WO2006062898A2 - Compounds and methods for treating hemorrhagic fever viruses - Google Patents
Compounds and methods for treating hemorrhagic fever viruses Download PDFInfo
- Publication number
- WO2006062898A2 WO2006062898A2 PCT/US2005/043931 US2005043931W WO2006062898A2 WO 2006062898 A2 WO2006062898 A2 WO 2006062898A2 US 2005043931 W US2005043931 W US 2005043931W WO 2006062898 A2 WO2006062898 A2 WO 2006062898A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- carboxamide
- hexafluoro
- methyl
- hydrazine
- sulfonyl
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
- 0 CC(C(F)(F)F)(C(F)(F)F)NC(*(*)*)=O Chemical compound CC(C(F)(F)F)(C(F)(F)F)NC(*(*)*)=O 0.000 description 1
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C311/00—Amides of sulfonic acids, i.e. compounds having singly-bound oxygen atoms of sulfo groups replaced by nitrogen atoms, not being part of nitro or nitroso groups
- C07C311/48—Amides of sulfonic acids, i.e. compounds having singly-bound oxygen atoms of sulfo groups replaced by nitrogen atoms, not being part of nitro or nitroso groups having nitrogen atoms of sulfonamide groups further bound to another hetero atom
- C07C311/49—Amides of sulfonic acids, i.e. compounds having singly-bound oxygen atoms of sulfo groups replaced by nitrogen atoms, not being part of nitro or nitroso groups having nitrogen atoms of sulfonamide groups further bound to another hetero atom to nitrogen atoms
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K31/00—Medicinal preparations containing organic active ingredients
- A61K31/16—Amides, e.g. hydroxamic acids
- A61K31/17—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine
- A61K31/175—Amides, e.g. hydroxamic acids having the group >N—C(O)—N< or >N—C(S)—N<, e.g. urea, thiourea, carmustine having the group, >N—C(O)—N=N— or, e.g. carbonohydrazides, carbazones, semicarbazides, semicarbazones; Thioanalogues thereof
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0014—Skin, i.e. galenical aspects of topical compositions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0019—Injectable compositions; Intramuscular, intravenous, arterial, subcutaneous administration; Compositions to be administered through the skin in an invasive manner
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/0031—Rectum, anus
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/007—Pulmonary tract; Aromatherapy
- A61K9/0073—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
- A61K9/0075—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy for inhalation via a dry powder inhaler [DPI], e.g. comprising micronized drug mixed with lactose carrier particles
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0012—Galenical forms characterised by the site of application
- A61K9/007—Pulmonary tract; Aromatherapy
- A61K9/0073—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy
- A61K9/0078—Sprays or powders for inhalation; Aerolised or nebulised preparations generated by other means than thermal energy for inhalation via a nebulizer such as a jet nebulizer, ultrasonic nebulizer, e.g. in the form of aqueous drug solutions or dispersions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/0087—Galenical forms not covered by A61K9/02 - A61K9/7023
- A61K9/0095—Drinks; Beverages; Syrups; Compositions for reconstitution thereof, e.g. powders or tablets to be dispersed in a glass of water; Veterinary drenches
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/02—Suppositories; Bougies; Bases therefor; Ovules
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/06—Ointments; Bases therefor; Other semi-solid forms, e.g. creams, sticks, gels
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/10—Dispersions; Emulsions
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/14—Particulate form, e.g. powders, Processes for size reducing of pure drugs or the resulting products, Pure drug nanoparticles
- A61K9/141—Intimate drug-carrier mixtures characterised by the carrier, e.g. ordered mixtures, adsorbates, solid solutions, eutectica, co-dried, co-solubilised, co-kneaded, co-milled, co-ground products, co-precipitates, co-evaporates, co-extrudates, co-melts; Drug nanoparticles with adsorbed surface modifiers
- A61K9/146—Intimate drug-carrier mixtures characterised by the carrier, e.g. ordered mixtures, adsorbates, solid solutions, eutectica, co-dried, co-solubilised, co-kneaded, co-milled, co-ground products, co-precipitates, co-evaporates, co-extrudates, co-melts; Drug nanoparticles with adsorbed surface modifiers with organic macromolecular compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
- A61K9/2004—Excipients; Inactive ingredients
- A61K9/2022—Organic macromolecular compounds
- A61K9/2027—Organic macromolecular compounds obtained by reactions only involving carbon-to-carbon unsaturated bonds, e.g. polyvinyl pyrrolidone, poly(meth)acrylates
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
- A61K9/2004—Excipients; Inactive ingredients
- A61K9/2022—Organic macromolecular compounds
- A61K9/205—Polysaccharides, e.g. alginate, gums; Cyclodextrin
- A61K9/2054—Cellulose; Cellulose derivatives, e.g. hydroxypropyl methylcellulose
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/20—Pills, tablets, discs, rods
- A61K9/2004—Excipients; Inactive ingredients
- A61K9/2022—Organic macromolecular compounds
- A61K9/205—Polysaccharides, e.g. alginate, gums; Cyclodextrin
- A61K9/2059—Starch, including chemically or physically modified derivatives; Amylose; Amylopectin; Dextrin
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K9/00—Medicinal preparations characterised by special physical form
- A61K9/48—Preparations in capsules, e.g. of gelatin, of chocolate
- A61K9/4841—Filling excipients; Inactive ingredients
- A61K9/4866—Organic macromolecular compounds
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07C—ACYCLIC OR CARBOCYCLIC COMPOUNDS
- C07C275/00—Derivatives of urea, i.e. compounds containing any of the groups, the nitrogen atoms not being part of nitro or nitroso groups
- C07C275/28—Derivatives of urea, i.e. compounds containing any of the groups, the nitrogen atoms not being part of nitro or nitroso groups having nitrogen atoms of urea groups bound to carbon atoms of six-membered aromatic rings of a carbon skeleton
- C07C275/40—Derivatives of urea, i.e. compounds containing any of the groups, the nitrogen atoms not being part of nitro or nitroso groups having nitrogen atoms of urea groups bound to carbon atoms of six-membered aromatic rings of a carbon skeleton being further substituted by nitrogen atoms not being part of nitro or nitroso groups
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D213/00—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members
- C07D213/02—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members
- C07D213/04—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom
- C07D213/60—Heterocyclic compounds containing six-membered rings, not condensed with other rings, with one nitrogen atom as the only ring hetero atom and three or more double bonds between ring members or between ring members and non-ring members having three double bonds between ring members or between ring members and non-ring members having no bond between the ring nitrogen atom and a non-ring member or having only hydrogen or carbon atoms directly attached to the ring nitrogen atom with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D213/72—Nitrogen atoms
- C07D213/74—Amino or imino radicals substituted by hydrocarbon or substituted hydrocarbon radicals
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D231/00—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings
- C07D231/02—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings
- C07D231/10—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D231/14—Heterocyclic compounds containing 1,2-diazole or hydrogenated 1,2-diazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D231/18—One oxygen or sulfur atom
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D233/00—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings
- C07D233/54—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members
- C07D233/66—Heterocyclic compounds containing 1,3-diazole or hydrogenated 1,3-diazole rings, not condensed with other rings having two double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D233/84—Sulfur atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D261/00—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings
- C07D261/02—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings
- C07D261/06—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members
- C07D261/10—Heterocyclic compounds containing 1,2-oxazole or hydrogenated 1,2-oxazole rings not condensed with other rings having two or more double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D265/00—Heterocyclic compounds containing six-membered rings having one nitrogen atom and one oxygen atom as the only ring hetero atoms
- C07D265/28—1,4-Oxazines; Hydrogenated 1,4-oxazines
- C07D265/34—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings
- C07D265/36—1,4-Oxazines; Hydrogenated 1,4-oxazines condensed with carbocyclic rings condensed with one six-membered ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D277/00—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings
- C07D277/02—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings
- C07D277/20—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members
- C07D277/32—Heterocyclic compounds containing 1,3-thiazole or hydrogenated 1,3-thiazole rings not condensed with other rings having two or three double bonds between ring members or between ring members and non-ring members with hetero atoms or with carbon atoms having three bonds to hetero atoms with at the most one bond to halogen, e.g. ester or nitrile radicals, directly attached to ring carbon atoms
- C07D277/36—Sulfur atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D285/00—Heterocyclic compounds containing rings having nitrogen and sulfur atoms as the only ring hetero atoms, not provided for by groups C07D275/00 - C07D283/00
- C07D285/01—Five-membered rings
- C07D285/02—Thiadiazoles; Hydrogenated thiadiazoles
- C07D285/04—Thiadiazoles; Hydrogenated thiadiazoles not condensed with other rings
- C07D285/06—1,2,3-Thiadiazoles; Hydrogenated 1,2,3-thiadiazoles
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
- C07D295/16—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms
- C07D295/18—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms acylated on ring nitrogen atoms by radicals derived from carboxylic acids, or sulfur or nitrogen analogues thereof
- C07D295/195—Radicals derived from nitrogen analogues of carboxylic acids
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D295/00—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms
- C07D295/22—Heterocyclic compounds containing polymethylene-imine rings with at least five ring members, 3-azabicyclo [3.2.2] nonane, piperazine, morpholine or thiomorpholine rings, having only hydrogen atoms directly attached to the ring carbon atoms with hetero atoms directly attached to ring nitrogen atoms
- C07D295/26—Sulfur atoms
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D317/00—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms
- C07D317/08—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3
- C07D317/44—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3 ortho- or peri-condensed with carbocyclic rings or ring systems
- C07D317/46—Heterocyclic compounds containing five-membered rings having two oxygen atoms as the only ring hetero atoms having the hetero atoms in positions 1 and 3 ortho- or peri-condensed with carbocyclic rings or ring systems condensed with one six-membered ring
- C07D317/48—Methylenedioxybenzenes or hydrogenated methylenedioxybenzenes, unsubstituted on the hetero ring
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07D—HETEROCYCLIC COMPOUNDS
- C07D319/00—Heterocyclic compounds containing six-membered rings having two oxygen atoms as the only ring hetero atoms
- C07D319/10—1,4-Dioxanes; Hydrogenated 1,4-dioxanes
- C07D319/14—1,4-Dioxanes; Hydrogenated 1,4-dioxanes condensed with carbocyclic rings or ring systems
- C07D319/16—1,4-Dioxanes; Hydrogenated 1,4-dioxanes condensed with carbocyclic rings or ring systems condensed with one six-membered ring
- C07D319/18—Ethylenedioxybenzenes, not substituted on the hetero ring
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2760/00—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA ssRNA viruses negative-sense
- C12N2760/00011—Details
- C12N2760/12011—Bunyaviridae
- C12N2760/12211—Phlebovirus, e.g. Rift Valley fever virus
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Definitions
- the arenaviruses characteristically produce chronic viremic infections in their natural host, 15 which in turn shed virus in their urine and feces, ultimately infecting humans in close contact with these infected materials either by aerosol or direct contact with skin abrasions or cuts.
- the natural history of the human disease is determined by the pathogenicity of the virus, its geographical distribution, the habitat and the habits of the rodent reservoir host, and the nature of the human-rodent interaction. 21
- Arenavirus hemorrhagic fever A live-attenuated vaccine, called Candid 1, has been evaluated in controlled trials among agricultural workers in AHF-endemic areas, where it appeared to reduce the number of reported AHF cases with no serious side effects. 16 It is not known if the Candid 1 vaccine would be useful against other Arenavirus hemorrhagic fevers and this vaccine is not available in the United States of America.
- Tacaribe virus is a biosafety level 2 (BSL 2) New World arenavirus (NWA) that is found in clade B and phylogenetically related to the Category A NWA (Junin, Machupo, Guanarito and Sabia). Tacaribe virus is 67% to 78% identical to Junin virus at the amino acid level for all four viral proteins.
