Classifications

• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
  • A61K38/1808—Epidermal growth factor [EGF] urogastrone
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
  • A61K38/00—Medicinal preparations containing peptides
  • A61K38/16—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
  • A61K38/17—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
  • A61K38/18—Growth factors; Growth regulators
• • A—HUMAN NECESSITIES
  • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
  • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
  • A61P3/00—Drugs for disorders of the metabolism
  • A61P3/08—Drugs for disorders of the metabolism for glucose homeostasis
  • A61P3/10—Drugs for disorders of the metabolism for glucose homeostasis for hyperglycaemia, e.g. antidiabetics

Definitions

• This invention relates to the treatment or prevention of a diabetic condition, and in particular to the use of a polypeptide or corresponding nucleic acid molecule in the treatment or prevention, or in delaying the onset, of diabetes mellitus of either Type 1 or Type 2.
• Diabetes mellitus is the most common of the serious metabolic diseases affecting humans. It may be defined as a state of chronic hyperglycemia, i.e. excess sugar in the blood, consequent upon a relative or absolute lack of insulin action.
• Type 1 diabetes also referred to as insulin-dependent diabetes (IDDM)
• IDDM insulin-dependent diabetes
• Type 2 diabetes or non-insulin dependent diabetes (NIDDM) refers to a group of disorders characterized by high blood levels of glucose (hyperglycemia) and a resistance to insulin, and occurs in patients with impaired pancreatic ⁇ -cell function.
• Type 1 diabetes The absence of insulin in patients with Type 1 and the insulin resistance in Type 2 diabetes results in decreased absorption of sugar from the bloodstream, and hence excess sugar accumulates in the blood. Both types of diabetes are associated with shortened life expectancy, and with significant morbidity, such as vascular disease, blindness and atherosclerosis.
• LADA Topic Autoimmune Diabetes in Adults
• LADA has been proposed to describe adults diagnosed with type 2 diabetes who also have immunological evidence of type 1 diabetes, in that they are Anti-Gad antibody positive. Diabetes is one of the most prevalent chronic diseases in developed countries, and a leading cause of death.
• Asians including South Asians, will have a huge epidemic of diabetes in the near future. These individuals develop diabetes in the absence of severe obesity, and therefore may have insulin deficiency as a major component of their condition.
• two types of diabetes which are associated with low insulin levels related to malnutrition, fibrocalculous pancreatic diabetes and protein deficient pancreatic diabetes have been described in India.
• Insulin is produced by ⁇ -cells in the islets of Langerhans in the pancreas. During pancreatic development, islet precursor cells proliferate and eventually differentiate into one of the four major islet cell types. It is thought that the formation of ⁇ -cells, in particular, is regulated by the effects of various growth factors, cytokines and hormones .
• ⁇ -cells are important to maintain glucose metabolism, and a severe reduction in the number and/or function of ⁇ -cells results in the onset of diabetes. It is now established that ⁇ -cell mass is maintained by a balance between loss and neoformation from precursor cells. When insulin demand is significantly increased by insulin resistance, for example due to obesity, ⁇ -cell neogenesis is stimulated. This leads to expansion of the ⁇ -cell mass, and glucose metabolism is maintained. If this compensatory mechanism is impaired, for example in Type 2 diabetes, glucose metabolism is disrupted. Recent studies have shown that ⁇ -cell neogenesis is impaired in animal models of type 2 diabetes.
• diabetes mellitus The primary aim of treatment in all forms of diabetes mellitus is the same, namely the reduction of blood glucose levels to as near normal as possible, thereby minimizing both the short- and long-term complications of the disease.
• Long-term management of diabetes often includes insulin therapy, regardless of whether the patient is classified as type 1 or type 2. In healthy individuals, insulin increases glucose uptake by skeletal muscle and decreases glucose production in the liver; however, in individuals with type 2 diabetes, insulin tends not to do so. Many patients with type 2 diabetes, therefore, do not respond well to insulin therapy, even when it is administered at high doses.
• Type 1 diabetes necessarily involves the administration of replacement doses of insulin, which is conventionally administered by the parenteral route.
• replacement doses of insulin which is conventionally administered by the parenteral route.
• Type 1 patients can achieve reasonable control of blood glucose.
• initial therapy is a regimen of optimal diet, weight reduction and exercise. Drug therapy is initiated if and when these measures no longer provide adequate metabolic control. Drugs which promote insulin secretion or which lower glucose levels by other means are commonly prescribed. Hypoglycemic agents, for example sulphonylureas or biguanides, are the principal drugs prescribed to such patients. They stimulate insulin production by directly stimulating ⁇ -cells; the effectiveness of such drugs therefore depends on the number of functioning ⁇ -cells (the ⁇ -cell mass) remaining in the pancreas.
• Sulphonylureas lose their effectiveness in a high proportion of Type 2 diabetics; in one study 30 percent of newly-diagnosed diabetic patients who were treated with sulphonylureas required insulin within the first six years of therapy. It has recently been reported that up to twelve percent of people with type 2 diabetes have a gene variant, the Arg972 variant in insulin receptor substrate-1, which may predispose them to having these drugs fail, so that they require treatment with insulin. Peptide growth factors are implicated in a wide variety of physiological and pathological processes, including signal transduction, cell survival, differentiation, cell adhesion, cell migration, immune response, hematopoiesis, inflammation, tissue repair, atherosclerosis and cancer.
• RTKs transmembrane receptor tyrosine kinases
• Most RTKs belong to small groups of highly homologous receptors which bind similar ligands and maintain inter-receptor interactions through ligand-induced homo- and hetero-dimer formation. Upon ligand-induced dimerization, these receptor specific tyrosine residues in the cytoplasmic domains are autophosphorylated.
• the phosphorylated tyrosine residues serve as high-affinity docking sites for proteins which possess SH2 or phosphotyrosine binding (PTB) domains, such as She, Grb2 and the p85 subunit of phosphoinositide 3' -kinase (PI 3-kinase) .
• PTB phosphotyrosine binding domains
• ErbB-1 also called epidermal growth factor receptor (EGFR)
• ErbB-2 also called HER2 or Neu
• ErbB-3 ErbB-4.
• EGFR epidermal growth factor receptor
• peptide growth factors are ligands for the ErbB receptor family. This group of factors shares a high degree of ' sequence similarity, particularly with respect to a common six-cysteine 36-40 amino acid residue epidermal growth factor (EGF) motif. This motif has a spacing of CX 7 CX 4 CXioCXiCX 8 C, and forms three intramolecular disulphide bonds (Ci-C 3 , C 2 -C 4 , C 5 -C 6 ) and a characteristic three-loop structure, including the Ci-C 3 disulphide loop, C 2 -C 4 disulphide loop and C 5 -C 6 disulphide loop.
• EGF epidermal growth factor
• the EGF-motifs of growth factor peptides belonging to this family all appear to be encoded by two exons with a precisely-located intervening intron, corresponding to the border separating the first two disulphide loops (A loop, C 1 -C 3 ; B loop, C 2 -C 4 ) from the third loop (C loop, C 5 -C 6 ) .
• a common feature of these molecules is that they are synthesized as larger transmembrane precursors, which are proteolytically cleaved to release the soluble biologically active form of the growth factor.
• the consensus EGF-motif is crucial for binding to and activating members of the ErbB receptor tyrosine kinase family.
• Mammalian ligands for the ErbB family include EGF, transforming growth factor- ⁇ (TGF- ⁇ ) , heparin-binding EGF-like growth factor (HB-EGF) , epiregulin, amphiregulin, neural- and thymus-derived activator for ErbB kinases (NTAK) , the neuregulin (NRG) subfamily, which includes the products of four genes (NRGl) , NRG2, NRG3 and NRG4, and betacellulin (BTC) .
• EGF transforming growth factor- ⁇
• HB-EGF heparin-binding EGF-like growth factor
• NTAK neural- and thymus-derived activator for ErbB kinases
• NNK neuregulin
• BTC betacellulin
• BTC was originally purified from the conditioned medium of a mouse pancreatic ⁇ -cell carcinoma (insulinoma) cell line, as a 32 kDa glycoprotein with mitogenic activity for fibroblasts, retinal pigment epithelial cells and smooth muscle cells.
• Human BTC has been cloned from the human breast cancer cell line MCF-7, and bovine BTC has been cloned from a bovine kidney cell line.
• BTC is synthesised as a membrane-anchored precursor protein which can be proteolytically cleaved to release the soluble mature growth factor.
