WO2006039656A2 - Modified small interfering rna molecules and methods of use - Google Patents

Modified small interfering rna molecules and methods of use Download PDF

Info

Publication number
WO2006039656A2
WO2006039656A2 PCT/US2005/035493 US2005035493W WO2006039656A2 WO 2006039656 A2 WO2006039656 A2 WO 2006039656A2 US 2005035493 W US2005035493 W US 2005035493W WO 2006039656 A2 WO2006039656 A2 WO 2006039656A2
Authority
WO
WIPO (PCT)
Prior art keywords
sirna
modified
virus
modification
fluoro
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Ceased
Application number
PCT/US2005/035493
Other languages
English (en)
French (fr)
Other versions
WO2006039656A3 (en
WO2006039656A9 (en
Inventor
Jang Han
Michael Houghton
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Novartis Vaccines and Diagnostics Inc
Original Assignee
Novartis Vaccines and Diagnostics Inc
Chiron Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Novartis Vaccines and Diagnostics Inc, Chiron Corp filed Critical Novartis Vaccines and Diagnostics Inc
Priority to ES05808592.9T priority Critical patent/ES2441791T3/es
Priority to JP2007534866A priority patent/JP2008514242A/ja
Priority to CA2581651A priority patent/CA2581651C/en
Priority to US11/664,008 priority patent/US8138161B2/en
Priority to EP05808592.9A priority patent/EP1796732B1/en
Publication of WO2006039656A2 publication Critical patent/WO2006039656A2/en
Publication of WO2006039656A9 publication Critical patent/WO2006039656A9/en
Publication of WO2006039656A3 publication Critical patent/WO2006039656A3/en
Anticipated expiration legal-status Critical
Priority to US14/711,845 priority patent/US20150376621A1/en
Ceased legal-status Critical Current

Links

Classifications

    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N15/00Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
    • C12N15/09Recombinant DNA-technology
    • C12N15/11DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
    • C12N15/113Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
    • C12N15/1131Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P1/00Drugs for disorders of the alimentary tract or the digestive system
    • A61P1/16Drugs for disorders of the alimentary tract or the digestive system for liver or gallbladder disorders, e.g. hepatoprotective agents, cholagogues, litholytics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P3/00Drugs for disorders of the metabolism
    • A61P3/06Antihyperlipidemics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/14Antivirals for RNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P31/00Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
    • A61P31/12Antivirals
    • A61P31/20Antivirals for DNA viruses
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61PSPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P43/00Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
    • AHUMAN NECESSITIES
    • A61MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61KPREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00Medicinal preparations containing peptides
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/10Type of nucleic acid
    • C12N2310/14Type of nucleic acid interfering nucleic acids [NA]
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/32Chemical structure of the sugar
    • C12N2310/3222'-R Modification
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/334Modified C
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/33Chemical structure of the base
    • C12N2310/335Modified T or U
    • CCHEMISTRY; METALLURGY
    • C12BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12NMICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
    • C12N2310/00Structure or type of the nucleic acid
    • C12N2310/30Chemical structure
    • C12N2310/35Nature of the modification
    • C12N2310/351Conjugate
    • C12N2310/3515Lipophilic moiety, e.g. cholesterol
    • YGENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
    • Y02TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
    • Y02ATECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
    • Y02A50/00TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
    • Y02A50/30Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change

