WO2006046492A1 - Nouvel agent régulant les ppar et procédé de recherche par criblage de celui-ci - Google Patents

Nouvel agent régulant les ppar et procédé de recherche par criblage de celui-ci Download PDF

Info

Publication number
WO2006046492A1
WO2006046492A1 PCT/JP2005/019431 JP2005019431W WO2006046492A1 WO 2006046492 A1 WO2006046492 A1 WO 2006046492A1 JP 2005019431 W JP2005019431 W JP 2005019431W WO 2006046492 A1 WO2006046492 A1 WO 2006046492A1
Authority
WO
WIPO (PCT)
Prior art keywords
ppar
substituted
activity
group
seq
Prior art date
Application number
PCT/JP2005/019431
Other languages
English (en)
Japanese (ja)
Inventor
Iichiro Shimomura
Original Assignee
Osaka University
Intellectual Property Consulting Incorporated
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Osaka University, Intellectual Property Consulting Incorporated filed Critical Osaka University
Publication of WO2006046492A1 publication Critical patent/WO2006046492A1/fr

Links

Classifications

    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/74—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing involving hormones or other non-cytokine intercellular protein regulatory factors such as growth factors, including receptors to hormones and growth factors
    • G01N33/743—Steroid hormones
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K31/00—Medicinal preparations containing organic active ingredients
    • A61K31/64—Sulfonylureas, e.g. glibenclamide, tolbutamide, chlorpropamide
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/04—Drugs for disorders of the alimentary tract or the digestive system for ulcers, gastritis or reflux esophagitis, e.g. antacids, inhibitors of acid secretion, mucosal protectants
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00—Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/18—Drugs for disorders of the alimentary tract or the digestive system for pancreatic disorders, e.g. pancreatic enzymes
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P15/00—Drugs for genital or sexual disorders; Contraceptives
    • A61P15/08—Drugs for genital or sexual disorders; Contraceptives for gonadal disorders or for enhancing fertility, e.g. inducers of ovulation or of spermatogenesis
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P17/00—Drugs for dermatological disorders
    • A61P17/06—Antipsoriatics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P25/00—Drugs for disorders of the nervous system
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P27/00—Drugs for disorders of the senses
    • A61P27/02—Ophthalmic agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/04—Anorexiants; Antiobesity agents
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/06—Antihyperlipidemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00—Drugs for disorders of the metabolism
    • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
    • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P9/00—Drugs for disorders of the cardiovascular system
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/042—Disorders of carbohydrate metabolism, e.g. diabetes, glucose metabolism
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2800/00—Detection or diagnosis of diseases
    • G01N2800/04—Endocrine or metabolic disorders
    • G01N2800/044—Hyperlipemia or hypolipemia, e.g. dyslipidaemia, obesity