• Mature BTC binds to and activates the ErbBl and ErbB-4 homodimers, and in addition, binds to and activates all possible ErbB heterodimers, including the highly oncogenic heterodimeric ErbB2-ErbB3 receptor complex.
• mice which often die in the first post-natal week of life, display a generalised proliferation defect of the pancreatic epithelia, associated with a delay in the differentiation of islet cells into insulin-producing ⁇ -cells and disturbed migration and structure-formation of developing islet endocrine cells. These defects indicate that ErbB-1 mediated signaling is critical to normal ⁇ -cell development. The development of the pancreas in ErbB-3 " ⁇ " mice is also severely defective.
• BTC but not EGF or TGF ⁇ , may have a unique, non-redundant role in pancreas development and function.
• BTC is strongly expressed in the pancreas, particularly in the islets of Langerhans, and stimulates the proliferation and differentiation of various pancreatic cells in vitro and in vivo. Since both ErbB-1 and ErbB-4 are expressed by the duct cells of the pancreas, it is thought that BTC may bind and activate these receptors to stimulate ⁇ -cell neogenesis.
• a surprisingly large number of membrane proteins undergo alternative splicing which removes the exonic sequence encoding the transmembrane domain, generating soluble forms which function differently from the membrane- bound form.
• Changes in mRNA structure as a result of alternative splicing can produce protein variants which may be differentially expressed in certain tissues, during different developmental stages and/or in different states of cell activation.
• the alternatively spliced exon encodes a protein domain which is functionally important for catalytic activity or binding interactions, the resulting proteins can often exhibit different or even antagonistic activities.
• BTC- ⁇ 4 This isoform, designated BTC- ⁇ 4, lacks 147 bp encoding exon 4 of the BTC gene, leading to the generation of an mRNA encoding an unusual BTC precursor in which the C-loop of the EGF domain and the transmembrane domain are deleted, while the remainder of the mature molecule, including loops A and B and the "hinge" valine, is fused in-frame to the truncated C-terminal cytoplasmic tail.
• BTC- ⁇ 4 may be a secreted protein. It was proposed in PCT/AUOl/00010 that this BTC splice variant would be useful in modulating activities mediated by ErbB receptors, and therefore would be useful for the treatment of conditions, such as cancer, associated with overexpression of ErbB oncogenes.
• this splice variant was a secreted protein.
• BTC- ⁇ 4 did not bind to or activate ErbBl or ErbB4 receptors, and did not bind to ErbB2 or ErbB3 homodimers; we therefore concluded that BTC- ⁇ 4 did not have functional activity, at least with respect to ErbBl and ErbB4 receptors and ErbB2 and ErbB3 homodimers, and that the core EGF motif which is missing from BTC- ⁇ 4 is likely to be essential for activity (Dunbar et al . , 2000) .
• a isoform lacking the third disulphide loop of the EGF domain has been reported for HB-EGF (Loukianov et al . , 1997) .
• a 94 bp insertion between exons III and IV causes a frameshift and premature termination, generating a protein which retains the signal peptide, pro- region, heparin-binding domain and the first two conserved disulphide loops of the EGF motif, while a short nine-amino acid tail replaces the third disulphide loop, transmembrane and cytoplasmic domains.
• SEQ ID NO. 38 discloses a variant of betaceullulin, identified as SEQ ID NO. 38, and suggests that this variant has intact betacellulin activity and reduced EGF activity.
• SEQ ID NO. 38 differs from the polypeptide of the present invention in that it comprises all six cysteines and is not deficient in the C5-C6 loop. - Si -
• BTC- ⁇ 4 stimulates ⁇ - cell differentiation, increases ⁇ -cell mass, decreases the decline of ⁇ -cell function and increases insulin secretion by ⁇ -cells.
• BTC- ⁇ 4 has higher potency than authentic BTC as a stimulator of ⁇ -cell differentiation; however the cell growth-promoting activity of BTC- ⁇ 4 is absent or reduced compared to that of authentic BTC.
• the invention provides a method of treating, preventing ' , or delaying the onset of a diabetic condition in a subject suffering from or at risk of suffering from the condition, comprising administering to the subject a polypeptide which has the ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells and which has absent or reduced cell growth promoting activity compared to that of authentic BTC.
• the invention provides a method of treating, preventing, or delaying the onset of a diabetic condition in a subject suffering from or at risk of the condition, comprising administering to the subject a nucleic acid which encodes a polypeptide which has the ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC.
• the invention provides the use of a polypeptide which has ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC, for treating, preventing, or delaying the onset of a diabetic condition in a subject suffering from the condition.
• the invention provides the use of a nucleic acid which encodes a polypeptide which has the ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC, for treating, preventing, or delaying the onset of a diabetic condition in a subject suffering from or at risk of suffering from the condition.
• the invention provides the use of a polypeptide which has ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC, for the preparation of a medicament for treating, preventing, or delaying the onset of a diabetic condition in a subject suffering from or at risk of suffering from the condition.
• the invention provides the use of a nucleic acid which encodes a polypeptide which has the ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC, for the preparation of a medicament for treating, preventing, or delaying the onset of a diabetic condition in a subject suffering from or at risk of suffering from the condition.
• the ability of the polypeptide to activate ErbBl and ErbB4 receptors in the subject is substantially reduced compared to authentic BTC and differentiation of islet cell progenitors into pancreatic ⁇ cells is stimulated without stimulating proliferation of other cell types.
• the fibroblast cell growth promoting activity is absent or reduced compared to that of authentic BTC.
• the epithelial cell growth promoting activity is absent or reduced compared to that of authentic BTC.
• the diabetic condition is Type 2 diabetes or Type 1 diabetes.
• the invention provides a composition for treating, preventing, or delaying the onset of a diabetic condition, comprising a polypeptide which has the ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC, together with a pharmaceutically-acceptable carrier.
• the invention provides a composition for treating, preventing, or delaying the onset of a diabetic condition, comprising a nucleic acid which encodes a polypeptide which has the ability to stimulate the differentiation of islet cell progenitors into pancreatic ⁇ cells, wherein the cell growth promoting activity of the polypeptide is absent or reduced compared to that of authentic BTC, together with a pharmaceutically- acceptable carrier.
• the ability of the polypeptide to stimulate the proliferation of cell types is absent or reduced compared to authentic BTC and the ability of the polypeptide to activate ErbBl or ErbB4 receptors is absent or reduced compared to that of authentic BTC.
• the fibroblast cell growth promoting activity is absent or reduced compared to that of authentic BTC.
• the epithelial cell growth promoting activity is absent or reduced compared to that of authentic BTC.
• the ability of the polypeptide to activate ErbB2 -or ErbB3 homodimers is absent or reduced compared to that of authentic BTC.
• the risk of cancer arising in the subject as a side-effect of treatment may be reduced compared to the risk arising from treatment with authentic BTC.
• the polypeptide is substantially homologous to a member of the EGF family. More preferably the polypeptide is substantially homologous to epidermal growth factor, transforming growth factor- ⁇ , heparin- binding EGF-like growth factor, epiregulin, amphiregulin, neural and thymus-derived activator for ErbB kinases (NTAK) , members of the neuregulin subfamily (NRGl, NRG2, NRG3 and NRG4) , or betacellulin (BTC) . Even more preferably the polypeptide is substantially homologous to BTC- ⁇ 4. Most preferably the polypeptide is BTC- ⁇ 4. The BTC- ⁇ 4 polypeptide has an amino acid sequence shown in Figure 4 (SEQ ID NOs: 11 to 15) .
• the polypeptide may be: (a) a splice variant of BTC, in which the C 5 -C 6 disulphide loop, which is normally present in the gene which encodes authentic BTC, is absent; or
• the polypeptide may be:
• a splice variant of BTC in which the C 5 -C 6 disulphide loop, normally encoded by a nucleic acid sequence present in the gene which encodes authentic BTC, is absent, and the remainder of the nucleic acid sequence encoding the authentic BTC polypeptide molecule, including loops A and B and the "hinge" valine, is fused in-frame to the nucleic acid sequence encoding the truncated C-terminal cytoplasmic tail;
• the polypeptide is capable of acting as a ⁇ -cell differentiation factor, increasing ⁇ -cell mass, decreasing the decline of ⁇ -cell function and/or increasing insulin secretion by ⁇ -cells.