Definitions

  • RNA silencing constitutes a phenomenon wherein non-coding RNA molecules mediate specific gene suppression in an organism. In nature, the phenomenon protects an organism's genome from foreign, invading nucleic acids such as transposons, trangenes and viral genes.
  • RNA silencing pathways involve a conversion of dsRNA into short interfering RNAs (siRNAs) that direct ribonucleases to homologous mRNA targets (Baulcombe et ah, 2001).
  • siRNAs short interfering RNAs
  • An enzyme called Dicer processes the dsRNA into siRNAs, which are 20-25 nucleotides long.
  • the siRNAs then assemble into endoribonuclease-containing complexes known as RNA-induced silencing complexes (RISCs).
  • RISCs RNA-induced silencing complexes
  • the siRNAs guide the RISCs to complementary RNA molecules, where the RISCs cleave and destroy the target mRNA.
  • Small amounts of dsRNA can silence a large amount of target mRNA due to an amplification component of RNA silencing (Fire et al, Nature, 391 :806-811 (1998)).
  • RNAi is a multi-step mechanism
  • RNAi can mediate gene-specific interference in mammalian cells (Wianny, F. and Zernicka-Goetz, M., Nature Cell Biol. 2:70-75 (2000) Svoboda, P. et al, Development 17:4147-4156 (2000))
  • PTR dsRNA-dependent protein kinase
  • siRNA of approximately 21 or 22 base pairs in length were shown to disrupt the expression of the targeted sequences in mammalian cells (Elbashir, S.M., et al, Nature 411 : 494-498 (2001)).
  • siRNA RNA or DNA sequences of a mammalian cell's genome are susceptible to siRNA. It is also uncertain that every mammalian cell type possesses the necessary machinery for effectuating gene-specific suppression using siRNA.
  • siRNA is of limited use for at least two reasons: (a) the transient nature of the suppression effect seen in cells where the siRNA has been administered, and (b) the necessity for chemical synthesis of siRNAs before their use (Tuschl, T., Nature Biotech., 20: 446-448 (2002)). Also, since siRNAs are unstable in vivo, their long-term effectiveness is limited.
  • RNAi for treating human disease at the level of nucleic acid activity.
  • such an invention will make RNAi a more practical therapy for viral infections, such as infections with HCV.
  • Current therapies for such viral infections are very limited, and tend to have poor response rates.
  • the invention provides a double-stranded (dsRNA) molecule that mediates RNA interference in target cells wherein one or more of the pyrimidines in the dsRNA are modified to include a 2 '-Fluorine.
  • dsRNA double-stranded
  • the invention provides a small interfering RNA (siRNA) that mediates RNA interference in target cells wherein one or more of the pyrimidines in the siRNA are modified to include a 2'-Fluorine.
  • siRNA small interfering RNA
  • all of the pyrimidines in the dsRNA or siRNA molecules of the first and second embodiments are modified to include a 2'-Fluorine.
  • the 2 ' -Fluorine dsRNA or siRNA of the third embodiment's further modified to include a two base deoxynucleotide "TT" sequence at the 3' end of the dsRNA or siRNA.
  • the 2'-Fluorine dsRNA or siRNA of the third embodiment inhibits viral replication in infected cells.
  • the 2'-Fluorine dsRNA or siRNA of the fifth embodiment correspond to hepatitis C virus (HCV) nucleic acids and inhibit replication of HCV in hepatic cells.
  • HCV hepatitis C virus
  • a method for inactivating a virus in a patient comprising administering to said patient a 2' -Fluorine dsRNA or siRNA in an effective amount to inactivate said virus.
  • a method for inactivating a virus in a patient comprising administering to said patient a 2 '-Fluorine dsRNA or siRNA in an effective amount to inactivate said virus, wherein all of the pyrimidines in the dsRNA or siRNA are modified to include a 2 '-Fluorine.
  • a method for inactivating a virus in a patient comprising administering to said patient a 2 '-Fluorine dsRNA or siRNA in an effective amount to inactivate said virus wherein the 2 '-Fluorine dsRNA or siRNA is further modified to include a two base deoxynucleotide "TT" sequence at the 3' end of the dsRNA or siRNA.
  • a method for inactivating a virus in a patient comprising administering to said patient a 2 '-Fluorine dsRNA or siRNA in an effective amount to inactivate said virus, wherein said virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.
  • HCV hepatitis C virus
  • a virus hepatitis A virus
  • hepatitis B virus hepatitis D virus
  • hepatitis E virus Ebola virus
  • influenza virus rotavirus
  • reovirus reovirus
  • retrovirus poliovirus
  • poliovirus human papilloma virus
  • coronavirus he
  • a method for inactivating a virus in a patient comprising administering to said patient a 2 '-Fluorine dsRNA or siRNA in an effective amount to inactivate said virus, wherein said virus is HCV.
  • a fourteenth embodiment there is provided a method of preparing an siRNA comprising the steps of:
  • siRNA wherein all of the pyrimidines in the siRNA are modified to include a 2'-Fluorine and wherein the 2'-Fluorine siRNA is further modified to include a two base deoxynucleotide "TT" sequence at the 3' end of the dsRNA or siRNA.
  • a target nucleotide sequence in the fourteenth embodiment is selected from the group consisting of 5 '-untranslated region (5'-UTR), 3 '-untranslated region (3'-UTR), core, andNS3 helicase.
  • a dsRNA molecule of from about 10 to about 30 nucleotides that inhibits replication of HCV 5 wherein said dsRNA contains at least one pyrimidine in the siRNA which is modified to include a 2 '-Fluorine.
  • a dsRNA molecule of from about 10 to about 30 nucleotides that inhibits replication of HCV, wherein all of the pyrimidines in the dsRNA are modified to include a 2' -Fluorine.
  • a dsRNA molecule of from about 10 to about 30 nucleotides that inhibits replication of HCV, wherein all of the pyrimidines in the dsRNA are modified to include a 2 '-Fluorine and wherein the 2'-Fluorine dsRNA is further modified to include a two base deoxynucleotide "TT" sequence at the 3' end of the dsRNA.
  • a method of inducing targeted RNA interference toward HCV in hepatic cells comprising administering the dsRNA molecule of sixteenth embodiment to hepatic cells and wherein the nucleotide sequence of said dsRNA molecule corresponds to an HCV nucleotide sequence.
  • a vector comprising a DNA segment encoding the dsRNA molecule of the sixteenth embodiment.
  • a vector comprising a DNA segment encoding the dsRNA molecule of the sixteenth embodiment wherein the sense strand of said double-stranded RNA molecule is operably linked to a first promoter and wherein the antisense strand of said double-stranded RNA molecule of is operably linked to a second promoter.
  • a host cell comprising the vector of the twentieth embodiment.
  • the invention provides a method for the delivery of siRNA to hepatocytes in an animal for therapeutic purposes, including inactivating a virus in the animal.
  • the method comprises administering a cholesterol- lowering drug to an animal in conjunction with the administration of a dsRNA or siRNA that is modified to further comprise a cholesterol as a receptor-binding ligand (cholesterol-siRNA).
  • the cholesterol-lowering drug can be administered prior to, at the same time, or subsequent to the administration of the cholesterol-labeled siRNA.
  • the cholesterol lowering drug is a statin.
  • Fig. 1 depicts the sequence and secondary structure of the 5' UTR from the HCV genome. It also provides specific sequences of siRNAs for inducing RNAi toward HCV in hepatic cells.
  • Fig. 2 provides sequences for several HCV-specific siRNAs that are useful for inducing RNAi toward HCV in hepatic cells. Each HCV-specific siRNA is identified by the designation provided in the first column.
  • Fig. 3 shows the nucleotide sequence of the SARS coronavirus.
  • Fig. 4 is a schematic representation of the open reading frames of the SARS coronavirus.
  • Fig. 5 depicts a subgenomic HCV replicon contained in the hepatoma cell line Huh 7, which was used to test the efficacy of siRNA in human liver cells.
  • Fig. 6 depicts the dose response of normalized luciferase activity in Huh-7 cells containing the subgenomic HCV replicon (5-2 line), that were administered different concentrations of siRNA5. Luciferase activity, which was measured at 1, 2 and 3 days post-transfection, fell with increasing doses of siRNA.
  • the luciferase assay was performed using a Luciferase assay system available from Promega Corp. (Madison, WI), according to the manufacturer's instructions.
  • Fig. 7 depicts the sequence specificity of siRNA5 for inducing HCV- directed RNAi in Huh-7 liver cells.
  • Fig. 8 demonstrates that siRNA5 is not toxic to Huh-7 cells. ATP ase levels were assayed using an ATPase assay kit available from Promega Corp. (Madison, WI), according to the manufacturer's instructions. [0044] Fig. 9 depicts the effects of siRN A5 on HCV replication in 21 -5 cells (Huh-7 cells containing full-length HCV), as measured by RNA assay. RNA levels were assayed using a TaqManTM RNA kit (F. Hoffman La-Roche, Switzerland), according to the manufacturer's instructions. Values are normalized.
  • Fig. 10 demonstrates that siRNA5 does not affect the viability of Huh 5-2 cells. Specifically, mRNA encoding GAPDH, an enzyme essential to glycolysis was measured in Huh 5-2 cells transfected with siRNA5 or GAPDH-specific siRNA. The graph demonstrates that siRNA5 did not affect RNA levels of GAPDH. GAPDH was measured using a TaqMan D RNA kit (F. Hoffman La-Roche, Switzerland), according to the manufacturer's instructions. Values are normalized.
  • Fig. 11 depicts a dose response of normalized luciferase activity in Huh 7 cells containing a subgenomic HCV replicon (5-2 line) that were administered different concentrations of 2'-fluoro-siRNA (2'-F-GL2), which targets the fruit fly luciferase gene.
  • Luciferase activity which was measured at 2 days post-transfection, fell with increasing doses of siRNA.
  • the luciferase assay was performed using a Firefly Luciferase kit (Promega Corp., Madison, WI), according to the manufacturer's instructions.
  • Fig. 12 demonstrates an inhibition of luciferase activity in 5-2 cells using the siRNA Chol-GL2 in the absence of liposomes.
  • Fig. 13 depicts an autoradiograph of 5 '-labeled siRNA duplexes separated by PAGE, and shows the stability of 2'-fluoro-modified siRNA (2'-F-GL2) incubated in human serum for up to 10 days.
  • the siRNA duplexes were subjected to incubation with human serum and analysis by 20% PAGE.
  • the composition of the lanes is as follows: Lanes 1, 11 and 21 : 32 P-end labeled siRNA alone; Lanes 2-10, 12- 20 and 22-25: siRNA incubated with human serum.
  • Fig. 14 demonstrates the use of recombinant human dicer to convert fluorinated dsRNA into 2'F-siRNA.
  • the composition of the lanes is as follows: Lane 1: size marker, ⁇ HindIII+ ⁇ X174 ⁇ HaeIII; Lane 2: ribo/ribo homoduplex RNA; Lane 3: ribo/2'-F heteroduplex RNA; Lane 4: 2'-F/ribo heteroduplex RNA; Lane 6: size marker, lObp DNA ladder; Lane 7: rib ⁇ /ribo homoduplex siRNA; Lane 8: ribo/2'-F heteroduplex siRNA; Lane 9: 2'-F/ribo heteroduplex siRNA; Lane 10: 2'-F/2'-F homoduplex siRNA.
  • Fig. 15 shows a dose response of normalized luciferase activity in Huh-7 cells containing the subgenomic HCV replicon (5-2 line) to HCV-specific siRNAs. Luciferase activity fell with increasing doses of each siRNA.
  • Fig. 16 shows that cholesterol shows a dose response of normalized luciferase activity in Huh-7 cells containing the subgenomic HCV replicon (5-2 line) to cholesterol-modified GL2 siRNA.
  • Fig. 17 demonstrates the increased stability seen with an siRNA that has been modified to include 2-Fluoro pyrimidines replacing all of the pyrimidines (2- F-siRNA) and 2-Fluoro pyrimidines replacing all of the pyrimidines and also a two base deoxynucleotide "TT" sequence added to the 3 'ends of the molecule in place of the ribolucleotide "UU" overhangs present in 2-F-siRNA (2'-F-siRNA 3'-X).
  • 2-Fluoro pyrimidines replacing all of the pyrimidines
  • 2-Fluoro pyrimidines replacing all of the pyrimidines and also a two base deoxynucleotide "TT" sequence added to the 3 'ends of the molecule in place of the ribolucleotide "UU" overhangs present in 2-F-siRNA (2'-F-siRNA 3'-X).
  • Fig. 18 shows that siRNA stability can be dramatically increased by fluorination within 2' -sugar.
  • Fig. 19 shows evaluation of siRNA in vivo.
  • Fig. 20 shows conjugated 2'-F-siRNA is efficacious in chimeric mice by low pressure IV injection.
  • Fig. 21 shows conjugated 2'-F-siRNA given subcutaneously is partically effective in chimeric mice.
  • the present invention provides dsRNA molecules that are about 10 to about 30 nucleotides long, and that mediate RNA interference in target cells.
  • the inventive molecules are chemically modified to confer increased stability against nuclease degradation, but retain the ability to bind to target nucleic acids.
  • RNA interference refers to sequence- specific or gene specific suppression of gene expression (protein synthesis) that is mediated by siRNA, without generalized suppression of protein synthesis. While the invention is not limited to a particular theory or mode of action, RNAi may involve degradation of messenger RNA (mRNA) by an RNA-induced silencing complex (RISC), preventing translation of the transcribed mRNA. Alternatively, it may involve methylation of genomic DNA, which shunts transcription of a gene. The suppression of gene expression caused by RNAi may be transient or it may be more stable, even permanent.
