide sequence which is not directly related to a (1,3;1,4)-p-D glucan synthase sequence but, nonetheless, may directly or indirectly modulate the expression of (1,3;1,4)-p-D-glucan synthase encoding nucleic acid in a cell. 10 Examples include nucleic acid molecules that encode transcription factors or other proteins which promote or suppress the expression of an endogenous (1,3;1,4)-p-D-glucan synthase encoding nucleic acid molecule in a cell; and other non-translated RNAs which directly or indirectly promote or suppress endogenous (1,3;1,4)-p-D-glucan synthase expression and the like. 15 In order to effect expression of an introduced nucleic acid in a genetically modified cell, where appropriate, the introduced nucleic acid may be operably connected to one or more control sequences. The term "control sequences" should be understood to include all components known in the art, which are 20 necessary or advantageous for the transcription, translation and or post translational modification of the operably connected nucleic acid or the transcript or protein encoded thereby. Each control sequence may be native or foreign to the operably connected nucleic acid. The control sequences may include, but are not limited to, a leader, polyadenylation sequence, propeptide 25 sequence, promoter, enhancer or upstream activating sequence, signal peptide sequence, and transcription terminator. Typically, a control sequence at least includes a promoter. The term "promoter" as used herein, describes any nucleic acid which confers, 30 activates or enhances expression of a nucleic acid molecule in a cell. Promoters are generally positioned 5' (upstream) to the genes that they control. In the construction of heterologous promoter/structural gene combinations, it is WO 2007/014433 PCT/AU2006/001107 - 33 generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, ie. the gene from which the promoter is derived. As is known in the art, some variation in this 5 distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, ie. the genes from which it is derived. Again, as is known in the art, some variation in this distance can also occur. 10 A promoter may regulate the expression of an operably connected nucleotide sequence constitutively, or differentially with respect to the cell, tissue, organ or developmental stage at which expression occurs, in response to external stimuli such as physiological stresses, pathogens, or metal ions, amongst others, or in 15 response to one or more transcriptional activators. As such, the promoter used in accordance with the methods of the present invention may include a constitutive promoter, an inducible promoter, a tissue-specific promoter or an activatable promoter. 20 The present invention contemplates the use of any promoter which is active in a cell of interest. As such, a wide array of promoters which are active in any of bacteria, fungi, animal cells or plant cells would be readily ascertained by one of ordinary skill in the art. However, in particularly preferred embodiments of the invention, plant cells are used. Therefore, plant-active constitutive, inducible, 25 tissue-specific or activatable promoters are particularly preferred. Plant constitutive promoters typically direct expression in nearly all tissues of a plant and are largely independent of environmental and developmental factors. Examples of constitutive promoters that may be used in accordance with the 30 present invention include plant viral derived promoters such as the Cauliflower Mosaic Virus 35S and 19S (CaMV 35S and CaMV 19S) promoters; bacterial plant pathogen derived promoters such as opine promoters derived from WO 2007/014433 PCT/AU2006/001107 - 34 Agrobacterium spp., eg. the Agrobacterium-derived nopaline synthase (nos) promoter; and plant-derived promoters such as the rubisco small subunit gene (rbcS) promoter, the plant ubiquitin promoter (Pubi) and the rice actin promoter (Pact). 5 "Inducible" promoters include, but are not limited to, chemically inducible promoters and physically inducible promoters. Chemically inducible promoters include promoters which have activity that is regulated by chemical compounds such as alcohols, antibiotics, steroids, metal ions or other compounds. 10 Examples of chemically inducible promoters include: alcohol regulated promoters (eg. see European Patent 637 339); tetracycline regulated promoters (eg. see US Patent 5,851,796 and US Patent 5,464,758); steroid responsive promoters such as glucocorticoid receptor promoters (eg. see US Patent 5,512,483), estrogen receptor promoters (eg. see European Patent Application 15 1 232 273), ecdysone receptor promoters (eg. see US Patent 6,379,945) and the like; metal-responsive promoters such as metallothionein promoters (eg. see US Patent 4,940,661, US Patent 4,579,821 and US 4,601,978); and pathogenesis related promoters such as chitinase or lysozyme promoters (eg. see US Patent 5,654,414) or PR protein promoters (eg. see US Patent 20 5,689,044, US Patent 5,789,214, Australian Patent 708850, US Patent 6,429,362). The inducible promoter may also be a physically regulated promoter which is regulated by non-chemical environmental factors such as temperature (both 25 heat and cold), light and the like. Examples of physically regulated promoters include heat shock promoters (eg. see US Patent 5,447858, Australian Patent 732872, Canadian Patent Application 1324097); cold inducible promoters (eg. see US Patent 6,479,260, US Patent 6,084,08, US Patent 6,184,443 and US Patent 5,847,102); light inducible promoters (eg. see US Patent 5,750,385 and 30 Canadian Patent 132 1563); light repressible promoters (eg. see New Zealand Patent 508103 and US Patent 5,639,952).

WO 2007/014433 PCT/AU2006/001107 - 35 "Tissue specific promoters" include promoters which are preferentially or specifically expressed in one or more specific cells, tissues or organs in an organism and/or one or more developmental stages of the organism. It should be understood that a tissue specific promoter may be either constitutive or 5 inducible. Examples of plant tissue specific promoters include: root specific promoters such as those described in US Patent Application 2001047525; fruit specific promoters including ovary specific and receptacle tissue specific promoters 10 such as those described in European Patent 316 441, US Patent 5,753,475 and European Patent Application 973 922; and seed specific promoters such as those described in Australian Patent 612326 and European Patent application 0 781 849 and Australian Patent 746032. 15 In one preferred embodiment, the tissue specific promoter is a seed and/or grain specific promoter. Exemplary seed or grain specific promoters include puroindoline-b gene promoters (for example see Digeon et al., Plant Mol. Biol. 39: 1101-1112, 1999); Pbf gene promoters (for example see Mena et a., Plant J. 16: 53-62, 1998); GS 1 .2 gene promoters (for example see Muhitch et al., Plant 20 Sci. 163: 865-872, 2002); glutelin Gtl gene promoters (for example see Okita et al., J. Biol. Chem. 264: 12573-12581, 1989; Zheng et al., Plant J. 4: 357-366, 1993; Sindhu et al., Plant Sci. 130: 189-196, 1997; Nandi et al., Plant Sci. 163: 713-722, 2002); Hor2-4 gene promoters (for example see Knudsen and MOller, Planta 195: 330-336, 1991; Patel et al., Mol. Breeding 6: 113-123, 2000; Wong 25 et al., Proc. Natl. Acad. Sci. USA 99: 16325-16330, 2002); lipoxygenase I gene promoters (for example see Rouster et al., Plant J. 15: 435-440, 1998); Chi26 gene promoters (for example see Leah et al., Plant J. 6: 579-589, 1994); Glu DI-1 gene promoters (for example see Lamacchia et al., J. Exp. Bot. 52: 243 250, 2001; Zhang et al., Theor. Apple. Genet. 106: 1139-1146, 2003); Hor3-1 30 gene promoters (for example see Sorensen et al., Mol. Gen. Genet. 250: 750 760, 1996; Horvath et al., Proc. Nat]. Acad. Sci. USA 97: 1914-1919, 2000) and Waxy (Wx) gene promoters (for example see Yao et al., Acta Phytophysiol. Sin.

WO 2007/014433 PCT/AU2006/001107 - 36 22: 431-436, 1996; Terada et al., Plant Cell Physiol. 41: 881-888, 2000; Liu et al., Transgenic Res. 12: 71-82, 2003). In a particularly preferred embodiment, the seed specific promoter is an endosperm specific promoter. 5 The promoter may also be a promoter that is activatable by one or more transcriptional activators, referred to herein as an "activatable promoter". For example, the activatable promoter may comprise a minimal promoter operably connected to an Upstream Activating Sequence (UAS), which comprises, inter alia, a DNA binding site for one or more transcriptional activators. 10 As referred to herein the term "minimal promoter" should be understood to include any promoter that incorporates at least an RNA polymerase binding site and, preferably a TATA box and transcription initiation site and/or one or more CAAT boxes. More preferably, when the cell is a plant cell, the minimal 15 promoter may be derived from the Cauliflower Mosaic Virus 35S (CaMV 35S) promoter. Preferably, the CaMV 35S derived minimal promoter may comprise a sequence that corresponds to positions -90 to +1 (the transcription initiation site) of the CaMV 35S promoter (also referred to as a -90 CaMV 35S minimal promoter), -60 to +1 of the CaMV 35S promoter (also referred to as a -60 20 CaMV 35S minimal promoter) or -45 to +1 of the CaMV 35S promoter (also referred to as a -45 CaMV 35S minimal promoter). As set out above, the activatable promoter may comprise a minimal promoter fused to an Upstream Activating Sequence (UAS). The UAS may be any 25 sequence that can bind a transcriptional activator to activate the minimal promoter. Exemplary transcriptional activators include, for example: yeast derived transcription activators such as Gal4, Pdrl, Gcn4 and Acel; the viral derived transcription activator, VP16; Hap1 (Hach et al., J Biol Chem 278: 248 254, 2000); Gaf1 (Hoe et al., Gene 215(2): 319-328, 1998); E2F (Albani et al., J 30 Biol Chem 275: 19258-19267, 2000); HAND2 (Dai and Cserjesi, J Biol Chem 277: 12604-12612, 2002); NRF-1 and EWG (Herzig et al., J Cell Sci 113: 4263 4273, 2000); P/CAF (Itoh et al., Nuc/ Acids Res 28: 4291 - 4298, 2000); MafA WO 2007/014433 PCT/AU2006/001107 - 37 (Kataoka et al., J Biol Chem 277: 49903-49910, 2002); human activating transcription factor 4 (Liang and Hai, J Biol Chem 272: 24088 - 24095, 1997); Bcl1O (Liu et al., Biochem Biophys Res Comm 320(1): 1-6, 2004); CREB-H (Omori et al., Nuc/ Acids Res 29: 2154 - 2162, 2001); ARR1 and ARR2 (Sakai 5 et a!., Plant J 24(6): 703-711, 2000); Fos (Szuts and Bienz, Proc Natl Acad Sci USA 97: 5351-5356, 2000); HSF4 (Tanabe et al., J Biol Chem 274: 27845 27856, 1999); MAMLI (Wu et al., Nat Genet 26: 484-489, 2000). In one preferred embodiment, the UAS comprises a nucleotide sequence that is 10 able to bind to at least the DNA-binding domain of the GAL4 transcriptional activator. UAS sequences, which can bind transcriptional activators that comprise at least the GAL4 DNA binding domain, are referred to herein as UASG. In a particularly preferred embodiment, the UASG comprises the sequence 5'-CGGAGTACTGT CCTCCGAG-3' or a functional homolog thereof. 15 As referred to herein, a "functional homolog" of the UASG sequence should be understood to refer to any nucleotide sequence which can bind at least the GAL4 DNA binding domain and which preferably comprises a nucleotide sequence having at least 50% identity, more preferably at least 65% identity, 20 even more preferably at least 80% identity and most preferably at least 90% identity with the UASG nucleotide sequence. The UAS sequence in the activatable promoter may comprise a plurality of tandem repeats of a DNA binding domain target sequence. For example, in its 25 native state, UASG comprises four tandem repeats of the DNA binding domain target sequence. As such, the term "plurality" as used herein with regard to the number of tandem repeats of a DNA binding domain target sequence should be understood to include at least 2 tandem repeats, more preferably at least 3 tandem repeats and even more preferably at least 4 tandem repeats. 30 As mentioned above, the control sequences may also include a terminator. The term "terminator" refers to a DNA sequence at the end of a transcriptional unit WO 2007/014433 PCT/AU2006/001107 - 38 which signals termination of transcription. Terminators are 3'-non-translated DNA sequences generally containing a polyadenylation signal, which facilitates the addition of polyadenylate sequences to the 3'-end of a primary transcript. As with promoter sequences, the terminator may be any terminator sequence 5 which is operable in the cells, tissues or organs in which it is intended to be used. Examples of suitable terminator sequences which may be useful in plant cells include: the nopaline synthase (nos) terminator, the CaMV 35S terminator, the octopine synthase (ocs) terminator, potato proteinase inhibitor gene (pin) terminators, such as the pinl and pini/ terminators and the like. 10 As would be appreciated by one of skill in the art, the method of the present invention for modulating the level of (1,3;1,4)-p-D-glucan in a cell, by modulating the level and/or activity of (1,3;1,4)-p-D-glucan synthase in the cell, has several industrial applications. 15 For example, (1,3;1,4)-p-D-glucans are known to form viscous solutions. The viscosity-generating properties of soluble cereal (1,3;1,4)-p-D-glucans are critical determinants in many aspects of cereal processing. For example, incompletely degraded (1,3;1,4)-p-D-glucans from malted barley and cereal 20 adjuncts can contribute to wort and beer viscosity and are associated with problems in wort separation and beer filtration (eg. see Bamforth, Brew. Dig. 69 (5): 12-16, 1994) Therefore, for example, in one embodiment, the present invention may be applied to reduce the level of (1,3;1,4)-p-D-glucan in barley grain, by reducing the level and/or activity of (1,3;1,4)-p-D-glucan synthase in 25 one or more cells of the barley grain, to increase its suitability for beer production. Soluble cereal (1,3;1,4)-p-D-glucans are also considered to have antinutritive effects in monogastric animals such as pigs and poultry. The "antinutritive" 30 effects have been attributed to the increased viscosity of gut contents, which slows both the diffusion of digestive enzymes and the absorption of degradative products of enzyme action. This, in turn, leads to slower growth rates.