Definitions

  • the present invention relates to diagnosis, treatment or prevention of a disease or disorder associated with a PPAR gene such as diabetes. More particularly, the present invention relates to screening for drugs for diagnosis, treatment or prevention of diseases associated with the PPAR gene. The present invention also provides the drug itself obtained thereby.
  • Sulfonylurea (SU) has been an effective oral hypoglycemic agent and has played a central role in the treatment of type 2 diabetes.
  • Sulfonylurea stimulates insulin secretion by binding to the sulfonylurea receptor (SUR) on the plasma membrane of knee ⁇ -cells (Non-Patent Document l: Gribble, FM, and Ashcroft, FM (2000 ) M etabolism 49, 3_6).
  • sulfonylureas include glimepiride and darribenclamide
  • glimepiride and darribenclamide have a direct effect on fat
  • sulfonylureas can be used in 3T3-L1 cells or isolated fat.
  • Peroxisome proliferator-activated receptor ⁇ is one of the important transcription factors that regulate glucose and lipid metabolism and lipogenesis (Non-Patent Document 2: Wu, Z. et al. 1998) J. Clin. Invest. 101, 22_32; Non-patent document 3: Tontonoz, P. et al. (1994) Genes Dev. 8, 1224-1234; Non-patent document 4: Tontonoz, P., Hu, E. , and Spiegelman, BM (1994) Cell 79, 1147-1156).
  • Thiazolidinedione (TZD) is another hypoglycemic agent that improves peripheral insulin resistance.
  • Thiazolidinedione is an effective PPAR gamma agonist, and the majority of its pharmacological action is the activity of PPAR gamma in adipocytes.
  • Non-patent document 5 Lehmann, JM et al (1995) J. Biol. Chem. 270, 12953-12956;
  • Non-patent document 6 Spiegelman, BM (1998) Diabetes 47, 507) -514).
  • Merck describes a new modulator of PPAR. However, this compound has been described for use in combination with other therapeutic agents for diabetes (for example, sulfonylurea agents). However, there is no description of compounds that both enhance the action of insulin (ie, increase sensitivity) and stimulate insulin secretion (activate spleen ⁇ cells) (patents) Reference 1).
  • Non-patent literature l Gribble, F. M. 'and Ashcroft, F. M. (2000) Metabolism 49, 3-6
  • Non-patent literature 2 Wu, Z. et al. (1998) J. Clin. Invest. 101, 22-32
  • Non-Patent Document 3 Tontonoz, P. et al. (1994) Genes Dev. 8, 1224-1234
  • Non-Patent Document 4 Tontonoz, P., Hu, Tsuji, and Spiegelman, B. M. (1994) Cell 79, 1147-11
  • Non-Patent Document 5 Lehmann, J. M. et al (1995) J. Biol. Chem. 270, 12953-12956
  • Non-Patent Document 6 Spiegelman, B. M. (1998) Diabetes 47, 507-514
  • Patent Document 1 WO2004 / 066963
  • an object of the present invention is to provide a method for screening a drug for treating diabetes more efficiently and a new compound for treating and preventing a disease associated with PPAR.
  • Sulfonylurea agents are widely used. Is an oral hypoglycemic agent that stimulates insulin secretion primarily by binding to the sulfonylurea receptor on the plasma membrane of presumptive beta cells.
  • Thiazolidinediones eg, thiazolidinediones
  • PPAR y peroxisome proliferator-activated receptor gamma
  • Glimepiride is a coactivator DRIP205 (abbreviation of vitamin D rec mark tor- interacting protein 205; accession number AF283812. Dr. David J.
  • N_CoR nuclear rece ptor corepressor
  • SMRT silencing medi at or for retinoid and thyroid hormone receptors
  • glimepiride bound directly to ⁇ R y in a manner that competes with rosiglitazone, a proven ligand for PPAR ⁇ . Furthermore, in 3T3-L1 adipocytes, glimepiride stimulates the transcriptional activity of gene promoters containing PPAR responsive elements (PPRE), and the mRNA levels of PPAR ⁇ target genes including aP2, leptin, and adiponectin. Changed. Finally, glimepiride induced adipocyte differentiation in 3T3-F442A cells. These 3T3-F442A cells were found to differentiate in a PPAR ⁇ agonist-dependent manner.
  • PPRE PPAR responsive elements
  • glimepiride and darribenclamide are agonists for PPAR y, but these capacities are 12--12 of the maximum values reached by pioglitazone. It was 20%.
  • glimepiride and darribenclamide could act not only on sulfonylurea receptor but also on PPAR ⁇ , the ideal anti-diabetes enhances insulin secretion of knee ⁇ -cells and insulin sensitivity at peripheral sites Clues for agent development can be given.
  • the present inventors studied the direct effect of sulfonylurea on PPAR ⁇ .
  • the inventors have found that glimepiride (which is one of the sulfonylurea agents) specifically induces PPARy transcriptional activity.
  • glimepiride was found to bind directly to PPAR 7 in a competitive manner with rosiglitazone.
  • 3T3 L1 gives a change in mRNA levels of PPAR 7 target gene in adipocytes, and was induced adipocyte fraction of the 3T3 F422A cells.
  • most of the effects observed with glimepiride were also reproduced with darivenclamide.
  • the present invention provides the following.
  • a peroxisome proliferator-activated receptor (PPAR) modulator comprising a sulfonylurea agent.
  • R and R are each independently hydrogen, alkyl, substituted
  • sulfonylurea agent is selected from the group consisting of glimepiride, darivenclamide, tonolebutamide, chlorpropamide, acetohexamide and daliclazide.
  • the PPAR modulator according to item 1 further having at least one activity selected from the group consisting of an activity of promoting insulin secretion activity and insulin sensitivity of spleen ⁇ cells.
  • the PPAR is represented by a SEQ ID NO selected from the group consisting of SEQ ID NO: 2 (NP-035276), SEQ ID NO: 4 (NP-619726), SEQ ID NO: 6 (NP_037256) and SEQ ID NO: 8 (AAB87480).
  • the above-mentioned PPAR modulators are: adipocyte differentiation; diabetes; hyperglycinemia ;; hypoglycolase tolerance; insulin resistance; obesity; steatosis; dyslipidemia; hyperlipidemia; Triglyceridemia; Hypercholesterolemia; Low HDL level; High LDL level; Atherosclerosis; Vascular stenosis; Irritable bowel syndrome; Inflammatory bowel disease; Crohn's disease; Neurodegenerative disease; retinopathy; psoriasis; metabolic syndrome; PPAR modulator used for the treatment of a disease selected from the group consisting of ovarian hyperandrogenism.
  • Activity to promote insulin secretion activity and peripheral insulin sensitivity of knee ⁇ -cells A method for identifying a compound having at least one activity selected from the group consisting of sex and having the ability to modulate PPAR, the method comprising:
  • R and R are each independently hydrogen, alkyl, substituted
  • the PPAR is an amino acid sequence represented by SEQ ID NO: 2 (NP_035276), SEQ ID NO: 4 (NP_619726), SEQ ID NO: 6 (NPJ337256) and SEQ ID NO: 8 (AAB87480). 13.
  • step C) includes a step of observing whether the candidate compound is provided and competes with the sulfonylurea agent or thiazolidinedione agent.
  • the insulin secretion activity of the knee cells is measured by directly measuring insulin secreted from the cells (J Pharmacol Exp Ther. 2004 Sep; 310 (3): 1273_80.), Item 12 the method of.
  • the activity of the PPAR is the activity of the candidate compound in a system comprising a nucleic acid construct comprising a nucleic acid sequence encoding a reporter operably linked to a transcription factor recognition sequence and the selected PPAR.
  • the candidate compound is determined to be an agonist of the PPAR, and when the expression of the reporter is decreased, the candidate compound is determined to be an antagonist of the PPAR.
  • Ii Means for measuring at least one activity selected from the group consisting of the ability to promote insulin secretory activity of the knee ⁇ -cells and peripheral insulin sensitivity for the candidate compound;
  • a system comprising:
  • a method for treating or preventing a disease associated with PPAR comprising:
  • sulfonylurea agent is selected from the group consisting of glimepiride, darivenclamide, tonolebutamide, chronolepropamide, acetohexamide and daliclazide.
  • sulfonylurea agent is selected from the group consisting of glimepiride, daribenclamide, tolptamide, chlorpropamide, acetohexamide and daliclazide.
  • the present invention provides a new screening method for searching for compounds for more effective treatment or prevention of diabetes.
  • the present invention also provides a new category of drugs related to PPAR.
  • FIG. 1A shows that glimepiride and darifenclamide are partial agonists for PPAR y.
  • HE K293 Itoda vesicles are transfected with GAL4—mouse PPAR y (mPPAR ⁇ ) and MHIOO (UAS)
  • X 4— tk—LUC reporter and treated with vehicle control (cont) or with sulfonylureas Processed.
  • FIG. 1 shows that glimepiride and darifenclamide are partial agonists for PPAR y.
  • B PPAR y concentration-dependent activation by pioglitazone.
  • HEK293 cells were co-transferred with GAL—mPPAR y and MHIOO (UAS)
  • UAS pioglitazone
  • X 4 tk—LUC reporters and treated with the indicated doses using pioglitazone (pio), glimepiride, darifelclamide.
  • FIG. 1 shows that glimepiride and darifenclamide are partial agonists for PPAR y.
  • C PPAR subtype selectivity of glimepiride.
  • HEK293 cells were transfected with GAL4, GAL4 mouse PPAR y, GAL4—mouse PPAR ⁇ , or GAL4_mPPAR ⁇ in combination with M HIOO (UAS)
  • X 4 tk— LUC reporter and vehicle control, respectively.
  • a ligand for PPAR subtypes PPAR ligand, ⁇ ⁇ ⁇ Wy 14643; PPAR ⁇ ligand, 10 ⁇ M GW 501516; PPAR ⁇ ligand, ⁇ ⁇ ⁇ pioglitazone), or a ligand for 10 ⁇ glimepiride .
  • FIG. 1 shows that glimepiride and darifenclamide are partial agonists for PPAR ⁇ .
  • D Dose response curve of [ 3 H] rosiglitazone binding to PPAR y with piodaritzone. Competitive binding assays were performed as described in the experimental procedure. Data show the average of duplicate points.
  • FIG. 1E is a graph showing whether a sulfonylurea agent is effective at a concentration higher than the concentration shown in FIG.
  • the experimental conditions are all as described in Figure 1 and the experimental procedure, except for the concentrations used.
  • FIG. 2 shows that glimepiride affects the interaction between cofactor and PPAR ⁇ .
  • A AF-2-dependent activation of PPAR ⁇ by glimepiride.
  • ⁇ 293 cells were co-transfected with CMX control vector (cont), CMX-mPPAR ⁇ or CMX— ⁇ mPPAR ⁇ , PPRE X 3—tk—LUC, and 1 / i M pioglitazone (p io)
  • p io a glimepiride
  • FIG. 2 shows that glimepiride affects the interaction between cofactor and PPAR ⁇ .
  • FIG. 2 shows that glimepiride affects the interaction between cofactors and PPAR o /.
  • C Effect of glimepiride on the interaction between PPARo / and cofactor in cell-based systems.
  • Figure 2 shows that glimepiride affects the interaction of cofactors and PPAR y.
  • D Direct effect of darimepiride on the interaction between PPARy and DRIP205 in a cell-free system. GST Punoré down assembly was performed as described in “Experimental Methods”. In the presence of pioglitazone or glimepiride, in vitro translation 35 S-mouse PPAR y was detected as a result of interaction with GST-DRIP205.
  • FIG. 3 shows that glimepiride and darribenclamide induce PPAR-dependent transactivation in 3T3 adipocytes.
  • FIG. 3 shows that glimepiride and darribenclamide induce PPAR-dependent transactivation in 3T3 adipocytes.
  • B against adiponectin promoter activity The effect of glimepiride.
  • CO nt control vehicle
  • Fig. 4 shows that glimepiride and darifenclamide enhance adiponectin production in 3T3-L1 adipocytes.
  • A is the effect of glimepiride on the mRNA expression of the PPAR y target gene.
  • 3T3-L1 adipocytes were treated with vehicle control (cont), 10 ⁇ pioglitazone (pio) or 20 ⁇ glimepiride (g mp) for 24 hours.
  • Total RNA was subjected to real-time quantitative RT-PCR analysis for mRNA expression of these genes.
  • FIG. 4 shows that glimepiride and darribenclamide enhance adiponectin production in 3T3-L1 adipocytes.
  • B is the effect of glimepiride on the mRNA expression of the PPAR y target gene.
  • 3T3-L1 adipocytes were treated with vehicle control (cont), 10 ⁇ pioglitazone (pio) or 20 ⁇ glimepiride (g mp) for 24 hours.
  • Total RNA was subjected to real-time quantitative RT-PCR analysis for mRNA expression of these genes.
  • FIG. 4 shows that glimepiride and darivenclamide enhance adiponectin production in 3T3-L1 adipocytes.
  • FIG. 4 shows that glimepiride and darifenclamide enhance adiponectin production in 3T3-L1 adipocytes.
  • Fig. 5A shows that glimepiride and darivenclamide stimulate adipocyte differentiation.
  • FIG. 5B shows that glimepiride and darivenclamide stimulate adipocyte differentiation.
  • Fig. 5 shows that glimepiride and darifenclamide stimulate adipocyte differentiation.
  • diabetes is used in the same meaning as used in the art, and refers to a metabolic disease that exhibits persistent hyperglycemia and diabetes. There are insulin dependence (type I) and insulin independence (type IV), and the former requires the administration of insulin with a rapid onset and severe symptoms. The latter is slow and does not necessarily require insulin administration.
  • disease related to PPAR refers to a function related to adipocyte differentiation. Diabetes mellitus; Diabetes; Hyperdaricinemia; Tolerance of hypognolecose; Insulin resistance; Obesity; Fatty disorder; Dyslipidemia; Hyperlipidemia; Hypertriglyceridemia; Hypercholesterolemia; Low HDL level High LDL level; atherosclerosis; vascular stenosis; irritable bowel syndrome; inflammatory bowel disease; Crohn's disease; S recruitment ulcer; inflammatory disease; vaginitis; abdominal obesity; sexual syndrome; ovarian hyperandrogenism and the like.
  • relating to insulin metabolism refers to any factor related to insulin secretion or glucose metabolism by insulin. Such genes are typically shown in Figure 5c.
  • Figure 5c shows the genes involved in insulin receptor signaling in adipocytes.
  • diagnosis refers to identifying various parameters related to the type of disease, type and degree of disorder, physical condition, etc. in a subject, and the current state of such disease, disorder, or condition, Refers to drug response prediction, pathological change prediction or determination of cause.
  • treatment refers to preventing a disease or disorder from deteriorating, preferably maintaining the status quo, more preferably, for a certain disease or disorder. Means to reduce, more preferably to dissipate.
  • prophylaxis refers to treating a disease or disorder so that it does not occur before it is triggered. Say. Therefore, it includes prevention of such a state, delay, etc., and prevention of deterioration for a certain disease or disorder. It is understood that the method of the present invention can also be used for prevention because it regenerates lung tissue.
  • treatment refers to any medical action performed on a disease, disorder or condition, and includes actions performed to contribute to diagnosis, treatment, prevention, prognosis, etc. .
  • the procedure should be performed by a health professional with some national license, such as a doctor or nurse. It should be noted that even if the action worsens the course of the controversial disease and is detrimental to the patient, the action itself is “treatment”. is there.
  • instructions describe a method of using the present invention or a method of diagnosis for a doctor, a person who administers a subject, a person to be diagnosed (which may be the subject). It is a thing. Instructions can be attached to indicate how to use a diagnostic agent or the like provided as a kit. This instruction describes a word for instructing a procedure for administering the diagnostic agent or medicine of the present invention. This instruction is prepared in accordance with the format prescribed by the national supervisory authority (for example, the Ministry of Health, Labor and Welfare in Japan and the Food and Drug Administration (FD A) in the United States) in the United States. It will be clearly stated that it has been approved. Instructions are so-called package inserts, which are usually provided in paper form, but are not limited thereto, such as electronic media (for example, a homepage (website) provided on the Internet, E-mail, SMS, PDF documents, etc.).
  • electronic media for example, a homepage (website) provided on the Internet, E-mail, SMS, PDF documents, etc.
  • DNA synthesis techniques and nucleic acid chemistry for producing artificially synthesized genes are described in, for example, Gait, MJ (1985). Oligonucleotide Synthesis: A Practical Approach, IRLPress; Gait, MJ (1990 Oligonucleotide Synthesis: A Practical Approach, IRL Press; Eckstein, F. (1991). Oligonucleotides and Analogues: A Practical Approac, IRL Press; Adams, RL etal. (1992). Barova, Z. et al. (1994). Advanced Organic Chemistry of Nucleic Acids, Weinheim; Blackburn, GM et al. (1996). Nucleic Acids in Chemistry and Biology, Oxford University Press; Hermanson, GT (1996). Bioconjugate Techniques, Academic Press, etc., which are incorporated herein by reference in the relevant part.
  • the PPAR, adiponectin promoter, and fragments and variants thereof used in the present invention can be produced using a transgenic animal production technique and a genetic engineering technique.
  • PPAR peroxisome proliferator—activator receptor
  • SEQ ID NOs:! To 8 each SEQ ID NO: 1-2 (NP_035276), SEQ ID NO: 3-4 (NP_619726), SEQ ID NO: 5-6 (NP _037256) and SEQ ID NO: 7 _ 8 (AAB87480), which are defined by mouse, human, rat and monkey nucleic acid sequence (odd number) and amino acid sequence (even number), respectively.
  • SEQ ID NOs SEQ ID NOs:! To 8 (each SEQ ID NO: 1-2 (NP_035276), SEQ ID NO: 3-4 (NP_619726), SEQ ID NO: 5-6 (NP _037256) and SEQ ID NO: 7 _ 8 (AAB87480), which are defined by mouse, human, rat and monkey nucleic acid sequence (odd number) and amino acid sequence (even number), respectively.
  • variants of the above sequences also fall within the scope of this term as long as they have similar activity.
  • PPAR is a type of nuclear receptor and refers to a molecule that initiates biological reactions in the nucleus by binding to a ligand.
  • Normal nuclear receptor Is included in the nucleus, but has the property of moving into the nucleus when a biological reaction is initiated.
  • Nuclear receptors usually form a complex when bound, bind to DNA, and act as transcription factors.
  • biological reactions of nuclear receptors typically include transcriptional regulation (for example, promotion, repression, initiation, or termination of transcription, typically, promotion of transcription, but are not limited thereto). That's right.
  • a nuclear receptor in the natural state, is present in the cytoplasm when not stimulated by a ligand, and when bound to a ligand, it migrates into the nucleus, and the stimulation enters the nucleus.
  • a nuclear receptor initiates a biological reaction in the nucleus by binding to a ligand that does not change its localization.
  • a "corresponding" amino acid means a protein or polypeptide molecule having a function similar to that of a predetermined amino acid in a protein or polypeptide used as a reference for comparison.
  • the domain corresponding to the A domain is a region having a transcription promoting function
  • the domain corresponding to the B domain is also a transcription promoting function. This area is sometimes called the A / B domain.
  • the domain corresponding to the C domain is a region having an action of DNA binding, and usually has two characteristic Zn finger structures found in DNA-binding proteins.
  • the domain corresponding to the D domain is a region existing between the C domain and the E'F domain, and the domain corresponding to the E'F domain is a region having an action of binding to a ligand (formone). Also referred to as the ligand binding domain.
  • This ligand binding domain (E'F domain) has a similar conformation consisting of 12 alpha helices.
  • the domain corresponding to the F domain is a region located on the C-terminal side of the ⁇ domain.
  • an enzyme molecule it refers to an amino acid that is present at the same position in the active site and contributes similarly to the catalytic activity.
  • Corresponding residues in PPAR can be identified by alignment.
  • domains A to F in nuclear receptors other than those listed above correspond to domains in the range of amino acid positions corresponding to the first amino acid and the last amino acid in the above specific examples. Is done.
  • the A to F domains can be determined based on definitions known in the art. For example, such a definition can be found in Robinson-Rechavi M et al., J Cell Sci 2003 Feb 15; 116 (Pt 4): 585-586 and references cited therein can be taken into consideration.
  • the "biological activity" of PPAR is the activity brought about by the nuclear receptor when the nuclear receptor binds to the ligand. , Such as, but not limited to, activities as described immediately before herein (eg, for PPAR y, PEPCK transcription promotion, gluconeogenesis promotion, etc.).
  • An agonist of a nuclear receptor eg, PPAR y
  • PPAR is typically PPAR y, and its sequence is SEQ ID NOs:! To 8 (odd numbers indicate nucleic acid sequences, even numbers indicate the corresponding amino acid sequences. Mouse, human, rat, and sal, respectively. Or a modified sequence thereof.
  • a PPAR can be a molecule such as:
  • At least one amino acid has at least one mutation selected from the group consisting of substitution, addition and deletion, and biological A polypeptide having activity;
  • Polybeptide K which is a species homologue of the amino acid sequence set forth in SEQ ID NO: 2, 4, 6 or 8;
  • the biological function of the PPAR protein is determined by ELISA, Northern blot analysis or quantitative PCR, biochemical analysis by measuring cell proliferation or differentiation, and the substance or organism to be examined. It is possible to measure by performing microscopic analysis on the morphogenesis of the biological extract, but is not limited thereto.
  • protein protein
  • polypeptide oligopeptide
  • peptide amino acid polymers of any length and their Refers to a variant.
  • This polymer may be linear, branched or cyclic.
  • the amino acid may be a modified amino acid, whether natural or non-natural.
  • the term also includes what can be assembled into a complex of multiple polypeptide chains. This term also encompasses amino acid polymers that are naturally or artificially modified. Such modifications include, for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation or any other manipulation or modification (eg, conjugation with a labeling component).
  • the “protein” is preferably a protein that is compatible with the host in which the composition is to be used, but can be treated to be compatible with that host. As long as you use any protein. Whether a protein is compatible with a host or can be treated to be compatible with a host is determined by transplanting the protein into the host and suppressing side reactions such as immune rejection as necessary. It can be determined by observing whether or not it will be established in the host.
  • a protein having the above-mentioned compatibility can include, but is not limited to, a protein derived from the host.
  • an "isolated" biological agent eg, a nucleic acid or protein Is the other biological factor in the cell of the organism in which it is naturally occurring (eg, if it is a nucleic acid, the non-nucleic acid factor and the nucleic acid sequence other than the nucleic acid of interest).
  • isolated nucleic acids and proteins include nucleic acids and proteins purified by standard purification methods. Thus, isolated nucleic acids and proteins include chemically synthesized nucleic acids and proteins.
  • a "purified" biological agent eg, nucleic acid or protein
  • a purified biological agent is one in which at least a portion of the factor that naturally accompanies the biological agent has been removed.
  • the purity of a biological agent in a purified biological agent is usually higher (ie, enriched) than the state in which the biological agent is normally present.
  • biomolecules used in the present invention can be collected from a living body or chemically synthesized by methods known to those skilled in the art.
  • the synthesis method using an automated solid phase peptide synthesizer is described by: Stewart, JM et a 1.984). Solid Phase Peptide synthesis, Pierce ChemicaLCo. (1992). Synthetic Peptides: A User's Guide, WH Freeman; Bodanszky, M. (1993). Principles of Peptide Synthesis, Springer—Verlag; Bodanszky, M. et al. (1994). The Practice of Peptide Synthesis , Springer—Verlag; Fields, GB (1997).
  • homology of a biomolecule refers to two or more sequences when they have comparable sequences. The degree of identity of each other. Therefore, the higher the homology between two sequences, the higher the identity or similarity between those sequences. Whether or not two types of sequences have homology depends on the sequence In the case of nucleic acids, or by hybridization under stringent conditions.
  • sequences are typically at least 50% identical, preferably at least 70% identical, more preferably z at least 80%, 90%, If they are 95%, 96%, 97%, 98% or 99% identical, the genes are homologous.
  • similarity of biomolecules (for example, nucleic acid sequences, amino acid sequences, etc.) refers to two or more gene sequences when conservative substitutions are regarded as positive (identical) in the above homology. The degree of identity to each other. Thus, if there is a conservative substitution, identity and similarity differ depending on the presence of the conservative substitution. In the absence of conservative substitutions, identity and similarity indicate the same number. In the present invention, those having such high identity or similarity may also be useful.
  • the comparison of similarity, identity and homology between amino acid sequences and base sequences is calculated using BLAST, a sequence analysis tool, using default parameters.
  • An identity search can be performed using NCBI's BLAST2.2.9 (issued 2004.5.12), for example.
  • the identity value in this specification is usually the value when the above BLAST is used and aligned under the default conditions. However, if a higher value is obtained by changing the parameter, the highest value is the identity value. When identity is evaluated in multiple areas, the highest value is used as the identity value.
  • amino acid may be natural or non-natural.
  • “Derivative amino acid” or “amino acid analog” refers to an amino acid that is different from a naturally occurring amino acid but has the same function as the original amino acid. Such derivative amino acids and amino acid analogs are well known in the art.
  • natural amino acid refers to the L_ isomer of a natural amino acid. Natural amino acids are glycine, alanine, valine, leucine, isoleucine, serine, methionine, threonine, phenylalanine, tyrosine, tryptophan, cysteine, proline, histidine, aspartic acid, asparagine, gnoretamic acid, gnoletamine, y —Carboxyglutamic acid, anoleginine, ornithine, and lysine. Unless otherwise indicated, all amino acids referred to herein are L-forms, but forms using D-form amino acids are also within the scope of the present invention. The
  • amino acid variant refers to a molecule that is not a natural amino acid but is similar to the physical properties and / or functions of a natural amino acid.
  • amino acid modifications include those in which an alkyl group, a halo group, a nitro group, etc. are bonded to the benzyl side chain of phenylalanine (para-position, meta-position, ortho-position, etc.), ethionine, canavanine, 2_methylglutamine Etc.
  • amino acid variants may include unnatural amino acids and amino acid mimetics.
  • unnatural amino acid means an amino acid that is not normally found in proteins.
  • non-natural amino acids are nonoleucine, para-nitrophenylalanine, homophenylalanine, para-fluorophenylalanine, 3-amino-2-benzylpropionic acid, homoarginine D-form or L-form and D-phenol For example, lulanin.
  • the "corresponding" amino acid or nucleic acid is the same as a predetermined amino acid in a polypeptide or polynucleotide as a reference for comparison with a polypeptide molecule or polynucleotide molecule, respectively.
  • a force that has an action, or a force that it has an action S For the predicted amino acid or nucleic acid, especially in the case of an enzyme molecule, an amino acid that is present at the same position in the active site and contributes similarly to the catalytic activity. Say. For example, it may be a similar part in a certain orthologue.