  • mRNA messenger RNA
  • RISC RNA-induced silencing complex
  • sequence-specific suppression is determined by separately assaying levels of the protein targeted for suppression in cells containing the siRNA (experimental cells) and in cells not containing the identical siRNA (control cells), then comparing the two values.
  • Experimental and control cells should be derived from the same source and same animal. Also, control and experimental cells used in determining the level or quantity of gene suppression should be assayed under similar, if not identical, conditions.
  • RNA is a polymer of ribonucleotides, each containing the sugar ribose in association with a phosphate group and a nitrogenous base (typically, adenine, guanine, cytosine, or uracil). Like its cousin, DNA, RNA can form complementary hydrogen bonds. Therefore, RNA may be double-stranded (dsRNA), single-stranded (ssRNA) or double-stranded with a single-stranded overhang.
  • dsRNA double-stranded
  • ssRNA single-stranded
  • ssRNA double-stranded with a single-stranded overhang.
  • RNA messenger RNA
  • tRNA transfer RNA
  • rRNA ribosomal RNA
  • siRNA short interfering RNA
  • miRNA micro RNA
  • shRNA small hairpin RNA
  • siRNA molecules are 12- 28 nucleotides long, more preferably 15-25 nucleotides long, still more preferably 19- 23 nucleotides long and most preferably 21-23 nucleotides long. Therefore, preferred siRNA molecules are 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 28 or 29 nucleotides in length.
  • the length of one strand designates the length of an siRNA molecule.
  • an siRNA that is described as 21 ribonucleotides long could comprise two opposite strands of RNA that anneal together for 19 contiguous base pairings. The two remaining ribonucleotides on each strand would form an "overhang.”
  • the longer of the strands designates the length of the siRNA. For instance, a dsRNA containing one strand that is 21 nucleotides long and a second strand that is 20 nucleotides long, constitutes a 21-mer.
  • siRNAs that comprise an overhang are desirable.
  • the overhang may be at the 5' or the 3' end of a strand. Preferably, it is at the 3' end of the RNA strand.
  • the length of an overhang may vary, but preferably is about 1 to about 5 bases, and more preferably is about 2 nucleotides long.
  • the siRNA of the present invention will comprise a 3' overhang of about 2 to 4 bases. More preferably, the 3' overhang is 2 ribonucleotides long. Even more preferably, the 2 ribonucleotides comprising the 3' overhang are uridine (U).
  • siRNAs of the present invention are designed to interact with a target ribonucleotide sequence, meaning they complement a target sequence sufficiently to bind to the target sequence.
  • the target ribonucleotide sequence derives from a disease producing agent or pathogen. More preferably, the target ribonucleotide sequence is in a virus genome of an RNA virus or a DNA virus.
  • the virus is selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus.
  • HCV hepatitis C virus
  • Figure 1 and Figure 2 disclose the nucleic acid sequences for several HCV-specific siRNA molecules.
  • siRNA5 siRNA5Cl
  • siRNAC2 siRNA5Bl
  • siRNA5B2 siRNA5B4
  • siRNA5B4 have shown particularly good activity, and therefore are highly preferred.
  • siRNAs at least 80%, 90%, or 95%, identical to these highly preferred siRNAs also constitute part of the invention.
  • coronavirus is associated with upper respiratory infections in humans and recently has been linked with SARS (severe acute respiratory syndrome).
  • Coronavirus has the largest known RNA virus genome, 32 kilobases long, and its genome is composed of positively stranded RNA.
  • Each coronavirus mRNA has a 5 '-end leader sequence of 60 to 80 nucleotides that is identical to the 5'-UTR of genomic RNA approximately 200 nucleotides long.
  • These sequences are highly conserved, and therefore, provide an excellent source of target sequences for which siRNAs. See Fundamental Virology. 3 rd Ed., Chapter 18, p. 541-560 (Eds.
  • the entire leader sequence (nucleotides 1-72) is targeted. In another embodiment, one or more sections of the leader sequence is targeted. In a preferred embodiment, nucleotides 64-72 (TAAACGAAC) of the leader sequence are targeted. siRNA targeted to the coronavirus may be modified or unmodified.
  • the invention provides an siRNA molecule comprising a ribonucleotide sequence at least 80% identical to a ribonucleotide sequence from a target agent or virus.
  • the siRNA molecule is at least 90%, 95%, 96%, 97%, 98%, 99% or 100% identical to the ribonucleotide sequence of the target agent or virus.
  • the target can be the entire viral genome, a primary transcript, an open reading frame, or any portion of these.
  • an siRNA will be 100% identical to the nucleotide sequence of a target agent or virus.
  • siRNA molecules with insertions, deletions or single point mutations relative to a target may also be effective.
  • a polynucleotide having a nucleotide sequence at least 95% "identical" to a reference nucleotide sequence means that the polynucleotide's sequence may include up to five point mutations per 100 nucleotides of the reference nucleotide sequence, or 1 point mutation per 20 nucleotides.
  • a polynucleotide having a nucleotide sequence at least 95% identical to a reference nucleotide sequence up to 5% of the nucleotides in the reference sequence may be deleted or substituted with another nucleotide, or a number of nucleotides up to 5% of the total nucleotides in the reference sequence may be inserted into the reference sequence.
  • These mutations of the reference sequence may occur at the 5' or 3' terminal positions of the reference nucleotide sequence or anywhere between those terminal positions, interspersed either individually among nucleotides in the reference sequence or in one or more contiguous groups within the reference sequence.
  • nucleic acid molecule is at least 90%, 95%, 96%, 97% 98%, 99% or 100% identical to the ribonucleotide sequence of a target agent or virus can be determined conventionally using known computer programs such as the Bestfit program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, Madison, WI). Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)) to find the best segment of homology between two sequences.
  • Bestfit program Wiconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, Madison, WI. Bestfit uses the local homology algorithm of Smith and Waterman (Advances in Applied Mathematics 2:482-489 (1981)) to find the best segment of homology between two sequences.
  • the parameters are set, of course, such that the percentage of identity is calculated over the full length of the reference ribonucleotide sequence and that gaps in homology of up to 5% of the total number of ribonucleotides in the reference sequence are allowed.
  • the present invention also includes siRNA molecules that have been chemically modified to confer increased stability against nuclease degradation, but retain the ability to bind to target nucleic acids that may be present in cells.
  • the modified siRNAs are able to bind to the virus specific RNAs or DNAs, thereby inactivating the virus.
  • a modified siRNA of the present invention comprises a modified ribonucleotide, and is resistant to enzymatic degradation, such as RNase degradation, yet retains the ability to inhibit viral replication in a cell containing the specific viral target RNA or DNA sequences.
  • the siRNA may be modified at any position of the molecule so long as the modified siRNA binds to a target sequence and is resistant to enzymatic degradation.
  • Modifications in the siRNA may be in the nucleotide base, i.e., the purine or the pyrimidine, the ribose or the phosphate.
  • the modification occurs at the 2' position of at least one ribose in an siRNA.
  • the siRNA is modified in at least one pyrimidine, at least one purine or a combination thereof.
  • pyrimidines cytosine or uracil
  • purines adenosine or guanine
  • a combination of all pyrimidines and all purines of the siRNA are modified.
  • the pyrimidines are modified, and these pyrimidines are cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof.
  • Ribonucleotides on either one or both strands of the siRNA may be modified.
  • Ribonucleotides containing pyrimidine bases found in RNA can be chemically modified by adding any molecule that inhibits RNA degradation or breakdown of the base, the ribose or the phosphates. As previously noted, the 2' position of ribose is a preferred site for modification. 2' modified siRNAs have a longer serum half-life and are resistant to degradation, relative to unmodified siRNAs or single-stranded RNAs, such as antisense or ribozyme. T- modified pyrimidine ribonucleotides can be formed by a number of different methods known in the art.
  • a preferable chemical modification is the addition of a molecule from the halide chemical group to a ribonucleotide of siRNA.
  • fluorine is a preferred molecule.
  • other chemical moieties such as methyl-, methoxyethyl- and propyl- may be added as modifications.
  • the most preferred modification, though, is fiuoro-modification, such as a 2'-fluoro- modification or a 2',2'-fluoro-modification.
  • siRNA is modified by the addition of a fluorine molecule to the 2' carbon of a pyrimidine ribonucleotide.
  • the siRNA may be fluorinated completely or partially.
  • only the cytosine ribonucleotides may be fluorinated.
  • only the uracil ribonucleotides may be fluorinated.
  • both uracil and cytosine are fluorinated.
  • Only one strand, either sense or antisense, of siRNA may to be fluorinated.
  • Even partial 2' fluorination of siRNA gives protection against nucleolytic degradation.
  • 2' fluorinated siRNA is not toxic to cells, an unexpected result given that fluorine chemistry usually is toxic to living organisms.
  • modified siRNAs of the present invention may contain chemical modifications that inhibit viral RNA polymerases.
  • siRNAs may comprise one or more nucleosides that inhibit viral RNA-dependent RNA polymerases. Examples of such nucleosides and other chemical modifications exist in WO 02/057425, WO 02/057287, WO 02/18404, WO 02/100415, WO 02/32920, WO 01/90121, US patent No. 6,063,628 and US published application No. 2002/0019363.
  • siRNA can be prepared in a number of ways, such as by chemical synthesis, T7 polymerase transcription, or by treating long double stranded RNA (dsRNA) prepared by one of the two previous methods with Dicer enzyme.
  • Dicer enzyme creates mixed populations of dsRNA from about 21 to about 23 base pairs in length from dsRNA that is about 500 base pairs to about 1000 base pairs in size.
  • Dicer can effectively cleave modified strands of dsRNA, such as 2' fluoro-modified dsRNA.
  • the Dicer method of preparing siRNAs can be performed using a Dicer siRNA Generation Kit available from Gene Therapy Systems (San Diego, CA).
  • the invention particularly includes a method of making a modified siRNA that targets a nucleic acid sequence in a virus, comprising (a) preparing a modified-double stranded RNA (dsRNA) fragment containing at least one modified ribonucleotide in at least one strand, and (b) cleaving the modified-dsRNA fragments with recombinant human Dicer, resulting in more than one modified siRNA.
  • the method may further comprise (c) isolating the modified siRNAs.
  • a dsRNA fragment can be prepared by chemical synthesis or in vitro translation.
  • the modified siRNA is a 2' modified siRNA in which the modification is at the 2' position of at least one ribonucleotide of said siRNA.
  • the modification is selected from the group consisting of fluoro-, methyl-, methoxyethyl and propyl-modification.
  • the fluoro-modification is a 2'-fluoro-modification or a 2',2'-fluoro- modification.
  • the pyrimidines, the purines or a combination thereof of the siRNA are modified. More preferably, the pyrimidines are modified, such as cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof.
  • One or both strands of the siRNA may contain one or more modified ribonucleotide.
  • the invention further provides a method of inactivating a target agent or virus in a patient by administering to the patient a dsRNA in an effective amount to inactivate the targeted agent or virus.
  • a dsRNA is modified as described above.
  • RNA interference toward a targeted DNA segment in a cell can be achieved by administering a double-stranded RNA molecule to the cells, wherein the ribonucleotide sequence of the double-stranded RNA molecule corresponds to the ribonucleotide sequence of the targeted DNA segment.
  • the dsRNA used to induce targeted RNAi is siRNA.
  • targeted DNA segment is used to mean a DNA sequence encoding, in whole or in part, an mRNA for a targeted protein, including introns or exons, where suppression is desired.
  • DNA segment can also mean a DNA sequence that normally regulates expression of the targeted protein, including but not limited to the promoter of the targeted protein.
  • the DNA segment may or may not be a part of the cell's genome or it may be extrachromosomal, such as plasmid DNA.