- NWA biosafety level 2
- HTS high-throughput screening
- the present invention provides compounds and compositions and/or methods for the treatment and prophylaxis of viral infections, as well as diseases associated with viral infections in living hosts.
- the present invention provides compounds and compositions and/or methods for the treatment and prophylaxis of hemorrhagic fever viruses, such as Arenaviruses.
- the invention relates to a method for the treatment or prophylaxis of a viral infection or disease associated therewith, comprising administering in a therapeutically effective amount to a mammal in need thereof, a compound of formula I or a pharmaceutically acceptable salt thereof.
- the invention relates to a pharmaceutical composition that comprises a pharmaceutically effective amount of the compound or a pharmaceutically acceptable salt thereof, and a pharmaceutically acceptable carrier.
- the invention also relates to compounds of formula I, as well as pharmaceutically acceptable salts thereof.
- Preferred compounds of formula I include:
- R 2 is selected from the group consisting of substituted or unsubstituted phenyl, substituted and unsubstituted aryl, substituted and unsubstituted heteroaryl, substituted or unsubstituted alkyl, substituted or unsubstituted branched alkyl, and substituted or unsubstituted unsaturated cycloheteroalkyls;
- R 1 and R 2 combine together to form a substituted or unsubstituted C 4- jo cyclic saturated heteroalkyl
- R 2 is selected from the group consisting of substituted or unsubstituted phenyl, substituted and unsubstituted aryl, substituted and unsubstituted heteroaryl, substituted or unsubstituted alkyl, substituted or unsubstituted branched alkyl, and substituted or unsubstituted unsaturated cycloheteroalkyls
- Ri is selected from the group consisting of H and alkyl
- R 2 is selected from the group consisting of substituted or unsubstituted phenyl, substituted and unsubstituted aryl, substituted and unsubstituted heteroaryl, substituted or unsubstituted alkyl, substituted or unsubstituted branched alkyl, and substituted or unsubstituted unsaturated cycloheteroalkyls;
- Ri and R 2 combine together to form a substituted or unsubstituted C 4-I0 cyclic saturated heteroalkyl
- n is 0 or 1.
- m is 1 and p is 1 or alternatively, m is 0 and p is O.
- Ri and R 2 combine together to form a substituted or unsubstituted C 4-10 cyclic saturated heteroalkyl selected from the group consisting of:
- R 2 is selected from the group consisting of:
- the mammal being treated is a human.
- the viral infection being treated is a hemorrhagic fever virus, such as an Areanvirus.
- the Arenavirus may be selected from the group consisting of Junin, Machupo, Guanavito, Sabia, and Lassa.
- FIG. 1 provides the chemical structure, formula, and molecular weight of ST-336.
- FIG. 2 shows the effect of the time of addition of ST-336 on Tacaribe virus yield and plaque formation.
- FIG. 2B Vero cells were infected with 400 pfu Tacaribe virus. ST-336 was added for 1 hour before the infection (-1), for 1 hour during adsorption (O) 5 and for 1 hour after the infection (+1). Infected monolayers were washed with PBS and overlay ed with medium containing agarose. Five days post-infection, cells were glutaraldehyde fixed and crystal violet stained prior to plaque counting.
- FIG. 3 shows that ST-336 binds with slow Koff to intact Tacaribe virion in the absence of cells.
- FIG. 3 A a diagram of the virus dilution scheme prior to plating is provided. The virus mixed with ST-336 and diluted (left side) or virus diluted and ST- 336 added after dilution (right side).
- FIG. 3B pictures of the plaques that resulted after plating each dilution shown in FIG. 3 A on Vero cells is provided.
- FIG. 4 shows the mapping of ST-336 drug resistant variants ("DRVs”).
- DBVs drug resistant variants
- FIG. 4 A a linear map of the glycoprotein precursor (“GPC") showing the location of the signal peptide (“SP"), transmembrane domain (“TM”), the cleavage site between GPl and GP2 (K261-A262), the location of the four ST-336 resistant mutants ("DR #1-4"), and the amino acid change for each is provided.
- FIG.4B the amino acid sequence alignment of GP2 from wild type NWA and ST 336 DRVs is shown.
- FIG. 5 provides the chemical structure, formula, and molecular weight for ST- 294.
- FIG. 6 shows the effect of ST-294 in newborn mice challenged with Tacaribe virus.
- Four day old BALB/c mice were infected IP with 30xLD50 Tacarbide virus and treated daily for 10 days with vehicle (control), ribavarin at 25 mg/kg, ST-294 twice a day (BID) at 50 mg/kg or once a day (SID) at 100 mg/kg. Shown in FIG. 6 are the percent survivors in each treatment group on day 9 and day 10 after infection.
- this invention relates to compounds which are useful for the treatment and prophylaxis of viral infections, as well as diseases associated with viral infections in living hosts.
- the present invention provides compounds and compositions and/or methods for the treatment and prophylaxis of hemorrhagic fever viruses, such as Arenaviruses.
- hemorrhagic fever viruses such as Arenaviruses.
- the mammal is human.
- the term "efficacy" as used herein in the context of a chronic dosage regime refers to the effectiveness of a particular treatment regime. Efficacy can be measured based on change the course of the disease in response to an agent of the present invention.
- Successess refers to the effectiveness of a particular treatment regime. This includes a balance of efficacy, toxicity (e.g., side effects and patient tolerance of a formulation or dosage unit), patient compliance, and the like. For a chronic administration regime to be considered “successful” it must balance different aspects of patient care and efficacy to produce the l o most favorable patient outcome.
- treating refers to obtaining a desired pharmacological and physiological effect.
- the effect may be prophylactic in terms of preventing or partially preventing a disease, symptom or condition thereof and/or may be therapeutic in terms of a partial or complete cure of a disease, condition,
- treatment covers any treatment of a disease in a mammal, particularly a human, and includes: (a) preventing the disease from occurring in a subject which may be predisposed to the disease but has not yet been diagnosed as having it, i.e., causing the clinical symptoms of the disease not to develop in a subject that may be predisposed to the disease but does not
- the invention is directed towards treating a patient's suffering from disease related to pathological inflammation.
- the present invention is involved in preventing,
- acyl refers to the groups H-C(O)-, alkyl-C(O)-, substituted alkyl-C(O)-, alkenyl-C(O)-, substituted alkenyl-C(O)-, alkynyl-C(O)-, substituted
- Acylamino refers to the group -C(O)NRR where each R is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, aryl, substituted aryl, cycloalkyl, substituted cycloalkyl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic and where each R is joined to form together with the nitrogen atom a heterocyclic or substituted heterocyclic ring wherein alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic and substituted heterocyclic are as defined herein.
- Alkenyl refers to alkenyl group preferably having from 2 to 10 carbon atoms and more preferably 2 to 6 carbon atoms and having at least 1 and preferably from 1-2 sites of alkenyl unsaturation.
- Substituted alkenyl refers to alkenyl groups having from 1 to 5 substituents independently selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, thiocarbonylamino, acyloxy, amino, amidino, alkylamidino, thioamidino, aminoacyl, aminocarbonylamino, aminothiocarbonylamino, aminocarbonyloxy, aryl, substituted aryl, aryloxy, substituted aryloxy, aryloxyaryl, substituted aryloxyaryl, halogen, hydroxyl, cyano, nitro, carboxyl, carboxylalkyl, carboxyl -substituted alkyl, carboxyl-cycloalkyl, carboxyl-substituted cycloalkyl, carboxylaryl, carboxyl-substituted aryl, carboxylheteroaryl, carboxyl-substituted
- the substituents are independently selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, ammocarbonylamino, aminocarbonyloxy, aryl, substituted aryl, aryloxy, substituted aryloxy, carboxyl, carboxyl esters, cyano, cycloalkyl, substituted cycloalkyl, cycloalkyloxy, substituted cycloalkyloxy, halogen, heteroaryl, substituted heteroaryl, heteroaryloxy, substituted heteroaryloxy, heterocyclic, substituted heterocyclic, hydroxyl, nitro, and oxycarbonylamino.
- Alkoxy refers to the group “alkyl-O-" which includes, by way of example, methoxy, ethoxy, ra-propoxy, zso-propoxy, «-butoxy, tert-butoxy, sec-butoxy, ra-pentoxy, «-hexoxy, 1,2-dimethylbutoxy, and the like.
- Substituted alkoxy refers to the group “substituted alkyl-O-".
- Alkyl refers to linear or branched alkyl groups preferably having from 1 to 10 carbon atoms and more preferably 1 to 6 carbon atoms. This term is exemplified by groups such as methyl, t-butyl, n-heptyl, octyl and the like.
- “Lower alkyl” refers to monovalent alkyl groups having from 1 to 5 carbon atoms including straight and branched chain alkyl groups. This term is exemplified by groups such as methyl, ethyl, iso-propyl, ra-propyl, rc-butyl, wo-butyl, sec-butyl, ?-butyl, rc-pentyl and the like. "Lower alkyl” may be optionally substituted with a halogen, such as chloro, fluoro, bronio and the like.
- Substituted alkyl refers to an alkyl group, of from 1 to 10 carbon atoms, having from 1 to 5 substituents independently selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, thiocarbonylamino, acyloxy, amino, amidino, alkyl amidino, thioamidino, aminoacyl, aminocarbonylamino, aminothiocarbonylamino, aminocarbonyloxy, aryl, substituted aryl, aryloxy, substituted aryloxy, aryloxylaryl, substituted aryloxyaryl, cyano, halogen, hydroxyl, nitro, carboxyl, carboxylalkyl, carboxyl-substituted alkyl, carboxyl-cycloalkyl, carboxyl-substituted cycloalkyl, carboxylaryl, carboxyl-substituted aryl, carboxylaryl, carboxyl-sub
- the substituents are independently selected from the group consisting of alkoxy, substituted alkoxy, acyl, acylamino, acyloxy, amino, substituted amino, aminoacyl, aminocarbonylamino, aminocarbonyloxy, aryl, substituted aryl, aryloxy, substituted aryloxy, carboxyl, carboxyl esters, cyano, cycloalkyl, substituted cycloalkyl, cycloalkyloxy, substituted cycloalkyloxy, halogen, heteroaryl, substituted heteroaryl, heteroaryloxy, substituted heteroaryloxy, heterocyclic, substituted heterocyclic, hydroxyl, nitro, and oxycarbonylamino.
- Amino refers to the group -NH 2 .
- Substituted amino refers to the group -NRR, where each R group is independently selected from the group consisting of hydrogen, alkyl, substituted alkyl, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, cycloalkyl, substituted cycloalkyl, aryl, substituted aryl, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic, -SO 2 -alkyl, -SO 2 -substituted alkyl, -SO 2 -alkenyl, -SO 2 -substituted alkenyl, -SO 2 -cycloalkyl, -SO 2 -substituted cycloalkyl, -SO 2 -aryl, -SO 2 -substituted aryl, - SO 2 -heteroaryl, -SO 2 -substituted heteroaryl, -SO 2 -he
- Aryl or “Ar” refers to an unsaturated aromatic carbocyclic group of from 6 to 14 carbon atoms having a single ring (e.g., phenyl) or multiple condensed rings (e.g., naphthyl or anthryl) which condensed rings may or may not be aromatic (e.g., 2- benzoxazolinone, 2H-l,4-benzoxazin-3(4H)-one-7yl, and the like) provided that the point of attachment is through an aromatic ring atom.
- Preferred aryls include phenyl, naphthyl and 5,6,7,8-tetrahydronaphth-2-yl.