  • the portion corresponding to the peptide of the present invention is “corresponding”. It is understood that it corresponds to “an amino acid”.
  • the "corresponding" gene refers to a gene having, or expected to have, the same action as that of a predetermined gene in a species as a reference for comparison in a certain species.
  • the genes having the same evolutionary origin are used.
  • the corresponding gene of a gene can be an ortholog of that gene.
  • the gene corresponding to mouse PPAR is human PPAR.
  • fragment refers to a full-length polypeptide or polynucleotide ( A polypeptide or polynucleotide having a sequence length from 1 to n-1 relative to length n).
  • the length of the fragment can be changed as appropriate according to its purpose.
  • the lower limit of the length is 3, 4, 5, 6, 7, 8, 9, 10 in the case of a polypeptide. , 15, 2 0, 25, 30, 40, 50 and more amino acids, specifically enumerated here, but not an integer length (eg 11 etc.) As may be appropriate.
  • examples include 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 40, 50, 75, 100 and more nucleotides.
  • Non-integer lengths may also be appropriate as lower bounds.
  • a polypeptide or polynucleotide or the like when used as a biological molecule, such a fragment is also a full-length fragment as long as the desired purpose (for example, a cell attracting effect) is achieved. It is understood that it can be used as well.
  • the lengths of polypeptides and polynucleotides can be expressed by the number of amino acids or nucleic acids, respectively, as described above.
  • the above numbers are not absolute but have the same function. As long as it has, the above number as the upper or lower limit is intended to include those above and below that number (or for example 10% above and below).
  • “about” may be added before the number. However, it should be rationalized herein that the presence or absence of “about” does not affect the interpretation of the value.
  • biological activity refers to the activity that a certain factor (for example, a polypeptide or a protein) can have in vivo, and the activity of exerting various functions. Is included.
  • a certain factor for example, a polypeptide or a protein
  • its biological activity includes binding to the nucleic acid molecule of interest, thereby suppressing expression.
  • the biological activity includes the enzyme activity.
  • an agent is a ligand
  • the ligand includes binding to the corresponding receptor.
  • polynucleotide As used herein, the terms “polynucleotide”, “oligonucleotide”, and “nucleic acid” are used interchangeably herein to refer to nucleotides of any length. Say Ma. The term also includes “oligonucleotide derivatives” or “polynucleotide derivatives”. “Oligonucleotide derivatives” or “polynucleotide derivatives” are used interchangeably, including derivatives of nucleotides or oligonucleotides or polynucleotides in which the linkage between nucleotides is unusual.
  • oligonucleotides include, for example, 2 ′ ___ methyl monoribonucleotides, oligonucleotide derivatives in which phosphodiester bonds in oligonucleotides are converted to phosphoroate bonds, in oligonucleotides Oligonucleotide derivative in which the phosphodiester bond is converted to N3'-P5 'phosphoramidate bond, the oligonucleotide derivative in which the ribose and phosphodiester bond in the oligonucleotide is converted into peptide nucleic acid bond, uracil in the oligonucleotide Is an oligonucleotide derivative substituted with C-5 propynyluracil, an oligonucleotide derivative in which uracil in the oligonucleotide is substituted with C_5 thiazoleuracil, and cytosine in the oligonucleotide
  • a particular nucleic acid sequence may also be conservatively modified (e.g., degenerate codon substitutes) and complementary, similar to the explicitly indicated sequence. It is intended to encompass sequences.
  • a degenerate codon substitute creates a sequence in which the third position of one or more selected (or all) codons is replaced with a mixed base and / or deoxyinosin residue.
  • nucleotide refers to a nucleoside in which the sugar moiety is a phosphate ester, and includes DNA, RNA, etc., whether natural or non-natural.
  • a nucleoside refers to a compound in which a base and a sugar form an N-glycoside bond.
  • Nucleotide derivative or “nucleotide analog” is different from a naturally occurring nucleotide. Force S This has the same function as the original nucleotide. Such derivative nucleotides and nucleotide analogs are well known in the art.
  • nucleotides and nucleotide analogs examples include phosphoroates, phosphonoreamidates, methyl phosphonates, chiral methyl phosphonates, 2-0-methyl ribonucleotides, peptide-nucleic acids (PNA).
  • DNA includes cDNA, genomic DNA, and synthetic DNA.
  • the "corresponding" gene refers to a gene having, or expected to have, the same action as that of a predetermined gene in a species as a reference for comparison in a certain species.
  • the genes having the same evolutionary origin are used.
  • the corresponding gene of a gene can be an ortholog of that gene. Therefore, a region corresponding to a region having promoter activity in the PPAR gene or human adiponectin gene can be found in other animals (mouse, rat, butterfly, ushi, etc.).
  • Such a corresponding gene or promoter region can be identified using techniques well known in the art based on the disclosure herein.
  • a corresponding gene in an animal can be searched using a sequence database of the animal (eg, mouse, rat) using the sequence of the gene serving as a reference for the corresponding gene (eg, human adiponectin promoter) as a query sequence.
  • a sequence database of the animal eg, mouse, rat
  • the sequence of the gene serving as a reference for the corresponding gene eg, human adiponectin promoter
  • the "corresponding" amino acid or nucleic acid is the same as a predetermined amino acid in a polypeptide or polynucleotide as a reference for comparison with a polypeptide molecule or polynucleotide molecule, respectively.
  • a force that has an action, or a force that it has an action S For the predicted amino acid or nucleic acid, especially in the case of an enzyme molecule, an amino acid that is present at the same position in the active site and contributes similarly to the catalytic activity.
  • an antisense molecule of a polynucleotide can be a similar part in an ortholog corresponding to a particular part of the antisense molecule.
  • the power at which a specific sequence in the promoter is used is used.
  • the portion corresponding to the nucleotide sequence of the present invention is the “corresponding nucleotide”. It is understood that it corresponds.
  • the term "variant" refers to a substance in which a part of the original substance such as a polypeptide or polynucleotide is changed. Such variants include substitutional variants, addition variants, deletion variants, truncated variants, allelic variants, and the like. Such a variant can also be used as the cell growth factor of the present invention as long as the desired purpose can be achieved.
  • alleles are genetic variants that belong to the same locus and are distinguished from each other. Therefore, an “allelic variant” refers to a variant that has an allelic relationship with a gene. Such allelic variants usually have the same or very similar sequence as their corresponding alleles, usually with nearly the same biological activity, but rarely different biological activities. May be included.
  • a “species homologue or homolog” is homology (preferably, 60./o or more, more preferably 80) with a gene at the amino acid level or nucleotide level within a certain species. / o or more, 85% or more, 90% or more, instances that have a 95./ 0 or more homology). The method for obtaining such species homologues will be apparent from the description herein.
  • ortholog also called orthologous gene, refers to a gene derived from speciation from a common ancestor with two genes. For example, taking the hemoglobin gene family with multiple gene structures as an example, the human and mouse ⁇ -hemoglobin genes are orthologs. The human ⁇ - hemoglobin gene and ⁇ -hemoglobin gene are paralogs (genes generated by gene duplication). is there. Orthologs are useful for estimating molecular phylogenetic trees. Since the onorosolog can usually perform the same function in another species as the original species, the ortholog of the present invention can also be useful in the present invention.
  • nucleic acid sequences As used herein, “conservative variants” applies to both amino acid and nucleic acid sequences. Conservatively modified with respect to a particular nucleic acid sequence refers to a nucleic acid that encodes the same or essentially the same amino acid sequence, or essentially when a nucleic acid does not encode an amino acid sequence. Refers to the same sequence. Because of the degeneracy of the genetic code, a large number of functionally identical nucleic acids encode any given protein. For example, the codons GCA, GCC, GCG, and GCU all encode the amino acid alanine. Thus, at every position where alanine is specified by a codon, the codon is encoded. It can be altered to any of the corresponding codons described without altering the polypeptide.
  • Such a nucleic acid can be obtained by a well-known PCR method or chemically synthesized.
  • a site-specific displacement induction method, a hybridization method, or the like may be combined with these methods.
  • substitution, attachment, or deletion of a polypeptide or polynucleotide refers to an amino acid or a substitute for the original polypeptide or polynucleotide, respectively. , Or the power of nucleotides or their substitutes to be replaced, added or removed.
  • substitution, addition, or deletion techniques are well known in the art, and examples of such techniques include site-directed mutagenesis techniques. Any number of substitutions, additions or deletions may be used as long as it is one or more. Such numbers may be used in the variant having the substitutions, additions or deletions (eg, angiogenesis, cell regeneration). Etc.) as long as it is retained. For example, such a number can be one or several and preferably can be within 20%, 10%, or 100, 50, 25, etc. of the total length. .
  • Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC — IUB Biochemica L Nomenclature Commission. Nucleotides can also be referred to by their generally recognized single letter codes.
  • vector refers to a vector that can transfer a target polynucleotide sequence into a target cell.
  • vectors include those that can autonomously replicate in host cells such as prokaryotic cells, yeast, animal cells, plant cells, insect cells, individual animals and individual plants, or can be integrated into chromosomes. Is done.
  • cloning vectors those suitable for cloning are referred to as “cloning vectors”.
  • Such cloning vectors usually contain multiple cloning sites that contain multiple restriction enzyme sites. Such restriction enzyme sites and multiplex purine cloning sites are well known in the art, and those skilled in the art can appropriately select and use them according to the purpose. Such techniques are described in the literature described herein (eg, Sambrook et al., Supra).
  • an "expression vector” refers to a structural gene and a promoter that regulates its expression, as well as various regulatory elements that are operably linked in a host cell. Nucleic acid sequence.
  • the regulatory element may preferably include a terminator, a selectable marker such as a drug resistance gene, and an enzyme. It is well known to those skilled in the art that the type of organism (eg, animal) expression vector and the type of regulatory element used can vary depending on the host cell.
  • Recombinant vectors for prokaryotic cells that can be used in the present invention include pc DNA3 (+), pBluescript—SK (+/—), pGEM—T, pEF—BOS, pEGFP, pHAT, pUC18 PFT—DEST TM 42GATEWAY (Invitrogen) and the like.
  • Recombinant vectors for animal cells that can be used in the present invention include pc DNAI / Amp, pcDNAI, pCDM8 (all commercially available from Funakoshi), pAGE107 [JP-A-3-229 (Invitrogen), pAGE103. Biochem., 101, 1307 (1987)], pAMo, pAMoA. Biol. Chem., 268, 22782-22787 (1993)], retroviral expression vectors based on Murine Stem Cell Virus (MSCV), pEF_BOS, pEGFP and the like.
  • MSCV Murine Stem Cell Virus
  • terminal 1 is located downstream of the gene-coding region of the gene, terminates transcription when DNA is transcribed into mRNA, and has the power of poly A sequences. This is an array related to ⁇ . Terminators are known to affect gene stability by affecting mRNA stability.
  • promoter refers to a region on DNA that determines the transcription start site of a gene and directly regulates its frequency. Usually, RNA polymerase binds to transcription. This is the base sequence to start. Therefore, in this specification, a part having a promoter function of a gene is referred to as a “promoter part”. Since the promoter region is usually within about 2 kbp upstream of the first exon of the putative protein coding region, if the protein coding region in the genomic nucleotide sequence is predicted using DNA analysis software, the promoter region The region can be estimated.
  • the putative promoter region varies from structural gene to structural gene, but is usually upstream of the structural gene, but is not limited to this and may be downstream of the structural gene. Preferably, the putative promoter region is present within about 2 kbp upstream from the first exon translation start point. In the present invention, a region approximately 3.6 kb upstream from the start of translation was identified as a promoter region, and this region was found to provide high expression ability and high specificity in fat cells.
  • enhancer refers to a sequence used to increase the expression efficiency of a target gene. Such enhancers are well known in the art. One or more forcers can be used S1 may or may not be used.
  • operably linked means expression (operation) of a desired sequence S transcription / transcriptional regulatory arrangement IK (eg, promoter, enhancer, etc.) or translational regulatory sequence It is arranged under the control of
  • IK eg, promoter, enhancer, etc.
  • the promoter is usually located immediately upstream of the gene, However, there is no need to place them next to each other.
  • any technique may be used for introducing a nucleic acid molecule into a cell.
  • Examples thereof include transformation, transduction, and transformation.
  • Such a technique for introducing a nucleic acid molecule is well known and commonly used in the art, for example, Ausubel FA et al. (1988), Current Protocols in Molecular Biology, Wiley, New York, NY Sambrook J et al. (1987) Molecular Cloning: A Laboratory Manual, 2nd Ed. And its third edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY , 1997 and the like. Gene transfer can be confirmed using methods described herein, such as Northern blot, Western plot analysis, or other well-known conventional techniques.
  • any of the methods described above for introducing DNA into a cell can be used.
  • transfection, transduction, transformation, etc. for example, Calcium phosphate method, ribosome method, DEAE dextran method, electroboration method, method using particle gun (gene gun), etc.
  • the “transformant” refers to all or part of a living organism such as a cell produced by transformation.
  • transformants include prokaryotic cells, yeast, animal cells, plant cells, insect cells and the like.
  • a transformant is also referred to as a transformed cell, a transformed tissue, a transformed host or the like depending on the subject.
  • the cell used in the present invention may be a transformant.
  • prokaryotic fungal cysts include Escherichia, Serratia, Bacillus, Brevibacterium, Corynebacteriumfe, Microbacteriiim, Pseudomonas, etc.
  • prokaryotic cells e.g., Escherichia coli XLl -Blue, Escherichia coli XL2 - B lue, Escherichia coli DH1 is / [indicated column.
  • animal cells include mouse 'myeloma cells, rat. , African green monkey kidney cells, human leukemia cells, HBT563 7 (Japanese Patent Laid-Open No. 63-299), and human colon cancer cell lines.
  • Mouse 'myeloma cells include ps20 and NSO
  • rat' myeloma cells include YB2 / 0, human fetal kidney cells such as HEK293 (ATCC: CRL-1573), and human leukemia cells such as BALL-1
  • human lizard kidney cells are COS-1, COS-7
  • human colon cancer cell lines are HCT-15, human neuroblastoma SK_N_SH, SK_N_SH_5Y, mouse neuroblastoma Neuro2A, etc. .
  • any method for introducing a DNA can be used as a method for introducing a recombinant vector.
  • a calcium chloride method an electroporation method [Methods] Enzymol., 194, 182 (1990)] lipofusion method, spheroplast method [Pro Natl. Acad. Sci. USA, 84, 1929 (1978)], lithium acetate method.
  • Bacteriol., 153, 163 (1983)] Proc. Natl. Acad. Sci. USA, 7 5, 1929 (1978).
  • the retrovirus infection method is well known in the art as described in, for example, Current Protocols in Molecular Biology supra (particularly Units 9.9-9.14) and the like.
  • trypsinizing embryonic stem cells into a single-cell suspension it is combined with the culture supernatant of a virus-producing cells (packaging cell lines). A sufficient amount of infected cells can be obtained by co-culture for 12 hours.
  • biomolecule refers to a molecule related to a living body and an assembly thereof.
  • living body refers to a biological organism, including but not limited to animals, plants, fungi, viruses and the like.
  • Biomolecules include, but are not limited to, molecules extracted from living organisms and their aggregates. The molecules that can be obtained and their aggregates fall within the definition of biomolecules. Therefore, small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.) also fall within the definition of biomolecules as long as the effects on the living body can be intended.
  • biomolecules include proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides, nucleic acids (eg, DNA such as cDNA, genomic DNA, RNA such as mRNA), Polysaccharides, oligosaccharides, lipids, small molecules (eg hormones, ligands, information transmitters, small organic molecules, etc.), complex molecules of these, and their aggregates (eg extracellular matrix, fibers, etc.) Les, included but not limited to them.
  • a biomolecule is intended to include any factor that interacts with PPAR.
  • in vivo or “in vivo” refers to the inside of a living body.
  • in vivo refers to the location where the target tissue or organ is to be placed. When screening is performed, in vivo screening can be performed.
  • in vitro refers to a state in which a part of a living body is removed or released “in vitro” (for example, in a test tube) for various research purposes. A term that contrasts with in vivo. When screening is performed, in vitro screening can be performed.
  • pharmaceutically acceptable carrier refers to a substance that is used when a pharmaceutical or veterinary drug is produced and does not adversely affect an active ingredient.
  • Such pharmaceutically acceptable carriers include, for example, antioxidants, preservatives, colorants, flavors, and diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffering agents, Examples include, but are not limited to, delivery vehicles, diluents, excipients and / or agricultural or pharmaceutical adjuvants.
  • Pharmaceutically acceptable carriers that can be used in the present invention include antioxidants, preservatives, colorants, flavors, and diluents, emulsifiers, suspending agents, solvents, fillers, bulking agents, buffering agents. , Delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants.
  • a medicament of the present invention is administered in the form of a composition comprising a support and a peptide or variant thereof together with one or more physiologically acceptable carriers, excipients or diluents.
  • a suitable vehicle can be water for injection, physiological solution, or artificial cerebrospinal fluid, which can be supplemented with other substances common to compositions for transplantation. .
  • Exemplary suitable carriers include neutral buffered saline or saline mixed with serum albumin.
  • the product is formulated as a lyophilizer using a suitable excipient (eg, sucrose).
  • suitable excipient eg, sucrose
  • Other standard carriers, diluents and excipients may be included as desired.
  • Other exemplary compositions include Tris buffer at pH 7.0 to 8.5 or acetate buffer at ⁇ 4 ⁇ 0 to 5.5, which further includes sorbitol or a suitable substitute thereof. obtain.
  • Acceptable carriers, excipients or stabilizers used herein are non-toxic to the recipient and are preferably inert at the dosages and concentrations used. , And include: phosphates, citrates, or other organic acids; antioxidants (eg, ascorbic acid); low molecular weight polypeptides; proteins (eg, serum albumin, gelatin or immunoglobulin); hydrophilic Amino acids (eg glycine, gnoretamine, asparagine, arginine or lysine); monosaccharides, disaccharides and other carbohydrates (including glucose, mannose or dextrin); chelating agents (eg EDTA) Sugar alcohols (eg mannitol or sorbitol ); Salt-forming counterions (eg, sodium); and / or non-ionic surfactants (eg, Tween, pluronic or polyethylene glycol (PEG)).
  • phosphates, citrates, or other organic acids include: phosphates, citrates
  • the drug used in the medicament of the present invention or a modified form thereof is advantageously derived from a living body intended for treatment, but is not limited thereto.
  • a peptide of the same origin as the host or a variant thereof is considered advantageous because it is considered that there is almost no immune reaction or the like.
  • an immune reaction usually does not occur, so there is no need to specifically limit its origin.
  • the "instruction” describes the method of using the present invention or the method of diagnosis for a doctor, a person who administers a subject, a person who diagnoses (which may be the subject). It is what. Instructions can be attached to indicate how to use a diagnostic agent or the like provided as a kit. This instruction describes a word for instructing a procedure for administering the diagnostic agent or medicine of the present invention. This instruction is prepared according to the format prescribed by the national supervisory authority (for example, the Ministry of Health, Labor and Welfare in Japan and the Food and Drug Administration (FDA) in the United States) in the United States. It will be clearly stated that it has been approved. Instructions are so-called package inserts and are not normally limited to the power provided by paper media, for example, electronic media (eg, homepages (websites) provided on the Internet, emails, SMS, PDF documents, etc.) can also be provided.
  • electronic media eg, homepages (websites) provided on the Internet, emails, SMS, PDF documents, etc.
  • the present invention can be used in combination with gene therapy.
  • Gene therapy refers to treatment performed by administration of a nucleic acid that is expressed or expressible to a subject.
  • the nucleic acid produces an encoded protein that mediates a therapeutic effect.
  • any method for gene therapy available in the art can be used in accordance with the present invention.
  • Exemplary methods are general reviews of methods of gene therapy, Goldspie Let al., Clinical Pharmacy 12: 488-505 (1993); Wu and Wu, Biot herapy 3: 87-95 (1991); Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32: 573-596 (1993); Mulligan, Science 260: 926-932 (1993); and Morgan and Anderson, Ann. Rev. Biochem. 62: 191-217 (1993) ; May, TIBTECH 11 (5): 155-215 (1993).
  • Commonly known recombinant DNA techniques used in gene therapy are Ausubel et al. (Eds.), Current Protocols in Molecular Biology, John Wiley & Sons, NY (1993); And Kriegler, Gene Transfer and Expression, A Laboratory Manua 1, Stockton Press, NY (1990).
  • transcription activity assay refers to an arbitrary assay for testing whether or not a certain region has transcription activity.
  • PPAR ⁇ is exemplified as the target gene.
  • a GAL4-binding region is exemplified upstream of the DNA encoding the reporter gene as a transcription factor recognition sequence.
  • An example of a transcriptional regulator is a PPAR binding domain (PPAR y LBD) fused with a GAL4 DNA binding domain (GAL4DBD).
  • cultured cells into which DNA encoding the target nuclear receptor and DNA encoding the reporter gene are introduced are prepared.
  • a chemical substance is added to the medium containing the cultured cells and cultured, and the fluorescence intensity is measured.
  • a high-throughput device that is a robot system.
  • such a transcription activity assay can be used in carrying out the method for determining whether or not a candidate compound is an antagonist of a nuclear receptor or an antagonist.
  • a candidate compound determined to be covalently bonded is selected, and the nuclear receptor is selected.
  • a candidate compound in a system eg, a cell
  • the candidate compound is determined to be an agonist of the nuclear receptor, and when the expression of the reporter decreases, the candidate compound is It is determined as an antagonist of the internal receptor.
  • any reporter may be used as long as expression can be confirmed, but luciferase is typically used. This is because chemiluminescence is easy to observe.
  • fluorescent proteins can be used, but not limited thereto.
  • the system utilized in the transcriptional activity assay used in the present invention can be a cell, but is not limited thereto, and a cell-free system can also be used.
  • transcription factor recognition sequence examples include GAL4DNA (Tyree CM, Kla using K., Methods Mol Med. 2003; 85: 175-83), LexA DBD (Chemistry and Biology, vol 10, no 7, pp. 584- 585 (July, 2003)). It will be appreciated that such transcription factor recognition sequences can be used with any nuclear receptor.
  • GAL4DNA Tyree CM, Kla using K., Methods Mol Med. 2003; 85: 175-83
  • LexA DBD Choemistry and Biology, vol 10, no 7, pp. 584- 585 (July, 2003)
  • GAL4DNA Tyree CM, Kla using K., Methods Mol Med. 2003; 85: 175-83
  • LexA DBD Choemistry and Biology, vol 10, no 7, pp. 584- 585 (July, 2003)
  • a transcription factor recognition sequence candidate sequence is used in place of the GAL4 DNA. It can be understood that any sequence that performs the above-described assay and in which a positive response by an
  • the present invention was partially completed by the discovery that sulfonylureas have the ability to modulate PPAR.
  • Sulfonylurea agents have long been Has been used as a substitute for insulin.
  • examples of the sulfonylurea agents include, but are not limited to, glimepiride, darivenclamide, tolptamide, chlorpropamide, acetohexamide, and daliclazide.
  • alkyl refers to a monovalent group formed by loss of one hydrogen atom from an aliphatic hydrocarbon (alkane) such as methane, ethane, or propane.
  • Alkyl can be linear or branched.
  • substituted alkyl refers to an alkyl in which H of the alkyl is substituted by the substituent specified below. Specific examples thereof include C1-C2 alkyl, C1-C3 alkyl, C1-C4 anolequinole, C1-C5 anolequinole, C1-C6 alkyl, C1-C7 alkyl, C1-C8 alkyl, C1-C9 anolequinole, C1-C10 anolequinole.
  • Cl-C11 alkyl or C1-C12 alkyl C1-C2 substituted alkyl, C1-C3 substituted alkyl, C1-C4 substituted alkyl, C1-C5 substituted alkyl, C1-C6 substituted Alkyl, C1-C7 substituted alkyl, C1-C8 substituted alkyl, C1-C9 substituted alkyl, C1-C10 substituted alkyl, C1-C11 substituted alkyl or C1-C12 substituted It can be alkyl.
  • C1-C10 alkynole means straight-chain or branched alkyl having 1 to 10 carbon atoms, and includes methyl (CH—), ethyl (CH—), n-propyl (CH 2 CH 2). CH —), iso
  • Norequinole means a C1-C10 alkyl having one or more hydrogen atoms substituted by substituents.
  • alkylene refers to a divalent group formed by loss of two hydrogen atoms from an aliphatic hydrocarbon (alkane) such as methylene, ethylene, or propylene. In general, -CH is represented by one (where n is a positive integer). Alkylene is linear or branched n 2n