WO 2007/014433 PCT/AU2006/001107 - 39 Moreover, in dietary formulations for poultry, high (1,3;1,4)-p-D-glucan concentrations are associated with 'sticky' faeces, which are indicative of the poor digestibility of the (1,3;1,4)-P-D-glucans and which may present major handling and hygiene problems for producers. Therefore, in another 5 embodiment, the present invention may be applied to reducing the level of (1,3;1,4)-p-D-glucan in one or more cells of a plant used for animal feed, to improve the suitability of the plant as animal feed. However, cereal (1,3;1,4)-p-D-glucans are important components of dietary fibre 10 in human and animal diets. As used herein, the term "dietary fibre" should be understood to include the edible parts of plants or analogous carbohydrates that are resistant to digestion and absorption in the human small intestine with complete or partial fermentation in the large intestine. "Dietary fibre" includes polysaccharides (specifically including (1,3;1,4)-p-D-glucans), oligosaccharides, 15 lignin and associated plant substances. In at least human diets, dietary fibres promote beneficial physiological effects including general bowel health, laxation, blood cholesterol attenuation, and/or blood glucose attenuation. Humans and monogastric animals produce no enzymes that degrade (1,3;1,4) 20 p-D-glucans, although there are indications that some depolymerization occurs in the stomach and small intestine, presumably due to the activity of commensal microorganisms. By comparison the soluble (1,3;1,4)-p-D-glucans and other non-starchy polysaccharides are readily fermented by colonic micro-organisms and make a small contribution to digestible energy. In contrast to their 25 antinutritive effects in monogastric animals, oat and barley (1,3;1,4)-p-D-glucans at high concentrations in human foods have beneficial effects, especially for non-insulin-dependent diabetics, by flattening glucose and insulin responses that follow a meal. High concentrations of (1,3;1,4)-p-D-glucans (20% w/v) in food have also been implicated in the reduction of serum cholesterol 30 concentrations, by lowering the uptake of dietary cholesterol or resorption of bile acids from the intestine.

WO 2007/014433 PCT/AU2006/001107 - 40 Therefore, in another embodiment, the present invention may be applied to increasing the dietary fibre content of an edible plant or edible plant part, by increasing the level of (1,3;1,4)-p-D-glucan in the plant, or part thereof. In a particularly preferred embodiment, the edible plant or edible part of a plant is a 5 cereal crop plant or part thereof. (1,3;1,4)-p-D-glucans, in common with a number of other polysaccharides, in particular (1->3)-p-D-glucans, are also thought to modify immunological responses in humans by a process that is mediated through binding to 10 receptors on cells of the reticuloendothelial system (leucocytes and macrophages). In addition, they may have the capacity to activate the proteins of the human complement pathway, a system that is invoked as a first line of defence before circulating antibodies are produced. 15 The method of the first aspect of the present invention also facilitates the production of (1,3;1,4)-p-D-glucan in a recombinant expression system. For example, a (1,3;1,4)-p-D-glucan may be recombinantly produced by introducing a (1,3;1,4)-p-D-glucan synthase encoding nucleotide sequence as described herein, under the control of a promoter, into a cell, wherein the cell 20 subsequently expresses the (1,3;1,4)-P-D-glucan synthase and produces (1,3;1,4)-p-D-glucan. A vast array of recombinant expression systems that may be used to express a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid are known in the art. 25 Exemplary recombinant expression systems include: bacterial expression systems such as E. coli expression systems (reviewed in Baneyx, Curr. Opin. Biotechnol. 10: 411-421, 1999; eg. see also Gene expression in recombinant microorganisms, Smith (Ed.), Marcel Dekker, Inc. New York, 1994; and Protein Expression Technologies: Current Status and Future Trends, Baneyx (Ed.), 30 Chapters 2 and 3, Horizon Bioscience, Norwich, UK, 2004), Bacillus spp. expression systems (eg. see Protein Expression Technologies: Current Status and Future Trends, supra, chapter 4) and Streptomyces spp. expression WO 2007/014433 PCT/AU2006/001107 -41 systems (eg. see Practical Streptomyces Genetics, Kieser et al., (Eds.), Chapter 17, John Innes Foundation, Norwich, UK, 2000); fungal expression systems including yeast expression systems such as Saccharomyces spp., Schizosaccharomyces pombe, Hansenula polymorpha and Pichia spp. 5 expression systems and filamentous fungi expression systems (eg. see Protein Expression Technologies: Current Status and Future Trends, supra, chapters 5, 6 and 7; Buckholz and Gleeson, Bio/Technology 9(11): 1067-1072, 1991; Cregg et al., Moi. Biotechnol. 16(1): 23-52, 2000; Cereghino and Cregg, FEMS Microbiology Reviews 24: 45-66, 2000; Cregg et al., Bio/Technology 11: 905 10 910, 1993); mammalian cell expression systems including Chinese Hamster Ovary (CHO) cell based expression systems (eg. see Protein Expression Technologies: Current Status and Future Trends, supra, chapter 9); insect cell cultures including baculovirus expression systems (eg. see Protein Expression Technologies: Current Status and Future Trends, supra, chapter 8; Kost and 15 Condreay, Curr. Opin. Biotechnol. 10: 428-433, 1999; Baculovirus Expression Vectors: A Laboratory Manual WH Freeman & Co., New York, 1992; and The Baculovirus Expression System: A Laboratory Manual, Chapman & Hall, London, 1992); Plant cell expression systems such as tobacco, soybean, rice and tomato cell expression systems (eg. see review of Hellwig et al., Nat 20 Biotechnol 22: 1415-1422, 2004); and the like. Therefore, in a fourth aspect, the present invention provides a method for producing (1,3;1,4)-p-D-glucan, the method comprising expressing a (1,3;1,4)-0 D-glucan synthase encoding nucleic acid in a cell. 25 In one preferred embodiment, the cell is a cell from a recombinant expression system as hereinbefore defined. In another preferred embodiment, the (1,3;1,4)-p-D-glucan synthase encoding 30 nucleic acid is a CsIF gene or functional homolog thereof.

WO 2007/014433 PCT/AU2006/001107 -42 In a fifth aspect, the present invention also provides (1,3;1,4)-p-D-glucan produced according to the method of the fourth aspect of the invention. In a sixth aspect, the present invention also provides a cell comprising any one 5 or more of: (i) a modulated level of (1,3;1,4)-p-D-glucan relative to a wild type cell of the same taxon; (ii) a modulated level and/or activity of (1,3;1,4)-p-D-glucan synthase 10 relative to a wild type cell of the same taxon; (iii) modulated expression of a (1,3;1,4)-p-D-glucan synthase encoding nucleic acid relative to a wild type cell of the same taxon. In one preferred embodiment, the cell of the sixth aspect of the invention is 15 produced according to the methods of the first, second or third aspects of the present invention as described herein. In another preferred embodiment, the cell is a plant cell, more preferably a monocot plant cell and most preferably a cereal crop plant cell. 20 Furthermore, in a seventh aspect, the present invention provides a multicellular structure comprising one or more cells according to the sixth aspect of the invention. As referred to herein, a "multicellular structure" includes any aggregation of one 25 or more cells. As such, a multicellular structure specifically encompasses tissues, organs, whole organisms and parts thereof. Furthermore, a multicellular structure should also be understood to encompass multicellular aggregations of cultured cells such as colonies, plant calli, suspension cultures and the like. 30 As mentioned above, in one preferred embodiment of the invention, the cell is a plant cell and as such, the present invention includes a whole plant, plant tissue, plant organ, plant part, plant reproductive material or cultured plant WO 2007/014433 PCT/AU2006/001107 - 43 tissue, comprising one or more plant cells according to the sixth aspect of the invention. In a more preferred embodiment, the present invention provides a cereal plant 5 comprising one or more cells according to the sixth aspect of the invention. In a particularly preferred embodiment, the present invention provides cereal grain comprising one or more cells according to the sixth aspect of the invention. 10 Therefore, in an eighth aspect, the present invention provides a cereal grain comprising an altered level of (1,3;1,4)-p-D-glucan, wherein the grain comprises one or more cells comprising an altered level and/or activity of (1,3;1,4)-p-D glucan synthase and/or altered expression of a (1,3;1,4)-p-D-glucan synthase 15 encoding nucleic acid molecule. In one embodiment, the grain of the eighth aspect of the invention may have an increased level of (1,3;1,4)-p-D-glucan compared to wild type grain from the same species. In an alternate embodiment, the grain may have a decreased 20 level of (1,3;1,4)-p-D-glucan compared to wild type grain from the same species. In a ninth aspect, the present invention also provides flour comprising: (i) flour produced by the milling of the grain of the eighth aspect of the 25 invention; and (ii) optionally, flour produced by the milling of one or more other grains. As such, the flour produced by the milling of the grain of the eighth aspect of the invention may comprise, for example approximately 10%, 20%, 30%, 40%, 30 50%, 60%, 70%, 80%, 90% or 100% by weight of the flour of the ninth aspect of the invention.