- Substituted aryl refers to aryl groups which are substituted with from 1 to 3 substituents selected from the group consisting of hydroxy, acyl, acylamino, thiocarbonylamino, acyloxy, alkyl, substituted alkyl, alkoxy, substituted alkoxy, alkenyl, substituted alkenyl, alkynyl, substituted alkynyl, amidino, alkylamidino, thioamidino, amino, aminoacyl, aminocarbonyloxy, aminocarbonylamino, aminothiocarbonylamino, aryl, substituted aryl, aryloxy, substituted aryloxy, cycloalkoxy, substituted cycloalkoxy, heteroaryloxy, substituted heteroaryloxy, heterocyclyloxy, substituted heterocyclyloxy, carboxyl, carboxylalkyl, carboxyl-substituted alkyl, carboxyl-cycloalkyl, carboxyl
- Preferred substituents are selected from the group consisting of hydroxy, acyl, acylamino, acyloxy, alkyl, substituted alkyl, alkoxy, substituted alkoxy, alkenyl, substituted alkenyl, amino, substituted amino, aminoacyl, aminocarbonyloxy, arninocarbonylamino, aryl, substituted aryl, aryloxy, substituted aryloxy, cycloalkoxy, substituted cycloalkoxy, heteroaryloxy, substituted heteroaryloxy, heterocyclyloxy , substituted heterocyclyloxy, carboxyl, carboxyl esters, cyano, cycloalkyl, substituted cycloalkyl, halo, nitro, heteroaryl, substituted heteroaryl, heterocyclic, substituted heterocyclic, and oxycarbonylamino.
- Heteroaralkoxy refers to the group heteroaryl-alkylene-O-.
- Substituted heteroaralkoxy refers to the group substituted heteroaryl- alkylene-O-.
- amines where the two or three substituents, together with the amino nitrogen, form a heterocyclic or heteroaryl group.
- suitable amines include, by way of example only, isopropylamine, trimethyl amine, diethyl amine, tri(iso-propyl) amine, tri(n-propyl) amine, ethanolamine, 2-dimethylaminoethanol, tromethamine, lysine, arginine, histidine, caffeine, procaine, hydrabamine, choline, betaine, ethylenediamine, glucosamine, N-alkylglucamines, theobromine, purines, piperazine, piperidine, morpholine, N-ethylpiperidine, and the like.
- carboxylic acid derivatives would be useful in the practice of this invention, for example, carboxylic acid amides, including carboxamides, lower alkyl carboxamides, dialkyl carboxamides, and
- the quantity of active compound in the pharmaceutical composition and unit dosage form thereof may be varied or adjusted widely depending upon the particular application, the manner or introduction, the potency of the particular compound, and the desired concentration.
- unit dosage forms refers to physically discrete units suitable as unitary dosages for human subjects and other mammals, each unit containing a predetermined quantity of active material calculated to produce the desired therapeutic effect, in association with a suitable pharmaceutical excipient.
- concentration of therapeutically active compound may vary from about 1 mg/ml to 250 g/ml.
- the presence of an agent, e.g., sodium chloride in an amount of about of 1-8 mg/ml, to adjust the tonicity to the same value of human blood may be required to avoid the swelling or shrinkage of erythrocytes upon administration of the intravenous formulation leading to undesirable side effects such as nausea or diarrhea and possibly to associated blood disorders.
- the tonicity of the formulation matches that of human blood which is in the range of 282 to 288 m ⁇ sm/kg, and in general is 285 mOsm/kg , which is equivalent to the osmotic pressure corresponding to a 0.9% solution of sodium chloride.
- a tablet formula is prepared using the ingredients below:
- Formulation Example 3 A dry powder inhaler formulation is prepared containing the following components:
- Tablets each containing 30 mg of active ingredient, are prepared as follows:
- the active ingredient, starch and cellulose are passed through a No. 20 mesh U.S. sieve and mixed thoroughly.
- the solution of polyvinyl-pyrrolidone is mixed with the resultant powders, which are then passed through a 16 mesh U.S. sieve.
- the granules so produced are dried at 50° to 60 0 C and passed through a 16 mesh U.S. sieve.
- the sodium carboxymethyl starch, magnesium stearate, and talc previously passed through a No. 30 mesh U.S. sieve, are then added to the granules, which after mixing, are compressed on a tablet machine to yield tablets each weighing 150 mg.
- Suppositories each containing 25 mg of active ingredient are made as follows:
- the active ingredient is passed through a No. 60 mesh U.S. sieve and suspended in the saturated fatty acid glycerides previously melted using the minimum heat necessary. The mixture is then poured into a suppository mold of nominal 2.0 g capacity and allowed to cool.
- Suspensions each containing 50 mg of medicament per 5.0 ml dose are made as follows:
- Hard gelatin tablets each containing 15 mg of active ingredient are made as follows:
- Quantity Ingredient (mg/caosulel
- the active ingredient, cellulose, starch, and magnesium stearate are blended, passed through a No. 20 mesh U.S. sieve, and filled into hard gelatin capsules in 560 mg quantities.
- Therapeutic compound compositions generally are placed into a container having a sterile access port, for example, an intravenous solution bag or vial having a stopper pierceable by a hypodermic injection needle or similar sharp instrument.
- a topical formulation may be prepared as follows:
- the white soft paraffin is heated until molten.
- the liquid paraffin and emulsifying wax are incorporated and stirred until dissolved.
- the active ingredient is added and stirring is continued until dispersed.
- the mixture is then cooled until solid.
- An aerosol formulation may be prepared as follows: A solution of the candidate compound in 0.5% sodium bicarbonate/saline (w/v) at a concentration of 30.0 mg/mL is prepared using the following procedure:
- transdermal delivery devices Such transdermal patches may be used to provide continuous or discontinuous infusion of the compounds of the present invention in controlled amounts.
- the construction and use of transdermal patches for the delivery of pharmaceutical agents is well known in the art. See, e.g., U.S. Patent No. 5,023,252, issued June 11, 1991, herein incorporated by reference.
- patches may be constructed for continuous, pulsatile, or on demand delivery of pharmaceutical agents.
- Direct or indirect placement techniques may be used when it is desirable or necessary to introduce the pharmaceutical composition to the brain. Direct techniques usually involve placement of a drug delivery catheter into the host's ventricular system to bypass the blood-brain barrier.
- One such implantable delivery system used for the transport of biological factors to specific anatomical regions of the body is described in U.S. Patent No. 5,011,472, which is herein incorporated by reference.
- Indirect techniques usually involve formulating the compositions to provide for drug latentiation by the conversion of hydrophilic drugs into lipid-soluble drugs.
- Latentiation is generally achieved through blocking of the hydroxy, carbonyl, sulfate, and primary amine groups present on the drug to render the drug more lipid soluble and amenable to transportation across the blood-brain barrier.
- the delivery of hydrophilic drugs may be enhanced by intra-arterial infusion of hypertonic solutions which can transiently open the blood-brain barrier.
- the compounds may be encapsulated, introduced into the lumen of liposomes, prepared as a colloid, or other conventional techniques may be employed which provide an extended serum half-life of the compounds.
- compositions of the invention are suitable for use in a variety of drug delivery systems. Suitable formulations for use in the present invention are found in
- the compounds described herein are suitable for use in a variety of drug delivery systems described above. Additionally, in order to enhance the in vivo serum half life of the administered compound, the compounds may be encapsulated, introduced into the lumen of liposomes, prepared as a colloid, or other conventional techniques may be employed which provide an extended serum half life of the compounds.
- a variety of methods are available for preparing liposomes, as described in, e.g., Szoka, et ah, U.S. Patent Nos. 4,235,871, 4,501,728 and 4,837,028, each of which is incorporated herein by reference.
- compositions are administered to a patient already suffering from AD in an amount sufficient to at least partially arrest further onset of the symptoms of the disease and its complications.
- An amount adequate to accomplish this is defined as "therapeutically effective dose.” Amounts effective for this use will depend on the judgment of the attending clinician depending upon factors such as the degree or severity of AD in the patient, the age, weight and general condition of the patient, and the like.
- the compounds described herein are administered at dosages ranging from about 0.1 to about 500 mg/kg/day.
- compositions are administered to a patient at risk of developing AD (determined for example by genetic screening or familial trait) in an amount sufficient to inhibit the onset of symptoms of the disease.
- An amount adequate to accomplish this is defined as “prophylactically effective dose.” Amounts effective for this use will depend on the judgment of the attending clinician depending upon factors such as the age, weight and general condition of the patient, and the like.
- the compounds described herein are administered at dosages ranging from about 0.1 to about 500 mg/kg/day.
- the compounds administered to a patient are in the form of pharmaceutical compositions described above. These compositions may be sterilized by conventional sterilization techniques, or may be sterile filtered. When aqueous solutions are employed, these may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile aqueous carrier prior to administration.
- the pH of the compound preparations typically will be between 3 and 11, more preferably from 5-9 and most preferably from 7 and 8. It will be understood that use of certain of the foregoing excipients, carriers, or stabilizers will result in the formation of pharmaceutical salts.
- Hemorrhagic fever viruses are RNA viruses that cause a variety of disease syndromes with similar clinical characteristics.
- HFVs that are of concern as potential biological weapons include but are not limited to: Arenaviridae (Junin, Machupo, Guanavito, Sabia and Lassa), Filoviridae (ebola and Marburg viruses), Flaviviridae (yellow fever, omsk hemorrhagic fever and Kyasanur Forest disease viruses), and Bunyaviridae (Rift Valley fever).
- Arenaviridae Junin, Machupo, Guanavito, Sabia and Lassa
- Filoviridae ebola and Marburg viruses
- Flaviviridae yellow fever, omsk hemorrhagic fever and Kyasanur Forest disease viruses
- Bunyaviridae Bunyaviridae (Rift Valley fever).
- the naturally occurring arenaviruses and potential engineered arenaviruses are included in the Category A Pathogen list according to the Center for Disease control and Prevention as being among those agents that have greatest potential for mass casualties.
- Risk factors include: travel to Africa or Asia, handling of animal carcasses, contact with infected animals or people, and/or arthropod bites. Arenaviruses are highly infectious after direct contact with infected blood and/or bodily secretions. Humans usually become infected through contact with infected rodents, the bite of an infected arthropod, direct contact with animal carcasses, inhalation of infectious rodent excreta and/or injection of food contaminated with rodent excreta. The Tacaribe virus has been associated with bats. Airborne transmission of hemorrhagic fever is another mode, but somewhat less common. Person-to-person contact may also occur in some cases.
- hemorrhagic fevers exhibit similar clinical symptoms. However, in general the clinical manifestations are non-specific and variable.
- the incubation period is approximately 7- 14 days. The onset is gradual with fever and malaise, tachypnea, relative bradycardia, hypotension, circulatory shock, conjeunctival injection, pharyngitis, lymphadenopathy, encephalitis, myalgia, back pain, headache and dizziness, as well as hyperesthesia of the skin.
- Some infected patients may not develop hemorrhagic manifestations.
- Methods of diagnosis at specialized laboratories include antigen detection by antigen-capture enzyme-linked immunosorbent assay (ELISA), IgM antibody detection by antibody-capture enzyme-linked immunosorbent assay, reverse transcriptase polymerase chain reaction (RT-PCR), and viral isolation.
- Antigen detection (by enzyme-linked immunosorbent assay) and reverse transcriptase polymerase chain reaction are the most useful diagnostic techniques in the acute clinical setting. Viral isolation is of limited value because it requires a biosafety level 4 (BSL-4) laboratory.
- the compounds of formula I, as well as IA and IB above are readily prepared via several divergent synthetic routes with the particular route selected relative to the ease of compound preparation, the commercial availability of starting materials, and the like.