• the fragment, analogue, variant, or derivative may be one which:
• one or more of the amino acid residues is substituted with a conserved or non-conserved amino acid residue, preferably a conserved amino acid residue; such a substituted amino acid residue may or may not be one encoded by the genetic code;
• one or more of the amino acid residues includes a substituent group,- (c) the mature polypeptide is fused with another compound to increase the half-life of the polypeptide;
• the subject has one or more of the following risk factors for diabetes: impaired glucose tolerance, metabolic syndrome, a family history of Type 1 or Type 2 diabetes, obesity, polycystic ovary syndrome, hypertension, or elevated cholesterol levels.
• the invention includes within its scope the use of variant forms of other members of the EGF family of peptide growth factors which are capable of acting as a ⁇ -cell differentiation factor in vitro and/or in vivo, increasing ⁇ -cell mass in vitro and/or in vivo, decreasing the decline of ⁇ -cell function and/or increasing insulin secretion by ⁇ -cells in vitro and/or in vivo, herein defined as "analogous growth factor variants" .
• amino acid residues normally present in the authentic polypeptide are absent, in a manner analogous to their absence from BTC- ⁇ 4.
• the C 5 -C 6 disulphide loop normally present in the authentic molecule is absent, in a manner analogous to BTC- ⁇ 4.
• Suitable authentic polypeptides selected from the EGF family include epidermal growth factor, transforming growth factor- ⁇ , heparin-binding EGF-like growth factor, epiregulin, amphiregulin, neural and thymus-derived activator for ErbB kinases (NTAK) , and members of the neuregulin subfamily (NRGl, NRG2, NRG3 and NRG4) . It is expected that such variant forms will function in a manner analogous to that found in the BTC- ⁇ 4 polypeptides of the invention, provided that they have the functional characteristics defined above.
• both BTC- ⁇ 4 and analogous variants of other growth factors may be synthesised by chemical means such as solid phase polypeptide synthesis or by recombinant methods, all of which are well known in the art.
• the polypeptide molecule has an amino acid sequence of human origin.
• the invention also encompasses the use of BTC- ⁇ 4 from non-human mammals; the BTC- ⁇ 4 polynucleotides of the invention may readily be used as probes for isolation of corresponding polynucleotides from cells of other mammals, using methods which are routine in the art.
• polypeptide of the invention may be a recombinant polypeptide, an isolated naturally-occurring polypeptide or a synthetic polypeptide, and is preferably a recombinant polypeptide.
• the method of the invention is useful for the treatment of a Type 2 diabetic condition and the prevention or delaying of the onset of a Type 2 diabetic condition. Furthermore, as Type 1 diabetes is characterised by the loss of ⁇ -cells and complete loss of ⁇ -cell function, the invention is also useful for the treatment of a Type 1 diabetic condition or for the prevention or delay of the onset of a Type 1 diabetic condition.
• the polypeptides of the invention may optionally be administered together with an immunosuppressive agent.
• Suitable immunosuppressive agents include corticosteroids, TNF- ⁇ antibodies such as Remicade and soluble TNF- ⁇ receptors such as Enbrel .
• Such combined treatment may be preferable in the treatment of Type 1 diabetes or LADA, in which any new ⁇ cells would still be subject to immune attack unless the immune attack was suppressed. It is envisaged that the method of the invention will entail a reduced risk of carcinogenesis compared to the use of authentic BTC. We have found that BTC- ⁇ 4 fails to activate ErbBl and ErbB4 receptors, so ErbB-stimulated cell proliferation is prevented, thus decreasing or avoiding the risk of cancer as a side-effect of treatment.
• compositions of the invention are suitable for use in medical treatment of a diabetic condition in humans, they are also applicable to veterinary treatment, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as non-human primates, felids, canids, bovids, and ungulates.
• polypeptides of the invention will generally be administered in the form of pharmaceutical compositions.
• Methods and pharmaceutical carriers for preparation of pharmaceutical compositions are well known in the art, as set out in textbooks such as Remington's Pharmaceutical Sciences, 20th Edition, Williams & Wilkins, Pennsylvania, USA.
• the carrier or diluent, and other excipients will depend on the route of administration, and again the person skilled in the art will readily be able to determine the most suitable formulation for each particular case.
• the compounds and compositions of the invention may be administered by any suitable route, and the person skilled in the art will readily be able to determine the most suitable route and dose for the condition to be treated. Dosage will be at the discretion of the attendant physician or veterinarian, and will depend on the nature and state of the condition to be treated, the age and general state of health of the subject to be treated, the route of administration, and any previous treatment which may have been administered.
• Figure IA shows the detection of authentic human BTC and splice variant human BTC- ⁇ 4 in MCF-7 cells (Lane 1) and human breast skin fibroblasts (Lane 2) by RT-PCR. Lane 3 is a control without cDNA template.
• Figure IB shows the corresponding Southern blot using a cDNA probe encompassing polynucleotides encoding amino acids O 22 -Y 111 of human BTC.
• Figure 2A compares the partial nucleotide and deduced amino acid sequence (shown in one letter amino acid code) of authentic human BTC with that of splice variant human BTC- ⁇ 4.
• the RT-PCR products obtained from MCF-7 cDNA in Figure IA were cloned into pBluescript II SK and the inserts sequenced. Sequences surrounding the point of the 147 bp deletion (indicated by a downward arrow) are shown.
• Figure 2B shows the complete nucleotide sequence and deduced amino acid sequence of BTC- ⁇ 4 cDNA.
• Figure 3 compares the complete amino acid sequences of authentic human BTC and splice variant human BTC- ⁇ 4 in a hypothetical alignment.
• the horizontal dashes within the BTC- ⁇ 4 sequence indicate the sites of the missing amino acids when compared to the authentic hBTC sequence.
• the schematic below shows the overall structure of authentic human BTC compared to BTC- ⁇ 4.
• FIG. 4 shows the amino acid sequences of the BTC- ⁇ 4 polypeptides (BTC- ⁇ 4i -129 , BTC- ⁇ 4 1-94 , BTC- ⁇ 4 32 - 9 4, BTC- ⁇ 4 32 -i29, BTC- ⁇ 432-in and BTC- ⁇ 4 95 -i 29 ) •
• Figure 5 illustrates the constructs used for recombinant expression and purification of BTC and BTC- ⁇ 4.
• Figure 5A is a schematic representation of the constructs which were used for BTC and BTC- ⁇ 4 respectively.
• Figure 5B shows the results of assessment of purity of each BTC or BTC- ⁇ 4 preparation by analytical RP-HPLC on a C 4 column.
• Figure 6 shows that BTC- ⁇ 4 is a secreted protein.
• FIG. 7 shows that BTC but not BTC- ⁇ 4 stimulates the proliferation of Balb/c 3T3 fibroblasts and also that BTC but not BTC- ⁇ 4 binds to ErbBl and ErbB4 in radioreceptor assays.
• Balb/c 3T3 fibroblasts were incubated with increasing concentrations of either BTC or BTC- ⁇ 4 alone (A) or increasing concentrations of BTC- ⁇ 4 in the presence of a fixed concentration of BTC (B) .
• Figure 8 shows that BTC but not BTC- ⁇ 4 induces ErbBl and ErbB4 receptor tyrosine phosphorylation in AG2804 and CHO-ErbB4 cells, respectively.
• Cells were immunoprecipitated (IP) with either anti-ErbBl (AG2804) or anti-ErbB4 (CHO-ErbB4) antibodies and then blotted and probed with anti-phosphotyrosine antibody ( ⁇ PY) . Blots were also stripped and re-probed with anti-ErbBl or anti-ErbB4 antibodies.
• FIG. 9 shows that BTC and BTC- ⁇ 4 induce the differentiation of AR42J Cells.
• AR42J-B20 cells were incubated for 48 hrs with 2 nM activin A and either InM BTC (panels A and C) or BTC- ⁇ 4 (panels B and D) and were then fixed and stained with anti-insulin antibody (arrow “1") and DAPI (arrow "2") to stain nuclei.
• InM BTC panels A and C
• BTC- ⁇ 4 panels B and D
• DAPI DAPI
• FIG. 10 shows that BTC but not BTC- ⁇ 4 ameliorates activin-induced apoptosis of AR42J cells.
• AR42J-B20 cells were treated with 2 nM activin A and either 1 nM BTC (A) or BTC- ⁇ 4 (B) for 48 hrs. TUNEL-positive cells are indicated by the arrow.
• FIG. 11 shows that BTC- ⁇ 4 administration to STZ-treated rats reduces the plasma glucose concentration and improves glucose tolerance.