WO 2007/014433 PCT/AU2006/001107 - 44 As referred to herein "milling" contemplates any method known in the art for milling grain, such as those described by Brennan et al. (Manual of Flour and Husk Milling, Brennan et al. (Eds.), AgriMedia, ISBN: 3-86037-277-7). 5 Preferably the flour produced by the milling of the grain of the eighth aspect of the invention used in the flour of the ninth aspect of the invention comprises an increased level of (1,3;1,4)-p-D-glucan compared to wild type flour. The "flour produced by the milling of one or more other grains" may be flour 10 produced by milling grain derived from any cereal plant, as hereinbefore defined. This component of the flour of the eighth aspect of the invention may, for example, comprise 0%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% by weight. 15 In a preferred embodiment, the flour produced by the milling of one or more other grains is a wheat flour and, therefore, the flour of the ninth aspect of the invention may be suitable for producing bread, cakes, biscuits and the like. As set out above, the present invention is predicated, in part, on the 20 identification and isolation of nucleotide and amino acid sequences that encode (1,3;1,4)-p-D-glucan synthases. Therefore, in a tenth aspect, the present invention provides an isolated nucleic acid molecule that encodes a (1,3;1,4)-p-D-glucan synthase. 25 In the present invention, "isolated" refers to material removed from its original environment (e.g., the natural environment if it is naturally occurring), and thus is altered "by the hand of man" from its natural state. For example, an isolated polynucleotide could be part of a vector or a composition of matter, or could be 30 contained within a cell, and still be "isolated" because that vector, composition of matter, or particular cell is not the original environment of the polynucleotide. An "isolated" nucleic acid molecule should also be understood to include a WO 2007/014433 PCT/AU2006/001107 - 45 synthetic nucleic acid molecule, including those produced by chemical synthesis using known methods in the art or by in-vitro amplification (eg. polymerase chain reaction and the like). 5 The isolated nucleic acid molecules of the present invention may be composed of any polyribonucleotide or polydeoxribonucleotide, which may be unmodified RNA or DNA or modified RNA or DNA. For example, the isolated nucleic acid molecules of the invention can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and 10 double-stranded RNA, and RNA that is mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single stranded or, more typically, double-stranded or a mixture of single- and double stranded regions. In addition, the isolated nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and 15 DNA. The isolated nucleic acid molecules may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritylated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus, "polynucleotide" embraces chemically, enzymatically, or 20 metabolically modified forms. In an eleventh aspect, the present invention also provides an isolated nucleic acid molecule comprising one or more of: 25 (i) the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11; (ii) a nucleotide sequence which is at least 50% identical to the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, 30 SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11; (iii) a nucleotide sequence which hybridises to a nucleic acid molecule comprising the nucleotide sequence set forth in any of SEQ ID NO: 1, WO 2007/014433 PCT/AU2006/001107 - 46 SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11 under low stringency, more preferably medium stringency and most preferably high stringency conditions; (iv) a nucleotide sequence which encodes the amino acid sequence set 5 forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12. (v) a nucleotide sequence which is the complement of any one of (i) to (iv); (vi) a nucleotide sequence which is the reverse complement of any one of 10 (i) to (iv); (vii) a fragment of any one of (i) to (vi). As referred to in this eleventh aspect of the invention, the term "at least 50% identical" should be understood to also include nucleotide sequence percentage 15 identities greater than 50%. For example, the term "at least 50% identical" preferably encompasses at least 60% identity, at least 70% identity, at least 80% identity, at least 90% identity and at least 95% identity. In a preferred embodiment, the isolated nucleic acid molecule or fragment 20 thereof comprises a nucleotide sequence encoding a (1,3;1,4)-p-D-glucan synthase, as herein before defined. In a more preferred embodiment, the isolated nucleic acid molecule comprises a nucleotide sequence defining a Cs/F gene, or functional homolog thereof, as hereinbefore defined. 25 As set out above, the eleventh aspect of the invention provides fragments of a nucleotide sequence. "Fragments" of a nucleotide sequence should be at least 15 nucleotides (nt), and more preferably at least 20 nt, still more preferably at least 30 nt, and even more preferably, at least 40, 50, 100, 150, 200, 250, 300, 325, 350, 375, 400, 450, 500, 550, or 600 nt in length. These fragments have 30 numerous uses that include, but are not limited to, diagnostic probes and primers. Of course, larger fragments, such as those of 601-3000 nt in length are also useful according to the present invention as are fragments corresponding WO 2007/014433 PCT/AU2006/001107 - 47 to most, if not all, of the nucleotide sequences SEQ ID NO: 1. By a fragment at least 20 nt in length, for example, is intended fragments which include 20 or more contiguous bases from, for example, the nucleotide sequence of SEQ ID NO: 1. 5 Preferably, the polynucleotide fragments of the invention encode a polypeptide, having (1,3;1,4)-p-D-glucan synthase functional activity as defined herein. Polypeptides or proteins encoded by these polynucleotides are also 10 encompassed by the invention. In a twelfth aspect, the present invention provides a genetic construct or vector comprising an isolated nucleic acid molecule of the eleventh aspect of the invention. 15 In addition to the nucleic acid of the eleventh aspect of the invention, the vector or construct of the twelfth aspect of the invention preferably further comprises one or more of: an origin of replication for one or more hosts; a selectable marker gene which is active in one or more hosts; or one or more control 20 sequences which enable transcription of the isolated nucleic acid molecule in a cell. As used herein, the term "selectable marker gene" includes any gene that confers a phenotype on a cell, in which it is expressed, to facilitate the 25 identification and/or selection of cells which are transfected or transformed with a genetic construct of the invention. "Selectable marker genes" include any nucleotide sequences which, when expressed by a cell, confer a phenotype on the cell that facilitates the 30 identification and/or selection of these transformed cells. A range of nucleotide sequences encoding suitable selectable markers are known in the art. Exemplary nucleotide sequences that encode selectable markers include: WO 2007/014433 PCT/AU2006/001107 - 48 antibiotic resistance genes such as ampicillin-resistance genes, tetracycline resistance genes, kanamycin-resistance genes, the AURI-C gene which confers resistance to the antibiotic aureobasidin A, neomycin phosphotransferase genes (eg. nptl and nptl) and hygromycin phosphotransferase genes (eg. hpt); 5 herbicide resistance genes including glufosinate, phosphinothricin or bialaphos resistance genes such as phosphinothricin acetyl transferase encoding genes (eg. bar), glyphosate resistance genes including 3-enoyl pyruvyl shikimate 5 phosphate synthase encoding genes (eg. aroA), bromyxnil resistance genes including bromyxnil nitrilase encoding genes, sulfonamide resistance genes 10 including dihydropterate synthase encoding genes (eg. sul) and sulfonylurea resistance genes including acetolactate synthase encoding genes; enzyme encoding reporter genes such as GUS and chloramphenicolacetyltransferase (CAT) encoding genes; fluorescent reporter genes such as the green fluorescent protein-encoding gene; and luminescence-based reporter genes 15 such as the luciferase gene, amongst others. Furthermore, it should be noted that the selectable marker gene may be a distinct open reading frame in the construct or may be expressed as a fusion protein with the (1,3;1,4)-p-D-glucan synthase protein. 20 The twelfth aspect of the invention extends to all genetic constructs essentially as described herein, which include further nucleotide sequences intended for the maintenance and/or replication of the genetic construct in prokaryotes or eukaryotes and/or the integration of the genetic construct or a part thereof into 25 the genome of a eukaryotic or prokaryotic cell. In one preferred embodiment, the construct of the twelfth aspect of the invention is adapted to be at least partially transferred into a plant cell via Agrobacterium mediated transformation. Accordingly, in a particularly preferred embodiment, 30 the construct according to the twelfth aspect of the invention comprises left and/or right T-DNA border sequences.

WO 2007/014433 PCT/AU2006/001107 - 49 Suitable T-DNA border sequences would be readily ascertained by one of skill in the art. However, the term "T-DNA border sequences" should be understood to encompass any substantially homologous and substantially directly repeated nucleotide sequences that delimit a nucleic acid molecule that is transferred 5 from an Agrobacterium sp. cell into a plant cell susceptible to Agrobacterium mediated transformation. By way of example, reference is made to the paper of Peralta and Ream (Proc. Nati. Acad. Sci. USA, 82(15): 5112-5116, 1985) and the review of Gelvin (Microbiology and Molecular Biology Reviews, 67(1): 16 37, 2003). 10 Although in one preferred embodiment, the construct of the twelfth aspect of the invention is adapted to be transferred into a plant via Agrobacterium-mediated transformation, the present invention also contemplates any suitable modifications to the genetic construct which facilitate bacterial mediated 15 insertion into a plant cell via bacteria other than Agrobacterium sp., as described in Broothaerts et al. (Nature 433: 629-633, 2005). Those skilled in the art will be aware of how to produce the constructs described herein and of the requirements for obtaining the expression thereof, when so 20 desired, in a specific cell or cell-type under the conditions desired. In particular, it will be known to those skilled in the art that the genetic manipulations required to perform the present invention may require the propagation of a genetic construct described herein or a derivative thereof in a prokaryotic cell such as an E. coli cell or a plant cell or an animal cell. Exemplary methods for cloning 25 nucleic acid molecules are described in Sambrook et a/. (2000, supra) In a thirteenth aspect, the present invention provides a cell comprising the isolated nucleic acid molecule of the tenth or eleventh aspects of the invention or genetic construct of the twelfth aspect of the invention. 30 WO 2007/014433 PCT/AU2006/001107 - 50 The isolated nucleic acid molecule of the tenth or eleventh aspects of the invention or genetic construct of the twelfth aspect of the invention may be introduced into a cell via any means known in the art. 5 The isolated nucleic acid molecule or construct referred to above may be maintained in the cell as a DNA molecule, as part of an episome (eg. a plasmid, cosmid, artificial chromosome or the like) or it may be integrated into the genomic DNA of the cell. 10 As used herein, the term "genomic DNA" should be understood in it's broadest context to include any and all DNA that makes up the genetic complement of a cell. As such, the genomic DNA of a cell should be understood to include chromosomes, mitochondrial DNA, plastid DNA, chloroplast DNA, endogenous plasmid DNA and the like. As such, the term "genomically integrated" 15 contemplates chromosomal integration, mitochondrial DNA integration, plastid DNA integration, chloroplast DNA integration, endogenous plasmid integration, and the like. Preferably, the isolated nucleic acid molecule is operably connected to, inter 20 alia, a promoter such that the cell may express the isolated nucleic acid molecule. The cell of the thirteenth aspect of the invention may be any prokaryotic or eukaryotic cell. As such, the cell may be a prokaryotic cell such as a bacterial 25 cell including an E coli cell or an Agrobacterium spp. cell, or an archaea cell. The cell may also be a eukaryotic cell including a fungal cell such as a yeast cell or mycelial fungus cell; an animal cell such as a mammalian cell or an insect cell; or a plant cell. In a preferred embodiment, the cell is a plant cell. In a more preferred embodiment, the plant cell is a monocot plant cell. In a most 30 preferred embodiment, the plant cell is a cereal plant cell.

WO 2007/014433 PCT/AU2006/001107 - 51 In a fourteenth aspect, the present invention provides a multicellular structure, as hereinbefore defined, comprising one or more of the cells of the thirteenth aspect of the invention. 5 As mentioned above, in one preferred embodiment, the cell is a plant cell and as such, the present invention should be understood to specifically include a whole plant, plant tissue, plant organ, plant part, plant reproductive material, or cultured plant tissue, comprising one or more cells of the thirteenth aspect of the invention. 10 In a more preferred embodiment, the present invention provides a cereal plant or part thereof, comprising one or more cells of the thirteenth aspect of the invention. 15 In a particularly preferred embodiment, the fourteenth aspect of the invention provides cereal grain comprising one or more cells of the thirteenth aspect of the invention. As set out above, the present invention also provides amino acid sequences for 20 (1,3;1,4)-s-D-glucan synthases. Accordingly, in a fifteenth aspect, the present invention provides an isolated polypeptide comprising an amino acid sequence encoding a (1,3;1,4)-p-D glucan synthase protein. Accordingly, the present invention provides an isolated 25 (1,3;1,4)-p-D-glucan synthase protein. As used herein, the term "polypeptide" should be understood to include any length polymer of amino acids. As such the term "polypeptide" should be understood to encompass peptides, polypeptides and proteins. 30 In a sixteenth aspect, the present invention provides an isolated polypeptide comprising one or more of: WO 2007/014433 PCT/AU2006/001 107 -52 (I) the amino acid sequence set forth In any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12; 5 (1!) an amino acid sequence comprising at least 56%/ identity to the amino acid sequence set forth in any of SEQ ID NO, 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ 10 NO: 10 and SEQ ID NO: 12; (ili) an amino acid sequence encoded by the nuicIeotide sequence set 10 forth In any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ.ID NO: 7; SEQ ID NO: 9 and SEQ 10 NO: 11; and/or. (iv) a fragme~nt of any one of (f), (III) or (ill). As referred to In this sixteenth aspect of the invention, the term "at least 50% 15 Identical" should be understood to also include percentage amino aicid sequence identities greater than 50%, For example, the term "att ieas't 50% Identicl" preferably encompasses at least 60% idenltity, at least 70% identity, at least 80% Identity, at lbast 90% identity and at least 96% identity. 20 In a iprferrec[ embodiment. the isolated polypeptide of the present invention comprises ani amino acid sequence~ definirig a "(1 ,3;1 ,4).-o-gIucan synthase" as hereinberbre defined. The isolated polypeptides of the sixteenth aspect may be composed of amino .25 acids joined to each ot her by peptide bonds or modified peptide bonds, ie., peptide isostleres, and may con~tain amino acids other than the 20 gene encoded amino acids. The Isolated polypeptides of the present Invention may be modified by either natural procestms, such as post-translational processing, or by chemicals modification techniques which are well known in the art, Such 3D modifications arm well described in basic texts and In more detailed monographs, as well sis in the literature.