- the compounds of Formulae I and II can be prepared from readily available starting materials using the following general methods and procedures. It will be appreciated that where typical or preferred process conditions (i.e., reaction temperatures, times, mole ratios of reactants, solvents, pressures, etc.) are given, other process conditions can also be used unless otherwise stated. Optimum reaction conditions may vary with the particular reactants or solvent used, but such conditions can be determined by one skilled in the art by routine optimization procedures.
- protecting groups may be necessary to prevent certain functional groups from undergoing undesired reactions.
- Suitable protecting groups for various functional groups as well as suitable conditions for protecting and deprotecting particular functional groups are well known in the art. For example, numerous protecting groups are described in T. W. Greene and G. M. Wuts, Protecting Groups in Organic Synthesis, Second Edition, Wiley, New York, 1991, and references cited therein.
- the compounds of this invention will typically contain one or more chiral centers. Accordingly, if desired, such compounds can be prepared or isolated as pure stereoisomers, i. e. , as individual enantiomers or diastereomers, or as stereoisomer- enriched mixtures.
- stereoisomers and enriched mixtures are included within the scope of this invention, unless otherwise indicated.
- Pure stereoisomers may be prepared using, for example, optically active starting materials or stereoselective reagents well-known in the art.
- racemic mixtures of such compounds can be separated using, for example, chiral column chromatography, chiral resolving agents and the like.
- the products of this invention are a mixture of R, S enantiomers.
- the chiral product can be obtained via purification techniques which separates enantiomers from a R 5 S mixture to provide for one or the other stereoisomer.
- the compounds can be provided as prodrugs which convert (e.g., hydrolyze, metabolize, etc.) in vivo to a compound of Formula I above.
- the carboxylic acid group of the compound of Formula I is modified into a group which, in vivo, will convert to a carboxylic acid group (including salts thereof).
- Example 1-50 The compounds of Examples 1-50 were prepared following the below mentioned general procedure for Example 13 using compound 13 (a) and reacting it with the following benzenesulfonylhydrazines: 4-Phenylbenzenesulfonyl hydrazine, 4-t- butylbenzenesulfonyl hydrazine, 4-methyl-3,4-dihydro-2i7-benzo[l ,4]oxazine-7-sulfonyl hydrazine, 5-(l-dimethylaminonaphthyl)sulfonyl hydrazine, 2,4,6- trimethylbenzenesulfonyl hydrazine, 3-chloro-6-methoxybenzenesulfonyl hydrazine, 2,5- dimethoxybenzenesulfonyl hydrazine, 4-(4-[l,2,3]thiadiazolyl) benzenesulfonyl hydr
- Examples 52-99 were prepared following the above mentioned general procedure for Example 51 using compound 13 (a) and reacting it with the following amines or anilines: morpholine, 2-acetylamline, piperidine, 3,4,5- trimethoxyaniline, 4-trifluoromethylaniline, 4-methylpiperazine, 1 -aminonaphthalene, 2- chloroaniline, 4-phenylpiperidine, 2-phenylaniline, 2,6-difluoroaniline, 2- amimobenzamide, 2-chloro-6-fluoroaniline, 3-trifluoromethylaniline, 2- aminobenzenesulfonamide, 5-amino(2,2,3,3-Tetrafluoro-2,3-dihydrobenzo[l,4]dioxane), 3-trifluoromethoxyaniline, 4-trifiuoromethoxyaniline, 4-methylpiperidine, 2- aminonaphthalene, 2-fluoroaniline, 2,6-dimethoxyaniline, 4-a
- Assay plates were set up as follows. Vero cells were plated at 80% confluency on 96-well plates. Test compounds (80 per plate) from the library were added to wells at a final concentration of 5 uM. Tacaribe virus (TRVL 11573) was then added at a virus dilution that would result in 90% CPE after 5 days (pre-determined as an 800-fold dilution of the virus stock; multiplicity of infection [MOI] approximately 0.001). Plates were incubated at 37°C and 5% CO2 for 5 days, then fixed with 5% glutaraldehyde and stained with 0.1% crystal violet.
- the extent of virus CPE was quantified spectrometrically at OD570 using a Molecular Devices VersaMax Tunable Microplate Reader.
- the inhibitory activity of each compound was calculated by subtracting from the OD570 of test compound well from the average OD570 of virus-infected ceil wells, then dividing by the average OD570 of mock-infected cell wells. The result represents the percent protection against Tacaribe virus CPE activity conferred by the compound.
- "Hits" in this assay were defined as compounds that inhibited virus-induced CPE by greater than 50% at the test concentration (5 (J.M). Of the approximately 400,000 compounds screened in the Tacaribe virus HTS campaign, 2,347 hits were identified (0.58% hit rate).
- Quality hits are defined as inhibitor compounds (hits) that exhibit acceptable chemical structures, antiviral potency and selectivity, and spectrum of antiviral activity.
- compounds identified as hits in HTS assays were evaluated against four criteria: (i) chemical tractability, (ii) inhibitory potency, (iii) inhibitory selectivity and, (iv) antiviral specificity.
- all hits have EC50 values ⁇ 5 uM.
- the chemical structures of compounds that met this initial criterion were visually examined for chemical tractability.
- a chemically tractable compound is defined as an entity that is synthetically accessible using reasonable chemical methodology, and which possesses chemically stable functionalities and (potential) drug-like qualities.
- EC50 values were determined from a plot of the compound inhibitory activity typically across eight compound concentrations (50, 15, 5, 1.5, 0.5, 0.15, 0.05 and 0.015 uM). To assess whether the hit is a selective inhibitor, the effect on cellular functions was determined using a standard cell proliferation assay. A 50% cytotoxicity concentration (CC50) was determined using a tetrazolium-based colorimetric method, which measures the in situ reduction of 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) to insoluble blue formazan crystals by mitochondrial enzymes in metabolically active cells.
- MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide
- SI Selective Index
- the specificity of the antiviral activity exhibited by hit compounds was determined by testing the compounds against a number of related and unrelated viruses. Compounds are tested against a variety of unrelated DNA (HSV, CMV 5 vaccinia virus) and RNA (RSV, rotavirus, Rift Valley fever, Ebola virus, Ebola GP-pseudotype, Lassa GP- pseudotype, HIV env-pseudotype) viruses. Compounds that will be selected for further development are thosejha A are selective against the selected original target virus and inactive against unrelated viruses.
- a chemical library was created and screened that represents a broad and well- balanced collection of 400,000 compounds accumulated over a number of years from a variety of distinct sources.
- the library achieves broad coverage across property space involving the following chemical descriptors: calculated logarithm of n-octano I/water partition coefficient (ClogP), polar (water-accessible surface area (PSA), globularity (three dimensional structure) and molecular weight (average: 394.5 daltons).
- Vero African green monkey kidney epithelial, ATCC #CCL-81
- MEM Eagle's minimum essential medium
- FBS heat-inactivated fetal bovine serum
- IM heat-inactivated fetal bovine serum
- HEp-2 cells human carcinoma of the larynx epithelial; ATCC #CCL-23 were cultured in MEM containing 10% heat-inactivated FBS and 1% penicillin/streptomycin.
- MRC-5 cells human normal lung fibroblast; ATCC #CCL-171 were cultured in MEM containing 10% heat- inactivated FBS, 1% penicillin/streptomycin, 1% L-glutamine (Invitrogen 25030-081), 1% Non-Essential Amino Acids (Invitrogen #11140-050), 1% sodium pyruvate (Invitrogen #11360-070), and 2% sodium bicarbonate.
- MA104 cells epidermal African green monkey kidney, ATCC CRL-2378.1
- MEM methicillin-containing medium
- penicillin/streptomycin 1% L-glutamine
- Non-Essential Amino Acids 1% sodium pyruvate
- sodium bicarbonate 2% sodium bicarbonate and 62.5ug/ml trypsin and no serum during virus infection. All cell lines were incubated at 37 0 C and 5% CO 2 .
- Respiratory syncytial virus (RSV; A isolate), lymphocytic choriomeningitis virus (LCMV; Armstrong E350 isolate), cytomegalovirus (CMV; AD-169 isolate), herpes simplex virus 1 (HSV-I ; KOS isolate), Vaccinia virus (Strain WR), Tacaribe virus (strain TRVL 11573) and rotavirus (strain WA) were obtained from ATCC (#VR-1422, #VR-1540, #VR-134, #VR-538, #VR-1493, #VR-1354 , #VR-114, and # VR-2018 respectively). Candid 1 and Amapari BeAn 70563 were obtained from Dr.
- CPE Cvtopathic Effect
- a viral CPE assay was used to evaluate the antiviral effect of compounds against Tacaribe virus (Vero cells), Candid- 1 vaccine virus (Vero cells), Amapari virus (Vero cells), SARS-CoV (Vero cells), HSV-I (Vero cells), RSV (HE ⁇ -2 cells), vaccinia virus (Vero cells), and Rotavirus (MAl 04).
- An enzyme-linked immunosorbent assay was used to evaluate the antiviral effect of compounds against Tacaribe virus (Vero cells), Candid- 1 vaccine virus (Vero cells), Amapari virus (Vero cells), SARS-CoV (Vero cells), HSV-I (Vero cells), RSV (HE ⁇ -2 cells), vaccinia virus (Vero cells), and Rotavirus (MAl 04).
- ELISA ELISA
- Virus stocks were titrated in a separate experiment to determine the concentration that resulted in 90% destruction of the cell monolayer (CPE assay) after 3 days (HSV-I, Rotavirus and vaccinia) or 4 days (SARS-CoV, RSV, Tacaribe virus,
- Candid 1 vaccine virus and Amapari virus or the concentration that generated an ELISA signal of 2.5 at an optical density of 650 nm (OD 6S0 ) after 3 days (LCMV) or 4 days (CMV).
- LCMV 3 days
- CMV 4 days
- These pre-established dilutions of virus were added to wells containing serial dilutions of compound. Uninfected cells and cells receiving virus without compound were included on each assay plate.
- reference agents when available, were included on each assay plate (gancyclovir for HSV-I and CMV, Sigma #G2536; ribavirin for LCMV and RSV, Sigma #R9644; and rifampicin for vaccinia virus, Sigma #R3501).
- HSV-I Rotavirus, LCMV, Vaccinia virus
- Tacaribe virus Amapari virus, Candid 1 virus, SARS-CoV, RSV, and CMV
- HSV- 1 , SARS-CoV, Rotavirus, Vaccinia virus, RSV, Tacaribe virus, Amapari virus, Candid 1 vaccine virus infected plates were processed for crystal violet staining while plates infected with CMV and LCMV were processed for ELISA analysis.
- crystal violet staining the plates were fixed with 5% glutaraldehyde and stained with 0.1% crystal violet.
- the optical density at 570 nm was measured using a Microplate Reader.
- the medium from the LCMV and CMV-infected plates was removed and the cells were fixed with 100% methanol (Fisher, CAS #67-56-1, HPLC grade) for 20 minutes at room temperature.
- the methanol solution was removed and the plates were washed 3 times with PBS.
- Non-specific binding sites were blocked by the addition of 130 ⁇ L of Superblock Blocking Buffer (Pierce #37515) for 1 hour at 37 0 C.
- the blocking agent was removed and the wells were washed 3 times with PBS.
- Tween-20 was added to the wells and the plates were incubated for 1 hour at 37 0 C.
- the secondary antibody solution was removed and the wells were washed 5 times with PBS.
- the assay was developed for 15 minutes by the addition of 130 ⁇ L of 3,3 ',5,5- tetramethylbenzidine substrate (Sigma #T0440) to quantify peroxidase activity.
- the OD 65 o of the resulting reaction product was measured using a Molecular Devices Kinetic Microplate Reader with a 650 nm filter.
- Antiviral activity against Tacaribe virus was evaluated by three methods: CPE Assay, Plaque Reduction, and Virus Yield Inhibition Assay.