• B Glucose tolerance test was performed on 2-month old-rats. Left panel, changes in the plasma glucose concentration.
• Figure 12 shows the number of PDX-I-positive ductal cells (A) and islet-like cell clusters (ICC) (B) measured on Day 4 of the study described in Figure 11.
• A PDX-I-positive ductal cell (arrow “1") : PDX-I (arrow “2") : cytokeratin.
• B ICC (arrow “3") : cytokeratin (arrow "4") : insulin (arrow 5") : DAPI.
• STZ STZ-injected rats treated with saline. * p ⁇ 0.05 vs STZ. ** p ⁇ 0.01vs STZ. Magnification, A: x400; B: xlOO. DETAILED DESCRIPTION
• an enzyme includes a plurality of such enzymes
• an ammo acid is a reference to one or more amino acids.
• subject refers to any animal having a diabetic condition which requires treatment with a pharmaceutically-active agent.
• the subject may be a human, or may be a domestic or companion animal. While it is particularly contemplated that the compounds of the invention are suitable for use in medical treatment of humans, it is also applicable to veterinary treatment, including treatment of companion animals such as dogs and cats, and domestic animals such as horses, cattle and sheep, or zoo animals such as non-human primates, felids, canids, bovids, and ungulates.
• terapéuticaally effective amount means an amount of a compound of the present invention effective to yield a desired therapeutic response, for example to prevent or treat a disease which is susceptible to treatment by administration of a pharmaceutically-active agent.
• the specific "therapeutically effective amount” will of course vary with such factors as the particular condition being treated, the physical condition and clinical history of the subject, the type of animal being treated, the duration of the treatment, the nature of concurrent therapy (if any) , and the specific formulations employed and the structure of the compound or its derivatives.
• the concentration of polypeptide in the treatment composition is not critical, but should be an amount effective to treat a diabetic condition or to prevent or delay the onset of a diabetic condition.
• effective amount means an amount sufficient to elicit a statistically significant response at a 95% confidence level (i.e. p ⁇ 0.05 that the effect is due to chance alone) .
• the amount of polypeptide employed can be determined empirically, on the basis of the response of cells in vitro and response of experimental animals to the polypeptide or formulations containing the polypeptide.
• the amount of polypeptide employed should be sufficient to elicit ⁇ -cell differentiation in vivo, an increase in ⁇ -cell mass in vivo, a decrease in the decline of ⁇ -cell function in vivo, and/or an increase in the insulin secretion by ⁇ -cells in vivo.
• the daily dose in a patient weighing approximately 75 kg is at least 0.001 mg/kg, preferably 0.01 mg/kg, to about 20 mg/kg, preferably 1 mg/kg, of body weight.
• a “pharmaceutical carrier” is a pharmaceutically acceptable solvent, suspending agent, excipient or vehicle for delivering BTC- ⁇ 4 and/or other pharmaceutically-active agent to the subject.
• the carrier may be liquid or solid, and is selected with the planned manner of administration in mind.
• diabetes condition includes both type 1 diabetes, also known as insulin- dependent diabetes mellitus (IDMM) , and type 2 diabetes, also known as non-insulin-dependent diabetes mellitus (NIDDM) .
• IDMM insulin- dependent diabetes mellitus
• NIDDM non-insulin-dependent diabetes mellitus
• the splice variant of the invention is designated BTC- ⁇ 4, and polynucleotides encoding BTC- ⁇ 4 are referred to herein as BTC- ⁇ 4 polynucleotides.
• the term "authentic" when used with reference to BTC means the full-length or mature soluble mature BTC protein of 178 amino acids.
• substantially homologous sequence refers to a polypeptide which is functionally equivalent to the specific BTC- ⁇ 4 sequences disclosed herein, and encompasses substitutions, deletions and insertions in the specifically-disclosed polypeptides sequences.
• fragment when referring to the polypeptide of the invention mean a molecule which retains essentially the same biological function or activity as this polypeptide.
• an analogue includes a proprotein which can be activated by cleavage of the proprotein portion to produce an active mature polypeptide.
• fragment will be clearly understood to include a portion or domain of any size of a full-length sequence, provided only that the fragment is functionally active.
• fragment of a sequence or "part of a sequence” means a truncated sequence of the original sequence referred to.
• the truncated sequence can vary widely in length, the minimum size being a sequence of sufficient size to provide a sequence with at least a comparable function and/or activity or the original sequence referred to, while the maximum size is not critical. In some embodiments, the maximum size usually is not substantially greater than that required to provide the desired activity and/or function(s) of the original sequence.
• the truncated amino acid sequence will typically be at least about 5 amino acids in length. More typically, however, the sequence will be at least about 50 amino acids in length, preferably at least about 60, 80, 100, 120, 150, 200 or 220 amino acids.
• the fragment sequences may be flanked by further amino acids, or may be modified according to methods known to those skilled in the art. The modified protein must maintain at least one biological activity- of the native protein.
• the fragments may be used in either the oxidised or the reduced forms, or in conjunction with conjugated or protective groups. For example, they may be conjugated to carrier molecules.
• “Variants” of proteins include homologues of the proteins shown in Figure 4, and proteins having conservative substitutions such that the secondary conformation of the protein remain unchanged.
• conservative substitutions include amino acid residues having substantially the same hydrophobicity, size, and charge as the original amino acid residue. Such substitutions are generally well known to those skilled in the art of protein chemistry.
• conservative substitutions include proline for glycine and vice versa,- alanine or valine for glycine and vice versa; isoleucine for leucine and vice versa,- histidine for lysine and vice versa; serine for asparagine and vice versa; threonine for cysteine and vice versa; serine or alanine for threonine and vice versa; glutamine for asparagine and vice versa; tryptophan for tyrosine and vice versa; and arginine for glutamate and vice versa.
• protein "derivative" includes proteins with one or several amino acid residues substituted by naturally-occurring or synthetic amino acid homologues of the 20 naturally-occurring amino acids.
• homologues are 4-hydroxyproline, 5-hydroxylysine, 3- methylhistidine, homoserine, ⁇ -alanine, 4-aminobutanoic acid, ornithine, norleucine, norvaline, hydroxyproline, thyroxine, ⁇ -amino butyric acid, homoserine, citrulline and the l ike .
• natural amino acid residues are the 20 amino acid residues commonly found in proteins (i.e. alanine, aspartic acid, asparagine, arginine, cysteine, glycine, glutamine, glutamic acid, histidine, isoleucine, leucine, lysine, methionine, phenylalanine, proline, serine, threonine, tyrosine, tryptophan and valine) , and includes both the D- and L- forms of such amino acids.
• synthetic amino acid residues include both D- and L- forms of any other amino acid residues whether found in a protein, found in nature or synthetically produced.
• Synthetic amino acid residues include, but are not limited to, ⁇ -alanine, ornithine, norleucine, norvaline, hydroxyproline, thyroxine, gamma-amino butyric acid, homoserine, citrulline and the like.
• the present invention employs conventional chemistry, protein chemistry, molecular biological and enzymological techniques within the capacity of those skilled in ' the art. Such techniques are well known to the skilled worker, and are explained fully in the literature. See, for example, Coligan, Dunn, Ploegh, Speicher and Wingfield: "Current protocols in
• the methods of this invention may involve
• IGT insulin-dependent diabetes mellitus
• NIDMM non-insulin-dependent diabetes mellitus
• ITT impaired glucose tolerance
• ADA impaired glucose tolerance
• Possible underlying conditions which may cause a diabetic condition or which may be associated with diabetic symptoms include metabolic syndrome (hypertension, obesity/overweight, and high cholesterol) , haemochromatosis, chronic pancreatitis, polycystic ovary syndrome (PCOS) , carcinoid syndrome, surgery or trauma to the pancreas, overactive pituitary, overactive adrenals, pancreatic insufficiency, acromegaly, Cushing' s syndrome, cystic fibrosis, adenocarcinoma, somatostatinoma, aldosteronoma-induced hypokalaemia, phaeochromocytoma, primary aldosteronism, Wolfram's syndrome, leprechaunism, Rabson-Mendenhall syndrome, stiff man syndrome, autoimmune lymphoproliterative syndrome; hyperprolactinemia; hyperthyroidism; POEMS or Crow-Fukase syndrome (polyneuropathy, organomegaly, endocrinopathy, M
• risk factors for Type 2 diabetes include one or more of IGT, a family history of Type 2 diabetes, obesity, hypertension, elevated cholesterol levels, and sedentary lifestyle. It is known that certain ethnic groups, in particular African, Hispanic and Mexican Americans, Australian Abrares, and Pacific islanders have a higher incidence of Type 2 diabetes. Factors associated with pregnancy are also involved, since a previous history of gestational diabetes, miscarriage, stillbirth, or giving birth to a large baby or one with a birth defect are all associated with increased incidence of Type 2 diabetes.