WO 2007/014433 PCT/AU2006/001107 -53 Modifications can occur anywhere In the isolated polypeptide, including the peptide backbone, the amino acid side-chains and/or the termini. It will be appreciated that the same type of modification may be present In the same or varying degrees at several sites In a given isolated polypeptide. Also, an 5. isolated polypeptide of the present invention may contain many types of modifications. The proteins may be branched, for exarnple, asa result of ubiquitination, and/or they may be cyclic, with or without branching. Cyclic, branched, and branched 10 cyclic polypeptides may result from post-translation natural processes or may be made by synthetic methods. Modifications include acetylation, acylation, ADP-ribosylation, amioation, covalent attachment of flavin, covalentt attachment of a heme moiety, covalent 15 attachment of a nucleotide or nucleotide derivative, covalent attachment of a lipid or lipid derivative, covalent attachment of phosphatidylinositol, cross linking; cyclization, disulfide bond formation, demethyation, formation of covalent cross-links, formation of cysteine, formation of pyroglutamate, formylation, gamma-carboxyiation, 'glycosylation, GPI anchor formation, 20 hydroxylation, iodination, methylatlon, myristoylation, oxidation, PEGylation, protealytic processing, - phosphorylation, prenylation, racemization, selenoylation, sulfatior transfer-RNA mediated addition of amino acids to proteins such as arginylation, and ubiquitination, (See, for instance, Protelrrs Structure And Molecular Properties 2 nd Ed., Creighton (ed.), W. H. Freeman and 25 Company, New York, 1993); Posttranslat/onal Covalent Modificat/on Of Protpins, Johnson (Ed.),. Academic Press, New York, 1983; Selfter et al., Meth Enzymol 182: 626-646, 1990); Rattan ot a/., Ann. NY Acad Sci 663:. 48 62.,1992:). 30 A5 set out above, the sixteenth aspect of the invention also provides fragments of isolated polypeptides. Polypeptide fragments may be "free-standing," or comprised within a larger polypeptide of which the fragment forms a part or WO 2007/014433 PCT/AU2006/001107 -54 region, most preferably as a single continuous regiort. The protein fragments can be at least 3, 4, 5, 6, 8, 9, 10, 11, 12, 13, 15, 20, 25, 30, 35, 40, 45, 50, 60-, 70, 50,-90, 100, 110, 120, 130, 140, or 150 amino acids 5 in length. In one preferred embodiment, the fragment comprises an amino acid sequence which is a part of the sequence set forth in SEQ ID NO: 2, in one preferred embodiment, the fragment comprises (1 ,3;1,4)-p-D-gIucan synthese functional activity, However, Oven if the fragment does not retain one * or more biologlcal funotlons of the (1,3;14)-P-o-glucan synthase protein, other functional activities may still be retained. For example, the fragments may lack (1,3;1,4)-pr->-glucan synthese functional activity but retain. the ability to induce and/or bind to antibodies which recognize the comploto or mature forms of an Isolated (1,3;1,4)-p-D-gl.ucan synthase protein. A peptide, polypeptile or protein 15 fragment which has the ability to Induce and/or bind to antibodies which recognize the complete or mature forms of the isolated (1,3;1,4)-f-D-glucan synthase protein is referred to herein as a "(1,3;14)-p-D-glucan synthase epitope". 20 A (1,3;1,4)-p-D-glucan synthase epitope may comprise as few as three or four amino acid residues, preferably at least 5 amino acids and more preferably at least 10 amino acid residues. Whether a particular epitope of an isolated (1,3;1,4)-p-o-gILucan synthase protein retains such immunologic activities can readily be determined by methode known in the art. As such, one preferred 25 (1,3;1,4)-p-D-glucan synthase protein fragment is a polypeptide comprisig one or more (1,3; 1 4)-p-glucan synthase epitopes. A polypeptide comprising one or more (1r3;1,4)-P-D-gIucan synthese epitopes may be produced by any conventional means for making polypeptides including 30 synthetic and recombinant methods known in the art, In one embodiment, (1 ,3;1,4)-pp-glucan synthese epitope-bearing polypeptides may be synthesized using known methods of chemical synthesis, For instance, Houghten has WO 2007/014433 PCT/AU2006/001107 -55 described a simple method for the synthesis of large numbers of peptides (Houghten, Proc. Nati. Acad. Sci. USA 82: 5131-5135, 1985). The isolated polypeptides and (1,3;1,4).-D--glucan synthase epitope-bearing 5 polypeptides of the sixteenth aspect of the invention are useful, for example, in the generation of antibodies that bind to the isolated (1,3;1,4)-p-D-gIucan synthase proteins of the invention. Such antibodies are useful, inter afia, in the detection and -localization of 10 (1,3;1,4)-P-D-glucan synthase proteins and in affinity purification of (1,3;1,4)-p-D glucan synthase proteins. The antibodies may also routinely be used in a variety of qualitative or quantitative immunoassays using methods knovn in the art. For example see Harlow et a/.,. Antibodies: A Laboratory Manuel, (Cold Spring Harbor Laboratory Press 2 ,d Ed., 1988). 15 Accordingly, in a seventeenth aspect, 'the present invention provides an antibody or an epitope binding fragment thereof, raised against an Isolated (1,3;1,4)-p-o-glucan synthase protein as hereinbefore defined or an epitope thereof. 20 The antibodies of the present invention include, but are not limited to, polyclonal,. monoclonal, multispecific, chimeric antibodies, single chain antibodies, Fab fragments, F(ab') fragments, fragments produced by a Fab expression library and epitope-binding fragments of any of the above. 25 The term "antibody", as used herein, refers to immunoglobulin molecules and immunologically active portions of immunoglobulin nploculos, I.e., molecules that contain an antigen-binding site that immunospecifically binds an antigen. The immunoglobulin molecules of the invention can be of any type (e.g., IgG, 30 IgE, gM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, igG4, IgA1 and IgA2) or subclass of immunoglobulin molecule.

WO 2007/014433 PCT/AU2006/001107 The antibodies of the prosent invention may be monospecific, bispecific, lrispecific, or of greater multispecificity. Multispecific antibodies may be specific for different epitopes of a polypeptide of the. present Invention or may be specific for both a polypeptide of the present invention as well as for a 5 heterolagous epitope, such as a heterologous polypeptide or solid support material, For example, see PCT publications WO 93117715; WO 92/08802; WO 91-100360; WO 92/05793; Tutt et al., J. Immunol. 147: 60-69, 1991; US Patents 4,474,893; 4,714,681; 4,926,648; 5,573,920; 5,601,819; and Kostelny et a/. J. immunol. 148: 1547-1553, 1992). 10 In one embodiment, the antibodies of the present invention may act as agonists or antagonists of (1,3;1,4)-p-D-glucan synthase. In further embodiments, the antibodies of the present invention may be used. for example, to purify, detect, and target the polypeptides of the present invention, Including both In vitro and 15 in vivo diagnostic and therapeutic methods. For example, the antibodies have use in immunoassays for qualitatively and quantitatively measuring levels of (1,3;1,4)-p<o-gluoan synthase In biological samples. See, e.g., Harlow et al., Antibodies: A Laboratory Manual (Cold Spring Harbor Laboratory Press, 2nd ed. 1988). 20 The term "antibody", as used herein, should be understood to encompass derivatives that are modified, eg. by the covalent attachment of any type of molecule to the antibody such that covalent attachment does not prevent the. antibody from binding to (1,3;1,4)-P-o-glucan synthase or an epitope thereof, 25 For example, the antibody derivatives include antibodies that have been modified, eg., by glycosylatlon, -acetylation, pegylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, linkage to a cellular ligand or other protein, etc. Furthermore, any of numerous chernical modifications may also be made using known techniques. 30 These include specific chemical cleavage, acetylation, formylation, metabolic synthesis of tunicamycin; etc. Additionally, the derivative may contain one or more non-classical amino acids.

WO 2007/014433 PCT/AU2006/001107 -57 Antibodies may be generated using methods known in the art, such as in vivo immunization, in vitro Immunization, and phage display methods, For example, see Bittle et I. (J. Gen. Virol. 66: 2347-2354, 1986). 5 If in vivo immunization is used, animals may be Immunized with free peptide; however, anti-peptide antibody titer may be boosted by coupling of the peptide to. a macromolecular carrier, such as keyhole limpet hemacyanin (KLH) or tetanus toxoid, For example, peptides containing cystelne residues may be 10 coupled to a carrier using a linker such as maleimidobenzoy-N hydroxysuccinimide ester (MBS), while other peptides may be coupled to carriers using a more general linking agent such as glutaraldehyde. Animals such as rabbits, rats and mice are immunized with either free or carrier 15 couplod poptidos, for instance, by Intraperitoneal and/or intradermal. injection of emulsions containing about 100 micrograms of peptide or carrier protein and Freund's adjuvant. Several booster injections may be needed, for example, at Intervals of about two weeks, to provide a useful titer of anti-peptide antibody which can be detected, for example,. by EUSA assay using free peptide 20 adsorbed to a solid surface. The titer of anti-peptide antibodies in serum from an immunized animal may be increased by selection of anti-peptide antib.odies, for instance, by adsorption to the peptide on a solid support and elution of the selected antibodies according to methods well known In the art. 25 For example, polyclonal antibodies to a (1,3;1,4)-P-D-glucan synthase protein or a polypeptide comprising one or more (1,3;1,.4)-D-glUcan synthase epitopes can be produced by various procedures well known in the art. For example, a polypeptide of the invention can be administorod to various host animals including, but not limited to, rabbits, mice, rats, etc. to induce the production of 30 sera containing polyclonal antibodies specific for the antigen, Various adjuvants may be used to Increase the immunological response, depending on the host species, for example, Freund's (complete and incomplete), mineral gels such as WO 2007/014433 PCT/AU2006/001107 -58-. aluminum hydroxide, surface active substances such as lysolecithin, pluronic polyols, polyanions, peptides, ail emulsions, keyhole limpet hemocyanins, dinitrophenol, and potentially useful human adjuvants such as BCG (bacille Calmette-Guerin) and Corynebecterlurn parvum. Such adjuvants are also well 5 known in the art. As another example, monoclonal antibodies can be prepared using a wide variety of techniques known in the art including the use of hybridoma, recombinant, and phage display technologies, or a combination thereof, For 10 example, monoclonal antibodies can be produced using hybridoma techniques Including those known in the art and taught, for example, in Harlow et a/., Antibodies: A Laboratory Manual, (Cold Spring Harbor Laboratory Press, 2nd ed., 1985) and Hammerling et a., In: Morioclonal Antibodies and T-Cell Hybridomas (Elsevier, NY, 1981). The term "monoclonal antibody" as used 15 herein is not limited to antibodies produced through hybridoma technology. The term "monoclonal antibody' refers to an antibody that is derived from a single clone, including any eukaryotic, prokaryotic, or phage clone, and not the method by which it is produced. 20 Methods for producing and screening for specific antibodies using hybridoma technology are routine and well known In the art. For example, mice can be immunized with a polypeptide of the invention or a cell expreeeing auch peptide. Once an immune response is detected, e.g., antibodies specific for the. antigen are detected in the mouse serum, the .mouse spleen Is harvested and 25 splenocytes isolated, The splenocytes are thon fused by well-known techniques to any suitable myeloma cells, for example cells from cell line SP20 available from the ATCC. Hybridomas are selected and cloned by limited dilution. The hybridoma clones are then assayed by methods known in the art for cells that secrete antibodies capable of binding a polypeptide of the Invention.. Ascites 30 fluid, which generally contains high levels of antibodies, can be generated by immunizing mice with positive hybridoms clones.

WO 2007/014433 PCT/AU2006/001107 -59 Antibody fragments which recognize one or more (1,3;1,4) D-glucan synthase epitopes may also be generated by known techniques. For example, Fab and F(ab')2 fragments may be produced by proteolytic cleavage of immunoglobulin molecules, using. enzymes such as papain (to produce Fab fragments) or 5 pepsin (to produce F(ab')2 fragments). F(ab')2 fragments contain the variable region, the light chain constant region and the CHI domain of the heavy chain. The antibodies of the present invention can also be generated using various phage display methods known in the art, in phage display methods, functional 10 antibody domains are displayed on the surface of phage particles which carry the polynucleotide sequences encoding them. In a particular embodiment, such phage can be utilized to display antigen-binding domains expressed from a repertoire or combinatorial antibody library (e.g., human or murine). Phage expressing an antigen binding domain that binds the antigen of interest can be 15 selected or identified with antigen, e.g., using labeled antigen or antigen bound or captured to a solid surface or bead. Phages used In these methods are typically filamentous phage including fd and M13 binding domains expressed from phage with Fab, Fv or disulfide stabilized Fv antibody domains recombinantly fused to either the phage gene Ill or gene Vill protein. 20 Examples of phage display methods that can be used to make the antibodles-of the present invention include those disclosed by Brinkman et Vl. (J. lInunol. Methods 182: 41-50, 1995), Ames et at. (J. Immuno, Methods 184: 177-186, 1995), Kettleborough et al. (Eur. J. Imrmuno. 24: 952-958, 1994). Persic at al. 25 (Gene 187: 9-18, 1997),. Burton etal, (Advances In Immunology 57: 191-280, 1994); PCT publications WO 90/02809; WO 91/10737; WO 92101047; WO 92/18619; WO 93/11236; WO 95115982; WO 95/20401; and US Patents 5,698,426; 5,223,409; 5,403,484; 5,580,717; 5,427,908; 5,750,753; 5,821,047; 5,571,698; 5,427,905; 5,516,637; 5,780,226; 5,658,727; 6,733,743 and 30 5,969,108. After phage selection, the antibody. coding regions from the phage can be WO 2007/014433 PCT/AU2006/001107 -60 isolated and used to generate whole antibodies or any other desired antigen binding fragrnent, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast, and bacteria. For example, techniques to recombinantly produce Fab, 'Fab' and F(ab')2 fragments can also be employed 5 using methods known in the art such as those disclosed in PCT publication WO 92/22324; Mullinax et al. (BjoTechniques 12(6): 864-869, 1992); and Sawal et aL (AJR/ 34:26-34, 1995): and Better et a/. (Science 240: 1041-1043, 1988). Exarhples of techniques which can, be used to produce single-chain Fvs and 10 antibodies include those described in U.S. Pat. Nos. 4,946,778 and 5,258,498; Huston et a. (Methods in Enzymology 203; 46-88, 1991}; Shu et al. (Proo. Nat. Aoed. Sci. USA 90: 7995-7999, 1993); and Skerra et a. (Science 240: 1038 1040, 1988). 15 The present Invention Js further described 'by the following non-limiting examples. EXAMPLE I 20 Identification of Candidate Genes Through Natural Variation of (1,3;1.4)-p-D glucan Content in Barly Grain Comparative mapping studies have revealed that there is a high level of conservation of gene order along chroimnosomes of species of the Poaceae, 25 although maoro-colinearity-at this level does not always predict gene -presence or order at the micro level, Nevertheless, co-linearity at the megabase level is essential for the use of model species for positional cloning of genes, for development of molecular markers and for identifying candidate genes that affect a trait of interest in one species through reference to the syntenous region 30 of a model species. Therefore, this approach was adopted to identify candidate genes for (1,3;1,4)-p-u-glucan synthases in cereals.