  • the present invention is particularly directed to a method of inactivating a virus in a patient by administering to the patient an siRNA, preferably a modified siRNA, in an effective amount to inactivate the virus.
  • the siRNA is preferably about 10 to about 30 ribonucleotides in length, more preferably 12-28 ribonucleotides, more preferably 15-25 ribonucleotides, even more preferably 19 -23 ribonucleotides and most preferably 21-23 ribonucleotides.
  • the method of inactivating a virus preferably utilizes an siRNA that is modified at the 2' position of at least one ribonucleotide of said siRNA.
  • the siRNA may be modified with chemical groups selected from the group consisting of fluoro-, methyl-, methoxyethyl- and propyl-. Fluoro-modification is most preferred, and either a 2'-fluoro-modification or a 2',2' ⁇ fluoro-modification is useful in the method.
  • the modification may be at a pyrimidine, a purine or a combination thereof of the siRNA. More preferably the pyrimidines are modified, such as cytosine, a derivative of cytosine, uracil, a derivative of uracil or a combination thereof.
  • one strand of the siRNA contains at least one modified ribonucleotide, while in another embodiment, both strands of the siRNA contain at least one modified ribonucleotide.
  • siRNAs useful in treatment methods may also be modified by the attachment of at least one, but preferably more than one, receptor-binding ligand(s) to the siRNA.
  • ligands are useful to direct delivery of siRNA to a target virus in a body system, organ, tissue or cells of a patient, such as the liver, gastrointestinal tract, respiratory tract, the cervix or the skin.
  • receptor-binding ligands are attached to either a 5'-end or a 3'-end of an siRNA molecule.
  • Receptor-binding ligands may be attached to one or more siRNA ends, including any combination of 5'- and 3 '-ends.
  • receptor binding ligands when receptor binding ligands are attached only to the ends of an siRNA molecule, anywhere between 1 and 4 such ligands may be attached.
  • an appropriate ligand for targeting siRNAs to viruses in particular body systems, organs, tissues or cells is considered to be within the ordinary skill of the art.
  • cholesterol may be attached at one or more ends, including any combination of 5'- and 3 '-ends, of an siRNA molecule.
  • the resultant cholesterol-siRNA is delivered to hepatocytes in the liver, thereby providing a means to deliver siRNAs to this targeted location.
  • Other ligands useful for targeting siRNAs to the liver include HBV surface antigen and low- density lipoprotein (LDL).
  • siRNA molecules that target Human Immunodeficiency virus type 1 can be delivered to T lymphocytes where the target nucleic acids are located (Song, E. et ah, J. of Virology, 77(13): 7174-7181 (2003)). This delivery can be accomplished by attaching, at the 3' -end or 5' -end of siRNA molecules, HIV-I surface antigen capable of binding to the CD4 surface protein located on T-cells (Kilby, M. et ah, New England J. of Medicine, 348(22): 2228-38 (2003)).
  • siRNA molecules that target Influenza A virus can be delivered to epithelial cells of the respiratory tract where the target nucleic acids are located (Ge, Q. et al, Proc. Natl. Acad, of Sciences, 100(5): 2718-2723 (2002)). This delivery can be accomplished by attaching, at the 3' -end or 5' -end of siRNA molecules, the Influenza virus surface antigen, which is capable of binding to the sialic acid residues located on the surface of the epithelial cells (Ohuchi, M., et ah, J. of Virology, 76(24): 12405-12413 (2002); Glick, G. et ah, J. of Biol. Chem., 266 (35): 23660-23669 (1991)).
  • siRNA molecules that target respiratory syncitial virus can be delivered to epithelial cells of the respiratory tract where the target nucleic acids are located (Bitko, V. et al, BMC Microbiology, 1:34 (2001)). This delivery can be accomplished by attaching, at the 3' -end or 5' -end of siRNA molecules, RSV surface antigen (Malhotra, R. et ah, Microbes and Infection, 5: 123-133 (2003)).
  • siRNAs that target Human Papillomavirus can be delivered to basal epithelial cells where the target nucleic acids are located (Hall, A. et al., J. of Virology, 77(10): 6066-6069 (2003)).
  • This delivery can be accomplished by attaching, at the 3' -end or 5' -end of siRNA molecules, HPV surface antigen capable of binding to heparin sulfate proteoglycans located on the surface of basal epithelial cells (Bousarghin L. et ah, J. of Virology, 77(6): 3846-3850 (2002)).
  • siRNAs that target Poliovirus (PV) can be delivered to cells of the nervous system where the target nucleic acids are located (Gitlin, L. et ah, Nature, 418: 430-434 (2002)). This delivery can be accomplished by attaching, at the 3' -end or 5' -end of siRNA molecules, PV surface antigen capable of binding to the CD 155 receptor located on the surface of neurons (He, Y. et al, Proc. Natl. Acad, of Sciences, 97 (1): 79-84 (2000)).
  • viruses which can be either RNA viruses or DNA viruses.
  • Preferred viruses are selected from the group consisting of hepatitis C virus (HCV), hepatitis A virus, hepatitis B virus, hepatitis D virus, hepatitis E virus, Ebola virus, influenza virus, rotavirus, reovirus, retrovirus, poliovirus, human papilloma virus (HPV), metapneumovirus and coronavirus. More preferably the target virus is hepatitis C virus or a coronavirus.
  • the method utilizes an siRNA prepared by (a) identifying a target ribonucleotide sequence in a virus genome for designing a small interfering RNA (siRNA) and (b) producing a siRNA that has been modified to contain at least one modified ribonucleotide.
  • the siRNA comprises a double-stranded RNA molecule with a first strand ribonucleotide sequence corresponding to a ribonucleotide sequence corresponding to a target ribonucleotide sequence in the virus, and a second strand comprising a ribonucleotide sequence complementary to the target ribonucleotide sequence.
  • the first and second strands should be separate complementary strands that hybridize to each other to form a double-stranded RNA molecule.
  • one or both of the strands should comprise at least one modified ribonucleotide.
  • the siRNA targets a ribonucleotide sequence in the hepatitis C virus genome.
  • the target ribonucleotide sequence comprises a conserved ribonucleotide sequence necessary for HCV replication, and the conserved ribonucleotide sequence is selected from the group consisting of 5 '-untranslated region (5'-UTR), 3 '-untranslated region (3'-UTR), core, and NS3 helicase.
  • Highly preferred siRNA molecules comprise a sequence at least 80% identical to those of siRNA5, siRNACl, siRNAC2, siRNA5Bl, siRNA5B2, or siRNA5B4.
  • the siRNAs may be unmodified, or modified as described above.
  • Methods of inhibiting the replication of HCV in cells positive for HCV should not be toxic to the cells, or cause apoptosis in the treated cells.
  • the inhibition of HCV replication is specifically tailored to affect only HCV replication in the cells, such that normal growth, division or metabolism is not affected.
  • Cells in which HCV has been shown to replicate include, but are not limited to hepatic cells, B cell lymphocytes and T cell lymphocytes.
  • a method of inhibiting the replication of HCV is performed in hepatic cells.
  • hepatic cells can be from any animal source. Further, the hepatic cells may be in cell culture, or part of a tissue, or an organ, in part or in whole. The phrase hepatic cells is meant to include any cell constituting a normal, abnormal or diseased liver cell. Examples of hepatic cells include, but are not limited to, Kupffer cells, hepatocytes and cells comprising a hepatocellular carcinoma. "Hepatic cells” is not meant to include cells that make up discrete structures within the liver, such as endothelial cells lining blood vessels. A tissue or organ containing the hepatic cells may be within a subject or may be biopsied or removed from the animal.
  • the tissue may be "fresh" in that the tissue would be recently removed from a subject, without any preservation steps between the excision and the methods of the current invention.
  • the tissue Prior to application of the methods of the current invention, the tissue may also have been preserved by such standard tissue preparation techniques including, but not limited to, freezing, quick freezing, paraffin embedding and tissue fixation.
  • the tissue may also be a xenograft or a syngraft on or in another host animal. As used herein, the terms animal and subject are used interchangeably.
  • hepatitis C virus takes its ordinary meaning in the art as of the date of invention.
  • the hepatitis C virus is an RNA virus of the Flaviviridae family.
  • HCV includes, but is not limited to genotypes 1-11 (using the most common genotyping system), with these genotypes being broken down into sub-types, some of which include but are not limited to Ia, Ib, Ic, 2a, 2b, 2c, 3 a, 3b, 4a, 4b, 4c, 4d, 4e, 5 a, 6a, 7a, 7b, 8a, 8b, 9a, 10a and 11a.
  • Pestivirus is yet another target of the present invention.
  • "pestivirus” takes its ordinary meaning in the art as of the date of invention.
  • the pestivirus belongs to the family Flaviviridae. Pestivirus is widespread throughout the Australian cattle population. It is believed that about 70% of herds are actively infected with pestivirus. Infection of susceptible animals can cause a variety of diseases - some not apparent until well after the initial spread of the virus into a herd.
  • Pestivirus is a genus of viruses that includes hog cholera virus, bovine viral diarrhea virus (BVDV) and border disease virus (BDV) or hairy-shaker disease virus.
  • BVDV bovine viral diarrhea virus
  • BDV border disease virus
  • siRNA may be administered to a patient by intravenous injection, subcutaneous injection, oral delivery, liposome delivery or intranasal delivery. The siRNA may then accumulate in a target body system, organ, tissue or cell type of the patient.
  • the present invention also provides a method of inhibiting the replication of a virus in mammalian cells, comprising transfecting cells harboring the virus with a vector that directs the expression of virus-specific siRNA.
  • the invention provides a method of inhibiting the replication of hepatitis C virus (HCV) in cells positive for HCV, comprising transfecting HCV-positive cells with a vector that directs the expression of an HCV-specific siRNA.
  • HCV hepatitis C virus
  • the cells may be evaluated to determine if a marker in the cells has been inhibited by the siRNA.
  • the invention also provides vectors and host cells comprising a nucleic acid segment encoding the described siRNAs.
  • Vectors of the present invention may be employed for producing siRNAs by recombinant techniques.
  • a DNA segment encoding an siRNA may be included in any one of a variety of expression vectors for expressing any DNA sequence.
  • Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences, e.g., derivatives of SV40; bacterial plasmids; phage DNA; baculo virus; yeast plasmids; vectors derived from combinations of plasmids and phage DNA, viral DNA such as vaccinia, adenovirus, fowl pox virus, and pseudorabies.
  • any other vector may be used as long as it is replicable and viable in a desired host.
  • the appropriate DNA segment may be inserted into the vector by a variety of procedures.
  • the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.
  • the DNA segment in the expression vector is operatively linked to an appropriate expression control sequence(s) (promoter) to direct siRNA synthesis.
  • Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoters of retroviral LTRs, such as those of the Rous Sarcoma Virus (RSV), and metallothionein promoters, such as the mouse metallothionein-I promoter.
  • the promoters of the present invention are from the type III class of RNA polymerase III promoters. More preferably, the promoters are selected from the group consisting of the U6 and Hl promoters.
  • the U6 and Hl promoters are both members of the type III class of RNA polymerase III promoters.
  • the promoters of the present invention may also be inducible, in that expression may be turned “on” or “off.”
  • a tetracycline-regulatable system employing the U6 promoter may be used to control the production of siRNA.
  • the expression vector may or may not contain a ribosome binding site for translation initiation and a transcription terminator.
  • the vector may also include appropriate sequences for amplifying expression.
  • the expression vectors preferably contain one or more selectable marker genes to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or tetracycline or ampicillin resistance.
  • recombinant expression vectors will include origins of replication and selectable markers permitting transformation of the host cell, e.g., the ampicillin resistance gene of E. coli and S. cerevisiae TRPl gene, and a promoter derived from a highly-expressed gene to direct transcription of a downstream structural sequence.
  • promoters can be derived from operons encoding glycolytic enzymes such as 3-phosphoglycerate kinase (PGK), a-factor, acid phosphatase, or heat shock proteins, among others.