• Oral glucose tolerance test An oral glucose tolerance test may be performed in a doctor's office or a laboratory. Blood glucose levels are measured five times over a period of 3 hours following a glucose challenge. The subject starts the test in a fasting state (having had no food or drink except water for at least 10 hours but not more than 16 hours) . An initial blood sample is taken, and the subject is then given a high glucose drink (75 grams of glucose; 100 grams for pregnant women) . Further blood samples are taken at 30 minutes, 1 hour, 2 hours and 3 hours after drinking the high glucose drink. In a non-diabetic person glucose levels in the blood rise following the glucose challenge, but then rapidly return to normal. In a diabetic subject, glucose levels rise to above normal levels after the glucose challenge, and return to normal levels much more slowly.
• OGTT Oral glucose tolerance test
• Mammalian ligands for the ErbB family include EGF (Savage et al . , 1972) , transforming growth factor- ⁇ (TGF- ⁇ ) (Marquardt et al . , 1984) , heparin-binding EGF-like growth factor (HB-EGF) (Higashiyama et al . , 1991) , epiregulin (Toyoda et al . , 1995) , amphiregulin (Shoyab et al . , 1989) , neural- and thymus-derived activator for ErbB kinases (NTAK) (Higashiyama et al .
• BTC- ⁇ 4 polypeptide and its variants are generally as described in PCT/AUOl/00010, the entire contents of which are incorporated herein by this reference. Suitable methods for producing the polypeptides are widely available in the art. Preferably recombinant DNA techniques are employed.
• the BTC- ⁇ 4 polynucleotide sequence is isolated from MCF-7 cells. It contains an open reading frame encoding a polypeptide of 129 amino acids.
• the polynucleotide sequence is identical to that of human BTC, except for a 147 bp deletion within the open reading frame (encoding 49 amino acids) resulting in the absence of the C 5 -C 6 disulphide loop normally present in the EGF domain (See Figure 2B and 3) .
• BTC- ⁇ 4 polynucleotides may be obtained from a variety of cell sources which express BTC-64 encoding mRNA.
• the inventors have identified a number of suitable human cell sources for BTC- ⁇ 4 polynucleotides, including but not limited to kidney, liver, pancreas, and a variety of breast carcinoma cell lines, such as MCF-7.
• polynucleotides encoding BTC- ⁇ 4 polypeptides may be obtained by cDNA cloning from RNA isolated and purified from cell sources.
• cDNA libraries of clones may be prepared using techniques well known to those in the art, and may be screened for BTC- ⁇ 4 encoding DNA with nucleotide probes which are substantially complementary to any portion of the BTC gene.
• Various PCR cloning techniques may also be used to obtain the BTC- ⁇ 4 polynucleotides of the invention.
• polynucleotides encoding BTC- ⁇ 4 polypeptides of the invention may be obtained by PCR, using oligonucleotide primers comprising polynucleotide sequences encoding portions of the BTC gene.
• the primer comprises the extreme 5 1 and 3 1 coding regions.
• the oligonucleotide primers have the following sequences, or sequences substantially homologous thereto 5 1 GAGCGGGGTTGATGGACCGG 3' (SEQ ID NO: 1) 5' TTAAGCAATATTTGTCTCTTC 3 1 (SEQ ID NO: 2)
• Host cells are transformed or transfected with the vectors of this invention, for example a cloning vector or an expression vector.
• a cloning vector or an expression vector for example a cloning vector or an expression vector.
• Various expression vector/host systems may be utilised equally well by those skilled in the art for the recombinant expression of BTC- ⁇ 4 polypeptides.
• Such systems include, but are not limited to micro-organisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors comprising the desired BTC- ⁇ 4 polynucleotide coding sequence; yeast transformed with recombinant yeast expression vectors comprising the desired BTC- ⁇ 4 polynucleotide coding sequence; insect cell systems infected with recombinant virus expression vectors (e.g., baculovirus) comprising the desired BTC- ⁇ 4 polynucleotide coding sequence; or animal cell systems transfected with appropriate mammalian expression vectors comprising the desired BTC- ⁇ 4 polynucleotide coding sequence.
• micro-organisms such as bacteria transformed with recombinant bacteriophage DNA, plasmid DNA or cosmid DNA expression vectors comprising the desired BTC- ⁇ 4 polynucleotide coding sequence
• yeast transformed with recombinant yeast expression vectors comprising
• the appropriate DNA sequence may be inserted into the vector by a variety of procedures.
• the DNA sequence is inserted into an appropriate restriction endonuclease site(s) by procedures well known to those skilled in the art.
• the DNA sequence inserted in the expression vector is operatively linked to an expression control sequence (s) (promoter) to direct mRNA synthesis.
• s expression control sequence
• any suitable transcription/translation elements may be used.
• promoters isolated from the genome of mammalian cells e.g., mouse metallothionein promoter
• viruses that grow in these cells e.g., human cytomegalovirus immediate-early (CMV) promoter
• Promoters produced by recombinant DNA or synthetic techniques may also be used to provide transcription of the inserted sequences.
• the expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. Specific initiation signals are also required for efficient translation of inserted coding sequences. These signals include the ATG initiation codon and adjacent sequences.
• initiation codon must be in phase with the reading frame of the BTC- ⁇ 4 coding sequences to ensure translation of the entire insert.
• exogenous translational control signals and initiation codons can be of a variety of origins, both natural and synthetic.
• the efficiency of expression may be enhanced by the inclusion of transcription attenuation sequences, enhancer elements etc.
• the expression vectors comprise one or more selectable marker genes to provide a phenotypic trait for selection of transformed or transfected host cells, such as neomycin (G418) resistance for eukaryotic cells, or ampicillin resistance for prokaryotic cells such as E. coli .
• selectable marker genes such as neomycin (G418) resistance for eukaryotic cells, or ampicillin resistance for prokaryotic cells such as E. coli .
• the vector containing a DNA molecule of the invention may be employed to transform or transfect an appropriate host to permit the host to express the protein.
• appropriate hosts include, but are not limited to, bacterial cells, such as E. coli; insect cells such as Drosophila and Sf9; and animal cells such as CHO, COS, or 293 cells.
• the constructs in host cells can be used in a conventional manner to produce the gene product encoded by the recombinant sequence.
• the polypeptide of the invention can be synthetically produced by conventional peptide synthesisers.
• polypeptide of the invention produced in a variety of different vector/host expression systems as described above, can be recovered and purified from recombinant cell cultures by a wide variety of methods, including ammonium sulphate or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction chromatography, affinity chromatography, hydroxyapatite chromatography, and reverse-phase high performance liquid chromatography (HPLC) . Protein refolding steps can be used, as necessary, in completing the configuration of the desired polypeptide.
• the polypeptide may be a purified product, isolated from a tissue or cellular source, a product of chemical synthetic procedures, or produced by recombinant techniques using a prokaryotic or eukaryotic host. Depending upon the host employed in a recombinant production procedure, the polypeptides of the invention may be glycosylated or may be non-glycosylated.
• polypeptides which have a sequence substantially homologous to BTC- ⁇ 4 or analogues, fragments, mutants, derivatives, or allelic variants of BTC- ⁇ 4 for use in accordance with the invention, for example by assessing the ability of the polypeptide to induce differentiation of pancreatic cell lines in vitro, or assessing the ability to reduce the severity of diabetic symptoms in animal models of diabetes.
• the analogue, fragment, mutant, derivative, or allelic variant of BTC- ⁇ 4 for use in accordance with the invention has the following biological properties in vitro;
• polypeptide does not displace radiolabelled mature BTC from ErbBl or ErbB4 receptors on human lung fibroblasts (AG2804) when utilising the method described in Example 5.
• the polypeptide does not induce the tyrosine phosphorylation of ErbBl or ErbB4 receptors on human lung fibroblasts (AG2804) when utilising the method described in Example 5.
• the compound of the invention may be administered orally, rectally, parenterally or by inhalation in dosage unit formulations containing conventional non-toxic pharmaceutically acceptable carriers, adjuvants, and vehicles.