WO 2007/014433 PCT/AU2006/001107 -61 Quantitative frait loci (QTL) mapping and comparative genomics has been used to identify genes involved in cell wall biosynthesis in maize (Zea mays). Because of the. central role played by (1,3;1,4)-P-D-g|UcanS In' mailing and brewing quality, QTL analyses of grain (1,3;1,4)4-0-gIucan content are 5 avaIlable. As shown in Figure 1, the QTL that has the largest effect on grain (1,3;1,4)-p-D-glUcan content was located on barey chromosome 2H, between the Adh8 and ABG019 markers. Using the sequences of the two ONA markers that flank the barley QTL on 10 chromosome 2H, a syntenous region was located on chromosome 7 of rice, where a cluster of six cellulose synthase-like (Cs/) genes was detected within an interval of 119 Kb, corresponding to the 21.59-21.7Z Mb region of the chromosome (Fig. 1), 15 Each of these genes was classified in the Os/F group of rice and they were designated OsCs fF1 (SEQ IQ NO: 19), OsCsF2 (SEQ ID NO: 21), OsCsIF3 (SEQ 1ID NO: 23), OaCs/F4 (SEQ ID NO: 25), OsCs/F8 (SEQ ID NO: 31) and *OsCs/F9 (SEQ ID NO:'33). Other known genes in this interval of. rice chromosome 7 include truncated OsCsIF genes that might represent 20 pseudogenes. The OsCSs/F5 (SEQ ID NO: 27) and OsCsIF7 (SEQ ID NO: 29) genes are located elsewhere on the rice genome (data not shown). 25 On this basis, the comparative genomics approach enabled the identification of the CsIF group of genes as potential .candidate genes for (1,3:1,4)-~l3-glucan synthases in cereals. It is noteworthy that the Cs/F group of Col genes Is only found in rnonocotyledons, which is consistent with the exclusive occurrence of (1,3;1,4)-P-D-glucans In cell walls of the Poales, 30 Meterias and Methods WO 2007/014433 PCT/AU2006/001107 - 62 (i) Plant Tissues Tissues were collected from mature rice plants (Oryzae sativa cv Nippon Bare) grown at 28 0 C day and 22"C night temperatures under high humidity, a 5 photolitensity of 300umol/m/s and an 1.1/13 hour day/night regime. Material was also collected from five day-old seedlings germinated at 28 0 G in the dark on damp filter paper in Petri dishes. (ii) Synteny Analysis 10 DNA sequences for the markers under the QTLs for barley (1,3; 1,4)-pD--glucan were obtained from the GralnGenes database (http://wheat.pw.usda.gov). Additional markers from within the corresponding chromosomal locations on the Barley-Consensus2- (01 et a0., Genome 39: 379-394, 1996) and Barley 15 Consensus2003 (Karakousa et al., Australian Journal of Agricultural Researcf 54: 1173-1185, 2003) maps were also included in the investigation. The syntenic chromosomal location(s) for the markers on the rice genome were determined by BLASTN analyses at the GRAMENE website (http://www.grarnene.org). Syntenic, regions were examined for gene 20 annotations of enzymes encoding for synthesis of cell wall polysaccharides, A thorough analysis of tho rogion on rico chromosome 7 that corresponded to the QTL peaK for (1,3;1,4)-p-D-glucan on barley chromosome 2H was carried out and six co-located Cs/F genes were identified for further analyses. 26 EXAMPLE 2 Transformation of Arabdopsis thallana with Rice Cs/P Genes The possible role of the rice OsCIF genes in (1,3;,4)-P-p-glucar synthesis 30 was tested by gain-of-function in transgenic Arab/dops/s plants. Arabidopsis walls contain no (1,3;1,4)-P3D-glucan and the Arabidopsis genome does not contain any known 0s/F genes, Therefore, the deposition of (13;1 4)-p-D- WO 2007/014433 PCT/AU2006/001107 - 63 glucan into walls of transgenic Arab/dopsis plants carrying rice OsCsIF genes would indicate that the introduced gene(s) encoded (1,3;1;4)-p-o-g(ucan syntheses. This approach assumed and depended upon the availability in Arab/dopsis of any precursors, Intermediates, cofactors or ancillary enzymes 5 needed for (1,3;1.4)-P-D-glucan synthesis. Awcordingly,- the rice CslFf,2 3,4,8 genee were successfully amplified from cDNA by PCR and cloned into the pAJ22 binary, vector, behind the 35S promoter, as shown in Figure 2. 10 The plasmid -vectors were subsequently inserted into Agrobacterium tumefaciens, which was used to transform Arabidopsis by standard floral dip procedures (Clough and Bent, Plant J. 16: 735, 1998). In- cas-e multiple OsCs/F genes might be required for (1,3;1,4)-P--o-glucan synthesis, transformation was 15 .performed not only with single gene constructs, but also with various combinations of the OsCs/F genes. Following selection with the herbicide BASTA, ONA and RNA were isolated from selected transgenic plants to check for the presence of the transgene(s) 20 and to monitor transcription of the.transgenos by real-time, quantitative PCR (Q POR; as described by Burton et al. (2004, supra). Southern hybridization analyses confirmed the presence of the transgenes (Fig. 3). As shown in Figure 4, at least some lines were fund to contain single 25 copies of the various OsCsIF genes. Where the Arab/dopsis was transformed with multiple OsCs/F genes, all of those genes could be detected (Fig. 3). Transcripion of the OsCsJF genes in 14-day old leaves of the transgenic lines was also confirmed, Normalized mRNA levels are shown for selected 30 transgenio plants in Fig, 5, where large differences in transcriptional activity of the transgenes are evident between plant lines and where similarly larde differences are observed between individual OsCsIF genes in lines carrying WO 2007/014433 PCT/AU2006/001107 - 64 more than one transgene. For example, in lines transformed with the OsCs/F2, OsCsfF4 and OsCs/F8 genes, OsCs/F4 transcripts were usually the highest in abundance. The results showed that the 35S promoter was clearly driving high level transcription in many lines. 5 Materials and Methods (i) Plants 10 Arabidopsis plants were grown in Arabidopsis soil mix at 23 0 C in a growth chamber under either long 12/12 hr day/night or short 8/16 hr day/night conditions. Seed collected from transgenic plants was dried, cleaned, vernalised for 2 days at 4C and sown onto solid M$ media containing 25mg/1 * Bialophos for selection. Survivors were transplanted into soil at the five leaf 15 stage and grown In growth rooms under the conditions described above. (1i) Binary Vector Construction The binary vector pAJ22 (Fig. 2) was -kindly supplied by Dr. Andrew Jacobs 20 (University of Adelaide) and is based on the PAMPAT-MCS backbone (accession no. AY436765), It contains a double 35S promoter with a pNOS terminator region, separated by a modified multiple cloning alte that incorporates a triple HA epitope, which was not used In this instance, Full length PCR products corresponding to the rice OsCs/F cDNAs amplified as 25 described above were cloned into the TEASY vector (Promega). Clones carrying an insert of the correct size were digested with the appropriate restriction enzymes (Table 2) and an enzyme to cut the TEASY backbone into two segments. The reactions were separated by agarose gel electrophoresis, the Cs/F fragments were excised and purified using the QlAquick (QIAGEN) gel 30 extraction kit according to the manufacturer's instructions. The binary vector pAJ22 was digested with the corresponding pair of restriction enzymes and the CsIF fragment was ligated into the pAJ22 vector. Plasmid DNA was extracted WO 2007/014433 PCT/AU2006/001107 - 65 from positive clones using the QiAquick miniprep kit and inserts were sequenced using BigDye 3.1 chemistry (ABI) on an Applied Biosystems AB13700 capillary sequencer. Plasmid DNA preparations containing verified inserts were transformed into Agrobacterium tumefaciens cv GV3101 via 5 electroporation using the method of Mersereau et at. (Gene 90: 149, 1990) and positive colonies were selected on media containing 25mg/I rifampicin, 48mg/l carbenicillin and 50mg/I kanamycin. (iii) Arabidopsis Transformation 10 Arabidopsis transformants were generated by the floral dip method of Clough and Bent (Plant J. 16: 735, 1998). (iv) DNA Extraction and Southern Hybridisation Analyses 15 Genomic DNA was extracted from young leaves and flower buds using the Qiagen miniprep plant kit. Approximately 5 pg genomic DNA per plant was digested with the relevant restriction enzymes and separated on a 1% agarose TAE gel. DNA was transferred to Highbond+ membranes. Membranes were 20 pre-hybridised and hybridised and probe fragments were labelled using the Rediprime labelling kit (Amersham, High Wycome, UK) following the manufacturer's instructions. (v) RNA extraction, cDNA synthesis and RT-PCR 25 All RNA extractions and cDNA syntheses were carried out as described in Burton et al. (Plant Physiol. 134: 224-236, 2004). Samples of cDNA from appropriate tissues were used as templates to amplify full-length Cs/F sequences, using Elongase Taq polymerase (Invitrogen) by PCR. Primer pairs, 30 as listed in Table 2, were used in the PCR, following a standard recipe suggested by the manufacturer. Dimethylsulphoxide (DMSO, 5% v/v; Sigma, St Louis, MO, USA) was added and PCR was performed for 40 cycles as follows; WO 2007/014433 PCT/AU2006/001107 - 66 94 0 C for 30 sec, 500C to 58 0 C (depending on the Tm of individual primers) for 30 sec and 68 0 C for 3 min. The primers contained restriction sites at each end, as indicated in Table 2, to facilitate cloning of the amplified fragment into the binary vector. 5 TABLE 2 - Oligonucleotides used for amplification of rice Cs/F cDNAs. cDNA Oligo Oligonucleotide sequence R.E. Sequence Site Identifier OsCsIF2 OsF2BII5 AGTCAGATCTGTTCCGTGCATGGCGGCCACCG Bg/II SEQ ID NO: 35 OsCsLF2 OsF2ML3 CAGTACGCGTCGCGATCGAACTGTCCCTACCC MIuI SEQ ID NO: 36 OsCsIF3 OsF3BIl5 AGTCAGATCTATAGAGTGCTCGTCATGGC Bg/II SEQ ID NO: 37 OsCsIF3 OsF3ML3 CAGTACGCGTTTTATCTATGCACCTAGAATGG Mlul SEQ ID NO: 38 OsCsIF4 OsF4H5 AGTCAAGCTTGCTACGGCCTCCACGATGTCCG Hindill SEQ ID NO: 39 OsCsIF4 OsF4S3 CAGTACTAGTCATGTCGTCCCTACCCAGATGG Spel SEQ ID NO: 40 OsCsIF8 OsF8H5 AGTCAAGCTTGCGACGATCGATGGCGCTTTCG HindIllI SEQ ID NO: 41 OsCs/F8 OsF8S3 CAGTACTACTTGCATCAATCAGAAACCCCGC Spel SEQ ID NO: 42 (vi) Quantitative Real Time PCR (Q-PCR) Analysis 10 The primer pairs for control genes and specific Cs/F genes were used as indicated in Table 3. Stock solutions of PCR products for the preparation of dilution series were prepared by PCR from a cDNA derived from either a composite of rice or Arabidopsis tissue cDNAs, and was subsequently purified and quantified by HPLC, as described by Burton et al. (2004, supra). A dilution 15 series covering seven orders of magnitude was prepared from the 109 copies/pl stock solution as follows; one microlitre of the stock solution was added to 99 Pl of water, and six 1:10 serial dilutions were prepared to produce a total of seven WO 2007/014433 PCT/AU2006/001107 - 67 solutions covering 107 copies/pIL to 101 copies/pl. Three replicates of each of the seven standard solutions were included with every Q-PCR experiment, together with a minimum of three no-template controls. For all genes, a 1:20 dilution of the cDNA was sufficient to produce expression data with an 5 acceptable standard deviation. Three replicate PCRs for each of the cDNAs were included in every run. All Q-PCR reaction mixes were prepared on a CAS-1200 robot (Corbett Robotics, Brisbane, Australia). Two microlitres of the diluted cDNA solution were used in a reaction containing 10 5 pl QuantiTect SYBR Green PCR reagent, 1 pi each of the forward and reverse primers at 4 tM, 0.3 pl 10x SYBR Green in water (10,000x in DMSO, BioWhittaker Molecular Applications, Rockland, USA, 0.5p.tl in 500pl of water, prepared daily) and 0.7 1i water. The total volume of each Q-PCR reaction mixture was 10 41. Reactions were performed in a RG 3000 Rotor-Gene Real 15 Time Thermal Cycler (Corbett Research, Sydney, Australia) as follows; 15 min at 950 followed by 45 cycles of 20 sec at 950, 30 sec at 550, 30 sec at 720 and 15 sec at the optimal acquisition temperature (AT) described in Table 3. A melt curve was obtained from the product at the end of the amplification by heating from 700 to 990. After the experiment, the optimal cycle threshold (CT) was 20 determined from the dilution series and the raw expression data was derived. The mean expression level and standard deviation for each set of three replicates for each cDNA was calculated. The raw expression data for the exogenous Cs/F genes was scaled using the 25 approach of Vandesompele et al. (Genome Biol. 3: 1-11, 2002). The normalisation factor derived from the best three of four Arabidopsis control genes was generated using the Genorm software (Vandesompele et al., supra, 2002). The raw expression data for the exogenous Cs/F genes in each cDNA was scaled by dividing the raw expression value by the normalisation factor for 30 the particular cDNA. TABLE 3 - Primers used for Q-PCR analysis.