  • substituted alkylene refers to an alkylene in which H of the alkylene is substituted by the substituent specified below. Specific examples of these include Cl to C2 alkylene, C1 to C3 alkylene, C1 to C4 alkylene, C1 to C5 alkylene, C1 to C6 alkylene, C1 to C7 alkylene, C1 to C8 alkylene, C1 to C9 alkylene, C :!
  • C1-C10 alkylene means a linear or branched alkylene having 1 to 10 carbon atoms, methylene (—CH—),
  • C1-C10 substituted alkylene is C1-C1
  • alkylene having one or more hydrogen atoms replaced by a substituent.
  • alkylene includes one or more atoms selected from oxygen and sulfur atoms.
  • optionally substituted alkylene means “alkylene” or “substituted alkylene” as defined above, which may be a deviation.
  • cycloalkyl refers to alkyl having a cyclic structure.
  • substituted cycloalkyl refers to the substitution of H in cycloalkyl by the substituents specified below. Refers to substituted cycloalkyl. Specific examples include C3-C4 cycloalkyl, C3-C5 cycloalkyl, C3-C6 cycloalkyl, C3-C7 cycloalkyl, C3-C8 cycloalkyl, C3-C9 cycloalkyl, C3-C10 cycloalkyl, C3-C11.
  • cycloalkyl is exemplified by cyclopropyl, cyclohexyl and the like.
  • cycloalkyl means that either “cycloalkyl” or “substituted cycloalkyl” as defined above may be used.
  • alkenyl refers to a monovalent group formed by loss of one hydrogen atom from an aliphatic hydrocarbon having one double bond in the molecule. n 2n— 1 (where n is a positive integer greater than or equal to 2). “Substituted alkenyl” refers to alkenyl in which H of alkenyl is substituted by the substituent specified below.
  • C2 to C3 anorekeninore C2 to C4 anorekeninole, C2 to C5 anorekeninole, C2 to C6 anorekenil, C2 to C7 alkenyl, C2 to C8 alkenyl, C2 to C9 alkenyl, C2 to C10 alkenore, 02 ⁇ ⁇ 11 alkenyl or ⁇ 2 to ⁇ 12 alkenyl, C2 to C3 substituted alkenyl, C2 to C4 substituted alkenyl, C2 to C5 substituted alkenyl, C2 to C6 substituted alkenyl, C2 to C7 substituted Alkenyl, C2-C8 substituted alkenyl, C2-C9 substituted alkenyl, C2-C10 substituted alkenyl, C2-C11 substituted alkenyl or C2-C12 substituted alkenyl.
  • C2 to C10 alkyl means a linear or branched alkeny
  • C2-C10 substituted alkenyl refers to C2-C10 alkenyl, in which one or more hydrogen atoms are replaced by substituents.
  • optionally substituted alkenyl means “alkenyl” or “substituted alkenyl” as defined above, which may be shifted.
  • alkenylene refers to a divalent group formed by losing two hydrogen atoms from an aliphatic hydrocarbon having one double bond in the molecule. n 2n-2 (where n is a positive integer greater than or equal to 2). “Substituted alkkenylene” refers to alkkenylene in which H of alkenylene is substituted by the substituent specified below.
  • C2-C25 alkenylene or C2-C25 substituted alkenylene among which C2-C3 alkenylene, C2-C4 alkenylene, C2-C5 alkenylene, C2-C6 alkenylene, C2- C7 alkenylene, C2 to C8 alkenylene, C2 to C9 alkenylene, C2 to C10 alkenylene, ⁇ 2 to ⁇ 11 alkenylene or ⁇ 2 to ⁇ 12 alkenylene, C2 to C3 substituted alkenylene, C2 to C4 substituted alkenylene C2-C5 substituted alkenylene, C2-C6 substituted alkenylene, C2-C7 substituted alkenylene, C2-C8 substituted alkenylene, C2-C9 substituted alkenylene, C2-C10 substituted alkkenylene, C2-C11 substituted alkkenylene or C2-C12 substituted alkkenylene are preferred.
  • C2-C10 substituted alkenylene refers to C2-C10 alkenylene, in which one or more hydrogen atoms are substituted with substituents.
  • alkylene includes one or more atoms selected from an oxygen atom and a sulfur atom.
  • optionally substituted alkenylene means that “alkenylene” or “substituted alkenylene” as defined above may be misaligned. To do.
  • cycloalkenyl refers to alkenyl having a cyclic structure. “Substituted cycloalkenyl” refers to cycloalkenyl in which H of cycloalkenyl is substituted by the substituent specified below. Specific examples include C3-C4 cycloalkenyl, C3-C5 cycloalkenyl, C3-C6 cycloalkenyl, C3-C7 cycloalkenyl, C3-C8 cycloalkenyl, C3-C9 cycloalkenyl, C3-C10 cycloalkenyl.
  • cycloalkenyl refers to “cycloalkenyl” or “substituted cycloalkenyl” as defined above, which may be a deviation. means.
  • alkynyl refers to a monovalent group formed by losing one hydrogen atom from an aliphatic hydrocarbon having one triple bond in the molecule, such as acetylene. Is represented by CH 1 (where n is a positive integer greater than or equal to 2). "Substituted al n 2n-3
  • “Quinyl” refers to an alkynole in which H of alkynyl is substituted by the substituent specified below. Specific examples include C2 to C3 alkynyl, C2 to C4 alkynole, C2 to C5 alkynolyl, C2 to C6 alkynyl, C2 to C7 alkynyl, C2 to C8 alkynyl, C2 to C9 alkynyl, C2 to C10 alkenochinole, C2 to C11 alkynyl C2-C12 alkynyl, C2-C3-substituted alkynyl, C2-C4-substituted alkynyl, C2-C5-substituted alkynyl, C2-C6-substituted alkynyl, C2-C7-substituted alkynyl, C2-C8 It can be substituted alkynyl, C2-C9 substituted alkynyl,
  • C2 to C10 alkynyl means, for example, straight chain or branched alkynyl containing 2 to 10 carbon atoms, such as ethur (CH ⁇ C—), 1_propynyl (CH 3 C 3 C_) is exemplified. Also, for example, C2-C10 substituted alkyl
  • Ninole refers to C2 to C10 alkynyl, in which one or more hydrogen atoms are replaced by substituents.
  • alkynyl means “alkynyl” or “substituted alkynyl” as defined above, which may be shifted.
  • alkoxy refers to a monovalent group formed by loss of a hydrogen atom of a hydroxy group of an alcohol, and is generally represented by CH 0 (where n is 1 or more).
  • “Substituted alkoxy” refers to alkoxy in which H of alkoxy is substituted by the substituent specified below. Specific examples include C1-C2 alkoxy, C1-C3 alkoxy, C1-C4 alkoxy, C1-C5 alkoxy, C1-C6 alkoxy, C1-C7 alkoxy, C1-C8 alkoxy, C1-C9 alkoxy, C1-C10 alkoxy C1-C11 anoroxy, C1-C12 alkoxy, C1-C2 substituted alkoxy, C1-C3 substituted alkoxy, C1-C4 substituted alkoxy, C1-C5 substituted ananoloxy, C1-C6 substituted Alkoxy, C1-C7 substituted alkoxy, C1-C8 substituted alkoxy, C1-C9 substituted alkoxy, C1-C10 substituted alkoxy, C1-C11 substituted alkoxy or C1-C
  • Mouth poxy (CH CH CH O—) and the like are exemplified.
  • optionally substituted alkoxy means either “alkoxy” or “substituted alkoxy” as defined above.
  • heterocycle (group) refers to a group having a cyclic structure including carbon and heteroatoms.
  • the heteroatom is selected from the group consisting of 0, S and N, and may be the same or different, and may be included in one or two or more.
  • Heterocyclic groups can be aromatic or non-aromatic and can be monocyclic or polycyclic. The heterocyclic group may be substituted.
  • optionally substituted heterocycle (group) means “heterocyclic ring (group)” or “substituted heterocycle (group)” defined above. I mean, even if it ’s a gap
  • alcohol refers to an organic compound in which one or more hydrogen atoms of an aliphatic hydrocarbon are substituted with a hydroxyl group. In this specification, it is also expressed as ROH.
  • R is an alkyl group. Preferably, R may be C1-C6 alkyl.
  • examples of alcohols include methanol, ethanol, 1_propanol, 2-propyl. Examples include, but are not limited to, ropanol.
  • the “carbocyclic group” is a group containing a cyclic structure containing only carbon, and includes the above-mentioned “cycloalkyl”, “substituted cycloalkyl”, “cycloalkenyl”, “ A group other than “substituted cycloalkenyl”.
  • Carbocyclic groups can be aromatic or non-aromatic and can be monocyclic or polycyclic. “Substituted carbocyclic group” refers to a carbocyclic group in which H of the carbocyclic group is substituted by the substituent specified below.
  • C3-C4 carbocyclic group C3-C5 carbocyclic group, C3-C6 carbocyclic group, C3-C7 carbocyclic group, C3-C8 carbocyclic group, C3-C9 carbocyclic group, C3-C10.
  • Carbocyclic group C3-C11 carbocyclic group, C3-C12 carbocyclic group, C3-C4-substituted carbocyclic group, C3-C5-substituted carbocyclic group, C3-C6-substituted carbocyclic group, C3- C7 substituted carbocyclic group, C3-C8 substituted carbocyclic group, C3-C9 substituted carbocyclic group, C3-C10 substituted carbocyclic group, C3-C11 substituted carbocyclic group or C3 It can be a C12 substituted carbocyclic group.
  • the carbocyclic group can also be a C4-C7 carbocyclic group or a C4-C7 substituted carbocyclic group.
  • Examples of the carbon ring group include those in which one hydrogen atom is deleted from a phenyl group.
  • the hydrogen deletion position may be any position chemically possible, and may be on an aromatic ring or a non-aromatic ring.
  • the "optionally substituted carbocyclic group” refers to the above-defined “carbocyclic group” or “substituted carbocyclic group”. Means that.
  • heterocyclic group refers to a group having a cyclic structure including carbon and heteroatoms.
  • the heteroatom is selected from the group consisting of ⁇ , S and N, and may be the same or different, and may be contained in one or more.
  • Heterocyclic groups can be aromatic or non-aromatic and can be monocyclic or polycyclic.
  • “Substituted hetero ring group” means a hetero ring group in which H of the hetero ring group is substituted by the substituent specified below.
  • C3-C4 carbocyclic group C3-C5 carbocyclic group, C3-C6 carbocyclic group, C3-C7 carbocyclic group, C3-C8 carbocyclic group, C3-C9 carbocyclic group, C3-C10.
  • Carbocyclic group C3-C11 carbocyclic group, C3-C12 carbocyclic group, C3-C4-substituted carbocyclic group, C3-C5-substituted carbocyclic group, C3-C6-substituted carbocyclic group, C3 ⁇ C7 substituted carbocyclic group, C3-C8 substituted carbocyclic group, C3-C9 substituted charcoal
  • Heterocyclic groups can also be those in which one or more heteroatoms are substituted for the carbon atoms of a C4-C7 carbocyclic group or a C4-C7 substituted carbocyclic group.
  • the heterocyclic group include a cetyl group, a pyrrolyl group, a furyl group, an imidazolyl group, and a pyridyl group.
  • the hydrogen deletion position may be any position chemically possible, and may be on an aromatic ring or a non-aromatic ring.
  • a carbocyclic group or a heterocyclic group may be substituted with a divalent substituent in addition to being substituted with a monovalent substituent as defined below.
  • halogen refers to a monovalent group of elements such as fluorine (F), chlorine (Cl), bromine (Br), iodine (I) belonging to Group 7B of the periodic table. .
  • hydroxy refers to a group represented by OH.
  • substituted hydroxy refers to hydroxy substituted with H as defined below.
  • thiol is a group (mercapto group) in which an oxygen atom of a hydroxy group is substituted with a sulfur atom, and is represented by SH.
  • substituted thiol refers to a group in which the H of a mercapto is substituted with a substituent as defined below.
  • carboxy refers to a group represented by COOH.
  • substituted carboxy refers to a carboxy H substituted with a substituent as defined below.
  • acyl refers to a monovalent group formed by removing OH from a carboxylic acid. . Typical examples of acyl groups include acetyl (CH 2 CO 3), benzoyl (CH 2 CO 3), etc.
  • Substituted acyl refers to a hydrogen substituted with the substituent defined below.
  • amide is a group in which hydrogen of ammonia is substituted with an acid group (acinole group), and is preferably represented by —CONH. “Substituted amide” means that the amide is substituted.
  • thiocarbonyl is a group in which an oxygen atom in carbonyl is substituted with a sulfur atom, and includes a characteristic group — (C ⁇ S) —.
  • Thiocarbonyl includes thioketones and thioaldehydes.
  • Substituted thiocarbonyl means thiocarbonyl substituted with a substituent selected as described below.
  • sulfonyl is a generic term for a substance containing SO which is a characteristic group.
  • Substituted sulfonyl means a sulfonyl substituted with a substituent selected below.
  • sulfinyl is a generic term for a substance containing SO 2 which is a characteristic group.
  • substituted sulfiel means sulfiel that is substituted with a substituent selected below.
  • aryl refers to a group formed by leaving one hydrogen atom bonded to an aromatic hydrocarbon ring, and is included in the carbocyclic group in the present specification.
  • substitution refers to replacement of one or more hydrogen atoms in an organic compound or substituent with another atom or atomic group.
  • One hydrogen atom can be removed and substituted with a monovalent substituent, and two hydrogen atoms can be removed and substituted with a divalent substituent.
  • substitution refers to replacement of one or more hydrogen atoms in an organic compound or substituent with another atom or atomic group. It is also possible to remove one hydrogen atom and replace it with a monovalent substituent, and the hydrogen atom It is also possible to remove two and substitute with a divalent substituent.
  • Examples of the substituent in the present invention include alkyl, cycloalkyl, alkenyl, cycloalkenyl, alkynyl, alkoxy, carbocyclic group, heterocyclic group, halogen, hydroxy, thiol, cyano, nitro, amino, carboxy, and rubamoyl. , Acyl, acyloleamino, thiocarboxy, amide, substituted carbonyl, substituted thiocarbonyl, substituted sulfonyl or substituted sulfinyl. Such substituents can be appropriately used in the present invention when designing amino acids.
  • each when there are a plurality of substituents, each may independently be a hydrogen atom or an alkyl, but not all of the plurality of substituents are hydrogen atoms. More preferably, independently, when there are multiple substituents, each may be independently selected from the group consisting of hydrogen and C1-C6 alkyl. All of the substituents may have a substituent other than hydrogen, but preferably have at least one hydrogen, more preferably 2 to n (where n is the number of substituents) hydrogen. Can do. It may be preferred that the number of hydrogens in the substituent is large.
  • the substituent other than hydrogen may preferably be C1-C6 alkyl, C1-C5 alkyl, C1-C4 alkyl, C1-C3 alkyl, C1-C2 alkyl, methyl and the like.
  • the effect of the present invention may be enhanced, it may be preferable to have a large substituent.
  • Cl, C2,... Cn represent the number of carbon atoms. Therefore, C1 is used to represent a 1 carbon substituent.
  • optical isomer refers to one or a pair of a pair of compounds that have a mirror-image relationship with a crystal or molecule and cannot be superimposed. It is a form of stereoisomer, and the other properties are the same, but only the optical rotation is different.
  • protection reaction refers to a reaction in which a protecting group such as Boc is added to a functional group desired to be protected. By protecting the functional group with the protecting group, the reaction of the functional group having higher reactivity can be suppressed and only the functional group having lower reactivity can be reacted.
  • the protection reaction can be performed by, for example, a dehydration reaction.
  • deprotection reaction refers to a reaction for removing a protecting group such as Boc. Examples of the deprotection reaction include a reaction such as a reduction reaction using Pd / C. The deprotection reaction can be performed, for example, by hydrolysis.
  • examples of the “protecting group” include a fluorenylmethoxycarbonyl (F moc) group, a acetyl group, a benzyl group, a benzoyl group, a t_butoxycarbonyl group, a t-butyldimethyl group, a silyl group.
  • F moc fluorenylmethoxycarbonyl
  • acetyl group a benzyl group
  • a benzoyl group a t_butoxycarbonyl group
  • a t-butyldimethyl group a silyl group.
  • Group, trimethylsilylethyl group, N-phthalimidyl group, trimethinolesyllinoleethyloxycarbonyl group, 2_nitro-4,5-dimethoxybenzyl group, 2-nitroxy-4,5-dimethoxybenzyloxycarbonyl group, force A rubamate group is a typical protection group.
  • the target product is a contaminant (unreacted weight loss, by-product, solvent, etc.) from the reaction solution, and a method commonly used in the art (for example, extraction, distillation, After removal by washing, concentration, precipitation, filtration, drying, etc.) followed by a combination of post-treatment methods commonly used in the art (eg adsorption, elution, distillation, precipitation, precipitation, chromatography, etc.) obtain.
  • a method commonly used in the art for example, extraction, distillation, After removal by washing, concentration, precipitation, filtration, drying, etc.
  • post-treatment methods commonly used in the art
  • screening refers to selecting a target such as an organism, cell, or substance having a specific target property from a large number of populations by a specific operation / evaluation method.
  • the factors eg antibodies
  • a library generated using an in silico system system using a computer
  • compounds obtained by screening having a desired activity are also included within the scope of the present invention.
  • Candidate compounds include, for example, proteins, polypeptides, oligopeptides, peptides, polynucleotides, oligonucleotides, nucleotides.
  • DNA DNA, nucleic acids (including cDNA, DNA such as genomic DNA, RNA such as mRNA), polysaccharides, oligosaccharides, lipids, small organic molecules (eg, hormones, ligands, information transmitters, small organic molecules) , Molecules synthesized by combinatorial chemistry, small molecules that can be used as pharmaceuticals (for example, small molecule ligands, etc.), and composite molecules of these can be used, but are not limited thereto.
  • a candidate compound is also called a candidate drug if the candidate is a drug.
  • Such a set of candidate compounds is also called a library.
  • compound species refers to a single compound having a desired property, such as having a specific target activity in a certain group of compounds. .
  • a compound species such as a compound species.
  • it is also simply referred to as a compound.
  • library refers to a certain collection of compounds for screening.
  • a library may be a collection of compounds having similar properties or a collection of random compounds.
  • a set of compounds predicted to have similar properties is used, but not limited thereto.
  • the compound library used in the present invention can be prepared by any means including, but not limited to, combinatorial chemistry techniques, fermentation methods, plant and cell extraction procedures, and the like. Power or can be obtained. Methods for creating combinatorial libraries are well known in the art. For example, ER Felder, Chimia 1 994, 48, 512-541; Gallop et al., J. Med. Chem. 1994, 37, 1233-1251; RA Houghten, Trends Genet.
  • modulation refers to biological activity when referring to PPAR. Is to be changed.
  • inhibitor refers to the reduction or disappearance of biological activity when referring to PPAR.
  • promotion refers to the occurrence of a state from a state where the biological activity is increased or absent when referring to PPAR.
  • biological test refers to determining whether a compound has a certain activity using an actual biological reaction. Biological tests include in vitro and in vivo tests. Biological testing is therefore an opposite concept to in silico.
  • evaluation when used in screening, refers to determining whether a candidate compound is capable of meeting the requirements of such an indicator with respect to an indicator (eg, pharmacological activity). .
  • an indicator eg, pharmacological activity
  • evaluation can be performed using methods known in the art, and can be performed in silico (using a computer) or wet (performing an actual biological assay).
  • a screening hit can be confirmed by an assembly using a genetic technique.
  • expression of a gene product such as a gene, a polynucleotide, or a polypeptide means that the gene (usually a DNA form) or the like undergoes a certain action in vivo. To be in form.
  • a gene, a polynucleotide, etc., force S, transcribed and translated to form a polypeptide, but transcribed to produce mRNA may also be a form of expression.
  • such polypeptide forms may have undergone post-translational processing (eg, leader sequence excision).
  • a gene "expressed specifically” means that the gene is different (preferably higher) from another site or time in a specific site or time of an organism. It is expressed. It can be expressed specifically at a certain site (for example, a specific site such as a diseased site) or at other sites. The expression specifically preferably means that it is expressed only at a certain site. Such specific expression can be realized by utilizing the characteristics of antigen-presenting cells.
  • only expression in a cell means that a gene is expressed only in that cell and is not substantially expressed in cells of other species. Therefore, expression only in a certain cell includes specific expression in that cell. In this case, it is active in adipocytes and there is almost no non-specific expression in other cells.
  • activity refers to an activity of a function that a gene or gene product originally intends to exhibit when it refers to a gene or gene product such as a nucleic acid or protein. Examples of such activity include, but are not limited to, PPAR, fat cell differentiation, regulation of sugar metabolism, regulation of lipid metabolism, and the like.
  • “detection” or “quantification” of gene expression is accomplished using appropriate methods including, for example, mRNA measurement and immunological measurement methods. Can be done. Examples of molecular biological measurement methods include Northern blot method, dot plot method, PCR method and the like. Examples of the immunological measurement method include ELISA, RIA, fluorescent antibody method, Western plot method, immunohistological staining method and the like using a microtiter plate as necessary. Examples of the quantification method include ELISA method and RIA method. It can also be performed by a gene analysis method using an array (eg, DNA array, protein array).
  • an array eg, DNA array, protein array
  • the DNA array is widely outlined in (edited by Shujunsha, separate volume of cell engineering “DNA microarray and the latest PCR method”).
  • the protein array is described in detail in Nat Genet. 2002 Dec; 32 suppl: 526_32.
  • gene expression analysis methods include, but are not limited to, RT_PCR, RACE method, SSCP method, immunoprecipitation method, two-hybrid system, and in vitro translation. Such further analysis methods are described, for example, in the genome analysis experiment method 'Yusuke Nakamura Lab' manual, edited by Yusuke Nakamura Yodosha (2002), etc., and all the descriptions in this specification are for reference. Be used.
  • expression amount refers to the amount of polypeptide or mRNA expressed in a target cell or the like. As such expression level, using the antibody of the present invention
  • “Change in the expression level” means an increase in the expression level at the protein level or mRNA level of the polypeptide of the present invention evaluated by any appropriate method including the above immunological measurement method or molecular biological measurement method. Or it means to decrease.
  • upstream refers to the position of the force from a particular reference point to the 5 'end of a polynucleotide.
  • downstream refers to a position that is directed toward a 3 'end of a polynucleotide from a particular reference point.
  • base pair and "Watson & Crick base pair” are used interchangeably herein, and are similar to those found in double-stranded DNA.
  • base pair When a group is bonded to a thymine residue or uracinole residue by two hydrogen bonds, and a cytosine residue and a guanine residue are bonded to each other by three hydrogen bonds, nucleotides that can hydrogen bond to each other based on the identity of the sequence. (See Stryer, L., Biochemistry, 4th edition, 1995).
  • the terms "complementary” or “complement” are used herein to refer to the entire complementary region intact with another specific polynucleotide and Watson & Crick base pair.
  • the sequence of polynucleotides that can form For purposes of the present invention, a first polynucleotide is considered to be complementary to a second polynucleotide when each base of the first polynucleotide is paired with its complementary base.
  • Complementary bases are generally A and T (some are A and U), or C and G.
  • the term “complement” is used as a synonym for “complementary polynucleotide”, “complementary nucleic acid” and “complementary nucleotide arrangement IJ”. These terms apply to a pair of polynucleotides based solely on their sequence, and It does not apply to a specific set of nucleotides that are in fact bound.
  • the Gnolecose clamp method is one of the methods for evaluating insulin sensitivity in peripheral tissues.
  • This gno-record clamp method is currently considered to be able to evaluate sensitivity most accurately.
  • glucose solution is infused while monitoring blood glucose level under continuous infusion of insulin, and blood glucose level is kept at fasting blood glucose level.
  • the required rate of injecting glenolecose is used as a glucose metabolism rate and is an indicator of insulin sensitivity.
  • the result of the test can be expressed as an average soil standard error.
  • the significant difference test is performed by a t-test, for example, it can be determined that the value is significant when the p-value is less than 0.05.
  • Example study design 1 Twenty patients with type 2 diabetes are randomly assigned to two groups of 10 each. Adjusted for differences in age, sex, body mass index, oral hypoglycemic medication, fasting blood glucose, and background factors such as hemoglobin A between study group and placebo group
  • Patients in the study group are orally administrated with the candidate compound 3 times a day for 1 week.
  • Patients in the placebo group should receive a similar placebo tablet once daily by mouth three times a day for one week.
  • blood is collected from the patient's vascular catheter on a fasting into a tube containing EDTA 1.2 mg and Aprotune (Trasylor, Bayer, Germany) 400 KIU. Plasma collected by centrifugation was stored at -40 ° C until analysis. Glucose, fructosamine and hemoglobin A in the blood
  • glucose clamp hyperinsulinemic-normoglycemic-clamp; hereinafter referred to as "glucose clamp”
  • ELISA enzyme-lin Ked immunosorbent assay
  • KKAy mice are insulin model animals that exhibit insulin resistance (Japanese clinical 60 ⁇ , special issue 8, 38-44, (2002)), and sulfonylurea hypoglycemia, a type 2 diabetes therapeutic agent based on insulin secretion promoting action.
  • the drug is known not to be effective (Medical Pharmacy, Vol. 24, No. 3, 131–136, (1990)).
  • KKAy mice suppression of blood glucose levels in KKAy mice by approximately 45% results in approximately the same as blood glucose levels in normal mice. preferable.
  • mice Measurement of the hypoglycemic rate by the oral administration hypoglycemic test using KKAy mice can be performed by a known method. Preferred methods are shown below.
  • 6 male mice (KKAy / Ta) aged 11 weeks are used as a group for the test.
  • blood is collected from the tail to measure the blood glucose level before treatment.
  • the biguanide derivative is dissolved in 0.5% CMC-Na (Sodium Carboxym ethyl Cellulose) solution at an appropriate concentration and orally administered at a dose of lOmLZkg.
  • CMC-Na Sodium Carboxym ethyl Cellulose
  • blood samples are collected from the tail to measure blood glucose levels.
  • the blood glucose level is measured using Glucose CII—Test Sakai (manufactured by Wako Pure Chemical Industries, Ltd.).
  • the blood glucose lowering rate is obtained by the following formula.
  • Blood glucose lowering rate (%) [(AUC of blood glucose level of control group_AUC of blood glucose level of compound administration group) / AUC of blood glucose level of control group] X 100
  • the AUC of the blood glucose level represents the area up to 6 hours after the drug administration, in which the blood glucose level change after the drug administration is plotted against the time, with the gnolecose value 0 as the baseline.
  • A blood glucose level before drug administration
  • B blood glucose level 1 hour after drug administration
  • C blood glucose level 2 hours after drug administration
  • D blood glucose level 4 hours after drug administration
  • E drug
  • the AUC for blood glucose level is given by the following formula:
  • Blood glucose level AUC 1 X ((A + B) / 2) + l X ((B + C) / 2) + 2 X ((C + D) / 2) + 2 X ((D + E) / 2)
  • the strength of the insulin sensitivity-enhancing action is due to the administration of drugs to db / db mice (Japanese clinical 60 ⁇ , extra number 8, 38-44, (2002)), a diabetes model animal that exhibits insulin resistance. It can also be evaluated by the blood glucose lowering rate.
  • the blood glucose level of dbZdb mice is almost the same as that of normal mice when the blood glucose level is suppressed by about 50%, and thus the rate of blood glucose reduction is 40% or more. It is more preferable that it is 50% or more.
  • the measurement of the blood glucose lowering rate by the oral glucose tolerance test using dbZdb mice can be carried out by a known method. Preferred methods are shown below. That is, first, 11-1 7-week-old female mice (C57BLKS / J—m + / + Lepr db> (db / db)) are fasted for 18-24 hours. At this time, 5 to 6 animals are used as a group for the test. As a control, blood is collected from the tail to measure the blood glucose level before treatment. After blood collection, the biguanide derivative is dissolved in phosphate buffered saline at an appropriate concentration and administered subcutaneously at a dose of 5 mlZkg.
  • a mouse to which only the solvent is administered is prepared as a control.
  • 30 minutes after administration of the compound or solvent gnolecose is orally administered at a dose of 3 gZ6 ml / kg, and an oral glucose tolerance test is performed.
  • Blood is collected from the tail to measure blood glucose levels 30 minutes, 1 hour, and 2 hours after glucose administration. The blood glucose level is measured using the new Blood 'Sugar Test (Roche's Diagnostax Co., Ltd.) or the Gnore Course CII Itest Test Co. (Wako Pure Chemical Industries, Ltd.).
  • the blood glucose lowering rate is obtained from the following equation.
  • Hypoglycemic rate (%) [(AUC of elevated blood glucose in vehicle administration group-AUC of elevated blood glucose in compound administration group) / AUC of elevated blood glucose in vehicle administration group] X 100
  • Blood glucose elevation AUC 0.5 X ((A + B) / 2-A) + 0.5 X ((B + C) / 2—A) + 1 X ((C + D) / 2-A )
  • Measurement of the blood glucose lowering rate and blood lactic acid level by the oral glucose tolerance test can be performed by a known method, and the former measurement can be performed by the method described above.
  • the latter measurement can be suitably performed by the following method. That is, first, 11 to 17-week-old female mice (C57BLKSZj_m + / + Lepr ⁇ db> (db / db)) are fasted for 18 to 24 hours. At this time, 5 to 6 animals are used as a group for the test. As a control, blood is collected from the tail to measure the blood lactate level before treatment.
  • Appropriate biguanide derivatives after blood collection Dissolve in phosphate buffer saline at a suitable concentration and administer subcutaneously at a dose of 5 ml / kg.
  • a mouse to which only the solvent is administered is prepared as a control.
  • 30 minutes after administration of the compound or solvent gnolecose is orally administered at a dose of 3 g / 6 ml / kg, and an oral glucose tolerance test is conducted.
  • Blood is collected from the tail to measure blood lactate levels 30 minutes, 1 hour, and 2 hours after glucose administration.
  • the blood lactic acid level can be measured by using “Force” Sigma (manufactured by Sigma “Dagno Stakes”).
  • Rate of increase in blood lactate (%) [(AUC of blood lactate in compound administration group-AUC of blood lactate in solvent administration group) AUC of blood lactate in Z solvent administration group] X 100
  • AUC of blood lactate level represents an area up to 2 hours after glucose administration in a graph in which changes in blood lactate level after administration of gnolecose were plotted against time.
  • £ blood lactate level before administration of gno-lecose
  • F blood lactate level 30 minutes after glucose administration
  • G blood lactate level 1 hour after glucose administration
  • H blood lactate level 2 hours after glucose administration
  • the AUC for blood lactate is expressed by the following formula:
  • variant molecules are designed to analyze the amino acid sequence and conformation of a pre-mutation protein or polypeptide molecule (e.g., a wild-type molecule (e.g., PPAR)) to determine what each amino acid is.
  • a pre-mutation protein or polypeptide molecule e.g., a wild-type molecule (e.g., PPAR)
  • properties e.g., catalytic activity, interactions with other molecules, etc.
  • desired property modifications eg, improved catalytic activity, improved protein stability, etc.
  • the design method is preferably performed using a computer. Examples of computer programs used in such design methods include the following, as mentioned in this specification: DENZO, a program for processing X-ray diffraction data, as a program for analyzing the structure.
  • MCSS Multiple Copy simultaneous Search Method Proteins: Structure, Function and Genetics, 11, 29-34 (1991)).
  • MCSS is available from Molecular Simulations, San Diego, CA.
  • AUTODOCK is available from Scripps Research Institute, La Jolla, CA.
  • DOCK is available from the University of California, San Francisco, CA.
  • candidate compounds compounds
  • they can be assembled into a single compound or complex with PPAR.
  • the 3D image displayed on the computer screen in relation to the structural coordinates of the PPAR or its modulating agent. Visual inspection of the relationship of each other's fragments can be performed on the table. This is followed by manual model building using software such as Quanta or Symbyl [Tripos Associates, St. Louis, MO].
  • Useful programs that can be used in linking individual chemicals include:
  • CAVEAT PA Bartlett et al., "CAVEAT: A Program to Facilitate the Structure-Derived Design of Biologically Active Molecules J (Molecular Recognition in Chemical and Biological Problems, Special Pub., Royal Chem. Soc., 78 182-196 (1989); G, Lauri and PA Bartlett, “CAVEAT: a Program to Facilitate the Design of Organic Molecules”, J. Comput. Aided Mol. Des., 8, 51-66 ( 1994)). CAVEAT is available from the University of California, Berkeley, CA.
  • inhibitory or other PPAR binding compounds use empty binding sites. Or can be designed globally or de novo, such as by including some known inhibitor moieties as needed. Examples of many new ligand design methods include, but are not limited to, the following.
  • LUDI (H. -J. Bohm, “The Computer Program LUDI: A New Met hod for the De Novo Design oi Enzyme Inhibitors J, J. Comp. Aid. Molec. Design, 6 61—78 (1992 LUDI stands for Molecular Simulations I ncorporated, San Diego, CA.
  • LEGEND (Y. Nishibata et al., Tetrahedron, 47, 8985 (1991)). LEGEN D is available from Molecular Simulations Incorporated, San Diego, CA.
  • an effective PPAR inhibitor should preferably exhibit a relatively small energy difference between its bound and free states (ie, a small deformation energy of binding).
  • PPAR inhibitors can interact with the binding pocket in two or more conformations that are similar in total binding energy. In these cases, the binding deformation energy is thought to be the difference between the energy of the free material and the average energy of these conformations observed when the inhibitor binds to the protein.
  • Substances designed or selected to bind to PPARs should preferably be designed so that there is no electrostatic repulsive interaction with the target enzyme and surrounding water molecules in its bound state. It can be further optimized by arithmetic. Such non-complementary electrostatic interactions include charge-charge repulsion interactions, dipole-dipole repulsion interactions and charge-dipole repulsion interactions.
  • Another approach possible with the present invention is the computational screening of small molecule databases for chemicals or compounds that can bind in whole or in part to PPARs.
  • the quality of such a substance's fit to the binding site can be determined by either shape complementarity or estimated interaction energy [E. C. Meng et al., J. Comp. Chem. , 16, 505-524 (1992)].
  • search refers to other nuclei having a specific function and defect or property using a certain nucleobase sequence electronically or biologically or by other methods. This refers to finding an acid-base sequence.
  • Electronic searches include BLAST (Altschul et al., J. Mol. Biol. 215: 403-410 (1990)), FASTA (Pearson & Lipman, Proc. Natl. Acad. Sci., USA 85: 2444. — 2448 (1988)), Smith and Waterman method (Smith and Waterman, J. Mol. Biol. 147: 195—197 (1981)), and Needleman and Wunsch method (Needleman and Wunsch, J. Mol.
  • the PPAR used in the present invention should also include the corresponding genes identified by such electronic and biological searches.
  • the percentages of “identity”, “homology” and “similarity” of sequences compare two sequences that are optimally aligned in a comparison window. Is required.
  • the portion of the polynucleotide or polypeptide sequence within the comparison window contains a reference sequence for the optimal alignment of the two sequences (although there may be gaps if other sequences contain additions).
  • the reference sequence herein may include additions or deletions (ie, gaps) when compared to those without additions or deletions. Find the number of match positions by determining the number of positions where the same nucleobase or amino acid residue is found in both sequences, and divide the number of match positions by the total number of positions in the comparison window.
  • BLAST Basic Local Alignment Search Tool
  • the BLAST program is an analogy called a “high-score segment pair” between an amino acid query sequence or nucleic acid query sequence, and preferably a test sequence obtained from a protein sequence database or nucleic acid sequence database.
  • the homologous sequence is identified by specifying the segment.
  • Many high-score segment pairs are preferably identified (ie, ordered 1J) by a scoring matrix well known in the art.
  • a BLOSUM62 matrix Gonnet et al., 1992, Science 256: 1443-1445, Henikoff and Henikoff, 1993, Proteins 17: 49-61) is used as the scoring matrix.
  • PAM or PAM250 matrices can also be used (eg Schwartz and Dayhoff, ed s., 1978, Matrices for Detecting Distance Relationships: Atlas of Protein Sequence and Structure, Washington: National Biomedical Research Foundation) checking).
  • the BLAST program evaluates the statistical significance of all identified high-scoring segment pairs and preferably selects segments that meet a user-defined threshold level of significance, such as user-specific homology. The It is preferable to evaluate the statistical significance of high-scoring segment pairs using Karlin's formula for statistical significance (see Karlin and Altschul, 1990, Proc. Natl. Ac ad. Sci. USA 87: 2267— 2268). )
  • nucleic acid molecule used in the present specification has a part of the nucleic acid sequence deleted as long as the expressed polypeptide has substantially the same activity as the native polypeptide. Alternatively, it may be substituted with another base, or another nucleic acid sequence may be partially inserted. Alternatively, other nucleic acids may be bound to the 5 ′ end and the Z or 3 ′ end. Further, it may be a nucleic acid molecule that hybridizes under stringent conditions and has substantially the same function (promoter activity in the present invention).
  • compound means any distinguishable chemical or molecule, including small molecules, peptides, proteins, sugars, nucleotides, or nucleic acids. Without being limited thereto, and such compounds can be natural or synthetic.
  • small organic molecule refers to an organic molecule having a relatively small molecular weight. Usually, a small organic molecule has a molecular weight of about 1000 or less, but may have a higher molecular weight. Small organic molecules can be synthesized by using methods known in the art or by combining them. Such small organic molecules may be produced by living organisms. Examples of small organic molecules include hormones, ligands, signal transmitters, organic small molecules, molecules synthesized by combinatorial chemistry, and small molecules that can be used as pharmaceuticals (for example, small molecule ligands). Les, not limited to.
  • the cell used in the present invention is any organism as long as it has an adipocyte (for example, a mammal (for example, single pores, marsupials, rodents, wings, wings). , Carnivorous, carnivorous, long-nosed, odd-hoofed, even-hoofed, rodent, scale, sea cattle, cetacean, primate, rodent
  • adipocyte for example, a mammal (for example, single pores, marsupials, rodents, wings, wings).
  • Etc. derived cells can be used.
  • cells derived from primates eg, chimpanzee, dihonosa, human
  • Such cells can also be adherent cells including adipocytes, suspension cells, tissue-forming cells, mixtures thereof, and the like.
  • tissue refers to substantially the same in a multicellular organism. A cell population having a function and / or morphology. Usually “tissue” can be referred to as tissue if it has the same function and / or morphology even if it is a population of cells with the same origin but different origins. Usually, tissue constitutes part of an organ. Animal tissues are classified into epithelial tissue, connective tissue, muscle tissue, nerve tissue, etc. based on morphological, functional or developmental basis. Particularly in the present invention, adipose tissue is used as the object.
  • an organ when the S ware is targeted, such an organ may be any organ, and the tissue or cell targeted by the present invention is derived from any organ or organ of an organism. It ’s a thing.
  • organ or “organ” is used interchangeably, and a certain function of an individual organism is localized and operates in a specific part of the individual, and that part is morphologically independent.
  • Such organs or organs include organs or organs associated with adipose tissue.
  • examples of the organ targeted by the present invention include, but are not limited to, internal organs (eg, abdomen, liver, etc.) having adipose tissue.
  • organism refers to a form of an organism that can exist as one individual that can exist as an organism.
  • adipocyte refers to a cell that is a major component constituting an adipose tissue.
  • the characteristic of this cell is that it contains a large amount of fat that forms adipose tissue as a group along the running of capillaries as a loose connective tissue scattered among tissues.
  • Intracellular fat begins to appear as a few small droplets, grows gradually, fuses together, and finally occupies most of the cell body. Intracellular fat is easily detected by Sudan III or osmium tetroxide.
  • Adipocytes include white adipocytes and brown adipocytes. Methods for identifying adipocytes are known in the art, and examples include, but are not limited to, the detection of fat, expression of adipocyte differentiation markers, expression of adipocyte-specific site force-in, and the like. Not.
  • Adipose tissue is a kind of connective tissue, which is characteristic in that it stores lipids, and is a tissue having various other important functions.
  • Adipose tissue contains fat Accumulated. Adipocytes in adipose tissue are surrounded by lattice fibers, and capillaries are densely distributed between the cells. Other tissue forces When an independent and almost constant mass or tufted fat tissue is formed, it is called a fat body. Adipose tissue develops in, for example, the abdomen, skeletal muscles, buttocks, chest, and internal organs.
  • the adipocytes used when a gene is introduced so as to be expressed or suppressed in a fat-specific manner are various organisms (for example, humans, mice, rats, rabbits, guinea pigs, pigs). Or cultured cells isolated from sushi, etc.), or cells existing in a living body.
  • fat refers to a fatty acid glycerin ester that is solid at room temperature, and in this specification, it can sometimes be used synonymously with adipose tissue or fat cells.
  • Means for "specific delivery" to a certain tissue, cell, etc. can be realized by using a DDS technique known in the art.
  • a specific delivery method to fat include, for example, a method in which an antibody specific for a surface marker specifically expressed in fat is bound to the inhibitor of the present invention, and a fat cell-specific promoter is used. Examples include, but are not limited to, the expression control used.
  • Such techniques are described in, for example, Shin 'Drug Delivery System, Supervision: Tsuneji Nagai CMC, 2000, etc.
  • amount effective for diagnosis, prevention, treatment or prognosis is an amount that is recognized as being medically effective in diagnosis, prevention, treatment (or treatment), or prognosis, respectively. Say. Such amounts can be determined by one skilled in the art using techniques well known in the art, taking into account various parameters.
  • such a composition may further contain a pharmaceutically acceptable carrier and the like.
  • pharmaceutically acceptable carrier contained in the medicament of the present invention include any substance known in the art.
  • Carriers used herein are preferably pharmaceutically acceptable. Such carriers include antioxidants, preservatives, colorants, flavors, and diluents, milk Les, including, but not limited to, agents, suspending agents, solvents, fillers, bulking agents, buffers, delivery vehicles, diluents, excipients and / or pharmaceutical adjuvants.
  • the medicament of the present invention is administered in the form of a composition comprising the peptide of the present invention, or a variant or derivative thereof, together with one or more physiologically acceptable carriers, excipients or diluents.
  • a suitable vehicle can be water for injection, physiological solution, or artificial cerebrospinal fluid, which can be supplemented with other materials common to compositions for parenteral delivery. is there.
  • Acceptable carriers, excipients or stabilizers used herein are non-toxic to the recipient and are preferably inert at the dosages and concentrations used.
  • phosphate, citrate, or other organic acids e.g, phosphate, citrate, or other organic acids; ascorbic acid, hytocopherol; low molecular weight polypeptide; protein (eg, serum albumin, gelatin or immunoglobulin); hydrophilic polymer (eg, poly Amino acids (eg, glycine, gnoretamine, asparagine, arginine or lysine); monosaccharides, disaccharides and other carbohydrates (including glucose, mannose, or dextrin); chelating agents (eg, EDTA); sugar alcohols (eg, EDTA); , Mannitol or sorbito nore); salt form And / or non-ionic surfactants (eg, Tween, pluronic or polyethylene glycol (PEG)), and the like.
  • exemplary suitable carriers include neutral buffered saline or saline mixed with serum albumin.
  • the product is formulated as a lyophilizate using a suitable excipient (eg sucrose).
  • suitable excipient eg sucrose
  • Other standard carriers, diluents and excipients can be included as desired.
  • Other exemplary compositions include Tris buffer at pH 7.0-8.5 or acetate buffer at ⁇ 4 ⁇ 0-5.5, which additionally contains sorbitol or a suitable replacement thereof. May be included.
  • a general method for preparing the pharmaceutical composition of the present invention is shown below.
  • veterinary drug compositions, quasi-drugs, marine drug compositions, food compositions, cosmetic compositions and the like can also be produced by known preparation methods.
  • polypeptide, polynucleotide and the like of the present invention are combined with a pharmaceutically acceptable carrier, and are solid preparations such as tablets, capsules, granules, powders, powders, suppositories, or syrups, injections. Oral or parenteral as liquid preparations such as pharmaceuticals, suspensions, solutions, sprays, etc. Can be administered.
  • pharmaceutically acceptable carriers include excipients, lubricants, binders, disintegrants, disintegration inhibitors, absorption enhancers, adsorbents in solid preparations.
  • excipient in the solid preparation examples include glucose, latatose, sucrose, D-mannitol, crystalline cellulose, starch, calcium carbonate, light anhydrous caustic acid, sodium chloride salt, kaolin and urea.
  • Examples of the lubricant in the solid preparation include, but are not limited to, magnesium stearate, calcium stearate, boric acid powder, colloidal key acid, talc, and polyethylene glycol.
  • binder in the solid preparation examples include water, ethanol, propanol, sucrose, D-mannitol, crystalline cellulose, dextrin, methylcellulose, hydroxypropenoresenorelose, hydroxypropinoremethinoresenorelose, and canoleboxoxymethinoresenore.
  • examples thereof include rose, starch solution, gelatin solution, polyvinyl pyrrolidone, calcium phosphate, potassium phosphate, and shellac.
  • Examples of the disintegrant in the solid preparation include starch, carboxymethyl cellulose, carboxymethyl cellulose calcium, agar powder, laminaran powder, croscarmellose sodium, sodium carboxymethyl starch, sodium alginate, sodium hydrogen carbonate, calcium carbonate, Examples include, but are not limited to, polyoxyethylene sorbitan fatty acid esters, sodium laurinole sulfate, starch, monoglyceride stearate, latatose and calcium calcium glycolate.
  • Preferable examples of the disintegration inhibitor in the solid preparation include, but are not limited to, hydrogenated oil, sucrose, stearin, cocoa butter and hydrogenated oil.
  • absorption enhancers in solid preparations include quaternary ammonium bases and Although sodium lauryl sulfate etc. are mentioned, it is not limited to them.
  • Examples of the adsorbent in the solid preparation include, but are not limited to, starch, ratatoose, kaolin, bentonite, and colloidal caustic acid.
  • humectant in the solid preparation examples include, but are not limited to, glycerin and starch.
  • solubilizing agents in solid preparations include, but are not limited to, arginine, gnoretamic acid, aspartic acid, and the like.
  • Examples of the stabilizer in the solid preparation include, but are not limited to, human serum albumin and ratatose.
  • tablets, pills, etc. When preparing tablets, pills, etc. as solid preparations, they may be coated with a film of a gastric or enteric substance (sucrose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, etc.) as necessary. Also good. Tablets include tablets with ordinary coatings as necessary, such as sugar-coated tablets, gelatin-encapsulated tablets, enteric-coated tablets, film-coated tablets or double tablets, and multilayer tablets. Capsules include hard capsules and soft capsules. When forming into the form of a suppository, in addition to the additives listed above, for example, higher alcohols, esters of higher alcohols, semi-synthetic glycerides and the like can be added, but are not limited thereto.
  • a gastric or enteric substance sucrose, gelatin, hydroxypropylcellulose, hydroxypropylmethylcellulose phthalate, etc.
  • Tablets include tablets with ordinary coatings as necessary, such as sugar-coated tablets,
  • solvents in liquid preparations include water for injection, alcohol, propylene glycol, macrogol, sesame oil and corn oil.
  • Preferred solubilizers in liquid formulations for example, polyethylene glycol, propylene glycol, D-mannitol, benzyl benzoate, ethanol, trisaminomethane, cholesterol, triethanolamine, sodium carbonate and ken Examples include, but are not limited to, sodium acid.
  • the suspending agent in the liquid preparation include surfactants such as stearyl triethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glyceryl monostearate,
  • surfactants such as stearyl triethanolamine, sodium lauryl sulfate, laurylaminopropionic acid, lecithin, benzalkonium chloride, benzethonium chloride, glyceryl monostearate
  • hydrophilic polymers such as cellulose and hydroxypropyl cellulose, but are not limited thereto.
  • isotonic agents in liquid preparations include, but are not limited to, sodium chloride salt, glycerin, D-mannitol and the like.
  • buffering agents in liquid preparations include, but are not limited to, buffers such as phosphates, acetates, carbonates, and citrates.
  • Preferred examples of soothing agents in liquid preparations include, but are not limited to, benzenolic alcohol, benzanoleconium chloride, and pro-hydrochloric acid hydrochloride.
  • Preferred preservatives in liquid preparations for example, para-benzoic acid esters, chlorobutanol and pendinoleanolenoconole, 2_phenenoletinoleanoreconole, dehydroacetic acid, sorbic acid, etc. But are not limited thereto.
  • antioxidant in the liquid preparation include, but are not limited to, sulfite, ascorbic acid, human coferol and cysteine.
  • the solution and suspension are preferably sterilized and isotonic with blood. Usually, these are sterilized by filtration using a bacteria retaining filter or the like, blending with a disinfectant, or irradiation. Furthermore, after these treatments, the solid is obtained by freeze-drying or the like, and immediately before use, sterile water or a sterile diluent for injection (lidocaine hydrochloride aqueous solution, physiological saline, aqueous glucose solution, ethanol or a mixed solution thereof, etc.) May be added.
  • the pharmaceutical composition may contain coloring agents, preservatives, fragrances, flavoring agents, sweeteners, and the like, as well as other agents.
  • the medicament of the present invention may be a physiologically acceptable carrier, excipient, or stabilizing agent (Japanese Pharmacopoeia 14th edition, its supplement or its latest edition, Remington's Pharm aceutical Sciences, as necessary). , 18th Edition, AR Gennaro, ed., Mack Publishing Company, 1990, etc.) and a glycan composition having the desired degree of purity to form a freeze-dried cake or aqueous solution. Can be prepared and stored.
  • the amount of the composition of the present invention to be administered depends on the purpose of use, target disease (type, severity, etc.), It can be easily determined by those skilled in the art in consideration of the age, weight, sex, medical history, cell morphology or type of the person.
  • the frequency with which the treatment method of the present invention is applied to a subject (or patient) also depends on the purpose of use, target disease (type, severity, etc.), patient age, weight, gender, medical history, treatment history, etc. Can be easily determined by those skilled in the art.
  • the frequency is, for example, once a month every day (for example, once a week-once a month). It is preferable to administer once a week _ once a month while monitoring the course
  • patient refers to an organism to which the treatment of the present invention is applied, and is also referred to as “subject” or “subject”.
  • the patient may preferably be a human.
  • the present invention provides methods of treatment, inhibition and prevention by administration of an effective amount of a composition of the present invention to a patient.
  • the composition of the present invention may be substantially purified (eg, the ability to limit its effect, or a condition that is substantially free of substances that cause undesirable side effects). ).
  • the compound or composition can be delivered encapsulated in vesicles, particularly ribosomes (Langer, Science 249: 1527-1533 (1990); Treat et al., Liposomes m the fherapy of Infectious Disease and ancer, Lo pez— Berestein and Fidler (eds.), Liss, New York, pp. 353-365 (1989); see Lo pez-Berestein, ibid., pages 317-327; see broadly )
  • the compound or composition can be delivered in a controlled sustained release system.
  • administering means that the pharmaceutical of the present invention or the like or a pharmaceutical composition containing the same is given to a host intended for treatment alone or in combination with other therapeutic agents.
  • the combinations can be administered, for example, either as a mixture simultaneously, separately but simultaneously or in parallel; or sequentially. This includes a presentation where the combined drugs are administered together as a therapeutic mixture, and the combined drugs are administered separately but simultaneously (eg, through separate mucosa to the same individual). Also includes. “Combination” administration further includes the separate administration of one of the compounds or agents given first, followed by the second.