• parenteral as used herein includes subcutaneous, intravenous, intramuscular, intrathecal, intracranial, injection or infusion techniques.
• the invention also provides suitable topical, oral, aerosol, and parenteral pharmaceutical formulations for use in the novel methods of treatment of the present invention.
• the compounds of the invention may be administered orally as tablets, aqueous or oily suspensions, lozenges, troches, powders, granules, emulsions, capsules, syrups or elixirs.
• composition ⁇ for oral use may contain one or more agents selected from the group of sweetening agents, flavouring agents, colouring agents and preserving agents in order to produce pharmaceutically elegant and palatable preparations.
• the tablets contain the active ingredient in admixture with non-toxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets.
• excipients may be, for example, inert diluents, such as calcium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, such as corn starch or alginic acid; binding agents, such as starch, gelatin or acacia; or lubricating agents, such as magnesium stearate, stearic acid or talc.
• the tablets may be uncoated, or may be coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period.
• a time-delay material such as glyceryl monostearate or glyceryl distearate may be employed. Coating may also be performed using techniques described in the U.S. Patent Nos . 4,256,108; 4,160,452; and 4,265,874 to form osmotic therapeutic tablets for controlled release.
• the BTC- ⁇ 4 as well as the pharmaceutically-active agent useful in the method of the invention can be administered parenterally by injection or by gradual perfusion over time independently or together.
• Administration may be intravenous, intra-arterial, intraperitoneal, intramuscular, subcutaneously, intracavity, or transdermal.
• the agents may be added or dissolved in an appropriate biologically acceptable buffer and added to a cell or tissue.
• Preparations for parenteral administration include sterile aqueous or non-aqueous solutions, suspensions, and emulsions.
• non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters such as ethyl oleate.
• Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered media.
• Parenteral vehicles include sodium chloride solution, Ringer's dextrose, dextrose and sodium chloride
• lactated Ringer's intravenous vehicles include fluid and nutrient replenishers, electrolyte replenishers such as those based on Ringer's dextrose, and the like.
• Preservatives and other additives may also be present, such as anti-microbials, anti-oxidants, chelating agents, growth factors and inert gases and the like.
• treating covers any treatment of, or prevention of disease in a vertebrate, a mammal, particularly a human, and includes preventing the disease from occurring in a subject who may be predisposed to the disease, but has not yet been diagnosed as having it; inhibiting the disease, ie. arresting its development; or relieving or ameliorating the effects of the disease, i.e., cause regression of the effects of the disease.
• the invention includes the use of various pharmaceutical compositions useful for ameliorating disease.
• the pharmaceutical compositions according to one embodiment of the invention are prepared by bringing BTC- ⁇ 4, analogues, derivatives or salts thereof and one or more pharmaceutically-active agents or combinations of BTC- ⁇ 4 and one or more pharmaceutically-active agents into a form suitable for administration to a subject using carriers, excipients and additives or auxiliaries.
• Frequently used carriers or auxiliaries include magnesium carbonate, titanium dioxide, lactose, mannitol and other sugars, talc, milk protein, gelatin, starch, vitamins, cellulose and its derivatives, animal and vegetable oils, polyethylene glycols and solvents, such as sterile water, alcohols, glycerol and polyhydric alcohols.
• Intravenous vehicles include fluid and nutrient replenishers.
• Preservatives include antimicrobial, anti-oxidants, chelating agents and inert gases.
• Other pharmaceutically acceptable carriers include aqueous solutions, non-toxic excipients, including salts, preservatives, buffers and the like, as described, for instance, in Remington's Pharmaceutical Sciences, 20th ed.
• the pharmaceutical compositions are preferably prepared and administered in dosage units. Solid dosage units include tablets, capsules and suppositories. For treatment of a subject, depending on activity of the compound, manner of administration, nature and severity of the disorder, age and body weight of the subject, different daily doses can be used.
• the administration of the daily dose can be carried out both by single administration in the form of an individual dose unit or else several smaller dose units and also by multiple administration of subdivided doses at specific intervals .
• the pharmaceutical compositions according to the invention may be administered locally or systemically in a therapeutically effective dose. Amounts effective for this use will, of course, depend on the severity of the disease and the weight and general state of the subject.
• dosages used in vitro may provide useful guidance in the amounts useful for in situ administration of the pharmaceutical composition, and animal models may be used to determine effective dosages for treatment of the cytotoxic side effects.
• animal models may be used to determine effective dosages for treatment of the cytotoxic side effects.
• Formulations for oral use may be in the form of hard gelatin capsules, in which the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin. They may also be in the form of soft gelatin capsules, in which the active ingredient is mixed with water or an oil medium, such as peanut oil, liquid paraffin or olive oil.
• Aqueous suspensions normally contain the active materials in admixture with excipients suitable for the manufacture of aqueous suspensions.
• excipients may be suspending agents such as sodium carboxymethyl cellulose, methyl cellulose, hydroxypropylmethylcellulose, sodium alginate, polyvinylpyrrolidone, gum tragacanth and gum acacia; dispersing or wetting agents, which may be (a) a naturally occurring phosphatide such as lecithin; (b) a condensation product of an alkylene oxide with a fatty acid, for example, polyoxyethylene stearate; (c) a condensation product of ethylene oxide with a long chain aliphatic alcohol, for example, heptadecaethylenoxycetanol; (d) a condensation product of ethylene oxide with a partial ester derived from a fatty acid and hexitol such as polyoxyethylene sorbitol monooleate, or (e) a condensation product of ethylene oxide with
• the pharmaceutical compositions may be in the form of a sterile injectable aqueous or oleaginous suspension.
• This suspension may be formulated according to known methods using suitable dispersing or wetting agents and suspending agents such as those mentioned above.
• the sterile injectable preparation may also a sterile injectable solution or suspension in a non-toxic parenterally-acceptable diluent or solvent, for example, as a solution in 1, 3-butanediol .
• the acceptable vehicles and solvents which may be employed are water, Ringer's solution, and isotonic sodium chloride solution.
• sterile, fixed oils are conventionally employed as a solvent or suspending medium.
• any bland fixed oil may be employed, including synthetic mono-or diglycerides.
• fatty acids such as oleic acid may be used in the preparation of injectables.
• Liposome delivery systems such as small unilamellar vesicles, large unilamellar vesicles, and multilamellar vesicles.
• Liposomes can be formed from a variety of phospholipids, such as cholesterol, stearylamine, or phosphatidylcholines.
• Dosage levels of BTC- ⁇ 4 will usually be of the order ' of about 0.5mg to about 20mg per kilogram body weight, with a preferred dosage range between about 0.5mg to about lOmg per kilogram body weight per day (from about 0.5g to about 3g per patient per day) .
• the amount of active ingredient which may be combined with the carrier materials to produce a single dosage will vary, depending upon the host to be treated and the particular mode of administration.
• a formulation intended for oral administration to humans may contain about 5mg to Ig of an active compound with an appropriate and convenient amount of carrier material, which may vary from about 5 to 95 percent of the total composition.
• Dosage unit forms will generally contain between from about 5mg to 500mg of active ingredient .
• the specific dose level for any particular patient will depend upon a variety of factors including the activity of the specific compound employed, the age, body weight, general health, sex, diet, time of administration, route of administration, rate of excretion, drug combination and the severity of the particular disease undergoing therapy.
• polypeptides of the invention may additionally be combined with other compounds to provide an operative combination. It is intended to include any chemically compatible combination of pharmaceutically- active agents, as long as the combination does not eliminate the activity of BTC- ⁇ 4.
• Pancreatic AR42J cells are derived from a chemically induced pancreatic tumor and express both exocrine and neuroendocrine properties (Rosewicz et al . ,
• AR42J-B20 cells stop growing, and their morphology changes significantly by extending neurites.
• activin-treated cells express mRNA encoding GLUT2 , ATP-sensitive K + channel, and pancreatic polypeptide (PP) .
• PP pancreatic polypeptide
• the production of insulin in response to BTC- ⁇ 4 can be detected by immunofluoresnce following the staining of the cells with an anti-insulin antibody.
• the AR42J clone AR1898-0192 can be used to measure the differentiation of AR42J cells into insulin-secreting cells quantitatively.
• This clone contains a secreted alkaline phosphatase (SEAP) gene downstream of the rat insulin II gene promoter.