- CPE Assay Vero cells were plated at 80% conf ⁇ ency on 96- well plates. Test compounds (80 per plate) from the library were added to wells at a final concentration of 5 ⁇ M. Tacaribe virus was then added at a virus dilution that would result in 90% CPE after 5 days (multiplicity of infection ("MOI") approximately 0.001). Plates were incubated at 37 0 C and 5% CO 2 for 5 days, then fixed with 5% glutaraldehyde and stained with 0.1% crystal violet.
- MOI multiplicity of infection
- the extent of virus CPE was quantified spectrometrically at ODs 70 using an Envision Microplate Reader.
- the inhibitory activity of each compound was calculated by subtracting from the OD 570 of test compound well from the average ODs 7O of virus- infected cell wells, then dividing by the average OD 570 of mock-infected cell wells. The result represents the percent protection against Tacaribe virus CPE activity conferred by each compound. "Hits" in this assay were defined as compound that inhibited virus- induced CPE by greater than 50% at the test concentration (5 ⁇ M). Hits that possessed chemical tractability were further evaluated for their inhibitory potency.
- the inhibitory concentration 50% (EC50) values were determined from a plot of the compound inhibitory activity following the CPE assay across eight compound concentrations (50, 15, 5, 1.5, 0.5, 0.15, 0.05 and 0.015 ⁇ M). AU determinations were performed in duplicate.
- Plaque Reduction Assay Vera cell monolayers grown in 6- well plates were infected with about 50 PFU/well in the absence or presence of various concentrations of the compounds. After Ih of virus adsorption at 37°C, residual inoculum was replaced by a 50:50 mix of 1% seaplaque agarose (in de-ionized water) and 2x MEM. Plaques were counted after 5-7 days of incubation at 37°C. The ECso was calculated as the compound concentration required to reduce virus plaque numbers by 50%. Under BSL 4 conditions at USAMRIID the plaque reduction assays (with Lassa, Machupo, Guanarito, and Junin viruses) were performed as follows: 200 PFU of each virus was used to infect Vero cells.
- cell monolayers were rinsed and overlaid with complete medium containing 1 % agarose and either lacking test compound or with different concentrations ranging from 15 ⁇ M to 0.05 ⁇ M. After 5 days incubation at 37 0 C, the monolayers were stained with neutral red and the numbers of plaques were counted.
- Virus Yield Reduction Assays Vero cells grown in 24-well plates were infected with Tacaribe virus at a multiplicity of infection ("MOI") of 0.1 in the presence of different concentrations of the compounds, two wells per concentration. After 48h of incubation at 37 0 C virus was harvested and the virus yields were determined by plaque formation in Vero cells. The EC 50 values were calculated as indicated above and similar calculations were performed to determine EC90 and EC99. Cytotoxicity Assay Cell viability was measured by a cell proliferation assay to determine a compound's effect on cellular functions so that a 50% cytotoxicity concentration (CC50) could be calculated; the ratio of this value to the EC50 is referred to as the selective index (S.I.
- S.I selective index
- the medium was removed when the cells reached 70-80% confluency and replaced with infection medium.
- Duplicate wells were treated with 3 ⁇ M ST-336 Ih prior to infection, at the time of infection or at specific times post infection (from 1 to 2Oh p.i.). Control infected cell cultures were treated with drug vehicle (DMSO) only.
- ST-336 was removed 1 hour post absorption and the monolayer was washed twice with cold PBS-M and replaced with fresh infection medium. The cells were harvested at 24h p.i. and were titrated as described above. In a separated experiment, Vero cells plated in a 6 well dish were infected with
- This experiment was designed to test the binding/fusion inhibitory properties of ST-336 towards Tacaribe virus.
- Vero cells were grown in MEM with 2% fetal calf serum.
- cells were grown to 70-80% confluency in 24-well culture plates.
- Tacaribe virus (4000 pfu) was treated with 1% DMSO, serially diluted tenfold in infection medium and treated with the specific concentrations of ST-336 (400 pfu + 0.5 ⁇ M ST-336, 40 pfu + 0.05 ⁇ M ST-336) or DMSO only (400 pfu or 40 pfu + DMSO).
- Tacaribe virus (4000 pfu) was treated with 5 ⁇ M ST-336 then serially diluted tenfold in infection medium.
- the suspensions were plated in wells and after adsorption for one hour inocula were removed and overlaid with 0.5% Seaplaque agarose in MEM.
- the plate was incubated at 37°C until cytopathic effect was observed in the DMSO control well.
- the cells were fixed with 5% gluteraldehyde and stained with 0.1% crystal violet for plaque visualization.
- each wild type plaque-purified isolate was titrated in the presence of 3 ⁇ M ST-336 as described. Vero cells in a 6-well plate were infected with 10 4 -10 6 pfu/well in media containing 3 ⁇ M ST- 336 for 1 hour, then the cells were overlaid with 0.5% seaplaque agarose in MEM containing 3 ⁇ M ST-336 and incubated until plaques formed. Plaques were picked and used to infect Vero cells in a 24-well plate without compound. When CPE developed the infected wells were harvested.
- Each drug-resistant isolate was then titrated on a 96- well plate in 0.5 log dilutions, starting with 25 ⁇ L of pure virus stock, without compound and with 1 ⁇ M and 3 ⁇ M ST-336. Each mutant went through several rounds of plaque purification before final virus stocks were made. Sequencing
- Primers specific to the GPC (Tac-forward: 5' GCCTAACTGAACCAGGTGAATC (SEQ ID NO: 1) and Tac-reverse: 5' TAAGACTTCCGCACCACAGG (SEQ ID NO:2)) from Tacaribe were used for amplification and sequencing. Solubility
- reaction ⁇ mixture minus cofactor cocktails, was prepared (1 mg/ml liver S9 fractions, 1 mM NADPH, 1 mM UDPGA, ImM PAPS, 1 mM GSH, 100 mM potassium phosphate pH 7.4, 10 mM magnesium chloride, 10 ⁇ M test article) and equilibrated at 37 0 C for 3 min. An aliquot of reaction mixture was taken as a negative control. The reaction was initiated by the addition of cofactor cocktails to the reaction mixture only, and then the reaction mixture and negative control were incubated in a shaking water bath at 37 0 C.
- An exploratory bacterial mutagenicity assay was used to assess the potential of the compound genotoxicity. This assay utilized S. typhimurium tester strains TA7007 and T Al 006 (single base pair mutations) and TA98 (frame shift mutation) with and without metabolic activation (Arochlor-induced rat liver S9) as described previously. 32 Pharmacokinetic ("PK") Assessments in Rats and Newborn Mice Analysis of the oral pharmacokinetics of selected compounds was performed in
- Mice were either treated with placebo (vehicle), ribavirin (MP Biomedical) administered IP at 25 mg/kg once a day for 10 days, or ST-294 administered IP at 100 mg/kg once a day or at 50 mg/kg twice a day for 10 days.
- Mice were monitored daily and weighed every other day throughout the study. Any mice showing signs of morbidity were euthanized by CO 2 asphyxiation.
- the New World Tacaribe complex comprises three phylogenetic lineages, designated clades A, B 5 and C.
- Clade B includes the prototypic Tacaribe virus, Amapari virus and the four South American Category A pathogens (Junin, Machupo, Guanarito and Sabia).
- Tacaribe virus is 67% to 78% identical to Junin virus at the amino acid level for all four viral proteins.
- BSL-4 laboratory containment
- Tacaribe virus is closely related to the Category A pathogens it was chosen as a surrogate BSL 2 NWA for the development of a HTS assay to screen for inhibitors of virus replication.
- Tacaribe HTS Assay Since Tacaribe virus grows well in cell culture and causes clear virus-induced cytopathic effect (CPE) a robust HTS CPE assay was developed in a 96-well plate. The CPE assay is a whole cell assay which allows for calculation of the selective index of the compounds and identification of inhibitors of any essential steps in the virus life cycle. Of the 400,000 compounds screened in the Tacaribe virus HTS assay, 2,347 hits were identified (0.58% hit rate). All of these hits had EC50 values ⁇ 5 ⁇ M.
- the 2,347 hits were then qualified based on four criteria: i) chemical tractability, ii) inhibitory potency, iii) inhibitory selectivity, and iv) antiviral specificity.
- a chemically tractable compound is defined as an entity that is synthetically accessible using reasonable chemical methodology, and which possesses chemically stable functionalities and potential drug- like qualities. Hits that passed this medicinal chemistry filter were evaluated for their inhibitory potency. EC 5O , CC 50 , and selective index (SI) values were determined to assess whether the hit was a selective inhibitor. Hits with SI values of at least 10 were considered further. Of the 2,347 hits identified, 36 compounds exhibited all the characteristics of quality hits.
- ST-336 is the representative prototype for this series.
- ST-336 is a 407.33 dalton compound and its structure is shown in FIG. 1. Table 1: Specificity of ST-336 virus (assay) ST-336 f ⁇ ivn
- Results represent the average of at least two independent determinations. *20 ⁇ M represents limit of compound solubility
- ST-336 has submicromolar potency, good selectivity, and antiviral specificity against Tacaribe virus as well as the Category A NWA.
- Evaluation of ST-336 in a virus yield reduction assay against Tacaribe virus produced EC 90 and EC 99 values of 0.068 ⁇ M and 0.085 ⁇ M respectively.
- the CC 50 value for ST-336 on Vero cells is >20 ⁇ M, which represents the solubility limit of this compound in cell culture media, giving it a selective index of >363.
- the activity of ST-336 against Tacaribe virus was tested on multiple cell lines and all the EC 50 values were similar to those achieved on
- Results represent the average of at least two independent determinations. *20 ⁇ M represents limit of compound solubility
- ST-336 The specificity of the antiviral activity exhibited by ST-336 was determined by testing against a number of related and unrelated viruses. As shown in Table 2, ST-336 showed no activity against a variety of unrelated DNA (HSV, CMV, vaccinia virus) and RNA (RSV, Rotavirus , SARS and Ebola virus) viruses.
- ST-336 A single cycle (24h) time of addition experiment was done to determine when during the virus replication cycle ST-336 exerts its antiviral activity.
- the effect of ST-336 on Tacaribe virus yield was determined following addition of compound to Vero cell cultures at various times before or after infection.
- ST-336 was added at one hour before infection (-Ih), during virus adsorption (Oh), and at several times post-infection. Drug was kept, following sequential addition, on infected cell cultures for the entire time of the experiment. Control infected cultures were treated with drug vehicle (DMSO) only.
- DMSO drug vehicle
- Tacaribe virus was incubated in a test tube with 5 ⁇ M of ST-336 or DMSO. Serial 1:10 dilutions were performed and for some samples ST-336 was added as a specified dilution representing the concentration of drug expected following sample dilution. As virus and compound are diluted with media, the compound concentration will reach a concentration without an inhibitory effect, unless the compound was capable of binding to virus. Test virus without compound in the initial tube was also diluted in media and compound concentrations corresponding to that found in the tubes where virus and compound were diluted together was added to each virus dilution.
- RNA viruses The expected mutation rate of RNA viruses is very high ( ⁇ 1 mutant in 10,000) and a common approach to determining the target of an antiviral is to isolate virus resistance to the antiviral and then map the site of resistance.
- Virus variants with reduced susceptibility to ST-336 were isolated from wild type Tacaribe virus stocks plated in the presence of ST-336.
- the observed frequency of ST-336 drug resistant (ST-336 DR ) variants was as expected for RNA viruses.
- Sixteen ST-336 DR isolates from four independent wild type Tacaribe virus stocks were isolated and plaque purified three times. All ST-336 DR isolates were tested for their ability to grow in the presence of ST- 336.