  • the heterologous structural sequence is assembled in appropriate phase with translation initiation and termination sequences, and preferably, a leader sequence capable of directing secretion of translated protein into the periplasmic space or extracellular medium.
  • the heterologous sequence can encode a fusion protein including an N-terminal identification peptide imparting desired characteristics, e.g., stabilization or simplified purification of expressed recombinant product.
  • the invention provides a vector, wherein the DNA segment encoding the sense strand of the RNA polynucleotide is operably linked to a first promoter and where the DNA segment encoding the antisense (opposite) strand of the RNA polynucleotide molecule of is operably linked to a second promoter.
  • each strand of the RNA polynucleotide is independently expressed.
  • the promoter driving expression of each strand can be identical or each one may be different from the other promoter.
  • the vector of the current invention may comprise opposing promoters.
  • the vector may comprise two U6 promoters on either side of the DNA segment encoding the sense strand of the RNA polynucleotide and placed in opposing orientations, with or without a transcription terminator placed between the two opposing promoters.
  • the U6 opposing promoter construct is similar to the T7 opposing promoter construct as described in Wang, Z. et at, J. Biol. Chem. 275: 40174-40179 (2000). See Miyagishi, M. and Taira, K., Nature Biotech. 20: 497-500 (2002).
  • the DNA segments encoding both strands of the RNA polynucleotide are under the control of a single promoter.
  • the DNA segments encoding each strand are arranged on the vector with a "loop" region interspersed between the two DNA segments, where transcription f the DNA segments and loop region creates one RNA transcript.
  • the single transcript will, in turn, anneal to itself creating a "hairpin" RNA structure capable of inducing RNAi.
  • the "loop" of the hairpin structure is preferably from about 4 to about 6 nucleotides in length. More preferably, the loop is 4 nucleotides in length.
  • the vector containing the appropriate DNA sequence as described herein, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the siRNA.
  • Appropriate cloning and expression vectors for use with prokaryotic and eukaryotic hosts are described by Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor, N.Y. (1989), the disclosure of which is hereby incorporated by reference.
  • Host cells are genetically engineered (transduced or transformed or transfected) with the vectors of this invention which may be, for example, cloning vectors or expression vectors.
  • the vectors may be, for example, in the form of a plasmid, a viral particle, a phage, etc.
  • the engineered host cells may be cultured in conventional nutrient media modified as appropriate for activating promoters, selecting transformants.
  • the culture conditions such as temperature, pH and the like, are those previously used with the host cell selected for expression, and will be apparent to the ordinarily skilled artisan.
  • the present invention relates to host cells containing the above-described constructs.
  • a host cell may be a higher eukaryotic cell, such as a mammalian cell, or a lower eukaryotic cell, such as a yeast cell, or the host cell may be a prokaryotic cell, such as a bacterial cell.
  • host cells are mammalian cells. More preferably, host cells are hepatic cells.
  • Introduction of a construct into host cells can be effected by calcium phosphate transfection, DEAE- Dextran mediated transfection, or electroporation (Davis, L., et al., Basic Methods in Molecular Biology (1986)).
  • patient refers to an animal, preferably a mammal. More preferably the patient can be a primate, including non-human and humans.
  • subject and patient are used interchangeably herein.
  • compositions can mean a pure compound, agent or substance or a mixture of two or more compounds, agents or substances.
  • agent, substance or compound is intended to mean a protein, nucleic acid, carbohydrate, lipid, polymer or a small molecule, such as a drug.
  • the composition administered to the subject is a pharmaceutical composition.
  • the pharmaceutical composition can be administered orally, nasally, parenterally, intrasystemically, intraperitoneally, topically (as by drops or transdermal patch), bucally, or as an oral or nasal spray.
  • Intranasal delivery of a virus that causes upper respiratory diseases, such as the coronavirus or the metapneumovirus would be a particularly advantageous delivery mode.
  • parenteral refers to modes of administration that include intravenous, intramuscular, intraperitoneal, intrasternal, subcutaneous and intraarticular injection and infusion.
  • the pharmaceutical compositions as contemplated by the current invention may also include a pharmaceutically acceptable carrier.
  • “Pharmaceutically acceptable carrier” includes, but is not limited to, a non-toxic solid, semisolid or liquid filler, diluent, encapsulating material or formulation auxiliary of any type, such as liposomes.
  • a pharmaceutical composition of the present invention for parenteral injection can comprise pharmaceutically acceptable sterile aqueous or nonaqueous solutions, dispersions, suspensions or emulsions as well as sterile powders for reconstitution into sterile injectable solutions or dispersions just prior to use.
  • suitable aqueous and nonaqueous carriers, diluents, solvents or vehicles include water, ethanol, polyols (such as glycerol, propylene glycol, polyethylene glycol, and the like), carboxymethylcellulose and suitable mixtures thereof, vegetable oils (such as olive oil), and injectable organic esters such as ethyl oleate.
  • compositions of the present invention can also contain adjuvants such as, but not limited to, preservatives, wetting agents, emulsifying agents, and dispersing agents.
  • adjuvants such as, but not limited to, preservatives, wetting agents, emulsifying agents, and dispersing agents.
  • Prevention of the action of microorganisms can be ensured by the inclusion of various antibacterial and antifungal agents, for example, paraben, chlorobutanol, phenol, sorb acid, and the like. It can also be desirable to include isotonic agents such as sugars, sodium chloride, and the like. Prolonged absorption of the injectable pharmaceutical form can be brought about by the inclusion of agents which delay absorption such as aluminum monostearate and gelatin.
  • Injectable depot forms are made by forming microencapsule matrices of the drug in biodegradable polymers such as polylactide-polyglycolide. Depending upon the ratio of drug to polymer and the nature of the particular polymer employed, the rate of drug release can be controlled. Examples of other biodegradable polymers include poly(orthoesters) and poly (anhydrides). Depot injectable formulations are also prepared by entrapping the drug in liposomes or microemulsions which are compatible with body tissues.
  • the injectable formulations can be sterilized, for example, by filtration through a bacterial-retaining filter, or by incorporating sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile injectable medium just prior to use.
  • Solid dosage forms for oral administration include, but are not limited to, capsules, tablets, pills, powders, and granules.
  • the active compounds are mixed with at least one item pharmaceutically acceptable excipient or carrier such as sodium citrate or dicalcium phosphate and/or a) fillers or extenders such as starches, lactose, sucrose, glucose, mannitol, and silicic acid, b) binders such as, for example, carboxymethylcellulose, alginates, gelatin, polyvinylpyrrolidone, sucrose, and acacia, c) humectants such as glycerol, d) disintegrating agents such as agar-agar, calcium carbonate, potato or tapioca starch, alginic acid, certain silicates, and sodium carbonate, e) solution retarding agents such as paraffin, f) absorption accelerators such as quaternary ammonium compounds, g) wetting agents such as, for example,
  • compositions of a similar type can also be employed as fillers in soft and hard filled gelatin capsules using such excipients as lactose or milk sugar as well as high molecular weight polyethylene glycols and the like.
  • the solid dosage forms of tablets, dragees, capsules, pills, and granules can be prepared with coatings and shells such as enteric coatings and other coatings well known in the pharmaceutical formulating art. They can optionally contain opacifying agents and can also be of a composition that they release the active ingredient(s) only, or preferentially, in a certain part of the intestinal tract, optionally, in a delayed manner. Examples of embedding compositions which can be used include polymeric substances and waxes.
  • the active compounds can also be in micro-encapsulated form, if appropriate, with one or more of the above-mentioned excipients.
  • Liquid dosage forms for oral administration include, but are not limited to, pharmaceutically acceptable emulsions, solutions, suspensions, syrups and elixirs.
  • the liquid dosage forms can contain inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and emulsifiers such as ethyl alcohol, isopropyl alcohol, ethyl carbonate, ethyl acetate, benzyl alcohol, benzyl benzoate, propylene glycol, 1,3- butylene glycol, dimethyl formamide, oils (in particular, cottonseed, groundnut, corn, germ, olive, castor, and sesame oils), glycerol, tetrahydrofurfuryl alcohol, polyethylene glycols and fatty acid esters of sorbitan, and mixtures thereof.
  • inert diluents commonly used in the art such as, for example, water or other solvents, solubilizing agents and
  • the oral compositions can also include adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
  • adjuvants such as wetting agents, emulsifying and suspending agents, sweetening, flavoring, and perfuming agents.
  • Suspensions in addition to the active compounds, can contain suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.
  • suspending agents as, for example, ethoxylated isostearyl alcohols, polyoxyethylene sorbitol and sorbitan esters, microcrystalline cellulose, aluminum metahydroxide, bentonite, agar-agar, and tragacanth, and mixtures thereof.
  • the composition can be pressurized and contain a compressed gas, such as nitrogen or a liquefied gas propellant.
  • a compressed gas such as nitrogen or a liquefied gas propellant.
  • the liquefied propellant medium and indeed the total composition is preferably such that the active ingredients do not dissolve therein to any substantial extent.
  • the pressurized composition can also contain a surface active agent.
  • the surface active agent can be a liquid or solid non-ionic surface active agent or can be a solid anionic surface active agent. It is preferred to use the solid anionic surface active agent in the form of a sodium salt.
  • compositions of the present invention can also be administered in the form of liposomes.
  • liposomes are generally derived from phospholipids or other lipid substances. Liposomes are formed by mono- or multi-lamellar hydrated liquid crystals that are dispersed in an aqueous medium. Any non-toxic, physiologically acceptable and metabolizable lipid capable of forming liposomes can be used.
  • the present compositions in liposome form can contain, in addition to the compounds of the invention, stabilizers, preservatives, excipients, and the like.
  • the preferred lipids are the phospholipids and the phosphatidyl cholines (lecithins), both natural and synthetic. Methods to form liposomes are known in the art (see, for example, Prescott, Ed., Meth. Cell Biol. 14:33 et seq (1976)).
  • agents of the invention can be determined empirically and can be employed in pure form or, where such forms exist, in pharmaceutically acceptable salt, ester or prodrug form.
  • a "therapeutically effective" amount of the inventive compositions can be determined by prevention or amelioration of adverse conditions or symptoms of diseases, injuries or disorders being treated.
  • the agents can be administered to a subject, in need of treatment of viral infection, as pharmaceutical compositions in combination with one or more pharmaceutically acceptable excipients. It will be understood that, when administered to a human patient, the total daily usage of the agents or composition of the present invention will be decided by the attending physician within the scope of sound medical judgement.
  • the specific therapeutically effective dose level for any particular patient will depend upon a variety of factors: the type and degree of the cellular or physiological response to be achieved; activity of the specific agent or composition employed; the specific agents or composition employed; the age, body weight, general health, sex and diet of the patient; the time of administration, route of administration, and rate of excretion of the agent; the duration of the treatment; drugs used in combination or coincidental with the specific agent; and like factors well known in the medical arts. For example, it is well within the skill of the art to start doses of the agents at levels lower than those required to achieve the desired therapeutic effect and to gradually increase the dosages until the desired effect is achieved.