• SEAP secreted alkaline phosphatase
• Immortalised epithelial cell lines Pancreatic precursor cell lines have been isolated from the pancreatic ducts of transgenic mice ("Immortomice") carrying a temperature-sensitive SV40 T antigen (Sharma et al, 2001) .
• Immortomice transgenic mice
• T antigen expression is shut off, and the cells differentiate appropriately.
• these cells when grown at 33°C do not display islet/neuroendocrine granules, and fail to express islet markers.
• This cell line is used in a rapid and sensitive assay similar to the one described above to measure insulin expression and ⁇ -cell differentiation.
• the rat insulin 1 promoter is used to drive expression of the Green Fluorescent Protein (GFP) reporter.
• GFP Green Fluorescent Protein
• This cell line provides a very sensitive method for identification of jS-cell differentiation factors such as BTC- ⁇ 4 which stimulate the expression of /3-cell specific genes such as insulin, as assayed by GFP fluorescence in living cells.
• Type 2 diabetes In addition to the Streptozotocin (STZ) model (see example 7) , a number of other animal models of Type 2 diabetes are available for use in testing the in vivo activity of BTC- ⁇ 4. These models include surgical generation of Type 2 diabetes, for example by pancreatectomy in rats (Bonner-Weir et al . , 1983) and genetic models based on selective breeding. Genetic models include, the Goto-Kakizaki (GK) rat, the Spontaneously Diabetic Torii (SDT) rat, the Otsuka-Long-Evans-Tokushima fatty (OLETF) rat, the db/db mouse and the NOD/Ltj mouse.
• GK Goto-Kakizaki
• SDT Spontaneously Diabetic Torii
• OLETF Otsuka-Long-Evans-Tokushima fatty
• the Goto-Kakizaki (GK) rat exhibits similar metabolic, hormonal and vascular disorders to those seen in the human diabetes disease. Unlike many other rodent models of Type II diabetes, the GK rat is non-obese. Characteristics of the Goto-Kakizaki rat include fasting hyperglycemia, impaired secretion of insulin in response to glucose both in vivo and in isolated pancreatic cells, and hepatic and peripheral insulin resistance. Late complications such as retinopathy, microangiopathy, neuropathy and nephropathy have been described in the literature.
• Diabetic Torii SDT
• Male rats spontaneously develop glucose intolerance with impaired insulin secretion after 14 weeks, and develop diabetes with remarkable hyperglycemia and marked hypoinsulinemia after 20 weeks.
• Diabetic Long-Evans rats are characterized by mild obesity and late-onset hyperglycemia after 18 weeks of age, with complications related to chronic diabetes. Although multiple loci have been identified by genetic analysis, the cause of diabetes in these rats seems to be a combination of insulin resistance and impaired insulin secretion, resembling human type 2 diabetes.
• Otsuka-Long-Evans-Tokushima fatty (OLETF) rats are derived from a spontaneous combination of insulin resistance and impaired insulin secretion, resembling human type 2 diabetes.
• insulin sensitivity decreases with aging, i.e., it is normal at 6 weeks and reduced by 40% at 12 weeks and 80% after 18 weeks compared with age-matched control Long-Evans Tokushima Otsuka (LETO) rats.
• Insulin secretion is impaired at 40 weeks (14) and lipotoxicity to islet ⁇ -cells may be involved in the pathogenesis of islet dysfunction in hypertriglyceridemic OLETF rats.
• OLETF rats exhibit reduced regenerative capacity of pancreatic ⁇ -cells compared with LETO rats (17) .
• OLETF rats are suitable for studying the pathophysiological changes during the prediabetic phase.
• the db/db mice harbour a point mutation in the leptin receptor gene, and spontaneously develop increased levels of blood glucose and depletion of pancreatic ⁇ cells by 8-10 weeks after birth. These mice also become overtly obese by about 4 weeks of age .
• NOD/Ltj mice are characterized by insulitis, a leukocytic infiltrate of the pancreatic islets.
• pancreatic insulin content Marked decreases in pancreatic insulin content occur in females at about 12 weeks of age, and several weeks later in males. Onset of diabetes is marked by moderate glycosuria and by a non-fasting plasma glucose higher than 250 mg/dl .
• Diabetic NOD/Ltj mice are hypoinsulinemic and hyperglucagonemic, indicating a selective destruction of pancreatic islet beta cells. Susceptibility to IDDM in NOD/LtJ mice is polygenic, and environment, including housing conditions, health status, and diet, exerts a strong effect on penetrance. NOD/LtJ females are more widely used than males, because the onset of IDDM symptoms occurs earlier and with a higher incidence (90-100% by 30 weeks of age) .
• NOD/LtJ males develop IDDM at a frequency of between 40-60% by 30-40 weeks of age.
• Male mice are useful for certain applications, including pharmaceutical studies, "accelerated transfer” of IDDM, and some in vitro studies.
• NOD mice also exhibit multiple aberrant immunophenotypes, including defective antigen-presenting cell immunoregulatory functions, defects in the regulation of the T lymphocyte repertoire, defective NK cell function, defective cytokine production from macrophages (Fan et al . , 2004) and impaired wound healing.
• NOD/LtJ mice are also severely hearing-impaired.
• Suitable methods available to persons skilled in the art to test putative polypeptides of the invention for use in accordance with the invention include the use of the in vivo models of Type-2 diabetes discussed above, the testing of ⁇ -cell regeneration, amelioration of glucose intolerance and improved glycemic control (fasting serum glucose) , stimulation of insulin secretion and inhibtion of glucagon secretion when blood glusose levels are elevated, hypoglycemia and measuring improvement in markers of ⁇ -cell function such as the intravenous glucose tolerence test, arginine stimulation and hypergylcemic clamp. These assays are also applicable to human clinical trials.
• Normal human breast skin fibroblasts were prepared from a piece of skin obtained during surgery for breast reduction. The skin was cultured as an explant for 5 days in DMEM supplemented with 10% fetal calf serum and penicillin- streptomycin sulphate until the fibroblasts had grown into a monolayer.
• Total RNA (2 ⁇ g) was subsequently reverse transcribed to cDNA with Superscript II enzyme according to the manufacturer's instructions using oligo dT primers (Gibco BRL, Gaithersburg, MD) .
• cDNA corresponding to human BTC- ⁇ was amplified by PCR with sense primer (5'-CTCGTCGACGAGCGGGGTTGATGGACCGG-B') (SEQ ID NO: 3) and antisense primer
• PCR was carried out in 50 ⁇ l of 60 mM Tris-SO 4 , 18 mM (NH 4 ) 2 SO 4 , 1.5 tnM MgSO 4 (pH 9.1) , 0.2 mM dNTPs, 200 ng each primer,
• BTC and BTC- ⁇ 4 PCR products were cloned and sequenced by separating the products by agarose gel electrophoresis and recovering the fragments following gel extraction with a Concert kit (Gibco BRL, Gaithersburg, MD) . Purified PCR products were then digested with Sail and Pstl and subcloned into Sail/Pstl-digested pBluescript
• Example 2 E. coli expression and purification of recombinant BTC and BTC- ⁇ 4
• BTC The mature form of BTC (Asp 32 -Tyr llx ) or full length BTC- ⁇ 4 (Asp 32 -Ala 129 , minus the hydrophobic signal peptide Met ⁇ Ala 31 ) were expressed as thioredoxin fusion proteins in the bacterial expression vector pET3.2a.
• pET3.2a-BTC and pET3.2a- BTC- ⁇ 4 constructs were transformed into the E. coli strain BL21 (DE3) and proteins expressed following induction with IPTG. Following induction, cells were collected, lysed and the BTC or BTC- ⁇ 4 purified using Ni-NTA agarose and RP-HPLC. Following expression, cells were lysed and fusion protein purified using Ni-NTA agarose. The purified thioredoxin fusion protein was cleaved with enterokinase to release BTC- ⁇ 4, which was purified to homogeneity by reverse-phase HPLC.
• the open reading frame sequence of BTC- ⁇ 4 32"129 was amplified by PCR using the primer set
• BTC constituting amino acids 32-111 (BTC 32"111 )
• BTC 32"111 was also expressed and purified using the pET system as a positive control as described previously (Seno et al . , 1996) or produced as a thioredoxin fusion protein with the plasmid pET32a.