- ST-336 DR isolates The growth of ST-336 DR isolates was unaffected by the presence of ST-336 at concentrations that completely inhibited wild type Tacaribe virus replication (data not shown). The isolation and confirmation of drug resistant virus variants strongly suggest that ST-336 acts as a direct antiviral inhibitor.
- the entire glycoprotein precursor GPC region of the S segment was sequenced. Sequence analysis was performed on four wild type isolates (WT#l-4) and four ST-336 DR isolates derived from drug selection applied to each corresponding parental wild type isolate (DR#1.1 from WT#1 , DR#2.1 from WT#2, DR#3.1 from WT#3 and DR#4.1 from WT#4). The sequence analysis showed that the GPC gene from the four parental wild type isolates had identical sequences.
- FIG. 4A shows the location of each of the mutations which are located in or around the transmembrane domain of GP2.
- the sequence alignments of the region of the GP2 containing the changes is presented in Fig. 4B.
- the single change in DR#1.1 was at amino acid position 418 (1418T), in DR#2.1 at amino acid 416 (T416N), in DR#3.1 at amino acid 433 (S433I) and in DR#4.1 at amino acid 436 (F436I).
- 1418 is similarly conserved (I or L, but never a T) in all clade B New World arenavirus, while T416 is conserved among all clade B NWA.
- F436 is similarly conserved with one exception; Amapari virus encodes a leucine at position 436. This change in Amapari virus may explain its lack of susceptibility to ST-336 (Table 2). 1418, T416, S433 and F436 lie near the N-terminal and C-terminal limits of the putative transmembrane domain of GP2, a region known to play a vital role in enveloped virus fusion.
- Lead optimization activities comprised a series of iterations involving design and chemical synthesis of analogs of the lead structure, followed by a series of biological, physiochemical, and pharmacological evaluations of the new compounds.
- Chemical analogs flowed through a compound evaluation paradigm that involved first in vitro virological and cytotoxicity assessments, followed by a series of evaluations as listed: in vitro metabolic stability (S9), solubility, exploratory bacterial mutagenesis and pharmacokinetic assessments.
- S9 in vitro metabolic stability
- solubility solubility
- exploratory bacterial mutagenesis pharmacokinetic assessments.
- 165 analogues were prepared and the most potent were examined for in vitro metabolism in S9 liver extracts. The most stable were dosed in rats, and ST-294 emerged as a potent, orally bioavailable representative of the compounds. Characterization of ST-294
- ST-294 N-2-(l,l,l,3,3,3-hexafluoro-l-methyl ⁇ ropyl)-2-[(4- difluoromethoxyphenyl)sulfonyl]hydrazine-l-carboxamide
- Fig. 5 The structure of ST-294 (N-2-(l,l,l,3,3,3-hexafluoro-l-methyl ⁇ ropyl)-2-[(4- difluoromethoxyphenyl)sulfonyl]hydrazine-l-carboxamide) is show in Fig. 5.
- ST-294 was tested against the drug resistant Tacaribe mutants generated with ST-336 (DR#l-4) and all of the mutants elicited cross-resistance to ST-294 suggesting that this compound is targeting the same area of GP2 as ST-336 (data not shown).
- the activity of ST-294 against Tacaribe, Machupo, Guanarito, and Junin viruses was similar to that seen with ST-3
- the CC 50 of ST-294 on Vero cells is >50 ⁇ M yielding a selective index of >416. Further characterization of ST-294 showed that this compound is soluble up to 23 ⁇ M in media containing 10% fetal calf serum and up to 480 ⁇ M in buffer at pH 7.4 (Table 3).
- the metabolic stability of ST-294 was tested in S9 liver extracts from rat, mouse, human, and guinea pigs and was found to be most stable in human S9 followed by mouse, rat and guinea pig respectively (Table 3). Analysis of the oral pharmacokinetics of ST-294 was initially performed in the rat as this species is well characterized for this type of study.
- Solubility (0%, 2%, 10% FBS) 18, 21 and 23uM
- ST-294 is a promising and appropriate drug candidate to advance into definitive animal studies where guinea pigs and primates will be challenged with authentic NWA (Junfn and Guanarito viruses) and treated at various times post infection and prophylatically with ST-294. Discussion
- a NWA antiviral drug candidate ST-294
- This drug potently and selectively inhibits NWA viruses in vitro including the 3 NIAID/CDC Category A viruses (Junin, Machupo, and Guanarito viruses).
- This compound was also evaluated for stability in S9 liver extracts and for it's pharmacokinetic properties and was found to be metabolically stable and orally bioavailable.
- ST-294 showed significant protection against Tacaribe virus induced disease in newborn mice. Through mechanism of action studies it is apparent that this series of compounds targets GP2 and are viral entry inhibitors.
- ST-294 Since ST-294 has better S9 stability than ST-336 does, it is thought that metabolism occurs at the methyl group on the aromatic ring (FIG. 1). The benzylic position is susceptible to oxidation. When there is no benzylic hydrogen present as in ST-294 (FIG. 2), the oxidation is blocked and thus eliminates the fastest metabolism pathway. The addition of the difluoromethoxy group in ST-294 gave this compound increased S9 stability, but did not reduce antiviral activity.
- mice appear to die of a neurological disease (indicated by hind quarter paralysis) and it is not known whether ST-294 can cross the blood brain barrier. Also the drug levels and half-life of this drug candidate given IP in newborn mice is not as good as oral dosing in rats so serum levels and compound getting to the brain may have compromised the ability to obtain complete protection in this model.
- the more appropriate animal models for hemorrhagic fever caused by arenaviruses are in guinea pigs and non-human primates where the virus replicates predominantly in the spleen, lymph nodes and bone marrow causing hemorrhagic diathesis.
- Guinea pig models are well established for Junin, Machupo, and Guanarito virus diseases, and represent the best small animal model for evaluation during preclinical studies. 26 ' 34 Guinea pigs infected with pathogenic strains of Junin virus develop a fatal disease akin to human AHF. 37
- transmembrane in the function of viral fusion proteins.
- influenza virus hemagglutinin it is clear that a transmemebrane anchor is required for full fusion activity.
- specific sequence requirements within the trasmembrane domain have been identified, for example, in human immunodeficiency virus (HIV) type 1 , murine leukemia virus, foamy viruses, coronavirus, Newcastle disease virus and measles virus.
- HIV human immunodeficiency virus
- the ST-336 class of compounds targets the GP2 envelope protein, with mutations eliciting reduced susceptibility to the drug arising in or around the transmembrane region (FIG. 4).
- Enfuvirtide (Fuzeon) is a potent fusion inhibitor that blocks formation of the six-helix bundle and thus prevents membrane fusion. 29 Enfuvirtide has been successful in improving the virological and immunological response in treatment-experienced HW- infected patients.
- ST-294 also has the potential for prophylactic use since this drug appears to bind to the virus (FIG. 3) and would prevent infection.
- Other virus entry inhibitors have demonstrated protection when given prophylactically. This is an indication that can be pursued to determine its feasibility.
- ST-294 is a potent specific inhibitor of New World arenaviruses including the Category A hemorrhagic fever viruses (Junin, Machupo, and Guanarito). More importantly, the target of ST-294 (virus entry into the cell) serves as a viable target for antiviral development. Since virus infection can be completely inhibited at concentrations in the nanomolar range, the target for ST-294 would seem to be both accessible and extremely sensitive to reagents that disrupt its role in the infection process. Therefore, it will be important to further define the mechanism involved in ST-294 mediated inhibition.
Landscapes
- Chemical & Material Sciences (AREA)
- Health & Medical Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Animal Behavior & Ethology (AREA)
- Medicinal Chemistry (AREA)
- Pharmacology & Pharmacy (AREA)
- General Health & Medical Sciences (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- Epidemiology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Engineering & Computer Science (AREA)
- Dispersion Chemistry (AREA)
- Otolaryngology (AREA)
- Pulmonology (AREA)
- Dermatology (AREA)
- Virology (AREA)
- Oncology (AREA)
- Chemical Kinetics & Catalysis (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Communicable Diseases (AREA)
- Molecular Biology (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Nitrogen- Or Sulfur-Containing Heterocyclic Ring Compounds With Rings Of Six Or More Members (AREA)
- Pyridine Compounds (AREA)
- Heterocyclic Carbon Compounds Containing A Hetero Ring Having Nitrogen And Oxygen As The Only Ring Hetero Atoms (AREA)
- Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
- Organic Low-Molecular-Weight Compounds And Preparation Thereof (AREA)
- Heterocyclic Compounds That Contain Two Or More Ring Oxygen Atoms (AREA)
- Thiazole And Isothizaole Compounds (AREA)
Priority Applications (11)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CA002590962A CA2590962A1 (en) | 2004-12-06 | 2005-12-06 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| AU2005314252A AU2005314252B2 (en) | 2004-12-06 | 2005-12-06 | Compounds and methods for treating hemorrhagic fever viruses |
| EP05852986A EP1827446A4 (en) | 2004-12-06 | 2005-12-06 | SULFONYL SEMICARBAZIDES, SEMICARBAZIDES AND URETINS, PHARMACEUTICAL COMPOSITIONS THEREOF AND METHOD FOR TREATING HEMORRHAGIC FEVER VIRUSES, INCLUDING INFECTIONS WITH ARENA VIRUSES |
| JP2007544594A JP5285276B2 (ja) | 2004-12-06 | 2005-12-06 | アレナウイルスに関連した感染をはじめとする出血熱ウイルスを処置するための、スルホニルセミカルバジド、セミカルバジドおよび尿素、その医薬組成物および方法 |
| US11/791,926 US8642596B2 (en) | 2004-12-06 | 2005-12-06 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses |
| US11/653,972 US7994221B2 (en) | 2004-12-06 | 2007-01-17 | Sulfonyl semicarbazides, carbonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US12/925,702 US8658697B2 (en) | 2004-12-06 | 2010-10-26 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US12/914,400 US8410149B2 (en) | 2004-12-06 | 2010-10-28 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US13/176,866 US8664274B2 (en) | 2004-12-06 | 2011-07-06 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses |
| US13/777,630 US9115065B2 (en) | 2004-12-06 | 2013-02-26 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with Arenaviruses |
| US14/134,165 US9067873B2 (en) | 2004-12-06 | 2013-12-19 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US63299004P | 2004-12-06 | 2004-12-06 | |
| US60/632,990 | 2004-12-06 |
Related Child Applications (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/791,926 A-371-Of-International US8642596B2 (en) | 2004-12-06 | 2005-12-06 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses |
| US11/653,972 Continuation-In-Part US7994221B2 (en) | 2004-12-06 | 2007-01-17 | Sulfonyl semicarbazides, carbonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US12/914,400 Continuation-In-Part US8410149B2 (en) | 2004-12-06 | 2010-10-28 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US14/134,165 Division US9067873B2 (en) | 2004-12-06 | 2013-12-19 | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2006062898A2 true WO2006062898A2 (en) | 2006-06-15 |
| WO2006062898A3 WO2006062898A3 (en) | 2007-06-07 |
Family
ID=36578452
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/043931 Ceased WO2006062898A2 (en) | 2004-12-06 | 2005-12-06 | Compounds and methods for treating hemorrhagic fever viruses |
Country Status (6)
| Country | Link |
|---|---|
| US (2) | US8642596B2 (enExample) |
| EP (1) | EP1827446A4 (enExample) |
| JP (1) | JP5285276B2 (enExample) |
| AU (1) | AU2005314252B2 (enExample) |
| CA (1) | CA2590962A1 (enExample) |
| WO (1) | WO2006062898A2 (enExample) |
Cited By (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2124921A4 (en) * | 2007-01-17 | 2010-04-14 | Siga Technologies Inc | SULFONYL SEMI-CARBAZIDES, CARBONYL SEMI-CARBAZIDS, SEMI-CARBAZIDS AND UREA, PHARMACEUTICAL COMPOSITIONS THEREOF, AND PROCESS FOR TREATING HEMORRHAGIC FEVER VIRUSES, INCLUDING ARENAVIRUS-ASSOCIATED INFECTIONS |
| US7872037B2 (en) | 2006-03-02 | 2011-01-18 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| EP1984379A4 (en) * | 2006-02-01 | 2011-05-18 | Siga Technologies Inc | ANTI-ARENAVIRAL COMPOUNDS |
| US7977365B2 (en) | 2006-03-02 | 2011-07-12 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US8148428B2 (en) | 2006-03-02 | 2012-04-03 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US8410149B2 (en) | 2004-12-06 | 2013-04-02 | Siga Technologies Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| WO2013022550A3 (en) * | 2011-08-10 | 2013-04-25 | President And Fellows Of Harvard College | Small molecule inhibitors of ebola and lassa fever viruses |
| US8461177B2 (en) | 2007-08-27 | 2013-06-11 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US8518960B2 (en) | 2007-05-23 | 2013-08-27 | Siga Technologies, Inc. | Antiviral drugs for treatment or prevention of dengue infection |
| US8642596B2 (en) | 2004-12-06 | 2014-02-04 | Siga Technologies, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses |
| US8791110B2 (en) | 2006-02-01 | 2014-07-29 | Siga Technologies, Inc. | Anti-arenaviral compounds |
| US8871746B2 (en) | 2006-03-02 | 2014-10-28 | Kineta Four, LLC | Antiviral drugs for treatment of arenavirus infection |
| US11629139B2 (en) | 2017-09-08 | 2023-04-18 | President And Fellows Of Harvard College | Small molecule inhibitors of Ebola and Lassa fever viruses and methods of use |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101034257B (zh) * | 2007-04-06 | 2010-09-08 | 上海复旦天臣新技术有限公司 | 用于全息记录的感光薄膜及其制备方法 |
| WO2012060820A1 (en) * | 2010-11-02 | 2012-05-10 | Siga Technologies, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| EP0133988A2 (de) | 1983-08-02 | 1985-03-13 | Hoechst Aktiengesellschaft | Regulatorische Peptide enthaltende pharmazeutische Präparate mit protrahierter Freisetzung und Verfahren zu deren Herstellung |
| US5023252A (en) | 1985-12-04 | 1991-06-11 | Conrex Pharmaceutical Corporation | Transdermal and trans-membrane delivery of drugs |
Family Cites Families (38)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| DE3709574A1 (de) | 1987-03-24 | 1988-10-06 | Bayer Ag | Substituierte triazolinone |
| US5625073A (en) * | 1987-06-12 | 1997-04-29 | Bayer Aktiengesellschaft | Herbicidal substituted triazolinones |
| DE3803523A1 (de) * | 1987-06-12 | 1988-12-22 | Bayer Ag | Substituierte triazolinone |
| US5182303A (en) * | 1988-12-27 | 1993-01-26 | E. I. Du Pont De Nemours And Company | Substituted semicarbazone arthropodicides |
| US5194084A (en) * | 1989-05-18 | 1993-03-16 | Bayer Aktiengesellschaft | Herbicidal substituted triazolones |
| DE3916208A1 (de) | 1989-05-18 | 1990-11-22 | Bayer Ag | Substituierte triazolone |
| US5534486A (en) * | 1991-04-04 | 1996-07-09 | Bayer Aktiengesellschaft | Herbicidal sulphonylaminocarbonyl triazolinones having substituents bonded via oxygen |
| DE4111394A1 (de) * | 1991-04-09 | 1992-10-15 | Behringwerke Ag | Amidinophenylalaninderivate, verfahren zu deren herstellung, deren verwendung und diese enthaltende mittel |
| WO1995033719A1 (en) | 1994-06-02 | 1995-12-14 | Zeneca Limited | Substituted pyrrolidone, thiazolidones or oxazolidones as herbicides |
| US5814442A (en) * | 1994-06-10 | 1998-09-29 | Georgetown University | Internally controlled virion nucleic acid amplification reaction for quantitation of virion and virion nucleic acid |
| US6610683B2 (en) * | 1996-09-12 | 2003-08-26 | Idun Pharmaceuticals, Inc. | Treatment of infectious disease using interleukin-1β-converting enzyme (ICE)/CED-3 family inhibitors |
| US5945446A (en) * | 1997-02-10 | 1999-08-31 | Laubc Biochemicals, Corporation | Process for preparing synthetic soil-extract materials and medicaments based thereon |
| US6524567B2 (en) * | 1997-02-10 | 2003-02-25 | Laub Biochemicals Corp. | Synthetic soil-extract materials and medicaments for hemorrhagic fever viruses based thereon |
| US5904857A (en) * | 1997-04-17 | 1999-05-18 | Nalco Chemical Company | 4-alkyl and aryl semicarbazides as oxygen scavengers |
| AU1361499A (en) | 1997-10-21 | 1999-05-10 | Merck & Co., Inc. | Azapeptide acids as cell adhesion inhibitors |
| JPH11240859A (ja) | 1997-12-26 | 1999-09-07 | Nippon Bayer Agrochem Co Ltd | フルオロ置換ベンゾイルウレア類及び有害生物防除剤 |
| CA2370030C (en) * | 1999-04-09 | 2007-08-14 | Euro-Celtique S.A. | Sodium channel blocker compositions and the use thereof |
| US7244721B2 (en) * | 2000-07-21 | 2007-07-17 | Schering Corporation | Peptides as NS3-serine protease inhibitors of hepatitis C virus |
| US7335779B2 (en) * | 2002-03-08 | 2008-02-26 | Quonova, Llc | Modulation of pathogenicity |
| US20040077607A1 (en) * | 2002-10-21 | 2004-04-22 | Uckun Fatih M. | Aryl phosphate derivatives of d4T with potent anti-viral activity against hemorrhagic fever viruses |
| WO2004096197A2 (en) | 2003-05-02 | 2004-11-11 | Universita Degli Studi Di Cagliari | 5-aza-7-deazapurine nucleosides for treating flaviviridae |
| US8039504B2 (en) * | 2003-06-20 | 2011-10-18 | Siga Technologies, Inc. | Chemicals, compositions, and methods for treatment and prevention of orthopoxvirus infections and associated diseases |
| AU2004249250C1 (en) | 2003-06-20 | 2012-04-12 | Siga Technologies, Inc. | Compounds, compositions and methods for treatment and prevention of orthopoxvirus infections and associated diseases |
| US7737168B2 (en) * | 2003-06-20 | 2010-06-15 | Siga Technologies, Inc. | Compounds, compositions, and methods for treatment and prevention of orthopoxvirus infections and associated diseases |
| US7687641B2 (en) * | 2003-06-20 | 2010-03-30 | Siga Technologies, Inc. | Chemicals, compositions, and methods for treatment and prevention of orthopoxvirus infections and associated diseases |
| DE10348023A1 (de) | 2003-10-15 | 2005-05-19 | Imtm Gmbh | Neue Alanyl-Aminopeptidasen-Inhibitoren zur funktionellen Beeinflussung unterschiedlicher Zellen und zur Behandlung immunologischer, entzündlicher, neuronaler und anderer Erkrankungen |
| US8410149B2 (en) * | 2004-12-06 | 2013-04-02 | Siga Technologies Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| AU2005314252B2 (en) | 2004-12-06 | 2012-09-27 | Siga Technologies, Inc. | Compounds and methods for treating hemorrhagic fever viruses |
| US7994221B2 (en) * | 2004-12-06 | 2011-08-09 | Siga Technologies, Inc. | Sulfonyl semicarbazides, carbonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US8106058B2 (en) * | 2006-02-01 | 2012-01-31 | Siga Technologies, Inc. | Anti-arenaviral compounds |
| WO2007100888A2 (en) | 2006-03-02 | 2007-09-07 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| JP5380078B2 (ja) | 2006-03-02 | 2014-01-08 | サイガ・テクノロジーズ・インコーポレーテッド | アレナウイルス感染の治療のための抗ウイルス薬剤 |
| US7977365B2 (en) * | 2006-03-02 | 2011-07-12 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US8518960B2 (en) | 2007-05-23 | 2013-08-27 | Siga Technologies, Inc. | Antiviral drugs for treatment or prevention of dengue infection |
| ES2424214T3 (es) | 2007-08-27 | 2013-09-30 | Siga Technologies, Inc. | Medicamentos antivirales para el tratamiento de una infección por Arenavirus |
| CA2712071A1 (en) | 2008-01-15 | 2009-10-08 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| MX338530B (es) | 2008-06-03 | 2016-04-21 | Siga Technologies Inc | Inhibidores de molecula pequeña para el tratamiento o prevencion de infeccion de virus del dengue. |
| WO2012060820A1 (en) | 2010-11-02 | 2012-05-10 | Siga Technologies, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
-
2005
- 2005-12-06 AU AU2005314252A patent/AU2005314252B2/en not_active Ceased
- 2005-12-06 WO PCT/US2005/043931 patent/WO2006062898A2/en not_active Ceased
- 2005-12-06 EP EP05852986A patent/EP1827446A4/en not_active Withdrawn
- 2005-12-06 JP JP2007544594A patent/JP5285276B2/ja not_active Expired - Fee Related
- 2005-12-06 US US11/791,926 patent/US8642596B2/en not_active Expired - Fee Related
- 2005-12-06 CA CA002590962A patent/CA2590962A1/en not_active Abandoned
-
2013
- 2013-12-19 US US14/134,165 patent/US9067873B2/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US3773919A (en) | 1969-10-23 | 1973-11-20 | Du Pont | Polylactide-drug mixtures |
| EP0133988A2 (de) | 1983-08-02 | 1985-03-13 | Hoechst Aktiengesellschaft | Regulatorische Peptide enthaltende pharmazeutische Präparate mit protrahierter Freisetzung und Verfahren zu deren Herstellung |
| US5023252A (en) | 1985-12-04 | 1991-06-11 | Conrex Pharmaceutical Corporation | Transdermal and trans-membrane delivery of drugs |
Non-Patent Citations (41)
| Title |
|---|