WO 2007/014433 PCT/AU2006/001107 - 68 Gene Forward Primer Reverse Primer amplicon A T (*C) (bp) GAPDH At TGGTTGATCTCGTTGTGCAG GTCAGCCAAGTCAACAACTC 262 77 GTCTC (SEQ ID NO: 43) TCTG (SEQ ID NO: 44) Tubulin At ATGTGGGTGAGGGTATGGAA CCGACAACCTTCTTAGTxCT 143 78 (SEQ ID NO: 45) CCTCT (SEQ ID NO: 46) Actin At GAGTTCTTCACGCGATACCT GACCACCTTTATTAACCCCA 180 76 CCA (SEQ ID NO: 47) TTTACCA (SEQ ID NO: 48) Cyclophilin TGGCGAACGCTGGTCCTAAT CAAAAACTCCTCTGCCCCAA 223 79 At ACA (SEQ ID NO: 49) TCAA (SEQ ID NO: 50) OsCSLF2 GTGCGCATACGAGGATGGGA AGAACATCTCCAGCGAGCCG 220 83 CG (SEQ ID NO: 51) CC (SEQ ID NO: 52) OsCSLF3 CCGATTGGGGCAAGGGTGTT GACACGCTGGAGAGGTTGGA 256 79 GG (SEQ ID NO: 53) GC (SEQ ID NO: 54) OsCSLF4 CTCCGTGTACACCTCCATGG CTCGGAGATGAGCCACATCA 255 82 AG (SEQ ID NO: 55) CC (SEQ ID NO: 56) OsCSLF8 TACGACATCGCGACGGAGGA GTCATGTTGGCGTACGCGAC 244 83 CG (SEQ ID NO: 57) GC (SEQ ID NO: 58) EXAMPLE 3 Immunological Characterization of Transgenic Arabidopsis Lines 5 Transgenic Arabidopsis lines in which OsCsIF transcript levels were highest were chosen for further analysis, in particular with respect to the deposition of (1,3;1,4)-p-D-glucan in cell walls. In the first instance, immunocytochemical methods involving monoclonal antibodies specific for (1,3;1,4)-p-D-glucans and 10 electron microscopy were used to screen transgenic lines for the presence of the polysaccharide in the Arabidopsis lines. The antibody used does not bind with cellooligosaccharides or the (1-+3)-p-D-glucan, callose. Inhibition studies showed that it binds relatively weakly to (1,3;1,4)-p-D-oligoglucosides. 15 Pieces of 14- and 28-day old leaves were sectioned for monoclonal antibody probing, and the antibody was routinely checked by pre-incubating tissue sections with commercially available barley (1,3;1,4)-p-D-glucan. Pre-incubation WO 2007/014433 PCT/AU2006/001107 - 69 with the polysaccharide blocks the binding of gold-labelled secondary antibody. (1,3;1,4)-p-D-glucan was detected in cell walls of several transgenic Arabidopsis plants with the specific monoclonal antibodies, such as Arabidopsis lines A28, A29 and A18, as shown in Figure 7. In Figure 7, panel B, walls from the 5 epidermal layers of leaves from transgenic Arabidopsis line A18 are shown to accumulate (1,3;1,4)-p-D-glucan over a period of about fourteen days. The polysaccharide was not detected in other tissues of this line. Finally, Panel C shows a representative control panel of a section of WT Arabidopsis leaf epidermal cell wall where minimal or no background labelling is commonly 10 observed. Materials and Methods (i) Preparation of Transformed Arabidopsis Leaves for Electron Microscopy 15 Arabidopsis leaves were fixed in 4% (viv) glutaraldehyde (EM Grade) in phosphate-buffered saline (PBS), pH 7.2, and stored at 40C. Samples were washed three times in PBS and post-fixed in a 2% osmium tetroxide solution in PBS for 1 h at room temperature. After three rinses in MilliQ water the samples 20 were dehydrated in a graded ethanol series and slowly infiltrated with LR White resin over several days. Individual leaves were placed in gelatin capsules, which were filled with fresh resin and polymerized overnight at 650C. (ii) Immunolocation for Transmission Electron Microscopy 25 Sections (80 nm) of Arabidopsis leaves were prepared on a Leica Ultracut R microtome using a diamond knife and collected on 100 and 200 mesh, Formvar coated gold grids. The ultrathin sections were blocked for 30 min in 1 % bovine serum albumin in PBS before incubation in murine monoclonal antibodies 30 raised against barley (1,3;1,4)-p-D-glucan (diluted 1:500; Biosupplies Australia, Parkville, VIC 3052, Australia) for 1 hr at room temperature and overnight at 4 C. The grids were washed twice in PBS and three times in blocking buffer WO 2007/014433 PCT/AU2006/001107 - 70 before a 1 h incubation in 18 nm Colloidal Gold-AffiniPure Goat-Anti Mouse IgG + IgM (H+L) (Jackson ImmunoResearch Laboratories, Inc., PA, USA). All grids were washed twice in PBS and several times in MilliQ water before staining in 2% aqueous uranyl acetate followed by triple lead citrate stain. The sections 5 were viewed on a Philips BioTwin Transmission Electron Microscope and images captured on a Gatan Multiscan CCD Camera. In some experiments the primary antibody was omitted to control for non specific secondary antibody binding. Other control experiments involved pre 10 absorbing the primary antibodies to their respective polysaccharides to ensure the specificity of the antibody. Solutions (1 mg/ml) of (1,3;1,4)-p-D-GLUCAN from barley (Biosupplies Australia) were mixed in equal volumes with their respective diluted primary antibodies. No labelling was observed in any of these negative control experiments. 15 Supplementary data relating to this experiment can be found in Burton et al., Science 311: 1940-1942, 2006. 20 EXAMPLE 4 Identification of Cs/F sequences from Barley Where available, partial EST barley sequences were assembled into complete Cs/F sequences, using the rice Cs/F sequences as a guide. 25 Where no barley EST sequences were available, putative wheat Cs/F EST sequences were identified, which were potentially highly homologous to the equivalent barley sequences. Primers were then designed on the basis of the wheat EST sequences and were then used on barley cDNA populations to 30 amplify the equivalent barley sequence. 3' and 5' RACE approaches were then used to extend the barley sequences.

WO 2007/014433 PCT/AU2006/001107 - 71 In a few cases additional parts of closely related barley genes for which there were no wheat ESTs were amplified, and these were also extended using RACE. In total, 6 different barley Cs/F sequences were identified, which were designated HvCsIF1, HvCsIF2, HvCsIF3, HvCsIF4, HvCsIF5 and HvCsF6. 5 EXAMPLE 5 Alignment of Cs/F DNA and Amino Acid Sequences from Rice and Barley 10 An alignment of the DNA and amino acid sequences for the Cs/F sequences in both rice and barley was performed, the results of which are shown in Figure 8. The protein sequences were aligned and compared using the default parameters for the bl2seq pairwise alignment program at NCBI 15 http://www.ncbi.nlm.nih.gov/blast/bl2seq/wblast2.cgi. For the DNA alignments, the EMBOSS pairwise alignment algorithms http://www.ebi.ac.uk/emboss/align/ with the water(local) method was used. Multiple sequence alignments and phylogenetic tree generation was performed 20 using the ClustaIX program as described by Thompson et al. (Nuc/ Acids Res 25: 4876-4882, 1997). The resultant phylogenetic tree is shown in Figure 9. EXAMPLE 6 25 Mapping of the Barley Cs/F Genes The QTL that has the largest effect on grain (1,3;1,4)-p-o-glucan content is located on barley chromosome 2H, between the Adh8 and ABG019 markers , 30 markers, as mapped in the Steptoe x Morex doubled haploid (DH) population by Han et al. (Theor. Apple. Genet. 91: 921, 1995).

WO 2007/014433 PCT/AU2006/001107 - 72 Specific gene fragments of the six barley Cs/F cDNAs generated by PCR were radiolabelled and used as probes on DNA from a set of wheat barley addition lines (Islam and the Clipper X Sahara barley DH populations to establish firstly their chromosomal location and then to fine map the genes. 5 Use of the wheat-barley addition lines showed that HvCsIF2, 4, 5 and 6 are found on chromosome 2H, HvCsIF1 is found on 7H and HvCsIF3 is found on 1HS. Identification of polymorphisms between the Clipper and Sahara barley cultivars (parent lines) for HvCsl2, 4, 5 and 6 and the subsequent screening of 10 the DH mapping population created from these parents allowed the accurate map location of these genes to be defined (Figure 10). These four barley Cs/F genes are therefore found to be coincident with the major QTL for grain (1,3;1,4)-p-D-glucan content on barley chromosome 2H. This implies that one or more of these genes is likely to directly influence barley grain (1,3;1,4)-p-D 15 glucan content. Materials and Methods Filters of digested genomic DNA of the wheat barley addition lines (Islam et al., 20 Heredity 46: 161-174 1981) were used to map the genes to the chromosome level. The barley DH mapping population Clipper x Sahara was used to fine map the HvCsIF genes (Karakousis et al., Aust. J. Ag. Res. 54: 1137-1140, 2003). Professor Peter Langridge (Australian Centre for Plant Functional Genomics, University of Adelaide) kindly supplied both sets of filters of digested 25 genomic DNA for Southern Hybridization analyses using standard methods. Loci were positioned using the Map Manager QTX software (Manly et al., Mammalian Genome 12: 930-932, 2001). 30 EXAMPLE 7 Overexpression of the barley Cs/F genes in transgenic barley plants.