  • Dosing also can be arranged in a patient specific manner to provide a predetermined concentration of the agents in the blood, as determined by techniques accepted and routine in the art.
  • patient dosaging can be adjusted to achieve regular on-going blood levels, as measured by HPLC, on the order of from 50 to 1000 ng/ml.
  • Various medications can lower blood cholesterol levels. These medications or drugs include e.g., statins, resins and nicotinic acid (niacin), gemfibrozil and clofibrate. Clofibrate (Atromid-S) raises the HDL cholesterol levels and lowers triglyceride levels. Gemfibrozil (Lopid) lowers blood fats and raises HDL cholesterol
  • Nicotinic Acid works in the liver and is used to lower triglycerides and LDL cholesterol, and raise HDL ("good") cholesterol. Resins promote increased disposal of cholesterol. Medications in this class include: Cholestryamine (Questran, Prevalite, Lo-Cholest); Colestipol (Colestid); and Coleseveiam (WelChol).
  • statin drags are very effective for lowering LDL ("bad") cholesterol levels, have few immediate short-term side effects and are a preferred cholesterol lowering drag for use in the methods of the present invention.
  • the statins include: Atorvastatin (Lipitor); Fluvastatin (Lescol); Lovastatin (Mevacor); Pravastatin (Pravachol); Rosuvastatin Calcium (Crestor); and Simvastatin (Zocor).
  • Atorvastatin Lipitor
  • Fluvastatin Lescol
  • Lovastatin Lovastatin (Mevacor); Pravastatin (Pravachol); Rosuvastatin Calcium (Crestor); and Simvastatin (Zocor).
  • HMG-CoA (3 ⁇ hydroxy-3-methylglutaryl-coenzyme A) reductase catalyzes the committed step in cholesterol biosynthesis.
  • Statins are HMGR inhibitors with inhibition constant values in the nanomolar range that effectively lower serum cholesterol levels and are widely prescribed in the treatment of hypercholesterolemia.
  • Statin drags increase the expression of LDL receptors on the surface of liver hepatocytes. As a consequence of the increase in LDL receptor expression, the level of cholesterol is lowered in plasma. Thus, by administering a statin drag, the level of competing cholesterol in plasma is reduced and the level of LDL receptors for binding cholesterol-siRNA in the liver are increased.
  • the invention thus provides a method for increased uptake of cholesterol labeled siRNA wherein the siRNA is administered in conjunction with a statin whereby the level of competing cholesterol in the serum is reduced, allowing for more efficient uptake of cholesterol labeled siRNA by hepatocytes.
  • the statin can be administered before, with or after the administration of the cholesterol-siRNA.
  • siRNA including modified siRNA
  • the examples demonstrate that siRNA, including modified siRNA, can effectively inhibit viral replication in mammalian cells.
  • the examples show that the inventive siRNAs promote HCV RNA degradation in human liver cells and establish that hepatocytes possess the necessary functional components of modified siRNA-induced silencing.
  • the examples also demonstrate that siRNA technology can be used as a therapy to inhibit HCV replication in host cells. The inventors, by submitting the following examples, do not intend to limit the scope of the claimed invention.
  • HCV cell culture systems in human hepatoma cell line, Huh-7, was used.
  • One of the cell lines, 5-2 harbors autonomously replicating subgenomic HCV RNA (Bartenschlager, J. Virol, 2001).
  • the subgenomic replicon carries firefly luciferase gene, allowing a reporter function assay as a measure of HCV RNA replication (Fig. 5).
  • Fig. 5 Owing to cell culture adaptive mutations introduced into the genome (Bart), these 5-2 cells replicate HCV RNA at levels of up to 5 x 10 4 virus particles/cell.
  • siRNA duplexes were designed, including GL2 and GL3, that were directed against the fruit fly and sea pansy luciferase genes, respectively.
  • the siRNAs were transfected into the 5-2 cells and luciferase activity was measured to determine the effect of the siRNAs on HCV replication. Luciferase activity was measured 48 hours after transfection. In cells where siRNA5 was transfected, there was reduced luciferase activity of up to 85%, in a dose responsive manner (Fig. 6). The inhibition of luciferase activity was not seen in cells that were transfected with irrelevant siRNA (SIN). The sequence of SIN was taken from Sindbis virus transcription promoter (Fig. 1).
  • siRNA5 was toxic to transfected cells also was tested. Toxicity was by measured using an ATPase activity assay.
  • Figure 8 shows that the siRNA5 -induced reduction in HCV replication, as seen in Figure 6, was not due to cellular toxicity which is attributed to non sequence-specific RNAi. ATPase levels were assayed using an ATPase assay kit from Promega (Madison, WI) according to the manufacturer's instructions.
  • the full-length HCV replicon may possess the ability to adapt and suppress RNAi, thus replicating in spite of the presence of siRNA, as documented in Li, H, Science 296:1319-1321 (2002).
  • siRNA5 To determine the effects of siRNA5 on replication of full-length HCV RNA in Huh-7 cells, from the 21-5 cell line, harboring the selectable full-length HCV replicon, were treated with siRNA5.
  • Levels of HCV RNA were measured by quantitative PCR using TaqManD (F. Hoffman La-Roche, Switzerland). The results as seen in Figure 9 show that siRNA-directed silencing reduced steady-state viral RNA production, even in the setting of an adapted HCV mutant, where RNA replication was very high. Results from both subgenomic and full-length HCV replicons suggest that none of the HCV proteins can suppress RNA interference.
  • siRNA5 was toxic to transfected cells also was tested. Specifically, mRNA encoding GAPDH, an enzyme essential in glycolysis, was measured in Huh 5-2 cells transfected with siRNA5, or siRNA specific towards the GAPDH sequence. Figure 10 demonstrates that siRNA5 did not affect RNA levels of GAPDH. GAPDH was measured using a TaqManD RNA kit (F. Hoffman La-Roche, Switzerland) according to the manufacturer's instructions.
  • liposome-encapsulated siRNA5, or control liposomes are administered by intravenous injection to the mice through the tail vein, or another accessible vein.
  • the mice are dosed one time a day for 3-10 days.
  • mice are sacrificed and blood collected and the livers removed.
  • the liver is divided into portions such that a portion is frozen using liquid nitrogen, a portion is fixed for paraffin embedding, and a portion is fixed for sectioning onto slides.
  • HCV RNA is quantified using the TaqManD RNA assay kit previously utilized herein to determine the levels of HCV RNA in the liver cells. Further, anti-HCV antibody titers can be measured in the collected blood samples, along with serum ALT levels.
  • liposome-encapsulated siRNA5, or control liposomes are administered by intravenous injection to the mice through the tail vein, or another accessible vein.
  • the mice are dosed one time a day for 3-10 days.
  • active HCV is then injected intravenously, or via hepatic injection, into the mice.
  • mice At about 6, 12, 18, 24 hours, and periodically up to about 5 days after the mice are infected with HCV, the mice are sacrificed and blood collected and the livers removed.
  • the liver is divided into portions such that a portion is frozen using liquid nitrogen, a portion is fixed for paraffin embedding, and a portion is fixed for sectioning onto slides.
  • HCV RNA is quantified using the TaqManD RNA assay kit previously utilized herein to determine the levels of HCV RNA in the liver cells. Further, anti-HCV antibody titers can be measured in the collected blood samples, along with serum ALT levels.
  • Modified siRNA can be prepared by chemical synthesis.
  • each C and U within a siRNA duplex e.g. GL2
  • a universal support can be used to produce siRNA with 3 '-end overhangs comprising 2'-F-U and 2'F-C.
  • a practitioner can ensure that residues of the overhangs comprise modified nucleotides.
  • the nucleotides comprising the 3 '-end overhang can be unmodified dTdT.
  • 2'-F RNA oligonucleotides can be synthesized on an Applied Biosystems 8909 or 8905 DNA/RNA synthesizer using the standard 1 ⁇ mol beta- cyanoethyl phosphoramidite RNA chemistry protocol.
  • the RNA phosphoramidite monomers and columns of Pac-A, 2'-F-Ac-C, iPr-Pac-G, 2'-F-U, and U-RNA CPG can be obtained from Glen Research (Sterling, VA). (See catalog nos. 10-3000-05, 10-3415-02, 10-3021-05, 10-3430-02, and 20-3430-41E, respectively.) Glen Research's Sulfurizing Reagent (catalog no.
  • RNA l ⁇ mol protocol can be replaced with the standard thioate 1 ⁇ mol protocol.
  • the 2'-F RNA's are cleaved and deprotected with 1 : 1 ammonium hydroxide/methylamine, and the silyl groups are removed with triethylamine trihydrofluoride using standard protocols. See e.g. http://www.glenres.com/productfiles/technical/tb_rnadeprotection.pdf.
  • the oligoribonucleotides are then desalted on Sephadex G25 columns (Pharmacia NAP 25, catalog no. 17-08252-02) with sterilized water and purified using standard gel electrophoresis protocols. Modified siRNAs also can be obtained from commercial vendors such as Dharmacon (Lafayette, CO).
  • modified siRNA can be prepared by transcription using the DurascribeD T7 Transcription Kit purchased from Epicentre Technologies (Madison, WI).
  • modified siRNAs made by these methods contain phosphodiester linked oligonucleotides.
  • Standard methods for making modified single-stranded RNAs, such as antisense molecules, are useful for making modified siRNAs, as modified single-stranded RNAs can be annealed together to form double stranded RNAs.
  • standard methods include, but are not limited to, those described in Chiang et al, J.Biol.Chem. 266, 18162-18171 (1991); Baker et al, J.Bio ⁇ .Chem. 272, 11994-12000 (1997); Kawasaki et al, J.Med.Chem. 36, 831-841 (1993); Monia et al, J.Biol.Chem. 268, 14514-14522 (1993).
  • UUGCAUGCGCCUUAUGAAGCU Each C and U within siRNA GL2, directed against the fruit fly luciferase gene, was substituted with 2'-F-U and 2'F-C.
  • the modified siRNAs were transfected into the 5-2 cells using standard liposome transfection techniques. Specifically, the modified siRNAs were incubated for 4 hrs at 37 0 C in a 250 ⁇ l cell suspension containing 0.5 ⁇ l of Oligofectamine (Invitrogen, Carlsbad, CA), for 20 hrs in 375 ⁇ l serum containing culture medium, and for 24 hrs at 37 0 C in fresh medium without the liposome-siRNA complex. Luciferase activity was measured 48 hours after transfection to determine the effect of the modified siRNAs on HCV replication.
  • the luciferase assay was carried out using a Luciferase assay system available from Promega Corp. (Madison, WI), according to the manufacturer's instructions.
  • the siRNA Chol-GL2 comprises a cholesteryl group on one of the 5' ends. 5-2 cells were incubated with various concentrations of Chol-GL2 in the absence of liposomes. Cells were harvested 48 hours after incubation and assayed for luciferase activity. Figure 12 shows that Chol-GL2 inhibited luciferase gene activity in a dose-dependent manner. InvA refers to chol-GL2 in inverted sequence.
  • siRNACl siRNAC2
  • siRNA5Bl siRNA5B2
  • siRNA5B4 siRNA5B4
  • siRNA5B4 siRNA5B4
  • Each siRNA was tested at concentrations of 1 nM, 1OnM and 100 nM.
  • each of the siRNAs significantly inhibited luciferase activity in a dose-dependent manner.
  • SiRNAC2 exhibited particular effectiveness.
  • siRNA was modified to include 2-Fluoro pyrimidines in place of all of the pyrimidines (2'-F-siRNA).
  • This 2'-F-siRNA was further modified to include a two base deoxynucleotide "TT" sequence added to the 3 'ends of the molecule in place of the ribolucleotide "UU" overhangs present in 2-F-siRNA (2'-F-siRNA 3'-X).
  • Figure 17 demonstrates that the further modification of the 2' fluorinated siRNA to include a 3"'dTdT" terminus resulted in significant increase in stability of the siRNA in human serum.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Engineering & Computer Science (AREA)
  • Organic Chemistry (AREA)
  • Chemical & Material Sciences (AREA)
  • General Health & Medical Sciences (AREA)
  • Genetics & Genomics (AREA)
  • Animal Behavior & Ethology (AREA)
  • Medicinal Chemistry (AREA)
  • Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
  • Pharmacology & Pharmacy (AREA)
  • General Chemical & Material Sciences (AREA)
  • Chemical Kinetics & Catalysis (AREA)
  • Public Health (AREA)
  • Veterinary Medicine (AREA)
  • Virology (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Molecular Biology (AREA)
  • Biomedical Technology (AREA)
  • Biotechnology (AREA)
  • Wood Science & Technology (AREA)
  • General Engineering & Computer Science (AREA)
  • Zoology (AREA)
  • Communicable Diseases (AREA)
  • Oncology (AREA)
  • Microbiology (AREA)
  • Biochemistry (AREA)
  • Physics & Mathematics (AREA)
  • Plant Pathology (AREA)
  • Biophysics (AREA)
  • Obesity (AREA)
  • Hematology (AREA)
  • Diabetes (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
  • Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
  • Medicinal Preparation (AREA)
  • Acyclic And Carbocyclic Compounds In Medicinal Compositions (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)
  • Saccharide Compounds (AREA)
PCT/US2005/035493 2004-10-01 2005-09-30 Modified small interfering rna molecules and methods of use Ceased WO2006039656A2 (en)