  • the administration of the medicament in the present invention may be performed by any method, but it is advantageous to use needleless injection. This is because it can be administered without undue burden on the patient.
  • the needleless syringe in the present invention is more preferably subcutaneously using a drug component subcutaneously by moving the piston by the gas pressure or the elasticity of the elastic member without using an injection needle and spraying the drug solution onto the skin. It means a medical device that is administered into subcutaneous cells.
  • Shimajet TM manufactured by Shimadzu Corporation
  • Medi-Jector Vision TM manufactured by Elite medical
  • Penjet TM manufactured by Pen Jet Etc.
  • AP2 promoter-acting Cre transgenic mice are widely used to specifically introduce or delete genes in adipose tissue (Imai, T. et al., Proc. Natl. Acad. Sci. USA) 98, 224-228 (2001), Bluher, M. et al., Developmental Cell 3, 25-38 (2002) and Barlow, C. et al., Nuc. Acid Res. 25, 2543-2545 (1997)).
  • the aP2 promoter is activated in macrophages and adipocytes (Fu, Y. et al., Atherosclerosis 165, 259-269 (2002)).
  • Cre transgenic mice that express the Cre gene in an adipocyte-specific manner are desired.
  • Adiponectin ZACRP30 is a fat-derived hormone identified by the present inventors by screening for fat-specific genes in a human cDNA project (Maeda, K. et al., Biochem. Biophys. Res. Commun. 221, 286-289 (1996)). Adiponectin is highly expressed in adipocytes, adipose most ab It was first discovered as undant gene 1 (apMl). Adiponectin mRNA is expressed exclusively in human, monkey and mouse differentiated adipocytes and adipose tissue (Maeda, N. et al., Nature Med. 8, 731-737 (2002)). In other cell types, including macrophages, adiponectin mRNA expression is not detected. Therefore, the present inventors considered that the adiponectin promoter is ideal for obtaining a completely adipocyte-specific transgenic mouse.
  • the present inventors have prepared adiponectin promoter actuation of Cre trans di
  • Adiponectin one Cr e / PPAR f ° lx / fl ° x lacks PPAR expressing tissue-specific and shows a stimulation effect of Akt signaling in adipose tissue, increased insulin sensitivity resulting.
  • Very interesting, especially fat PPAR deficiency significantly induces mitochondrial biogenesis in accumulated fat and increases energy expenditure, and these changes are associated with increased body weight and fat despite increased feeding. There was a significant decrease in weight.
  • Our physiologic experiment also suppresses heat production by down-regulating mitochondrial-related genes in adipocytes that not only negatively regulate PPAR force S insulin-mediated signaling. Also suggested.
  • Our data provide a therapeutic strategy for treating obesity and type 2 diabetes by enhancing the inhibitory energy expenditure and insulin sensitivity of PPAR in adipocytes.
  • adiponectin 2kb promoter a specific adipose tissue promoter that has little expression.
  • the promoter region of adiponectin the homology between human and mouse is very high, and as a result of cloning and analyzing the DNA sequence of 3600 bases from the promoter region start point, the sequence containing this region is It has been found that it has a promoter activity that exceeds the adiponectin 2 kb promoter described above and has adipocyte specificity.
  • This invention The adiponectin 3.6 kb promoter also surpasses the AP-2 promoter not only in its specificity but also in its activity. In the present invention, such a promoter that induces expression specifically in fat (preferably only in fat) has been isolated.
  • the present invention provides:
  • Polynucleotides selected from the group of forces can be used.
  • the polynucleotide used in the present invention consists of the sequence shown in SEQ ID NO: 10.
  • the present invention provides a vector comprising the polynucleotide.
  • a gene to be expressed in adipocytes is operably linked to the vector of the present invention.
  • the vector of the present invention may further contain a poly A sequence on the 3 ′ side of the gene.
  • the present invention further provides an adipocyte-specific Cre expression vector comprising the above-mentioned polynucleotide and a Cre recombinase gene operably linked to the polynucleotide.
  • the vector of the present invention is a virus-derived vector (eg, an adenovirus-derived vector or a retrovirus-derived vector).
  • the vector further comprises a poly A sequence.
  • the present invention provides an adipocyte into which the above vector has been introduced; an adipose tissue containing the adipocyte; a non-human animal containing the adipocyte (eg, mouse, rat, rabbit, guinea pig, etc.).
  • a non-human animal containing the adipocyte eg, mouse, rat, rabbit, guinea pig, etc.
  • the present invention is a method for producing a fat cell that specifically expresses a useful gene, wherein the vector used in the present invention is introduced into the fat cell. And a method of expressing the gene.
  • the present invention is a method for specifically producing a target gene in an adipocyte, the step of introducing a vector used in the present invention into an adipocyte, and the expression of the gene.
  • a method comprising the steps of:
  • the expression of the gene is suppressed in cells other than adipocytes (for example, human cells, mouse cells, rat cells, rabbit cells, and guinea pig cells, preferably human cells).
  • adipocytes for example, human cells, mouse cells, rat cells, rabbit cells, and guinea pig cells, preferably human cells.
  • the present invention provides a method for producing a transgenic non-human animal (for example, mouse, rat, rabbit, guinea pig, etc., preferably the above-mentioned adipocyte-specific Cre expression vector). And a transgenic non-human animal produced by this method, which also requires high expression of genes in adipocytes, but fibroblasts,
  • the present invention relates to the use of the above polynucleotides for treating diseases in which expression of the gene is not desired in epidermal cells, stromal cells, or macrophages.
  • adiponectin refers to a protein identified as a secreted protein produced by adipocytes or a gene encoding the same.
  • Adiponectin includes Aci "p30 (adipocyte complement—related protein of 30 kDa), gelatin-binding protein, and Adipose most abundunt gene transcript l (apM—1).
  • the gene names are also known as APM1, ACRP30, GBP28, whose mRNA is induced more than 100 times during the process of adipocyte differentiation.Adiponectin is also an abundant serum protein, resulting in energy 'Affects homeostasis and obesity.
  • Adiponectin is very similar to TNF human structure, Since it becomes unregulated in various obesity forms of animals such as mice, research is proceeding as an important molecule that affects energy and homeostasis.
  • Adiponectin is an animal adipose tissue-specific protein newly isolated in 1996 by Maeda et al., And its amino acid sequence has been clarified. (Mae da K, et al. Biochem. Biophys. Res. Commun. 221: 286 (1996)). A substance called ACRP30 (Scherer PE et al. J. Biol. Chem. 270: 267 46-26749 (1995)) cloned from mouse 3T3-F442A cells was found to be adiponectin by a research group at about the same time. It is considered the same substance.
  • This adiponectin is present not only in adipose tissue but also in blood, and is present in normal human blood at a high concentration of 5-10 zg / ml (Arita Y et al, Biochem Biophys. Res. Commun. 257: 79-83 (1999)). In addition, this adiponectin is paradoxically decreased in blood concentration as obesity progresses.
  • Adiponectin is also known as a collagen-like factor specific to human adipose tissue.
  • the gene is known to be a protein composed of 244 amino acids.
  • the nucleic acid and amino acid sequences of human adiponectin protein are shown in SEQ ID NOs: 11 and 12.
  • the present inventors have already found a phenomenon in which human adiponectin suppresses the proliferation of monocyte-type cells and B-cell type cells, and as a proliferation inhibitor of these hematopoietic cells. It was shown to be effective. As described above, a phenomenon in which leukocyte cells such as monocytes, macrophages and neutrophils proliferate and accumulate during inflammation is observed.
  • Monocytes whose growth is suppressed by adiponectin are cells that play an important role in such cellular defense responses, and when mature, become macrophages that engulf phagocytosis, while interleukin-1 and tumor necrosis. Factors Produce inflammatory site forces such as chicks. Monocytes play such an important role in the inflammatory response, and adiponectin can be used as an anti-inflammatory agent by inhibiting monocyte proliferation and preventing accumulation.
  • Adiponectin is a protein that is produced in adipose tissue of animals including humans and is also present in large amounts in blood.
  • human adiponectin the cDNA that encodes this gene A product purified to a high purity by a recombination method has been obtained (Arita, Y. et al. Biochem. Biophys. Res. Commun. 257, 79-83 (1999)).
  • mouse-derived ACRP30 is also highly purified and can be obtained at the factory.
  • biological activity of adiponectin includes at least one function of adiponectin, such as vascular endothelial function improving action, vascular smooth muscle growth inhibitory action, macrophage Examples include, but are not limited to, foaming inhibitory action, inflammatory site force insecretion inhibitory action, and muscle cell uptake promoting action.
  • Such biological activity can be measured by [ 3 H] thymidine incorporation into vascular smooth muscle cells, macrophage culture supernatant TNFa secretion, muscle cell [ 3 H] deoxyglucose uptake, and the like.
  • the promoter of the present invention is very useful for studying adipocyte function in vivo. For example, by using the promoter of the present invention in combination with the Cre- ⁇ system, it is possible to analyze the function of adipocytes more accurately.
  • Cre— ⁇ system is an expression control system using Cre recombinase and its recognition sequence ⁇ sequence. Cre recombinase recognizes the loxP sequence and cuts out a gene sandwiched between ⁇ sequences.
  • the promoter of the present invention has high activity in adipocytes and has substantially no non-specificity in cells other than adipocytes.
  • a loxP system can be constructed. This enables functional analysis of adipocytes, which was difficult in vitro, to be performed in vivo, and is considered to contribute to further progress in functional analysis of adipocytes.
  • the present invention provides an adipose tissue specific Cre expression vector.
  • the vector is a virus-derived vector.
  • Virus-derived vector One is, for example, a retrovirus or adenovirus-derived vector.
  • the vectors of the present invention may also include a poly A sequence 3 ′ to the Cre gene.
  • the present invention also provides a method for producing a transgenic animal using the promoter of the present invention, and a transgenic animal produced by this method.
  • transgenic animals Various methods are known in the art for producing transgenic animals. For example, in the case of production of a transgenic mouse, a general production technique is described in International Publication WO01 / 13150 (Ludwig Inst. Cancer Res.). US Pat. No. 4,873,191 (Wagner et al.) Teaches a mammal with exogenous DNA obtained by microindication of DNA into a mammalian zygote. Furthermore, transposons are transduced into endogenous DNA or further translocated to cause structural changes in the DNA, inactivate them, and produce mutants such as animals and plants efficiently. Methods have been studied. It has become possible to introduce and add specific genes to chromosomes using transposons.
  • transgenic animals include, for example, M. Markkula et al., Rev. Reprod., 1, 97-106 (1996); RT Wall et al., J. Dairy Sci. , 80, 2213-2224 (1997); JC Dalton et al., Adv. Exp. Med. Biol., 411, 419-428 (1997); Tsuji and H. Lubon et al., Transfus. Med. Rev., 10, 131 — Examples include, but are not limited to, the method described in 143 (1996).
  • transgenic animals including knockout and knockin
  • ES embryonic stem
  • positive selection using the neomycin resistance gene and negative selection using the HSV thymidine kinase gene or the diphtheria toxin gene allow efficient selection of recombinants.
  • Homologous recombinants can also be selected by PCR or Southern blotting.
  • a part of the target gene is replaced with a neomycin resistance gene for positive selection, etc., and a targeting vector in which the HSVTK gene for negative selection is ligated to the end of the target gene is created, and it is applied to ES cells by electoral positioning Introduce and select in the presence of G418 and ganciclovir to isolate the resulting colonies and select homologous recombinants by PCR or Southern blot.
  • a method for producing a transgenic (target genetically modified) mouse having a loss of function or altered mutation by replacing or destroying an endogenous target gene in this manner was targeted. Since the mutation is introduced only into the gene, it is useful for analyzing the gene function.
  • the obtained recombinant ES cells are mixed with normal embryos by scutellum injection method or assembly chimera method to produce chimeric mice of ES cells and host embryos .
  • blastocyst injection ES cells are injected into a blastocyst with a glass pipette.
  • the collective chimera method ES cell mass and an 8-cell embryo from which the zona pellucida has been removed are adhered.
  • a blastocyst into which an ES cell has been introduced is transplanted into the uterus of a surrogate mother who is pseudopregnant to obtain a chimeric mouse.
  • ES cells are totipotent, they can differentiate into all types of cells, including germ cells, in vivo.
  • mice having ES cell chromosomes heterozygously are obtained, and when these mice are mated, a transgenic mouse having a homologous ES cell modified chromosome Is obtained.
  • a male chimeric mouse and a female wild-type mouse were mated to produce an F1 generation heterozygous mouse.
  • Male and female heterozygous mice are mated to select F2 generation homozygous mice.
  • Cre Transgenic mice using ⁇ introduce a neomycin resistance gene into a position that does not inhibit the expression of the target gene, and introduce a targeting vector into the ES cell with the ⁇ ⁇ ⁇ sequence inserted so as to sandwich the exon. The homologous recombinant is then isolated. A chimeric mouse is obtained from the isolated clone, and a genetically modified mouse is prepared.
  • Cre can be expressed in adults using the ability to mate with transgenic mice carrying the Cre gene, or viral vectors carrying the Cre gene.
  • the promoter of the present invention highly expresses a gene specifically in an adipocyte, Cre can be expressed in an adipocyte-specific manner using the promoter of the present invention. Therefore, it is possible to destroy or mutate the target gene only in adipocytes that do not affect other tissues. Thus, it is thought that the importance of this has greatly contributed to the functional analysis of adipocytes, which has attracted increasing attention in recent years. Transgenic organisms can be created using other mechanisms even with other organisms.
  • the present invention provides a novel adipocyte-specific promoter derived from adiponectin. Including the polynucleotide shown in SEQ ID NO: 10 (human) or SEQ ID NO: 13 (mouse) used in the promoter of the present invention.
  • the present invention also encompasses a polynucleotide that hybridizes with the polynucleotide shown in SEQ ID NO: 10 or SEQ ID NO: 13 under stringent conditions and has adipocyte-specific promoter activity. Stringent conditions are already explained in the definition section.
  • the present invention can also utilize a fragment or variant of the polynucleotide shown in SEQ ID NO: 10, SEQ ID NO: 13, etc., which has adipocyte-specific promoter activity.
  • fragments or variants of the invention include, for example, those with truncated ends or those with one or more base additions or deletions in the polynucleotide sequence. Whether or not it has an activity equivalent to (or higher than) the promoter sequence shown in the fragment or variant S of the present invention, SEQ ID NO: 10, SEQ ID NO: 13, etc. can be determined by various methods known to those skilled in the art. Examples of the method for measuring promoter activity include, but are not limited to, a method using a reporter gene).
  • Reporter genes include, but are not limited to, luciferase genes.
  • luciferase gene When the luciferase gene is used as a reporter, a vector containing the fragment or variant of the present invention and the luciferase gene is prepared, cells are tranfected with this vector, and the expressed luciferase is released by cell lysis.
  • Promoter activity can be measured by adding a luciferase substrate to the cell lysate and measuring the resulting luminescence with a luminometer. Whether or not the fragment or variant has adipocyte-specific activity can be determined by conducting a similar experiment using adipocytes and other cells and comparing the promoter activity.
  • adipocyte-specific promoter activity refers to only a vector that does not contain a promoter in cells other than adipocytes when the activity is measured by any method as described above. When used, that is, an activity that is almost equal to or less than that of the control (ie, control), it means that it has a detectably high activity in adipocytes.
  • the promoter of the present invention surprisingly suppresses gene expression in cells other than adipocytes that are not only highly expressed in adipocytes. It has power. Such an activity was not found in the AP 2 promoter used conventionally.
  • the present invention relates to a method for specifically and highly expressing a target gene in adipocytes.
  • This method includes a step of introducing the vector of the present invention into an adipocyte and a step of expressing the gene.
  • the meaning of this specificity includes suppression of expression in cells other than adipocytes.
  • the present invention also relates to a method for producing adipocytes that specifically and highly express useful genes. This method includes a step of introducing the vector of the present invention into an adipocyte and a step of expressing the gene.
  • the present invention also provides a vector comprising the promoter of the present invention.
  • the vector of the present invention comprises a promoter of the present invention and a gene operably linked to the promoter.
  • This gene is a gene that is desired to be specifically expressed in adipocytes.
  • the gene that is desired to be specifically expressed in adipocytes is an adipocyte force-in gene (particularly the adiponectin gene).
  • the vector of the present invention may also contain a poly A sequence 3 ′ to the gene of interest.
  • the present invention further provides an adipocyte comprising the promoter of the present invention.
  • adipocyte refers to the major component making up adipose tissue.
  • An adipose tissue is a type of connective tissue that is characteristic in that it stores lipids. However, as described in the background section of the invention, it is a tissue having various other important functions.
  • the adipocyte into which the vector 1 of the present invention is introduced may be a cultured cell isolated from various organisms (for example, human, mouse, rat, rabbit, guinea pig, pig, ushi, etc.) Even cells that exist in the body.
  • the promoter of the present invention is introduced into adipocytes in the form of a vector.
  • such cells can be identified using screening techniques well known in the art using a portion of the promoter of the present invention as a probe in a sample containing cells.
  • the culture medium for culturing the cells of the present invention is RPMI1640 medium (The Journal of the American Medical Association, 199, 519 (1967)), Eagle's MEM. Medium (Science, 122, 501 (1952)), DMEM medium (Virology, 8, 396 (1959)), 199 medium (Proceedings of the Society for the Biological Medicine, 73, 1 (1950)) or f ⁇ Kushi This is a medium supplemented with fetal serum.
  • the culture is usually carried out under the conditions of pH 6-8, 25-40 ° C, 5% CO, etc .:! -7 days.
  • antibiotics such as kanamycin, penicillin, streptomycin, etc. may be added to the medium during the culture.
  • the present invention relates to an adipose tissue containing the promoter of the present invention.
  • the promoter of the present invention is preferably operably linked to a specific gene (eg, adiponectin). Good.
  • the present invention also relates to a non-human animal comprising the promoter of the present invention.
  • the promoter of the present invention is preferably operably linked to a specific gene (for example, adiponectin).
  • a specific gene for example, adiponectin
  • non-human animals include, but are not limited to, mice, rats, rabbits, guinea pigs, rabbits, butterflies and the like.
  • the promoter of the present invention is very useful for adipocyte-specific expression of a target gene because of its very high specificity for adipocytes.
  • the reduction in adiponectin levels is associated with obesity-related metabolic disorders (eg, insulin resistant diabetes and atherosclerosis). Therefore, the promoter of the present invention is very useful for introducing these genes into adiponectin gene adipocytes for high expression in fat cells in order to treat these disorders. Therefore, the present invention relates to a method for specifically expressing a target gene in adipocytes.
  • the method of the present invention includes the step of introducing a vector containing the promoter of the present invention and the gene of interest into a fat cell.
  • the invention further relates to a method for treating or preventing a disease or disorder resulting from down-regulation of gene expression in adipocytes.
  • This method involves introducing into a fat cell a vector comprising a promoter of the invention and a down-regulated gene.
  • the gene is adiponectin and the disease to be treated or prevented is an obesity-related disease as described above (eg, insulin resistant diabetes and atherosclerosis).
  • the present invention also relates to the use of the promoter or vector of the present invention in the manufacture of a medicament for treating the diseases as described above.
  • the above diseases are diseases in which high expression of genes in adipocytes is desired, but expression of the genes in cells other than adipocytes is undesirable.
  • Such diseases include, but are not limited to, cancer and the like. Such diseases can be treated by specifically expressing a factor that suppresses cancer in adipocytes.
  • the transcription factor SREBP-la which is highly expressed in the liver, causes fatty liver due to marked lipid accumulation, but excessive expression of lipid does not occur even when highly expressed in fat.
  • the present invention provides a PPAR modulator comprising a sulfonylurea agent.
  • the sulfonylurea agent is typically
  • R and R are each independently hydrogen, alkyl, substituted
  • typical sulfonylurea agents include, but are not limited to, glimepiride, darribenclamide, tolptamide, chlorpropamide, acetohexamide, and daliclazide.
  • the sulfonylurea agent may advantageously use glimepiride or darribenclamide. These sulfonylureas are more effective in PPAR This is because it has node activity.
  • the PPAR modulator of the present invention may be an activator or an inhibitor. Preferably it can be an activator.
  • the PPAR modulating agent of the present invention further has at least one activity selected from the group consisting of insulin-stimulating activity and insulin-sensitizing activity of spleen ⁇ cells. Also good.
  • the PPAR-modulating activity can be determined by comparison with a thiazolidinedione agent (eg, piodaritazone, rosiglitazone, etc .; preferably pioglitazone).
  • a thiazolidinedione agent eg, piodaritazone, rosiglitazone, etc .; preferably pioglitazone.
  • the PPAR modulators of the present invention may typically have an activity of at least 10%, more preferably at least 15% of the thiazolinedione agent.
  • the receptor targeted by the PPAR modulating agent of the present invention may be any subtype, but it is preferable to target PPAR ⁇ .
  • the PPAR targeted by the present invention is the amino acid sequence represented by SEQ ID NO: selected from the group consisting of SEQ ID NO: 2, 4, 6 and 8, or a variant thereof (for example, 1 or several) Substitutions, additions or deletions).
  • the PPAR targeted by the present invention has at least a C-terminal activation function.
  • the PPAR targeted by the present invention preferably contains 2 (AF-2) domains.
  • the PPAR targeted by the present invention preferably contains the amino acid sequence IJPLLQEIYKDLY (SEQ ID NO: 9). This is because it was confirmed that the binding activity disappeared when this sequence was deleted.
  • the interaction between the PPAR cofactor and the PPAR can be observed. This is because it has become clear that sulfonylureas affect the interaction between PPAR cofactors and PPARs.
  • the PPAR modulating agent of the present invention comprises diabetes (particularly type 2); hyperdaricinemia; hypoglycolose tolerance; insulin resistance; obesity; steatosis; dyslipid hyperlipidemia; hypertriglyceridemia; hypercholesterolemia; low HDL level; high LD L level; atherosclerosis; vascular stenosis; irritable bowel syndrome; inflammatory bowel disease; Crohn's disease; Inflammatory disease; knee disease; abdominal obesity; neurodegenerative disease; retinopathy; psoriasis; metabolic syndrome; It can be used for the treatment or prevention of diseases selected from the group consisting of Ndrogenosis.
  • the present invention has at least one activity selected from the group consisting of the activity of promoting insulin secretion activity and peripheral insulin sensitivity of spleen cells, and the ability to modulate PPAR
  • Methods of identifying compounds are provided.
  • the method comprises: A) providing a candidate compound; B) at least one activity selected from the group consisting of an insulin secreting activity of knee / 3 cells and an activity of promoting peripheral insulin sensitivity. C) subjecting the candidate compound to an assembly for measuring the activity of PPAR; and D) identifying the substance determined to be active in each of Step B and Step C as a lead compound. Process.
  • candidate compounds targeted by the present invention include a sulfonylurea agent.
  • a sulfonylurea agent any of those described above in this specification can be used.
  • the screening method of the present invention targets a compound having a PPAR activation or inhibition effect, and preferably a compound having an activation effect.
  • the compound targeted by the screening method of the present invention preferably has both the insulin secretory activity and the insulin sensitivity promoting activity of knee ⁇ cells.
  • Such activity measurement can be performed by using any method as described above in this specification.
  • PPAR modulating activity is measured as compared to thiazolidinedione. In this case, you can compare the results of different experiments, or you can compare them competitively.
  • the PPAR targeted by the screening method of the present invention is a PP.
  • Such a PPAR is a PPAR, SEQ ID NO: 2
  • amino acid sequence 1 shown in SEQ ID NO: selected from the group consisting of may contain a partial sequence thereof.
  • the PPAR activity is determined by the candidate compound being a sulfonyl Providing with a urea agent or thiazolidinedione agent and observing if competing can be included.
  • the assay for measuring PPAR activity can utilize a transcription activity assay.
  • transcriptional activity assays are described herein and illustrated in the examples.
  • the insulin secretory activity of knee ⁇ -cells is determined by directly measuring insulin secreted from cells (J Pharmacol Exp Ther. 2004 Sep; 310 (3): 1273-80.) Can be measured more.