WO 2007/014433 PCT/AU2006/001107 - 73 The role of individual members of the barley Cs/F gene family in (1,3;1,4)-p-D glucan synthesis was tested by inserting the genes under the control of the strong constitutive promoter, CaMV 35S, into the genome of Golden Promise barley plants. The complete cDNAs for the barley genes Cs/F1, CsIF4 and 5 CsIF6 were amplified by PCR using the primers shown in Table 4 and a high fidelity polymerase and sequenced to ensure that they contained no PCR induced errors. The PCR fragments were cloned into the binary vector pMDC32, shown in Figure 11. 10 The plasmid vectors were subsequently inserted into Agrobacterium tumefaciens, which was used to transform the barley cultivar Golden Promise by standard transformation procedures (Tingay et al. Plant J. 11: 1369-1376, 1997; Matthews etal. Mol. Breeding 7: 195-202, 2001) 15 Following selection with hygromycin, total RNA was extracted from the leaves of transgenic plantlets to monitor transcription of the endogenous and the integrated transgenes by Q-PCR (Burton et a. Plant Phys. 134: 224-236, 2004). The QPCR results for transcription of the selectable marker gene, hygromycin, using the primers shown in Table 5, are shown in Figure 12. There is no PCR 20 product for hygromycin in the cDNA of the wild type, non-transformed control plants (lines WT1-3) whilst all plants transgenic for the hygromycin transgene, including the transformed controls (G89 lines) which contain a gene unrelated to the Cs/F family, show positive levels of hygromycin QPCR product (Figure 2) 25 Transcription of the three HvCsIF genes was also examined in these plants using the pimers given in Table 5. Normalized mRNA levels are shown for HvCs/F1, HvCsIF4 and HvCs/F6 across the whole transgenic population and the control plants. Plants transformed with 35S:HvCs/F1 are designated G98 and overexpression of the HvCs/Fl gene in these lines is evident at significant 30 levels above that of the endogenous gene in the WTC, G89, G99 and G103 groups (Figure 13). Particularly high levels of transcripts are seen in plants 98 10, 98-11 and 98-24 (Figure 13). Plants transformed with 35S:HvCsIF4 are designated G103 and overexpression of the HvCs/F4 gene in these lines is WO 2007/014433 PCT/AU2006/001107 - 74 evident at significant levels above that of the endogenous gene in the WTC, G89, G98 and G99 groups (Figure 14). The highest level of transcript is seen in plant 103-5 (Figure 14). Finally, plants transformed with 35S:HvCs/F6 are designated G99 and overexpression of the HvCsIF6 gene in these lines is 5 evident at significant levels above that of the endogenous gene in the WTC, G89, G98 and G103 groups (Figure 15), with the highest number of transcripts seen in lines 99-6 and 99-11 (Figure 15). Materials and Methods. 10 (i) Binary vector construction The binary vector pMDC32 was obtained from Dr Mark Curtis, University of Zurich (http://www.unizh.ch/botinst/Devo Website/curtisvector/index 2.html) 15 and is a Gateway-enabled (Invitrogen) binary vector carrying the hygromycin resistance gene and the CaMV 35S promoter suitable for use in barley transformation experiments where gene over-expression is desired (Curtis and Gossniklaus, Plant Phys 133: 462-469, 2003) Full-length PCR products corresponding to the barley HvCs/F cDNAs amplified with the primers given in 20 Table 4 were sequenced using BigDye 3.1 chemistry (ABI) on an Applied Biosystems AB13700 capillary sequencer. Correct cDNAs were recombined into the Gateway entry vector pDENTR-Topo (Invitrogen). The orientation of the cDNA was verified by restriction enzyme digestion and then the entry clone was used in an LR recombination reaction (Invitrogen) with pMDC32 as the 25 destination vector. Successful insertion into pMDC32 was confirmed by restriction enzyme digestion and plasmid DNA preparations containing verified inserts were transformed into Agrobacterium tumefaciens cv AGLO via electroporation using the method of Mersereau at al. (Gene 90: 149, 1990) and positive colonies were selected on media containing 25mg/l rifampicin, and 30 25mg/I kanamycin. (ii) Barley Transformation WO 2007/014433 PCT/AU2006/001107 -75 Agrobacterium tumefaciens-mediated transformation experiments were performed using the procedure developed by Tingay et al. (1997, supra) and modified by Matthews et al. (2001, supra). The developing spikes were 5 harvested from donor plants (cv. Golden Promise) grown in the glasshouse when the immature embryos were approximately 1-2 mm in diameter. The immature embryos were aseptically excised from the surface-sterilised grain, and the scutella were isolated by removing the embryonic axis. Twenty five freshly isolated scutella were cultured cut side-up in the centre of a 90 mm x 10 10 mm Petri dish that contained callus induction medium, based on the recipe of Wan and Lemaux (Plant Phys. 104: 37-48, 1994). This medium was composed of MS macro-nutrients (Murashige and Skoog, Physiologia Plant. 15: 473-497, 1962), FHG micro-nutrients supplemented with 30 g/L maltose, 1 mg/L thiamine-HCI, 0.25 g/L myo-inositol, 1 g/L casein hydrolysate, 0.69 g/L L 15 proline, 10 pLM CuSO 4 , 2.5 mg/L Dicamba (3,6-dichloro-o-anisic acid), and was solidified with 3.5 g/L Phytagel"m (Sigma Chemicals, St. Louis, MO, USA). Agrobacterium suspension (50 Id) was aliquotted onto the scutella, and the Petri dish was held at a 450 angle to drain away excess bacterial suspension. The explants were turned over and dragged across the surface of the medium to the 20 edge of the Petri dish. The scutella were transferred to a fresh plate of callus induction medium and cultured cut side-up for three days in the dark at 22 240C. Following co-cultivation, the scutella were removed to fresh callus induction medium containing 95 paM hygromycin B (Becton Dickinson Biosciences, Palo Alto, CA, USA) and cultured in the dark. The entire callus of 25 an individual scutellum was transferred to fresh selection medium every fortnight for a further six weeks. At the end of the callus selection period, the callus derived from each treated scutellum was transferred to shoot regeneration medium. This niedium was based on the FHG recipe of Wan and Lemaux (1994, supra). It contained FHG macro- and micro-nutrients, 1 mg/L 30 thiamine-HCI, 1 mg/L benzylaminopurine, 0.25 g/L myo-inositol, 0.73 g/L L glutamine, 62 g/L maltose, 10 tM CuSO 4 , 38 pM hygromycin B, and was solidified with 3.5 g/L Phytage"'. The cultures were exposed to light (16 h day/8 WO 2007/014433 PCT/AU2006/001107 - 76 h night photo-period) for three to four weeks at 22-24*C. The regenerated shoots were excised from the callus and transferred to culture boxes (Magenta Corporation, Chicago, IL, USA) that contained hormone-free callus induction medium, supplemented with 95 [M hygromycin B to induce root formation. The 5 tissue culture-derived plants that grew vigorously were established in soil and grown to maturity (Singh et al. Plant Cell, Tissue and Organ Culture 49:121-127 1997). All the media contained 150 mg/L Timentin® (SmithKline Beecham, Pty. Ltd., Melbourne, Australia) to inhibit the growth of Agrobacterium tumefaciens following co-cultivation. 10 (iii) RNA extraction and cDNA synthesis. Total RNA was extracted from the leaves of plantlets growing in Magenta boxes, as described above, using TRIZOL, and cDNA was synthesised using 15 the reverse transcriptase Superscript IlIl (Invitrogen) as described in Burton et al. (Plant Phys 134: 224-236, 2004). (iv) Quantitative Real Time PCR (Q-PCR) Analysis 20 The primer pairs for control genes (Burton et al,, 2004, supra) and specific Cs/F genes were used as indicated in Table 5. Stock solutions of PCR products for the preparation of dilution series were prepared by PCR from a cDNA derived from either a composite of barley tissue cDNAs, and was subsequently purified and quantified by HPLC, as described by Burton et al. (2004, supra). A dilution 25 series covering seven orders of magnitude was prepared from the 109 copies/pl stock solution as follows; one microlitre of the stock solution was added to 99 pAl of water, and six 1:10 serial dilutions were prepared to produce a total of seven solutions covering 10 7 copies/pl to 101 copies/pi. Three replicates of each of the seven standard solutions were included with every Q-PCR experiment, 30 together with a minimum of three no-template controls. For all genes, a 1:20 dilution of the cDNA was sufficient to produce expression data with an acceptable standard deviation. Three replicate PCRs for each of the cDNAs WO 2007/014433 PCT/AU2006/001107 - 77 were included in every run. All Q-PCR reaction mixes were prepared on a CAS-1200 robot (Corbett Robotics, Brisbane, Australia). Two microlitres of the diluted cDNA solution were used in a reaction containing 5 5 l QuantiTect SYBR Green PCR reagent, 1 pl each of the forward and reverse primers at 4 ptM, 0.3 ld 1Ox SYBR Green in water (10,000x in DMSO, BioWhittaker Molecular Applications, Rockland, USA, 0.5d in 500pl of water, prepared daily) and 0.7 pl water. The total volume of each Q-PCR reaction mixture was 10 pl. Reactions were performed in a RG 3000 Rotor-Gene Real 10 Time Thermal Cycler (Corbett Research, Sydney, Australia) as follows; 15 min at 950 followed by 45 cycles of 20 sec at 950, 30 sec at 550, 30 sec at 720 and 15 sec at the optimal acquisition temperature (AT) described in Table 5. A melt curve was obtained from the product at the end of the amplification by heating from 700 to 990. After the experiment, the optimal cycle threshold (CT) was 15 determined from the dilution series and the raw expression data was derived. The mean expression level and standard deviation for. each set of three replicates for each cDNA was calculated. The raw expression data for the HvCsIF genes was scaled using the approach 20 of Vandesompele et al. (Genome Biol. 3: 1-11, 2002). The normalisation factor derived from the best three of four barley control genes (Burton et al., 2004, supra) was generated using the Genorm software.(Vandesompele et al., 2002, supra). The raw expression data for the exogenous CsIF genes in each cDNA was scaled by dividing the raw expression value by the normalisation factor for 25 the particular cDNA. TABLE 4 - Primers used for amplification of barley CsIF cDNAs Hv CsIF1 HvFD5END GGAGAGCGCGTGCATTGAGGACG SEQ ID NO: 59 Hv CsIF1 HvFDRQ TGTCCGGGCAAAGTCATCAA SEQ ID NO: 60 Hv CsIF4 HvFC5N GCACGGTAGGCACTTACACTATGG SEQ ID NO: 61 Hv CsIF4 HvFC3N TTGCAGTGACTCTGGCTGTACTTG SEQ ID NO: 62 Hv Csi F6 HvFH5 GTAGCTGGCTACTGTGCATAGC SEQ ID NO: 63 HvCSLF6 HvFF3N GAACTTACAAACCCCAGCTTGTGG SEQ ID NO: 64 WO 2007/014433 PCT/AU2006/001107 - 78 Hv CsiF1 HvFD5END GGAGAGCGCGTGCATTGAGGACG SEQ ID NO: 59 TABLE 5 - Primers used for Q-PCR analysis. Gene Forward Primer Reverse Primer amplicon A T ('C) (bp) Hyg GTCGATCGACAGATCCGGTC GGGAGTTTAGCGAGAGCCTG 291 82 (SEQ ID NO: 65) (SEQ ID NO: 66) Hv CsJF1 TGGGCATTCACCTTCGTCAT TGTCCGGGCAAACTCATCAA 157 81 (SEQ ID NO: 67) (SEQ ID NO: 68) Hv CsIF4 CCGTCGGGCTCGTGTATGTC TTGCAGTGACTCTGGCTGTA 144 79 (SEQ ID NO: 69) CTTG (SEQ ID NO: 70) Hv CsIF6 GGGATTGTTCGGTTCCACTT GCTGTTGCTTTGCCACATCT 250 77 T (SEQ ID NO: 71) C (SEQ ID NO: 72) 5 EXAMPLE 8 Immunological Detection of (1,3;1,4)-p-D-glucans in Transgenic Barley Lines at the Light Microscope Level. Transgenic barley lines as described in Example 7, in which the HvCsIFI, 10 HvCsIF4 or HvCs!F6 transcript levels driven by the 35S promoter were highest, were chosen for further analysis, with respect to the deposition of (1,3;1,4)-beta D-glucan in the cell walls. Leaf sections were screened for the presence of the polysaccharide in the barley lines using an immunocytochemical method in which a monoclonal antibody specific for (1,3;1,4)-@-D-glucan (as described in 15 Example 3) is detected by a fluorophore-conjugated secondary antibody and observed by light microscopy. Due to expression of endogenous CsIF genes (1,3;1,4)-p-D-glucans are normally deposited in the cell walls of vegetative tissues such as leaf, and their occurrence and distribution in the emergent tissues of the barley seedling has been documented at the TEM level by 20 Trethewey and Harris (New Phytologist 154: 347-358, 2002). Here we contrast the distribution pattern of endogenous (1,3;1,4)-p-D-glucans in control leaf sections with patterns displayed by transgenic leaf samples over-expressing barley Cs/F genes.