Priority Applications (6)

Application Number Priority Date Filing Date Title
ES05808592.9T ES2441791T3 (es) 2004-10-01 2005-09-30 Moléculas de ARN de interferencia pequeñas modificadas y métodos de uso
JP2007534866A JP2008514242A (ja) 2004-10-01 2005-09-30 改変型の小さい干渉rna分子および使用方法
CA2581651A CA2581651C (en) 2004-10-01 2005-09-30 Cholesterol-labelled modified rna
US11/664,008 US8138161B2 (en) 2004-10-01 2005-09-30 Modified small interfering RNA molecules and methods of use
EP05808592.9A EP1796732B1 (en) 2004-10-01 2005-09-30 Modified small interfering rna molecules and methods of use
US14/711,845 US20150376621A1 (en) 2005-09-30 2015-05-14 Modified small interfering rna molecules and methods of use

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
US61495504P 2004-10-01 2004-10-01
US60/614,955 2004-10-01

Related Child Applications (2)

Application Number Title Priority Date Filing Date
US11/664,008 A-371-Of-International US8138161B2 (en) 2004-10-01 2005-09-30 Modified small interfering RNA molecules and methods of use
US13/325,308 Division US8765704B1 (en) 2004-10-01 2011-12-14 Modified small interfering RNA molecules and methods of use

Publications (3)

Publication Number Publication Date
WO2006039656A2 true WO2006039656A2 (en) 2006-04-13
WO2006039656A9 WO2006039656A9 (en) 2006-06-22
WO2006039656A3 WO2006039656A3 (en) 2007-02-01

Family

ID=36143139

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/US2005/035493 Ceased WO2006039656A2 (en) 2004-10-01 2005-09-30 Modified small interfering rna molecules and methods of use

Country Status (6)

Country Link
US (1) US8138161B2 (enExample)
EP (1) EP1796732B1 (enExample)
JP (3) JP2008514242A (enExample)
CA (1) CA2581651C (enExample)
ES (1) ES2441791T3 (enExample)
WO (1) WO2006039656A2 (enExample)

Cited By (18)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2010033247A3 (en) * 2008-09-22 2010-06-03 Rxi Pharmaceuticals Corporation Reduced size self-delivering rnai compounds
US8815818B2 (en) 2008-07-18 2014-08-26 Rxi Pharmaceuticals Corporation Phagocytic cell delivery of RNAI
US9074211B2 (en) 2008-11-19 2015-07-07 Rxi Pharmaceuticals Corporation Inhibition of MAP4K4 through RNAI
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
WO2016059376A1 (en) * 2014-10-14 2016-04-21 London School Of Hygiene & Tropical Medicine Pharmaceutical composition for treating a viral infection
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US9963702B2 (en) 2010-03-24 2018-05-08 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
CN108676800A (zh) * 2010-08-17 2018-10-19 瑟纳治疗公司 使用短干扰核酸(siNA)的乙型肝炎病毒(HBV)基因表达的RNA干扰介导的抑制
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US10184124B2 (en) 2010-03-24 2019-01-22 Phio Pharmaceuticals Corp. RNA interference in ocular indications
WO2019014359A3 (en) * 2017-07-12 2019-02-21 The Scripps Research Institute POLYMERASE CHAIN TRANSCRIPTION (PCT): EXPONENTIAL SYNTHESIS OF RNA AND MODIFIED RNA
US10808247B2 (en) 2015-07-06 2020-10-20 Phio Pharmaceuticals Corp. Methods for treating neurological disorders using a synergistic small molecule and nucleic acids therapeutic approach
US10900039B2 (en) 2014-09-05 2021-01-26 Phio Pharmaceuticals Corp. Methods for treating aging and skin disorders using nucleic acids targeting Tyr or MMP1
US10934550B2 (en) 2013-12-02 2021-03-02 Phio Pharmaceuticals Corp. Immunotherapy of cancer
US11001845B2 (en) 2015-07-06 2021-05-11 Phio Pharmaceuticals Corp. Nucleic acid molecules targeting superoxide dismutase 1 (SOD1)
US11021707B2 (en) 2015-10-19 2021-06-01 Phio Pharmaceuticals Corp. Reduced size self-delivering nucleic acid compounds targeting long non-coding RNA
US11279934B2 (en) 2014-04-28 2022-03-22 Phio Pharmaceuticals Corp. Methods for treating cancer using nucleic acids targeting MDM2 or MYCN

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US20170137821A1 (en) 2015-07-17 2017-05-18 Arcturus Therapeutics, Inc. Molecules and agents for treating hepatitis b virus
AU2016296592B2 (en) 2015-07-17 2021-08-19 Arcturus Therapeutics, Inc. Compositions and agents against Hepatitis B virus and uses thereof
AU2017368050A1 (en) 2016-11-29 2019-06-20 Puretech Lyt, Inc. Exosomes for delivery of therapeutic agents
US11425125B2 (en) * 2020-06-24 2022-08-23 Google Llc Shared resource identification

Family Cites Families (27)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5610054A (en) 1992-05-14 1997-03-11 Ribozyme Pharmaceuticals, Inc. Enzymatic RNA molecule targeted against Hepatitis C virus
US20030206887A1 (en) 1992-05-14 2003-11-06 David Morrissey RNA interference mediated inhibition of hepatitis B virus (HBV) using short interfering nucleic acid (siNA)
US6174868B1 (en) 1992-09-10 2001-01-16 Isis Pharmaceuticals, Inc. Compositions and methods for treatment of hepatitis C virus-associated diseases
JP4637972B2 (ja) * 1992-09-28 2011-02-23 ノバルティス バクシンズ アンド ダイアグノスティックス,インコーポレーテッド Hcvタンパク質の翻訳を制御するための方法および組成物
US6107027A (en) 1994-12-14 2000-08-22 University Of Washington Ribozymes for treating hepatitis C
US6133246A (en) 1997-08-13 2000-10-17 Isis Pharmaceuticals Inc. Antisense oligonucleotide compositions and methods for the modulation of JNK proteins
US6506559B1 (en) 1997-12-23 2003-01-14 Carnegie Institute Of Washington Genetic inhibition by double-stranded RNA
CA2363088A1 (en) * 1999-02-11 2000-08-17 Patrick T. Prendergast Methods for treating viral infections
US8202979B2 (en) 2002-02-20 2012-06-19 Sirna Therapeutics, Inc. RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid
US20070026394A1 (en) 2000-02-11 2007-02-01 Lawrence Blatt Modulation of gene expression associated with inflammation proliferation and neurite outgrowth using nucleic acid based technologies
US20050209180A1 (en) 2001-05-18 2005-09-22 Sirna Therapeutics, Inc. RNA interference mediated inhibition of hepatitis C virus (HCV) expression using short interfering nucleic acid (siNA)
US20040209831A1 (en) * 2002-02-20 2004-10-21 Mcswiggen James RNA interference mediated inhibition of hepatitis C virus (HCV) gene expression using short interfering nucleic acid (siNA)
CA2454183C (en) * 2001-07-23 2016-09-06 The Board Of Trustees Of The Leland Stanford Junior University Methods and compositions for rnai mediated inhibition of gene expression in mammals
US20030219823A1 (en) 2001-09-07 2003-11-27 Alsobrook John P. Therapeutic polypeptides, nucleic acids encoding same, and methods of use
US20080207542A1 (en) 2002-03-26 2008-08-28 Sirna Therapeutics, Inc. RNA inteference mediated inhibition of hepatitis C virus (HVC) gene expression using short interfering nucleic acid (siNA)
US20030191075A1 (en) * 2002-02-22 2003-10-09 Cook Phillip Dan Method of using modified oligonucleotides for hepatic delivery
EP1495141A4 (en) 2002-03-20 2006-03-22 Massachusetts Inst Technology THERAPY OF HIV
US7148342B2 (en) 2002-07-24 2006-12-12 The Trustees Of The University Of Pennyslvania Compositions and methods for sirna inhibition of angiogenesis
CA2884658A1 (en) 2002-07-26 2004-02-05 Novartis Vaccines And Diagnostics, Inc. Modified small interfering rna molecules and methods of use
KR20120038546A (ko) 2002-11-01 2012-04-23 더 트러스티스 오브 더 유니버시티 오브 펜실바니아 HIF-1 알파의 siRNA 억제를 위한 조성물 및 방법
DK2284266T3 (da) 2002-11-14 2014-01-13 Thermo Fisher Scient Biosciences Inc sIRNA-MOLEKYLE MOD TP53
MXPA05007651A (es) * 2003-01-16 2005-10-26 Univ Pennsylvania Composiciones y metodos para la inhibicion por arnsi de la molecula de adhesion intercelular-1.
DE10302421A1 (de) * 2003-01-21 2004-07-29 Ribopharma Ag Doppelsträngige Ribonukleinsäure mit verbesserter Wirksamkeit
US20050085528A1 (en) * 2003-10-17 2005-04-21 Pfizer Inc. Parmaceutical
EP1753292A4 (en) * 2004-05-12 2007-09-26 Kamel Khalili COMPOSITIONS AND METHODS FOR INHIBITING ARNIC GENES OF PRIMATE POLYOMA VIRUS
AR066984A1 (es) 2007-06-15 2009-09-23 Novartis Ag Inhibicion de la expresion de la subunidad alfa del canal epitelial de sodio (enac) por medio de arni (arn de interferencia)
KR101605932B1 (ko) 2009-12-18 2016-03-24 노파르티스 아게 Hsf1-관련 질환을 치료하기 위한 유기 조성물