  • the activity that promotes peripheral insulin sensitivity can be measured by the glucose clamp method, the insulin tolerance test.
  • the activity of PPAR is determined by the candidate compound in a system comprising a nucleic acid construct comprising a nucleic acid sequence encoding a reporter operably linked to a transcription factor recognition sequence and the selected PPAR.
  • the candidate compound is determined to be an agonist of the PPAR, and when the expression of the reporter is decreased, the candidate compound is an antagonist of the PPAR.
  • Reporters that can be used here include luciferase.
  • a cell-free system or cells can be used.
  • the target PPAR can be a protein containing a C-terminal activation function 2 (AF-2) domain, preferably the target has the amino acid sequence P LLQEIYKDLY ( SEQ ID NO: 9) may be included.
  • the cofactor of this PPAR may be a factor selected from the group consisting of DRIP 205 (vitamin D receptor-interacting partner for retinoid and thyroid hormone receptors).
  • the present invention has at least one activity selected from the group consisting of the activity of promoting insulin secretion activity and peripheral insulin sensitivity of spleen ⁇ cells, and modulates PPAR
  • a system for identifying compounds that have the ability to The system comprises: i) a candidate compound as needed; i) at least one selected from the group consisting of an activity that promotes insulin secretion activity of the knee ⁇ -cell and peripheral insulin sensitivity.
  • a system comprising means for identifying It can be understood that this system can take any form that can be employed in the screening method.
  • the present invention provides a method for treating or preventing a disease associated with PPAR, comprising the step of i) administering a sulfonylurea agent to a subject.
  • diseases related to PPAR for example, diabetes (especially type 2); hyperglycinemia; low glucose tolerance; insulin resistance; obesity; fat disorder; dysli pidemia; Hypertriglyceridemia; high cholesterol level; low HDL level; high LDL level; atherosclerosis; vascular stenosis; irritable bowel syndrome; inflammatory bowel disease; Crohn's disease; Diseases; knee inflammation; abdominal obesity; neurodegenerative disease; retinopathy; psoriasis; metabolic syndrome; ocular hyperandrogenism.
  • Treatment or prevention methods may use methods known in the art and are exemplified herein.
  • sulfonylurea agent one selected from the group consisting of glimepiride, darifenclamide, tolptamide, chronolepropamide, acetohexamide, and daliclazide can be used.
  • the present invention provides the use of a sulfonylurea agent in the manufacture of a medicament for treating or preventing a disease associated with PPAR.
  • Diabetes mellitus especially type 2
  • hyperglycinemia low glucose tolerance; insulin resistance; obesity; Hyperlipidemia; hypertriglyceridemia; hypercholesterolemia; low HDL level; high LDL level; atherosclerosis; vascular stenosis; irritable bowel syndrome; Intestinal ulcers; inflammatory diseases; knee inflammation; abdominal obesity; neurodegenerative diseases; retinopathy; psoriasis; metabolic syndrome;
  • a method for preparing a medicine a method known in the art can be used, and exemplified in the present specification.
  • sulfonylurea agent one selected from the group consisting of glimepiride, darifenclamide, tolptamide, chronolepropamide, acetohexamide and daliclazide can be used. It is understood that other specific forms may take any specific form shown elsewhere in the specification.
  • rosiglitazone (material) [ 3 H] rosiglitazone (ART1231; specific activity was 50 Ci / mmol) was purchased from American Radiolabeled Chemical (St Louis, MO). Pioglitazone is a courtesy of Takeda Pharmaceutical Company Limited (Osaka). Glimepiride is a courtesy of Aventis Pharma (Tokyo). Darivenclamide, tolptamide, chlorpropamide, and daliclazide were purchased from Sigma Aldrich Japan Co., Ltd. (Tokyo).
  • An expression plasmid (pCMX_GAL4) encoding GAL4 (SEQ ID NO: 14-15), an expression plasmid (pCMX-GAL4-mPPAR ⁇ ) encoding GAL4-mouse PPAR a chimeric protein (SEQ ID NO: 16-17), GAL4—mouse PPAR Expression plasmid encoding ⁇ chimeric protein (SEQ ID NO: 18_19) ⁇ 1 ⁇ _0 8 4 111-8 13 ⁇ 43), 0 8 4 mouse PPAR ⁇ chimeric protein (SEQ ID NO: 20 -21) encoding plasmid (SEQ ID NO: 20-21) pCM X—GAL4—mPPARy), full-length mouse PPARy (SEQ ID NO: 1-2, amino acid 31 corresponding to glycoform 1 and later IJ (MVDTEMPFWPTNFGISSVDLSVMEDHSHS)
  • the plasmid (pCMX_VP16_mPPAR7) and the expression plasmid (pCMX— ⁇ -gal) encoding / 3-galactosidase (SEQ ID NO: 26-27) were obtained from Dr. David Mangelsdorf (University of Texas Southwestern Medic al Center, Dallas, TX). Courtesy (Willy, PJ, and Mangelsdorf, DJ (1997) Genes Dev.
  • C-terminal activation function 2 mouse deletion of 11 amino acids (PLLQEIYKDLY (SEQ ID NO: 9))
  • ⁇ PPAR ⁇ mutant construct pCMX ⁇ mPPAR ⁇ ; ⁇ PPAR y mutant Is deleted by deleting the last 11 amino acids (PLLQEIYKDLY) from the amino acid sequence of PPAR ⁇ isoform 1 described above.) (SEQ ID NO: 28-29) is prepared in a form in which the sequence to be deleted is deleted. did.
  • GAL4 - Vitamin D receptor-binding proteins (DRIP) 205 (SEQ ID NO: 30 _ 31) encoding expression plasmid (P CMX_GAL4_DRIP205) and GAL4 nuclear receptions coater corepressor (N_CoR) (SEQ ID NO: 32 33) encoding the expression plasmids ( pCM X-GAL4-N-CoR) has been described in the literature (for pCMX_GAL4_DRIP205 Kaneko, E. et al (2003) J. Biol. Chem. 278, 36091-36098, and pCMX_GAL4 N CoR Adachi, R., et al (2004) Mol. Endocrinol. 18, 43-52).
  • the nuclear receptor interaction domain of DRI P205 (amino acids 578-728) (SEQ ID NOs: 34-35) and the nuclear receptor interaction domain of N-CoR (amino acids 1990-2416) (SEQ ID NOs: 3 6-37) are GAL4 DNA binding Fused to the domain (SEQ ID NO: 38-39).
  • GAL4 responsiveness MH100 (UAS)
  • X 4—tk—LUC reporter (SEQ ID NO: 40—41)
  • ⁇ : 3— 1 ⁇ 1 ⁇ ; ⁇ Reporter (SEQ ID NO: 42-43) was used to evaluate the activities of GAL4—chimeric receptor and PPAR, respectively (Willy, PJ, and Mangelsd orf, DJ (1997) Genes Dev. 11, 289-298 (GAL4 chimeric receptor) Kliewer, SA, et al (1994) Proc. Natl. Acad. Sci. USA 91,7355- 7359 (PPAR)).
  • Wild type luciferase reporter plasmid [p (— 908) / LUC wt] (SEQ ID NO: 44) and PPRE mutant luciferase reporter plasmid [p (— 908) / LUC PPRE mut] (SEQ ID NO: 45) has been described in the literature (Iwaki, M., et al (2003) Diabetes 52, 1655-1663).
  • HEK Human embryonic kidney
  • ATCC American Type Culture Collection
  • DMEM Dulbecco's modified Eagle's medium containing
  • Transfection was performed by calcium phosphate coprecipitation assembly as described in the literature (Lu, TT et al (2000) Mol. Cell 6, 507-515).
  • Transfuek The ligand compound was added 8 hours after Chillon. Cells were harvested 16-20 hours later for luciferase and gala tosidase assays.
  • DNA simultaneous transfection experiments are performed using 50 ng reporter plasmid, 20 ng pCM_ ⁇ -gal (Dr. David J.
  • Glutathione S-transferase full-length human ⁇ ⁇ 2 ((Y13467; also known as p53 regulatory protein, RB18Aprotein) and 40 nM [.H] rosiglitazone, 10 00 / i L of 10 mM Tris-HCl (pH 8.0) ), 50 mM KC1, lOmM dithiothreitol (DTT) and 4% glycerol for 24 hours at 4 ° C.
  • GST Glutathione S-transferase
  • Bound ligand was separated from free ligand by centrifugation on a Spin G-25 column (Amersham Biosciences) Radioactivity was measured with a Wallac 1409 liquid scintillation counter (Wallac, Turku, Finland). To go in duplicate.
  • the nuclear receptor interaction domain of DRIP205 (amino acids 578 to 728 of SEQ ID NO: 35) was cloned into the GST fusion vector pGEX-4T1 (Amersham Biosciences). GST-DRIP205 fusion protein was expressed in BL21 DE3 cells (Promega). A 35 S-labeled full-length mouse PPAR y was prepared using the TNT Quick Coupled Transcription / dianslation System (Promega).
  • GST-DRIP205 was bound to Gnoretathione-Sepharose beads (Amersham Biosciences) and 20 mM Tris-HCl ( ⁇ 7.9), 180 mM KC1, 0.2 mM EDTA, 0.05% Nonid et P-40, equilibrated in a binding buffer containing 0.5 mM phenylmethanesulfonyl fluoride (PMSF), ImM DTT and 3.5% ushi serum albumin (BSA). The bound GST protein was then incubated with labeled mPPAR y and ligand at 4 ° C for 1.5 hours.
  • PMSF phenylmethanesulfonyl fluoride
  • BSA 3.5% ushi serum albumin
  • Mouse 3T3-L1 preadipocytes (available from ATCC) were cultured and induced to differentiate as described in the literature (Iwaki, M. et al (2003) Diabetes 52, 1655-1663).
  • 3T3 L1 cell culture medium of OPTI- MEM Invitrogen, Tokyo, Japan
  • LipofectAMINE 2000 reagent (Invitrogen) was used to transfect the cells with a reporter plasmid containing the PPRE X3-tk-LU C reporter or the human adiponectin promoter.
  • Luciferase reporter assay was performed 20 hours after drug treatment using Luciferase Assay System (Promega). Luciferase values were normalized with the internal i3-galactosidase control and expressed as relative luciferase activity.
  • the mRNA level was normalized to the amount of cyclophilin mRNA and expressed in arbitrary units.
  • adiponectin secreted into the culture medium was measured with a mouse / rat adiponectin enzyme-linked immunosorbent assay (ELISA) kit (Otsuka Pharmaceutical, Tokusmma, Japan).
  • ELISA enzyme-linked immunosorbent assay
  • Mouse 3T3-F442A preadipocytes (courtesy of Dr. Hiroshi Sakagami (Kobe University)) were maintained in DMEM containing 10% FBS. For differentiation, cells (3 days after reaching confluence) were incubated in the presence or absence of compounds in DMEM mobilized with 10% FBS containing 1 ⁇ g / mL insulin. Differentiated adipocytes were fixed and stained with Oil Red O Strength Light Tester (Kyoto)) to visualize the lipids.
  • Data are expressed as mean soil SE. Differences were analyzed by Dunnett's test. Dunnett's test is a method of comparing one group designated as a control group with another group, and can be used even if no significant difference was found in analysis of variance among multiple groups. It is possible to test without limiting the number of data in each group, whether it is a variance or a normal distribution. In this example, P is 0.05 and Considered statistically significant.
  • the present inventors have clarified the effect on PPARy transcriptional activity by using glimepiride and darbenclamide as sulfonylureas.
  • reporter assembly was performed on HEK293 cells, which are non-adipocytes, using GAL4_PPARy and a GAL4-responsive luciferase reporter in accordance with the experimental method described above.
  • the ligand binding domain of PPAR was fused to the DNA binding domain of the yeast transcription factor GAL4. Since the reporter used in this example is activated only by exogenous GAL4-chimeric reporter, the effect of the endogenous reporter is eliminated. Interestingly, the inventors found that glimepiride and darifenclamide induced GAL4_PPAR o / transcriptional activity at a dose of 10 ⁇ M. However, we found that at 10 ⁇ , other sulfonylureas (tolptamide, chlorpropamide, and gliclazide) did not detect PPAR y activation as much as glimepiride and darifenclamide (Figure 1E). .
  • the inventors investigated the concentration-dependent activation of G AL4_PPAR 7 by glimepiride and Daribenkuramido in HEK293 cells. As shown in Figure 1B, treatment with glimepiride or darifenclamide resulted in a concentration-dependent activation of GAL4_PPARo /. Glimepiride and darifenclamide activated GAL4-PPAR y to 12% and 20% of the maximum levels activated by pioglitazone, respectively.
  • Example 2 PPAR subtype specificity of sulfonylurea
  • PPAR subtype selectivity of glimepiride we performed a reporter assay using GAL-PPAR in HEK293 cells.
  • Wyl4643, GW501516, and pioglitazone are known as specific ligands for each PPAR subtype (Hsu, MH et al (2001) J. Biol. Chem. 276, 27950-27958; Oliver, WRet al (2001) Proc. Natl. Acad. Sci.
  • glimepiride is the force to activate GAL4—PPAR y
  • GAL4 a chimeric reporter, glimepiride against the transcriptional activity of R XR, LXR, LXR / 3, and FXR Glimepiride had no effect on these reporters.
  • glimepiride was found to be specific for PPAR.
  • the 50 values were 24 / i M and 96 ⁇ M, respectively ( Figure ID).
  • PPAR y and coactivator DRIP205 also known as PPAR binding protein (PBP). Zhu, Y. et al (1997) J. Biol. Chem. 272 , 2550 0-25506; Yang, W., Rachez, C, and Freedman, LP (2000) Mol. Cell. Biol. 20,8008 -8017), or the effect of glimepiride on the interaction with the corepressor N_CoR It was examined by mammalian two-hybrid assembly in HEK293 cells according to the experimental procedure.
  • PBP PPAR binding protein
  • the two-hybrid system is a mammalian cell-based system that uses luciferase for quantification. This is an effective method for detecting protein-protein interactions in vivo using the module domain found in transcription factors.
  • the transcriptional activation domain (VP16) and the DNA binding domain (GAL4) associate to promote the transcriptional activity of the reporter gene.
  • both pioglitazone and glimepiride significantly increased the transcriptional activity of VP16_PPARo /, GAL4 — DRIP205 and GAL4-responsive LUC reporter by simultaneous transfection (Fig. 2B).
  • Fig. 2B simultaneous transfection of VP16- ⁇ and GAL4-N-CoR resulted in reporter activation in the absence of ligand.
  • the reporter activity was significantly suppressed ( Figure 2C). Similar to pioglitazone or glimepiride
  • an inhibitory effect on the interaction between PPAR y and the corepressor SMRT was also observed.
  • the present inventors evaluated the direct effect of glimepiride on the interaction of full-length PPAR y with DRIP2 05 using the GST pull-down assay. As shown in FIG. 2D, 35 S-labeled PPAR y bound to GST-DRIP205, and this binding was enhanced by pioglitazone (lane 8). Similarly, glimepiride induced the interaction of labeled PPAR y with GST—DRI P205 in a dose-dependent manner (FIG. 3D, lanes 9–11). No binding between GST alone and labeled PPAR 7 was observed in the presence or absence of ligand (Figure 2D, lanes 2-6). These data strongly suggest that glimepiride direct binding to PPAR y induces association with DRIP 205, the coactivator of PPAR y.
  • glimepiride a sulfonylurea agent
  • PPAR ⁇ PPAR ⁇
  • glimepiride and daribenclamide were used as the sulfonylurea agents.
  • the inventors then performed a reporter assay in 3T3-L1 adipocytes.
  • the present inventors have previously demonstrated that adiponectin gene expression is up-regulated by PPAR y activation (Iwaki, M. et al (2003) Diabetes 52, 1 655-1663) in FIG. 3B.
  • glimepiride as well as pioglitazone increased the transcriptional activity of the wild-type adiponectin promoter in fat cells.
  • Example 6 Effect of sulfonylurea agent on adiponectin production in adipocytes
  • sulfonylurea agent has an effect on the production of adiponectin and levtin as a downstream effect of PPAR. I observed how.
  • glimepiride is a mRNA for both aP2 and leptin.
  • FIGS. 4A and 4B Next, we examined the effect of glimepiride on the expression and secretion of adiponectin mRNA in differentiated 3T3-L1 adipocytes. As reported in (Maeda, N. et al (2001) Diabetes 50, 2094-2099), pioglitazone increased both mRNA expression and secretion of adiponectin (FIGS. 4C and 4D). In particular, treatment with glimepiride significantly increased the mRNA level of adiponectin in adipocytes (FIG. 4C). Furthermore, glimepiride stimulated adiponectin secretion into the medium in a dose-dependent manner (FIG. 4D).
  • glimepiride and darribenclamide both increase the production of adiponectin, an insulin-sensitizing hormone, through PPAR y activation in adipocytes
  • glimepiride and darifenclamide increase adiponectin production in adipocytes.
  • Glimepiride reduced the gene expression of levtin in adipocytes. It is effective for hyperlevutinemia associated with obesity.
  • PPAR ⁇ agonists are known to promote the conversion of preadipocytes to mature adipocytes (Tontonoz, P., Hu, E., and Spiegelman, BM (1994) Cell 79,114 7 -1156).
  • sulfonylureas such as glimepiride and darifenclamide were tested for their PPAR agonist activity.
  • the present inventors investigated the effects of glimepiride and darifenclamide on adipocyte differentiation in 3T3-F422A adipocyte precursors (with courtesy of Dr. Hiroshi Sakagami (Kobe University)).
  • 3T3-F442A preadipocytes are known to exhibit PPAR ⁇ agonist-dependent adipocyte differentiation (Wright, HM et al (2000) J. Biol. Chem. 275, 1873-1877).
  • Incubation with glimepiride as well as pioglitazone significantly stimulated adipocyte differentiation, as shown by fat staining with Oil red O (FIG. 5A).
  • Fat deposition due to darifenclamide was observed, and fat deposition was also observed in glimepiride.
  • the present inventors examined the effects of glimepiride and darribenclamide in the induction of aP2 and adiponectin, which are adipocyte differentiation marker genes.
  • Glimepiride increased the recruitment of coactivator DRIP205 and dissociation of corepressors (eg N_CoR and SMRT);
  • Glimepiride stimulated the transcriptional activity of gene promoters including PPER and altered the mRNA levels of PPARy target genes in 3 3 adipocytes;
  • Hyperglycemia in type 2 diabetes is the result of multiple deficiencies in both insulin secretion from presumptive beta cells and insulin sensitivity in peripheral tissues. Therefore, to develop a pharmacological approach to type 2 diabetes, it has been considered important to improve insulin sensitivity, not just increasing plasma insulin levels. Sulfonylureas have been widely used so far because sulfonylureas were thought to be effective in lowering blood sugar by stimulating presumably insulin secretion. . In contrast, thiazolidinedione, PPAR yagonist, exhibits potent hypoglycemic effects by improving terminal insulin resistance.
  • a substance that may enhance the activity of PPAR is screened using reporter gene assembly.
  • PBS Phosphate buffered saline
  • Lysis solution 25 mM Tris (7.5), 2 mM dithiothreitol (DTT), 10% glycerol, 1% TritonX—100; Luciferin mix: 20 mM Tricine / 1.07 mM (MgCO) Mg (OH) _ 5 ⁇ ⁇ / 2. 67mM MgSO / 0. ImM EDTA / 33
  • Brown adipocytes HIB1B
  • Luciferase is an enzyme that produces fluorescence (approximately 560 nm).
  • a plasmid containing the nucleic acid sequence encoding PPAR (SEQ ID NO: 1) and a reporter plasmid (luciferase reporter) are simultaneously forcibly expressed in the cell and the reporter activity is measured.
  • Gene expression can be measured by measuring fluorescence due to the expression of the luciferase gene product.
  • transfection and the like can be performed according to the technique described in the above (Transfertion studies in 3T3-L1 adipocytes) of the present specification.
  • the candidate compound can measure suppression or enhancement of PPAR function.
  • Example 8 The screening performed in Example 8 can be automated using a robot.
  • a robot for example, using the Beckman Coulter Biomek series, it is possible to construct a system using a microplate-based system or Zymark's Staccato Mini-System series.
  • the lead compound thus obtained can be used for animal experiments. Alternatively, other compounds can be designed based on such lead compounds.
  • Such screening has actually differentiated adipocytes in animals; diabetes; Glycinemia; low glucose tolerance; insulin resistance; obesity; fat disorder; dysli pidemia; hyperlipidemia; hypertriglyceridemia; hypercholesterolemia; low HDL lenore; LDL level; Atherosclerosis; Vascular stenosis; Irritable bowel syndrome; Inflammatory bowel disease; Crohn's disease; Intestinal ulcer; Inflammatory disease; Kneeitis; Abdominal obesity; Neurodegenerative disease; Retinopathy; Psoriasis; Substances that act on diseases such as nest hyperandrogenosis can be screened.
  • Example 10 Of the substances that were actually effective in Example 10, those that were not toxic were administered to human subjects and observed for obesity. Here, clinical trials are conducted using energy expenditure, body weight, fat mass, body fat percentage, etc. as indicators. Thereby, it can be determined whether or not the compound identified as the lead compound in Example 10 is actually effective for the disease.
  • the present invention is useful in that PPAR-related diseases can be treated by using targets useful in diagnosis, treatment and prevention of PPAR-related diseases and screening methods therefor, and pharmaceuticals identified by the methods. Have sex.
  • the present invention has also shown that sulfonylurea is effective for such PPAR-related diseases.
  • the present invention is useful in developing a drug for effective treatment of diabetes.
  • SEQ ID NO: 1 is the nucleic acid sequence of mouse PPAR ⁇ . (NM_011146, PPAR ⁇ isoform 2 is shown.)
  • SEQ ID NO: 2 is the amino acid sequence of mouse PPAR ⁇ . (NP_035276, PPAR ⁇ isoform 2 is shown.)
  • SEQ ID NO: 3 is the nucleic acid sequence of human PPAR ⁇ .
  • SEQ ID NO: 4 is the amino acid sequence of human PPAR ⁇ .
  • SEQ ID NO: 5 is the nucleic acid sequence of rat PPAR ⁇ . (NM.013124)
  • SEQ ID NO: 6 is the amino acid sequence of rat PPAR ⁇ . ( ⁇ .037256)
  • SEQ ID NO: 7 is the nucleic acid sequence of monkey PPAR ⁇ . (AF033103)
  • SEQ ID NO: 8 is the amino acid sequence of monkey PPAR ⁇ . ( ⁇ 87480)
  • SEQ ID NO: 9 is the amino acid sequence PLLQEIYKDL, which is one of the essential binding sequences in PPAR
  • SEQ ID NO: 10 is the nucleic acid sequence of the human adiponectin 3.6 kb promoter. (AF304 467)
  • SEQ ID NO: 11 is the nucleic acid sequence of human adiponectin protein.
  • SEQ ID NO: 12 is the amino acid sequence of human adiponectin protein.
  • NP_004788 SEQ ID NO: 13 is the nucleic acid sequence of the mouse adiponectin promoter (Das, K. et a 1 (2001) Biochem Biophys Res Commun. 280, 1120-1129, Seo JB et al (2004) J. Biol. Chem. 279, 22108-22117 etc.).
  • SEQ ID NO: 14 is the nucleic acid sequence of GAL4. (X85976; corresponding to amino acids 1- 147: atgaag ctactgtcttctatcgaacaagcatgcgatatttgccgacttaaaaagctcaagtgctccaaagaaaaccgaagtgcgc caagtgtctgaagaacaactgggagtgtcgctactctcccaaaaccaaaaggtctccgctgactagggcacatctgaca gaagtggaatcaaggctagaaagactggaacagctatttctactgatttttcctcgagaagaccttgacatgattttgaaa atggattctttacaggatataaaagcattgttaacaggattatttgtacaagataatgt
  • SEQ ID NO: 15 is the amino acid sequence of GAL4. (X85976) (Amino acid 1-147; MKLLSSI
  • SEQ ID NO: 16 is the nucleic acid sequence of GAL4-mouse PPAR chimeric protein. (Mouse PPAR hi, NM_011144)
  • SEQ ID NO: 17 is the amino acid sequence of GAL4-mouse PPAR chimeric protein. (Ma (US PPAR a, NP— 035274)
  • SEQ ID NO: 18 is the nucleic acid sequence of GAL4-mouse PPAR ⁇ chimeric protein. (Mouse PPAR 5, ⁇ — 011145)
  • SEQ ID NO: 19 is the amino acid sequence of GAL4-mouse PPAR ⁇ chimeric protein. (Mouse PPAR ⁇ , ⁇ .035275)
  • SEQ ID NO: 20 is the nucleic acid sequence of GAL4-mouse PPAR ⁇ chimeric protein. (Mouse ⁇ ⁇ , ⁇ _011146)
  • SEQ ID NO: 21 is the amino acid sequence of GAL4-mouse PPAR ⁇ chimeric protein. (Mouse PPAR ⁇ , ⁇ .035276)
  • SEQ ID NO: 16-21 is a fusion of the above-mentioned GAL4 sequence and each mouse PPAR ligand binding region. Kliewer, SA, et al (1994) Proc. Natl. Acad. Sci. USA 91,7355-7359, Umeson o, (See K et al (1991) Cell 65, 1255-1266, etc.)
  • SEQ ID NO: 22 is the nucleic acid sequence of VP16. (Consisting of 78 amino acids)
  • SEQ ID NO: 23 is the amino acid sequence of VP16. (78 amino acids)
  • SEQ ID NO: 24 is the nucleic acid sequence of the VP16-mouse PPAR ⁇ chimeric protein.
  • SEQ ID NO: 25 is the amino acid sequence of the VP16-mouse PPAR ⁇ chimeric protein.
  • SEQ ID NO: 26 is the nucleic acid sequence for ⁇ -galatatosidase.
  • SEQ ID NO: 27 is the amino acid sequence of ⁇ -galatatosidase.
  • SEQ ID NO: 28 is the nucleic acid sequence of the mouse ⁇ PPAR ⁇ mutant construct.
  • SEQ ID NO: 31 is the amino acid sequence of GAL4-vitamin D receptor binding protein (DRIP) 205. This is a fusion of the above-mentioned GAL4 sequence and the nuclear receptor interaction domain (amino acids 578 to 728) of DRIP205 described later.
  • DRIP GAL4-vitamin D receptor binding protein
  • SEQ ID NO: 32 is the nucleic acid sequence of GAL4-nuclear receptor corepressor (N_CoR). This is a fusion of the above-mentioned GAL4 sequence and the N_CoR nuclear receptor interaction domain (amino acids 1 990 to 2416) described later.
  • N_CoR GAL4-nuclear receptor corepressor
  • SEQ ID NO: 33 is the amino acid sequence of GAL4-nuclear receptor corepressor (N_CoR). It is a fusion of the above-mentioned GAL4 sequence and the N_CoR nuclear receptor interaction domain (amino acids 1990-2416) described below.
  • SEQ ID NO: 34 is the nucleic acid sequence of the nuclear receptor interaction domain (amino acids 578-728) of DRIP205. (Y13467) (alias p53 regulatory protein, RB18A protein).
  • SEQ ID NO: 35 is the amino acid sequence of the nuclear receptor interaction domain (amino acids 578-728) of DRIP205. (Y13467) (alias p53 regulatory protein, RB18A protein).
  • SEQ ID NO: 36 is the nucleic acid sequence of the nuclear receptor interaction domain of N-CoR (amino acids 1990-2416). (U35312)
  • SEQ ID NO: 37 is the amino acid sequence of the N-CoR nuclear receptor interaction domain (amino acids 1990-2416). (U35312)
  • SEQ ID NO: 38 is the nucleic acid sequence of the GAL4 DNA binding domain. (See Willy, P. J., and Mangelsdorf, D. J. (1997) Genes Dev. 11, 289-298).
  • SEQ ID NO: 39 is the amino acid sequence of the GAL4 DNA binding domain. (See Willy, P. J., and Mangelsdorf, D. J. (1997) Genes Dev. 11,289-298).
  • SEQ ID NO: 40 is the nucleic acid sequence of the GAL4-responsive MHIOO (UAS) X 4_tk_LUC reporter. (See Willy, P. J., and Mangelsdorf, D. J. (1997) Genes Dev. 11,289-298).
  • SEQ ID NO: 41 is the amino acid sequence of the GAL4-responsive MHIOO (UAS) X 4_tk_LUC reporter. (See Willy, PJ, and Mangelsdorf, DJ (1997) Genes Dev. 11,289-298).
  • SEQ ID NO: 42 is the nucleic acid sequence of a PPAR-responsive PPRE X 3—tk LUC reporter
  • SEQ ID NO: 43 is the amino acid sequence of the PPAR-responsive PPRE X 3_tk_LUC reporter. (See Kliewer, S. A., et al (1994) Proc. Natl. Acad. Sci. U. S. A. 91,7355-7359, Klie was, S. A., et al (1992) Nature (London) 358, 771-774, etc.).
  • SEQ ID NO: 44 is the nucleic acid sequence of the wild type luciferase reporter plasmid of the human adipocyte promoter. See Iwaki, M., et al (2003) Diabetes 52, 1655-1663.
  • SEQ ID NO: 45 is a PPRE mutant luciferase reporter plasmid [p (_ 908) / LU
  • SEQ ID NO: 46 is a primer forward nucleic acid sequence of mouse aP2 IK mouse aP2, 5'-CCG
  • SEQ ID NO: 47 is the nucleic acid sequence IK5′—CTC ATG CC CTTTT CAT AAA CT—3 ′) in the reverse direction of the primer for mouse aP2.
  • SEQ ID NO: 48 is a nucleic acid sequence in the forward direction of mouse leptin primer (5′—GAT GGA
  • SEQ ID NO: 49 is a nucleic acid sequence in the reverse direction of the primer for mouse leptin (5′—AGA GTG
  • SEQ ID NO: 50 is a primer forward nucleic acid sequence of mouse adiponectin (5′-GAT
  • SEQ ID NO: 51 is the nucleic acid sequence in the reverse direction of the primer of mouse adiponectin (5′-CTT)
  • SEQ ID NO: 52 is the nucleic acid sequence in the forward direction of the mouse cyclophilin primer (5′_CAG A CG CCA CTG TCG CTT T — 3).
  • SEQ ID NO: 53 is a nucleic acid sequence IJ (5′-TGT CTT TGG AAC TTT GTC TGC AA — 3,) in the reverse direction of the primer of mouse cyclophilin.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Veterinary Medicine (AREA)
  • Public Health (AREA)
  • Animal Behavior & Ethology (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Organic Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • General Chemical & Material Sciences (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Endocrinology (AREA)
  • Obesity (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Reproductive Health (AREA)
  • Immunology (AREA)
  • Urology & Nephrology (AREA)
  • Pain & Pain Management (AREA)
  • Analytical Chemistry (AREA)
  • Neurology (AREA)
  • Neurosurgery (AREA)
  • Child & Adolescent Psychology (AREA)
  • Ophthalmology & Optometry (AREA)
  • Biotechnology (AREA)
  • Cell Biology (AREA)
  • Emergency Medicine (AREA)
  • Microbiology (AREA)
  • Heart & Thoracic Surgery (AREA)
  • Food Science & Technology (AREA)
  • Physics & Mathematics (AREA)
  • Rheumatology (AREA)
  • Biochemistry (AREA)
  • General Physics & Mathematics (AREA)