WO 2007/014433 PCT/AU2006/001107 - 79 Leaf pieces representative of the plant groups described in example 7 were harvested, fixed and embedded in paraffin. Slide-mounted sections were treated with the specific monoclonal antibody which binds to (1,3;1,4)-beta-D 5 glucan (primary antibody) and, after washing, fluorophore-conjugated Alexa 488 (secondary antibody) was added. Sections were rinsed with buffer, mountant was added, and images were captured using a microscope with appropriate fluorescence filters. All images were taken at a standard exposure time of seven seconds. Overall morphology and the position of the various cell types were 10 identified using the UV filter, which causes all cell wall material to fluoresce non specifically (Figure 16). Specific antibody signal was viewed using the 13 filter (Figures 17 and 18). All control sections taken from any sample treated without either primary, 15 secondary or both antibodies showed very low levels of, fluorescence at 400x magnification (Figure 17). Labeling with both primary and secondary antibodies appears as a green signal when using the 13 filter (Figure 18). As expected with both antibodies, a level of endogenous (1,3;1,4)-p--glucans was evident on tissue sections taken from wild type (WT, Figure 18E) and transgenic control 20 (G89, Figure 18F), where signal was mainly concentrated in the mesophyll cells and vascular bundles in the mid regions of the sections. Under UV it was evident that all cells in all sections were present and intact. In contrast, antibody-labeled sections taken from the transgenic G98 and G103 plants, such as G98-10 (Figure 18A), G98-24 (Figure 18B) and G103-5 (Figure 18C), display 25 an increased intensity of signal, where the walls of the epidermal cells and sclerenchyma fibre cells are much more heavily labelled. The sclerenchyma cells have thickened secondary cell walls and Trethewey and Harris (2002, supra) detected only sparse labelling at the TEM level in these cells from wild type seedlings. The labelling pattern displayed by G99 plants, such as G99-12 30 (Figure 18D), varies from that shown by the wild type and transgenic controls and from the G98 and G103 plants. In this case fluorescence is seen only in the stomatal cells and parts of the vascular bundle.

WO 2007/014433 PCT/AU2006/001107 -80 These results indicate that over-expression of individual barley CsIF genes may lead to elevated protein levels of the glucan synthase enzymes, which in turn leads to increased deposition of (1,3;1,4)-beta-D-glucans in the cell walls of 5 these transgenic plants. Materials and Methods (i) Preparation of Transformed Barley Leaves for Light Microscopy 10 Barley leaf pieces were fixed in 0.25% (v/v) glutaraldehyde, 4% (v/v) paraformaldehyde (EM Grade), and 4% sucrose in phosphate-buffered saline (PBS), pH 7.2, and stored at 4"C overnight. Samples were washed three times in PBS, dehydrated in a graded ethanol series and slowly infiltrated with paraffin 15 over several days. Blocks were trimmed and sectioned at 6pm. (ii) Immunolabelling for Light Microscopy With a Fluorophore-Conjugated Antibody 20 Sections were dewaxed in xylene and rehydrated progressively through 100%, 90% and 70% ethanol solutions. After two rinses with i x phosphate buffered saline (PBS) the sections were incubated with 0.05M glycine for 20 mins to inactivate residual aldehyde groups. Sections were blocked in incubation buffer (1% bovine serum albumin (BSA) in I x PBS ) for 2 x 10 mins to prevent non 25 specific binding. Slides were drained and the specific primary antibody, BG1 (BioSupplies, Melbourne, Australia) was added at a dilution of 1:50 and left to incubate for one hour in a humidity chamber. Unbound primary antibody was removed by rinsing with incubation buffer for 3 x 10 mins and the secondary antibody, Alexa Fluor@ 488 goat anti-mouse IgG (Molecular Probes, Eugene, 30 USA), was added. Slides were wrapped in aluminium foil to exclude light and incubated for 2 hours at room temperature. Unbound secondary antibody was removed by rinsing 3 x 10 mins with incubation buffer before a few drops of WO 2007/014433 PCT/AU2006/001107 - 81 mountant (90% glycerol: 10% water) were applied and sections cover-slipped. Controls were included which omitted either the primary antibody, the secondary antibody or both antibodies. Images were captured on a Leica AS LMD microscope under filter D (UV, excitation 355-425 nm) or filter 13 (blue, 5 excitation 450-490 nm) using a DFC480 CCD camera. All images shown were taken at 400x magnification with a 7 second exposure time to standardise fluorescence intensity. 10 EXAMPLE 9 Immunological Detection of (1,3;1,4)-p-D-glucans in Transgenic Barley Using Transmission Electron Microscopy Transgenic barley lines, as described in Examples 7 and 8, in which the 15 HvCsIF1, 4 or 6 transcript levels driven by the 35S promoter were highest, were chosen for further analysis, with respect to the deposition of (1,3;1,4)-@-D glucan in the cell walls. An immunocytochemical method using the monoclonal antibody specific for (1,3;1,4)-p-D-glucan, as described in Example 3, and electron microscopy, was employed to screen leaf sections for the presence of 20 the polysaccharide in the barley lines. Due to expression of the endogenous Cs/F genes (1,3;1,4)-p-D-glucans are normally deposited in the cell walls of vegetative tissues, such as leaf, and their occurrence and distribution in the emergent tissues of the barley seedling has been documented at the TEM level by Trethewey and Harris (New Phytologist 154: 347-358, 2002). In Example 7 25 we contrasted the distribution of endogenous (1,3;1,4)-p-D-glucans at the light microscope level in control material with that displayed by leaf sections of plantlets over-expressing barley Cs/F genes. A repeat analysis of a sub-set of the same lines using the specific monoclonal antibody and TEM, which allows a much closer examination of individual cell walls, is described here. 30 Leaf pieces representative of the plant groups described in Example 7 were harvested, fixed and embedded in LR white resin. Mounted sections were WO 2007/014433 PCT/AU2006/001107 - 82 treated with the specific monoclonal antibody which binds to (1,3;1,4)-E-D glucan and colloidal gold and examined on the transmission electron microscope. 5 The presence of endogenous (1,3;1,4)-O-D-glucans was clearly evident, as expected, on sections taken from wild type (WT) and transgenic control (G89) leaves. In contrast, sections taken from the transgenic G98 and G103 plants, such as G98-10 and G103-5, display much heavier labeling. A labeled epidermal cell wall of the control G89 is shown in Figure 19A. Equivalent 10 epidermal cell walls of the transgenics G98-10 and G103-5 are shown in Figure 19B (G98-10) and 19C (G103-5), where the increased amount of labeling is clearly evident. Figure 20A shows the wall of a sclerenchyma fibre cell in the G89 control which is lightly labeled. Such cells have thickened secondary cell walls and Trethewey and Harris (2002, supra) also detected sparse labeling at 15 the TEM level in these fibres from wild type seedlings. In comparison the fibre cell walls from the transgenic G98-10 and G103-5 plants, shown in Figures 20B and 20C respectively, are more heavily labeled. These results indicate that over-expression of individual CsIF genes has the potential to increase deposition of (1,3;1,4)-L-D-glucans in the cell walls of transgenic plants. This 20 has been demonstrated using both a fluorophore for glucan detection at the light microscope level (Example 7) and, as demonstrated here, by employing immunogold labeling at the TEM level. Materials and Methods 25 (i) Preparation of Transformed Barley Leaves for Electron Microscopy Pieces of barley plantlet leaves were fixed in 0.25% glutaraldehyde, 4% (v/v) paraformaldehyde (EM Grade) and 4% sucrose in phosphate-buffered saline 30 (PBS), pH 7.2, and stored at 4 0 C.overnight. After three rinses in MilliQ water the samples were dehydrated in a graded ethanol series and slowly infiltrated with WO 2007/014433 PCT/AU2006/001107 - 83 LR White resin over several days. Individual leaf pieces were placed in gelatin capsules, which were filled with fresh resin and polymerized overnight at 65 0 C. (ii) Immunolocation for Transmission Electron Microscopy 5 Sections (80 nm) of barley leaves were prepared on a Leica Ultracut R microtome using a diamond knife and collected on 100 and 200 mesh, Formvar coated gold grids. The ultrathin sections were blocked for 30 min in 1% bovine serum albumin in PBS before incubation in murine monoclonal antibodies 10 raised against barley (1,3;1,4)-p-D-glucan (diluted 1:500; Biosupplies Australia, Parkville, VIC 3052, Australia) for 1 hr at room temperature and overnight at 40C. The grids were washed twice in PBS and three times in blocking buffer before a I h incubation in 18 nm Colloidal Gold-AffiniPure Goat-Anti Mouse IgG + IgM (H+L) (Jackson ImmunoResearch Laboratories, Inc., PA, USA). All grids 15 were washed twice in PBS and several times in MilliQ water before viewing on a Philips BioTwin Transmission Electron Microscope and images captured on a Gatan Multiscan CCD Camera. Those skilled in the art will appreciate that the invention described herein is 20 susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to, or indicated in this specification, individually or collectively, and any and all combinations of any two or more of 25 the steps or features. Also, it must be noted that, as used herein, the singular forms "a", "an" and "the" include plural aspects unless the context already dictates otherwise. Thus, for example, reference to "a transgene" includes a single transgene as well as two 30 or more transgenes; "a plant cell" includes a single cell as well as two or more cells; and so forth.

Claims (15)

1. A method for influencing the level of (1,3;1,4)-P-D-glucan produced by a cell, the method comprising modulating the expression of a Cs/F gene or functional 5 homolog thereof in the cell.

2. A method for producing (1,3;1,4)-p-D-glucan, the method comprising transforming a cell with a Cs/F gene or functional homolog thereof and allowing the cell to express the Cs/F gene or functional homolog thereof. [0

3. A genetically modified non-human cell comprising a modulated expression of a Cs/F gene or functional homolog thereof relative to a wild type cell of the same taxon, wherein modulated expression of the Cs/F gene or functional homolog thereof produces any one or more of: 15 (i) a modulated level of (1,3;1,4)-@-D-glucan relative to a wild type cell of the same taxon; and (ii) a modulated level and/or activity of (1,3;1,4)-@-D-glucan synthase relative to a wild type cell of the same taxon. 20

4. The cell of claim 3, wherein the cell is produced according to the method of claim 1.

5. A method of claim I or claim 2, or a cell of claim 3 or claim 4, wherein the Cs/F gene or functional homolog thereof comprises: 25 (i) a nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11; (ii) a nucleotide sequence which is at least 85% identical over the full length of the nucleotide sequence set forth in any of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9 and SEQ ID NO: 11; 30 (iii) a nucleotide sequence which encodes the amino acid sequence set forth in any of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12; (iv) a nucleotide sequence which encodes an amino acid sequence, wherein the amino acid sequence is at least 90% identical over the full length of an amino -85 acid sequence set forth in any one of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, SEQ ID NO: 10 and SEQ ID NO: 12; and/or (v) a nucleotide sequence which hybridises to any one of (i) to (iv) under stringent conditions. 5

6. The method of any one of claims 1, 2 and 5, or a cell of any one of claims 3 to 5, wherein the cell is a plant cell.

7. The method or cell of claim 6, wherein the cell is a monocot plant cell. [0

8. The method or cell of claim 6 or claim 7, wherein the cell is a cereal crop plant cell.

9. A multicellular structure comprising one or more cells of any one of claims 3 to [5 8.

10. The multicellular of claim 9, wherein the multicellular structure is selected from the list consisting of a whole plant, a plant tissue, a plant organ, a plant part, plant reproductive material or cultured plant tissue. z0

11. The multicellular structure of claim 9 or claim 10, wherein the multicellular structure comprises a cereal crop plant or a tissue, organ or part thereof.

12. The multicellular structure of claim 11, wherein the multicellular structure 25 comprises a cereal grain.

13. Flour comprising: (i) flour produced by the milling of the grain of claim 12; and (ii) optionally, flour produced by the milling of one or more other grains 30

14. (1,3;1,4)-s-o-glucan produced according to the method of claim 2.

15. A method of claim 1 or claim 2, or a cell of claim 3, substantially as herein described with reference to any one or more of the Examples and/or Figures.