Non-Patent Citations (1)

* Cited by examiner, † Cited by third party
Title
None

Cited By (42)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US10633654B2 (en) 2008-02-11 2020-04-28 Phio Pharmaceuticals Corp. Modified RNAi polynucleotides and uses thereof
US10131904B2 (en) 2008-02-11 2018-11-20 Rxi Pharmaceuticals Corporation Modified RNAi polynucleotides and uses thereof
US8815818B2 (en) 2008-07-18 2014-08-26 Rxi Pharmaceuticals Corporation Phagocytic cell delivery of RNAI
EP2949752A3 (en) * 2008-09-22 2016-02-17 RXi Pharmaceuticals Corporation Reduced size self-delivering rnai compounds
US10876119B2 (en) 2008-09-22 2020-12-29 Phio Pharmaceuticals Corp. Reduced size self-delivering RNAI compounds
US10774330B2 (en) 2008-09-22 2020-09-15 Phio Pharmaceuticals Corp. Reduced size self-delivering RNAI compounds
US11396654B2 (en) 2008-09-22 2022-07-26 Phio Pharmaceuticals Corp. Neutral nanotransporters
US9175289B2 (en) 2008-09-22 2015-11-03 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
WO2010033247A3 (en) * 2008-09-22 2010-06-03 Rxi Pharmaceuticals Corporation Reduced size self-delivering rnai compounds
US9303259B2 (en) 2008-09-22 2016-04-05 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US10138485B2 (en) 2008-09-22 2018-11-27 Rxi Pharmaceuticals Corporation Neutral nanotransporters
US8664189B2 (en) 2008-09-22 2014-03-04 Rxi Pharmaceuticals Corporation RNA interference in skin indications
US8796443B2 (en) 2008-09-22 2014-08-05 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US9938530B2 (en) 2008-09-22 2018-04-10 Rxi Pharmaceuticals Corporation RNA interference in skin indications
WO2010033248A3 (en) * 2008-09-22 2010-06-17 Rxi Pharmaceuticals Corporation Neutral nanotransporters
US10041073B2 (en) 2008-09-22 2018-08-07 Rxi Pharmaceuticals Corporation Reduced size self-delivering RNAi compounds
US10815485B2 (en) 2008-09-22 2020-10-27 Phio Pharmaceuticals Corp. RNA interference in skin indications
US11254940B2 (en) 2008-11-19 2022-02-22 Phio Pharmaceuticals Corp. Inhibition of MAP4K4 through RNAi
US9074211B2 (en) 2008-11-19 2015-07-07 Rxi Pharmaceuticals Corporation Inhibition of MAP4K4 through RNAI
US10167471B2 (en) 2009-01-05 2019-01-01 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAI
US9493774B2 (en) 2009-01-05 2016-11-15 Rxi Pharmaceuticals Corporation Inhibition of PCSK9 through RNAi
US9745574B2 (en) 2009-02-04 2017-08-29 Rxi Pharmaceuticals Corporation RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US11667915B2 (en) 2009-02-04 2023-06-06 Phio Pharmaceuticals Corp. RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US10479992B2 (en) 2009-02-04 2019-11-19 Phio Pharmaceuticals Corp. RNA duplexes with single stranded phosphorothioate nucleotide regions for additional functionality
US10184124B2 (en) 2010-03-24 2019-01-22 Phio Pharmaceuticals Corp. RNA interference in ocular indications
US10662430B2 (en) 2010-03-24 2020-05-26 Phio Pharmaceuticals Corp. RNA interference in ocular indications
US10240149B2 (en) 2010-03-24 2019-03-26 Phio Pharmaceuticals Corp. Reduced size self-delivering RNAi compounds
US11584933B2 (en) 2010-03-24 2023-02-21 Phio Pharmaceuticals Corp. RNA interference in ocular indications
US9963702B2 (en) 2010-03-24 2018-05-08 Rxi Pharmaceuticals Corporation RNA interference in dermal and fibrotic indications
US11118178B2 (en) 2010-03-24 2021-09-14 Phio Pharmaceuticals Corp. Reduced size self-delivering RNAI compounds
US10913948B2 (en) 2010-03-24 2021-02-09 Phio Pharmaceuticals Corp. RNA interference in dermal and fibrotic indications
US9080171B2 (en) 2010-03-24 2015-07-14 RXi Parmaceuticals Corporation Reduced size self-delivering RNAi compounds
CN108676800A (zh) * 2010-08-17 2018-10-19 瑟纳治疗公司 使用短干扰核酸(siNA)的乙型肝炎病毒(HBV)基因表达的RNA干扰介导的抑制
US10934550B2 (en) 2013-12-02 2021-03-02 Phio Pharmaceuticals Corp. Immunotherapy of cancer
US11279934B2 (en) 2014-04-28 2022-03-22 Phio Pharmaceuticals Corp. Methods for treating cancer using nucleic acids targeting MDM2 or MYCN
US10900039B2 (en) 2014-09-05 2021-01-26 Phio Pharmaceuticals Corp. Methods for treating aging and skin disorders using nucleic acids targeting Tyr or MMP1
US11926828B2 (en) 2014-09-05 2024-03-12 Phio Pharmaceuticals Corp. Methods for treating aging and skin disorders using nucleic acids targeting TYR or MMP1
WO2016059376A1 (en) * 2014-10-14 2016-04-21 London School Of Hygiene & Tropical Medicine Pharmaceutical composition for treating a viral infection
US11001845B2 (en) 2015-07-06 2021-05-11 Phio Pharmaceuticals Corp. Nucleic acid molecules targeting superoxide dismutase 1 (SOD1)
US10808247B2 (en) 2015-07-06 2020-10-20 Phio Pharmaceuticals Corp. Methods for treating neurological disorders using a synergistic small molecule and nucleic acids therapeutic approach
US11021707B2 (en) 2015-10-19 2021-06-01 Phio Pharmaceuticals Corp. Reduced size self-delivering nucleic acid compounds targeting long non-coding RNA
WO2019014359A3 (en) * 2017-07-12 2019-02-21 The Scripps Research Institute POLYMERASE CHAIN TRANSCRIPTION (PCT): EXPONENTIAL SYNTHESIS OF RNA AND MODIFIED RNA

Also Published As

Publication number Publication date
CA2581651A1 (en) 2006-04-13
US8138161B2 (en) 2012-03-20
WO2006039656A3 (en) 2007-02-01
WO2006039656A9 (en) 2006-06-22
JP2012105686A (ja) 2012-06-07
JP2008514242A (ja) 2008-05-08
EP1796732A2 (en) 2007-06-20
EP1796732B1 (en) 2013-10-30
CA2581651C (en) 2014-12-16
ES2441791T3 (es) 2014-02-06
JP2012255024A (ja) 2012-12-27
US20080269148A1 (en) 2008-10-30

Similar Documents

Publication Publication Date Title
EP1532248B1 (en) Modified small interfering rna molecules and methods of use
CA2581651C (en) Cholesterol-labelled modified rna
CN103333890B (zh) 治疗乙型病毒性肝炎的rna干扰制剂
JP5934310B2 (ja) 遺伝子サイレンシングに有用なhbvおよびhcv保存配列
JP2009159971A (ja) 異常スプライシングを阻害するアンチセンスオリゴヌクレオチドと同物質の利用法
JP2009159971A6 (ja) 異常スプライシングを阻害するアンチセンスオリゴヌクレオチドと同物質の利用法
US20230119360A1 (en) Pharmaceutical combination of a therapeutic oligonucleotide targeting hbv and a tlr7 agonist for treatment of hbv
JP2010029212A (ja) C型肝炎ウイルスの働きを阻害するオリゴリボヌクレオチドまたはペプチド核酸
US9084808B2 (en) Modified small interfering RNA molecules and methods of use
JP2023506954A (ja) B型肝炎ウイルス感染を処置するためのsaraf阻害剤の使用
WO2007084359A2 (en) Compositions and methods for the treatment of influenza infection
US9574243B2 (en) Compositions and methods for the treatment of influenza infection
Ely et al. 799. Expressed Long Hairpin RNA Sequences Inhibit HBV Replication In Vivo without Inducing an Interferon Response

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A2

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV LY MA MD MG MK MN MW MX MZ NA NG NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A2

Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU LV MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

COP Corrected version of pamphlet

Free format text: PAGES 1/19-29/29, DRAWINGS, REPLACED BY NEW PAGES 1/28-28/28

WWE Wipo information: entry into national phase

Ref document number: 2581651

Country of ref document: CA

WWE Wipo information: entry into national phase

Ref document number: 2007534866

Country of ref document: JP

WWE Wipo information: entry into national phase

Ref document number: 2005808592

Country of ref document: EP

NENP Non-entry into the national phase

Ref country code: DE

WWP Wipo information: published in national office

Ref document number: 2005808592

Country of ref document: EP

WWE Wipo information: entry into national phase

Ref document number: 11664008

Country of ref document: US