Abstract

L'invention concerne un procédé extrêmement efficace de recherche par criblage de composés pour le traitement du diabète ; et de nouveaux composés pour le traitement et la prévention de maladies associées aux PPAR. L'invention concerne un procédé d'identification d'un composé capable de réguler un récepteur activé par les proliférateurs des peroxysomes (PPAR), lequel composé a au moins une activité sélectionnée entre l'activité consistant à promouvoir la sécrétion d'insuline de cellules β pancréatiques et l'activité consistant à promouvoir la sensibilité périphérique à l'insuline. Ce procédé comprend les étapes consistant à (A) fournir les composés candidats ; (B) pour les composés candidats, mesurer au moins une activité sélectionnée entre l'activité consistant à promouvoir la sécrétion d'insuline de cellules β pancréatiques et l'activité consistant à promouvoir la sensibilité périphérique à l'insuline ; (C) soumettre les composés candidats à un essai servant à mesurer l'activité de PPAR ; et (D) identifier ceux dont on estime qu'ils ont une activité dans chacune des étapes (B) et (C) comme composés phares.
PCT/JP2005/019431 2004-10-25 2005-10-21 Nouvel agent régulant les ppar et procédé de recherche par criblage de celui-ci WO2006046492A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
JP2004-310178 2004-10-25
JP2004310178A JP2008019169A (ja) 2004-10-25 2004-10-25 新規ｐｐａｒ調節剤およびそのスクリーニング方法

Publications (1)

Publication Number Publication Date
WO2006046492A1 true WO2006046492A1 (fr) 2006-05-04

Family

ID=36227731

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/JP2005/019431 WO2006046492A1 (fr) 2004-10-25 2005-10-21 Nouvel agent régulant les ppar et procédé de recherche par criblage de celui-ci

Country Status (2)

Country Link
JP (1) JP2008019169A (fr)
WO (1) WO2006046492A1 (fr)

Cited By (2)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20120015884A1 (en) * 2009-01-19 2012-01-19 Alain Prochiantz Polypeptides for Specific Targeting to Otx2 Target Cells
EP2719380A3 (fr) * 2008-09-16 2014-07-30 University of Maryland, Baltimore Inhibiteurs de SUR1 pour la thérapie

Families Citing this family (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JP5393119B2 (ja) * 2008-12-05 2014-01-22 日本メナード化粧品株式会社 幹細胞の褐色脂肪細胞への分化誘導方法

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0967271A (ja) * 1995-06-20 1997-03-11 Takeda Chem Ind Ltd 医 薬
JP2001510158A (ja) * 1997-07-18 2001-07-31 スミスクライン・ビーチャム・パブリック・リミテッド・カンパニー チアゾリジンジオンおよびスルホニル尿素を用いる糖尿病の治療
JP2002332266A (ja) * 2000-04-28 2002-11-22 Sankyo Co Ltd ＰＰＡＲ−γモジュレータ
WO2002100413A1 (fr) * 2001-06-01 2002-12-19 Astrazeneca Ab Combinaison pharmaceutique comprenant soit de l'acide (s)-2-ethoxy-3-[4-(-(2-{4-methanesulfonyloxyphenyl}ethoxy)phenyl]propionique ou 3-{4-[2-(4-tert-butoxycarbonylaminophenyl)ethoxy]phenyl}-(s)-2-ethoxy propionique et une sulfonyluree
JP2004513076A (ja) * 2000-07-25 2004-04-30 メルク　エンド　カムパニー　インコーポレーテッド 糖尿病治療で有用なｎ−置換インドール類

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
JPH0967271A (ja) * 1995-06-20 1997-03-11 Takeda Chem Ind Ltd 医 薬
JP2001510158A (ja) * 1997-07-18 2001-07-31 スミスクライン・ビーチャム・パブリック・リミテッド・カンパニー チアゾリジンジオンおよびスルホニル尿素を用いる糖尿病の治療
JP2002332266A (ja) * 2000-04-28 2002-11-22 Sankyo Co Ltd ＰＰＡＲ−γモジュレータ
JP2004513076A (ja) * 2000-07-25 2004-04-30 メルク　エンド　カムパニー　インコーポレーテッド 糖尿病治療で有用なｎ−置換インドール類
WO2002100413A1 (fr) * 2001-06-01 2002-12-19 Astrazeneca Ab Combinaison pharmaceutique comprenant soit de l'acide (s)-2-ethoxy-3-[4-(-(2-{4-methanesulfonyloxyphenyl}ethoxy)phenyl]propionique ou 3-{4-[2-(4-tert-butoxycarbonylaminophenyl)ethoxy]phenyl}-(s)-2-ethoxy propionique et une sulfonyluree

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
AMMARI F. ET AL: "The effect of gliclazide on plasma insulin,intact and 32/33 split proinsulin in South Asian subjects with Type 2 diabetes mellitus", DIABETIC MEDICINE, vol. 16, no. 2, 1999, pages 142 - 146, XP002993866 *
KABADI U. ET AL: "Effects of glimepiride on insulin secretion and sensitivity in patients with recently diagnosed type 2 diabetes mellitus", CLINICAL THERAPEUTICS, vol. 26, no. 1, January 2004 (2004-01-01), pages 63 - 69, XP002992882 *
TSUNEKAWA T. ET AL: "Plasma adiponectin plays an important role in improving insulin resistance with glimepiride in elderly type 2 diabetic subjects", DIABETES CARE, vol. 26, no. 2, 2003, pages 285 - 289, XP002993865 *

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
EP2719380A3 (fr) * 2008-09-16 2014-07-30 University of Maryland, Baltimore Inhibiteurs de SUR1 pour la thérapie
US20120015884A1 (en) * 2009-01-19 2012-01-19 Alain Prochiantz Polypeptides for Specific Targeting to Otx2 Target Cells
US10842852B2 (en) 2009-01-19 2020-11-24 Centre National De La Recherche Scientifique Methods of delivering a polypeptide molecule to Otx2 target cells using an Otx2 targeting peptide

Also Published As

Publication number Publication date
JP2008019169A (ja) 2008-01-31

Similar Documents

Publication Publication Date Title
Yong et al. Therapeutic opportunities for pancreatic β-cell ER stress in diabetes mellitus
Hotamisligil Foundations of immunometabolism and implications for metabolic health and disease
Ferrington et al. Immunoproteasomes: structure, function, and antigen presentation
Lodhi et al. Inhibiting adipose tissue lipogenesis reprograms thermogenesis and PPARγ activation to decrease diet-induced obesity
Pilz et al. Visfatin/pre-B-cell colony-enhancing factor: a protein with various suggested functions
Harvey et al. Regulation of Notch function by O-glycosylation
JP4344771B2 (ja) ＮＦ−κＢ活性化遺伝子
US20060089325A1 (en) Antisense modulation of PTP1B expression
US20050065333A1 (en) Breast cancer-associated genes and uses thereof
WO2011140215A2 (fr) Protéines analogues au composant c de lanthionine synthétase comme cibles moléculaires pour prévention et traitement de maladies et de troubles
Capaccio et al. A novel germline mutation in peroxisome proliferator-activated receptor γ gene associated with large intestine polyp formation and dyslipidemia
WO2006046492A1 (fr) Nouvel agent régulant les ppar et procédé de recherche par criblage de celui-ci
JP2002504808A (ja) β−カテニン／転写因子相互作用に基づく病気を診断／治療するための組成物及び方法
Cui et al. Molecular cloning, expression and functional analysis of TNF13b (BAFF) in Japanese sea perch, Lateolabrax japonicus
WO2004069194A9 (fr) Compositions et procedes pour traiter le diabete
Ayan et al. A brief atlas of insulin
Noh et al. Analysis of amylin consensus sequences suggests that human amylin is not optimized to minimize amyloid formation and provides clues to factors that modulate amyloidogenicity
KR20040089093A (ko) 시스틴-결절 폴드 단백질
Garcia-Ocaña et al. Glucose mediated regulation of beta cell proliferation
WO2007139970A2 (fr) Gène men1 pour le diagnostic et le traitement du diabète
Griffin et al. N-arylpyrazole NOD2 agonists promote immune checkpoint inhibitor therapy
PT1701978E (pt) Utilização de caderina-t solúvel no tratamento de distúrbios metabólicos
TWI627957B (zh) 以ｐｄｉａ４蛋白作為糖尿病之診斷、監測及治療之標的
Lee et al. Analysis of prairie vole amylin reveals the importance of the N-terminus and residue 22 in amyloidogenicity and cytotoxicity
EP2168589B1 (fr) INDUCTEUR DE SÉCRÉTION D'INSULINE ET ACCÉLÉRATEUR POUR AUGMENTER LA CROISSANCE DES CELLULES ß PANCRÉATIQUES

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BW BY BZ CA CH CN CO CR CU CZ DK DM DZ EC EE EG ES FI GB GD GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV LY MD MG MK MN MW MX MZ NA NG NO NZ OM PG PH PL PT RO RU SC SD SG SK SL SM SY TJ TM TN TR TT TZ UG US UZ VC VN YU ZA ZM

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SZ TZ UG ZM ZW AM AZ BY KG MD RU TJ TM AT BE BG CH CY DE DK EE ES FI FR GB GR HU IE IS IT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

122 Ep: pct application non-entry in european phase

Ref document number: 05795105

Country of ref document: EP

Kind code of ref document: A1

NENP Non-entry into the national phase

Ref country code: JP