| AWLS, W. E.; BANERJEE, S.N.; MCMILLAN, C. A.; BUCHMEIER, M. J.: "Inhibition of Pichinde virus replication by actinomycin D", J. GEN. V ., vol. 33, no. 3, 1976, pages 421 - 434 |
| BAGAI, S.; LAMB, R. A., J. CELLB ., vol. 135, 1996, pages 73 - 84 |
| BEYER, W. R. ET AL., J. V ROL., vol. 77, 2003, pages 2866 - 72 |
| BOWEN, M. D. ET AL., VIROLOGY, vol. 219, 1996, pages 285 - 90 |
| CANDURRA, N. A.; MASKIN, L.; PAMONTE, E.B.: "Inhibition ofarenavirus multiplication in vitro byphenotiazines", I R ., vol. 31, no. 3, 1996, pages 149 - 158 |
| CASTAGNA, A. ET AL., DRUGS, vol. 65, 2005, pages 879 - 904 |
| CHILDS, J. E.; PETERS, C. J.: "The Arenaviridae", 1993, PLENUM PRESS, pages: 331 - 84 |
| CIANCI, C. ET AL., A IMICROB AGENTS CH MOTH R, vol. 48, 2004, pages 2448 - 54 |
| CLEGG, J. C., C TOP M IM, vol. 262, 2002, pages 1 - 24 |
| CLEGG, J.C.S.; BOWEN, M.D. ET AL.: "Virus Taxonomy. Seven Report of the International Committee for the Taxonomy of Viruses", 2000, ACADEMIC PRESS, article "Arenavirideal", pages: 633 - 640 |
| ENRIA, D. A.; FEUILLADE, M. R.; LEVIS, S.; BRIGGILER, A. M.; ANIBROSIO, A. M.; SAAVEDRA, M. C; BECKER, J. L.; AVILES, G.; GARCIA,: "FACTORS IN THE EMERGENCE AND CONTROL FOR RODENT-BORNE VIRAL DISEASES", 1999, ELSEVIER, article "Impact of vaccination of a high-risk population for Argentine hemorrhagic fever with a live-attenuated Junin virus vaccine in Saluzzo", pages: 273 - 279 |
| ENRIA, D.A.; MAIZTEGUI, J.I.: "Antiviral treatment ofArgentine Hemorrhagic Fever", AN IVIRAL RES., vol. 23, 1994, pages 23 - 31, XP023702740, DOI: doi:10.1016/0166-3542(94)90030-2 |
| FROESCHKE, M. ET AL., J. B C ., vol. 278, 2003, pages 41914 - 20 |
| GARCIA, C. C. ET AL., ANTIVIR CHEM CHEMOTHER, vol. 11, 2000, pages 231 - 7 |
| GLUSHAKOVA, S. E.; LAKUBA, A. I.; VASIUCHKOV, AP.; MAR'IANKOVA, R. F.; KUKAREKO, T. M.; STEL'MAKH, T.A.; KURASH, T. P.; LUKASHEVIC: "Lysosomotropic agents inhibit the penetration of arenavirus into a culture of BHK-21 andvero cells", V V II, vol. 35, no. 2, 1990, pages 146 - 150 |
| HALL, W. C. ET AL., AM J TROP MED HYG, vol. 55, 1996, pages 81 - 8 |
| HARMAN, A. ET AL., J V, vol. 76, 2002, pages 10708 - 16 |
| HUGGINS, J.W.: "Prospects For Treatment Of Viral Hemorrhagic Fevers With Ribavirin, A Broad-Spectrum Antiviral Drug", REV. INFECT. DIS., vol. LL, no. 4, 1989, pages 8750 - S761 |
| JEETENDRA, E. ET AL., J V, vol. 77, 2003, pages 12807 - 18 |
| KILGORE, P. E.; KSIAZEK, T. G.; ROLLIN, P. E. ET AL.: "Treatment of Bolivian Hemorrhagic Fever with intravenous ribavirin", CLIN. INFECT. PIS., vol. 24, 1997, pages 718 - 722 |
| KINOMOTO, M. ET AL., J VIROL, vol. 79, 2005, pages 5996 - 6004 |
| KUNZ, S. ET AL., VIROLOGY, vol. 314, 2003, pages 168 - 78 |
| LANGER ET AL., J. BIOMED. MATER. RES., vol. 15, 1981, pages 167 - 277 |
| LANGER, CHEM. TECH., vol. 12, 1982, pages 98 - 105 |
| LEIFER, E.; GOCKE, D.J. ET AL.: "Report of a laboratory-acquired infection treated with plasma from a person recently recovered from the disease", A . J. T . M . H ., vol. 19, 1970, pages 677 - 679 |
| LENZ, O. ET AL., PROC NATL ACADSCIUSA, vol. 98, 2001, pages 12701 - 5 |
| MARON, M. D.; AMES, B. N., MU R S, vol. 113, 1983, pages 173 - 215 |
| MCCORMICK, J. B.: "Epidemiology and control of Lassa fever", C . TOP. M I ., vol. 134, 1987, pages 69 - 78 |
| MCCORMICK, J.B.; KING, I.J.; WEBB, P.A. ET AL.: "Lassa Fever: Effective therapy with Ribavirin", N. E . J. M ., vol. 314, 1986, pages 20 - 26, XP008130768 |
| OLDFIELD, V. ET AL., DRUGS, vol. 65, 2005, pages 1139 - 60 |
| PETERS, C. J. ET AL., C TOP M L I L, vol. 134, 1987, pages 5 - 68 |
| PETKEVICH, A. S. ET AL., VOP VI SOL, 1981, pages 244 - 5 |
| PETKEVICH, A. S.; SABYNIN, V. M.; LEMESHKO, N. N.; LUKASHEVICH, I. S.; BELORUSS, N.: "Study of the effect ofrimantadine on the reproduction of several arenaviruses", EPIDEMIOL. MIKROBIOL., 1982, pages 138 - 143 |
| See also references of EP1827446A4 |
| SIDMAN ET AL., BIOPOLYMERS, vol. 22, 1983, pages 547 - 556 |
| SOUTHERN, P. J., VIROLOGY, vol. 2, 2001, pages 1505 - 51 |
| T. W. GREENE; G. M. WUTS: "Protecting Groups in Organic Synthesis, Second Edition,", 1991, WILEY |
| WACHSMAN, M. B.; LOPEZ, E. M. F.; RAMIREZ, J. A.; GALAGOVSKY, L. R.; COTO, C. E.: "Antiviral effect ojbrassinosteroids against herpes virus and arenavirus", ANTIVIRAL. CHEM. CHEMO ., vol. 11, no. 1, 2000, pages 71 - 77 |
| WEISSENBACHER, M. C. ET AL., INFECT I, vol. 35, 1982, pages 425 - 30 |
| WEST, J. . ET AL., J V, vol. 75, 2001, pages 9601 - 12 |
| YAO, Q.; COMPANS, R. W., J V, vol. 69, 1995, pages 7045 - 53 |
Cited By (28)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US9115065B2 (en) | 2004-12-06 | 2015-08-25 | Kineta, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with Arenaviruses |
| US9067873B2 (en) | 2004-12-06 | 2015-06-30 | Kineta Four, LLC | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US7994221B2 (en) | 2004-12-06 | 2011-08-09 | Siga Technologies, Inc. | Sulfonyl semicarbazides, carbonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US8664274B2 (en) | 2004-12-06 | 2014-03-04 | Siga Technologies, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses |
| US8410149B2 (en) | 2004-12-06 | 2013-04-02 | Siga Technologies Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US8658697B2 (en) | 2004-12-06 | 2014-02-25 | Siga Technologies, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses |
| US8642596B2 (en) | 2004-12-06 | 2014-02-04 | Siga Technologies, Inc. | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses |
| US8518951B2 (en) | 2006-02-01 | 2013-08-27 | Siga Technologies, Inc. | Anti-arenaviral compounds |
| EP1984379A4 (en) * | 2006-02-01 | 2011-05-18 | Siga Technologies Inc | ANTI-ARENAVIRAL COMPOUNDS |
| US8791110B2 (en) | 2006-02-01 | 2014-07-29 | Siga Technologies, Inc. | Anti-arenaviral compounds |
| US8106058B2 (en) | 2006-02-01 | 2012-01-31 | Siga Technologies, Inc. | Anti-arenaviral compounds |
| US8148428B2 (en) | 2006-03-02 | 2012-04-03 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US9199920B2 (en) | 2006-03-02 | 2015-12-01 | Kineta Four, LLC | Antiviral drugs for treatment of arenavirus infection |
| US8492434B2 (en) | 2006-03-02 | 2013-07-23 | Siga Technologies Inc. | Antiviral drugs for treatment of arenavirus infection |
| US8629170B2 (en) | 2006-03-02 | 2014-01-14 | Siga Technologies, Inc. | Anti-viral drugs for treatment of arenavirus infection |
| US7872037B2 (en) | 2006-03-02 | 2011-01-18 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US8871746B2 (en) | 2006-03-02 | 2014-10-28 | Kineta Four, LLC | Antiviral drugs for treatment of arenavirus infection |
| US7977365B2 (en) | 2006-03-02 | 2011-07-12 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| EP2124921A4 (en) * | 2007-01-17 | 2010-04-14 | Siga Technologies Inc | SULFONYL SEMI-CARBAZIDES, CARBONYL SEMI-CARBAZIDS, SEMI-CARBAZIDS AND UREA, PHARMACEUTICAL COMPOSITIONS THEREOF, AND PROCESS FOR TREATING HEMORRHAGIC FEVER VIRUSES, INCLUDING ARENAVIRUS-ASSOCIATED INFECTIONS |
| JP2010526025A (ja) * | 2007-01-17 | 2010-07-29 | サイガ・テクノロジーズ・インコーポレーテッド | スルホニルセミカルバジド、カルボニルセミカルバジド、セミカルバジドおよび尿素、その薬学的組成物、ならびにアレナウイルスに関連する感染を含む、出血熱ウイルスを治療するための方法。 |
| US8518960B2 (en) | 2007-05-23 | 2013-08-27 | Siga Technologies, Inc. | Antiviral drugs for treatment or prevention of dengue infection |
| US9353051B2 (en) | 2007-05-23 | 2016-05-31 | Siga Technologies, Inc. | Antiviral drugs for treatment or prevention of dengue infection |
| US8754082B2 (en) | 2007-08-27 | 2014-06-17 | Siga Technologies, Inc. | Antiviral drugs for treatment of Arenavirus infection |
| US8461177B2 (en) | 2007-08-27 | 2013-06-11 | Siga Technologies, Inc. | Antiviral drugs for treatment of arenavirus infection |
| US9096597B2 (en) | 2007-08-27 | 2015-08-04 | Kineta Four, LLC | Antiviral drugs for treatment of Arenavirus infection |
| WO2013022550A3 (en) * | 2011-08-10 | 2013-04-25 | President And Fellows Of Harvard College | Small molecule inhibitors of ebola and lassa fever viruses |
| US9452992B2 (en) | 2011-08-10 | 2016-09-27 | President And Fellows Of Harvard College | Small molecule inhibitors of ebola and lassa fever viruses |
| US11629139B2 (en) | 2017-09-08 | 2023-04-18 | President And Fellows Of Harvard College | Small molecule inhibitors of Ebola and Lassa fever viruses and methods of use |
Also Published As
| Publication number | Publication date |
|---|---|
| AU2005314252B2 (en) | 2012-09-27 |
| EP1827446A2 (en) | 2007-09-05 |
| EP1827446A4 (en) | 2011-01-12 |
| AU2005314252A1 (en) | 2006-06-15 |
| US20090203675A1 (en) | 2009-08-13 |
| WO2006062898A3 (en) | 2007-06-07 |
| US9067873B2 (en) | 2015-06-30 |
| US20140275037A1 (en) | 2014-09-18 |
| JP2008524119A (ja) | 2008-07-10 |
| US8642596B2 (en) | 2014-02-04 |
| JP5285276B2 (ja) | 2013-09-11 |
| CA2590962A1 (en) | 2006-06-15 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8664274B2 (en) | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arena viruses | |
| US9067873B2 (en) | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses | |
| US7977365B2 (en) | Antiviral drugs for treatment of arenavirus infection | |
| US8629170B2 (en) | Anti-viral drugs for treatment of arenavirus infection | |
| EP2182805B1 (en) | Antiviral drugs for treatment of arenavirus infection | |
| US9199920B2 (en) | Antiviral drugs for treatment of arenavirus infection | |
| JP2017538676A (ja) | ミトコンドリア透過性遷移孔(mtPTP)の小分子阻害剤 | |
| WO2012060820A1 (en) | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with arenaviruses | |
| US9115065B2 (en) | Sulfonyl semicarbazides, semicarbazides and ureas, pharmaceutical compositions thereof, and methods for treating hemorrhagic fever viruses, including infections associated with Arenaviruses | |
| US8871746B2 (en) | Antiviral drugs for treatment of arenavirus infection | |
| US8791110B2 (en) | Anti-arenaviral compounds |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KN KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2005314252 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2590962 Country of ref document: CA Ref document number: 2007544594 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| ENP | Entry into the national phase |
Ref document number: 2005314252 Country of ref document: AU Date of ref document: 20051206 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005314252 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005852986 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005852986 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11791926 Country of ref document: US |