• the ORF sequence of BTC 32"111 was amplified by PCR using the primer set
• BTC or BTC- ⁇ 4 in BL21trxB(DE3) cells For the expression of BTC or BTC- ⁇ 4 in BL21trxB(DE3) cells, a single colony was inoculated into a 50 ml overnight culture grown at 37 0 C in LB medium (supplemented with 50 ⁇ g/ml ampicillin and 15 ⁇ g/ml kanamycin) with constant shaking. Ten ml of this overnight culture was then used to inoculate 200 ml of fresh LB medium. The cells were grown at 37°C to an OD 6 oonm of 0.4-0.5, prior to induction with IPTG (1 mmol/1) and then for a further 3 h before being pelleted by centrifugation (4 000 rpm, 10 min 4°C) and stored at -80 0 C prior to purification.
• BTC or BTC- ⁇ 4 expressed as fusion proteins frozen cell pellets were thawed on ice and resuspended in 18 ml BugBuster Protein Extraction Reagent containing lysozyme (100 ⁇ g/ml) and incubated at room temperature with gentle shaking for 10 min. Following incubation, the cell lysate was sonicated (3 x 5 sec bursts) to reduce viscosity and clarified by centrifugation (20 min, 16 000 rpm, 10 min) .
• the clarified cell lysate was adjusted to 10 mmol/1 imadazole and incubated with 6 ml of Ni-NTA agarose, pre-equilibrated in 50 mmol/1 NaH 2 PO 4 , 0.3 mol/1 NaCl, 10 mmol/1 imidazole (pH 8.0) , for 1 h at 4°C with gentle shaking. Following incubation, the resin was centrifuged (5 min, 15 000 rpm, 4°C) , the supernatant removed and the resin washed by resuspension in 50 mmol/1 NaH 2 PO 4 ,
• BTC or BTC- ⁇ 4 was separated from the thioredoxin fusion partner by further Ni-NTA agarose affinity chromatography as described above. In this case, the cleaved thioredoxin fusion partner was captured on the resin and BTC or BTC- ⁇ 4 was collected in the flow through fraction. BTC or BTC- ⁇ 4 present in the flow through fraction was further purified by reverse-phase HPLC.
• Ni-NTA agarose flow through fraction was diluted 1:4 (v/v) with 0.1% TFA and applied to a C4 Prep-Pak reverse-phase HPLC column (25 mm x 100 mm; 300 A, 15 ⁇ m; Millipore-Waters) at a flow rate of 10 ml/min.
• the column was washed with 0.1% TFA until OD 2 i 4nm returned to baseline and the column then eluted with a gradient of 8-80% (v/v) acetonitrile over 150 min in the presence of 0.08% TFA at a flow rate of 10 ml/min.
• the molecular mass of recombinant BTC and BTC- ⁇ 4 determined by electrospray ionization mass spectrometry was 9211.35 ⁇ 0.29 Da and 11450.26 ⁇ 0.23 Da, respectively, which is consistent with the calculated theoretical masses of 9249 and 11452 Da (data not shown) .
• SDS-PAGE and silver staining a single band at approximately 9 kDa and 11.5 kDa was obtained for BTC and BTC- ⁇ 4 detected under reducing or non-reducing conditions.
• the purity of both BTC and BTC- ⁇ 4 was further confimed by N-terminal sequence analysis (5 cycles) which gave the expecte N-terminal sequence with an approximate purity of >95%.
• BTC- ⁇ 4 32"129 (containing an initiation methionine residue) was cloned into the expression vector pET3b and the recombinant protein, solubilized, and refolded from inclusion bodies, purified by cation exchange column and gel filtration column chromatography as previously described (Maeda et al, 2002) . All the recombinant proteins prepared in this study were lyophilised and stored at -80°C prior to use.
• Example 3 Construction of a BTC- ⁇ 4 expression plasmid for mammalian expression
• BTC- ⁇ 4 Full length BTC- ⁇ 4 (1-129) was cloned into the vector pcDNA3.1 (Invitrogen) to generate expression vectors for the mammalian production of BTC- ⁇ as follows. Briefly, pBlue-BTC- ⁇ 4 from Example 1 was digested with Apal and BairiRI and the released insert purified following agarose gel electrophoresis. The digested and purified insert was then cloned into Apal/BarriHI-digested pcDNA3.1, and recombinant clones identified following transformation in E. coli TOPlO cells (Invitrogen) . To generate a "Flag- tagged" pcDNA3.
• the resultant Flag-tagged pBlue- BTC- ⁇ 4 construct was digested with Apal/BamKl and cloned into Apal/BamHl-digested pcDNA3.1 to generate pcDNA3.1-FLAG-BTC- ⁇ 4.
• BTC is synthesized as a transmembrane-anchored precursor protein (pro-BTC) which can be proteolytically cleaved to yield soluble BTC containing the EGF-motif (Asp 32 -Tyr li:L ) . Retention of the hydrophobic signal peptide and the absence of the transmembrane domain suggests that BTC- ⁇ 4 may be a secreted protein.
• pro-BTC transmembrane-anchored precursor protein
• COS-7 cells were plated into 12 well plates at 2xlO 5 cells/well in DMEM/10% FBS. Following overnight incubation, cells were transfected with 2 ⁇ g of construct DNA using Lipofectamine 2000 and Optimem-1 medium (both from Invitrogen) according to the manufacturer's instructions. Twelve hours later, the cells were washed twice and replenished with fresh Optimem-1 medium. Seventy-two hours post-transfection, culture medium (CM) was collected and cell lysates prepared.
• CM culture medium
• CM was clarified by centrifugation and the presence of BTC or BTC- ⁇ 4 in the media analyzed by ELISA or Western blotting using an anti-FLAG-M2 antibody (Sigma) .
• BTC or BTC- ⁇ 4 present in the cell lysate was analysed by Western blotting with the anti-FLAG-M2 antibody.
• Cell lysates were prepared by washing the cells twice with PBS following the removal of CM and then lysing the cells directly in SDS-PAGE sample buffer and heating to 95°C for 5 min.
• CM For ELISA analysis of the CM, 90 ⁇ l of CM was mixed with lO ⁇ l of 10 x coating buffer (0.15 mol/1 Na 2 CO 3 , 0.35 mol/1 NaHCO 3 , pH 9.3) and loaded into 96 well immunosorbent plates. Plates were coated overnight at 4 0 C then blocked in 2% BSA in PBS/0. l%Tween (PBS-T) . Plates were washed 4 times with PBS-T and then incubated for 1 h at 37°C with anti-FLAG antibody diluted in PBS-T (2.5 ⁇ g/ml) .
• CM or cell lysates were resolved by SDS-PAGE (10-20% Tris-Tricine gels) . Proteins were then transferred to nitrocellulose (Hybond-C extra,- Amersham) and membranes probed with mouse anti-FLAG-M2 antibody (2.5 ⁇ g/ml) and then HRP-conjugated sheep anti-mouse antibody (1:10 000) . HRP-labeled proteins were visualized using Supersignal West Dura Extended Duration Substrate (Pierce) .
• BTC- ⁇ 4 To investigate the biological activity of BTC- ⁇ 4, we initially tested its ability to stimulate the proliferation of Balb/c 3T3 mouse fibroblasts which express ErbBl.
• the Balb/c 3T3 cells were obtained from the American Tissue Type Culture Collection.
• the binding affinity of BTC and BTC- ⁇ 4 for ErbB receptors was determined by measuring the ability of BTC or BTC- ⁇ 4 to competitively displace [ 125 I] -labeled recombinant human BTC from ErbBl or ErbB4 receptors present on AG2804 fibroblasts (Dunbar et al . , 1999) or Chinese Hamster Ovary (CHO) cells stably transfected with ErbB4 (CHO-ErbB4 cells,- (Tzahar et al . , 1996) , a kind gift from Professor Yosef Yarden, Weizmann Institute, Israel) , respectively.
• AG2804 or CHO-ErbB4 cells were grown to 70-80% confluence in DMEM/10% FBS in 24-well plates. (Human lung fibroblast. The cells were then washed twice with binding buffer (100 mmol/1 Hepes, (pH 7.6) , 120 mmol/1 NaCl, 5 mmol/1 KCl, 1.2 mmol/1 MgSO 4 , 8 mmol/1 glucose, 0.1% BSA) and then incubated with [ 125 I] -rhBTC (10 000-15 000 cpm, labeled with Na[ 125 I] using chloramine-T to a specific activity of approximately 20 ⁇ Ci/ ⁇ g and increasing concentrations of unlabelled BTC or BTC- ⁇ 4 (0-100 nmol/1 for AG2804 cells and 0-10 nmol/1 for CHO-ErbB4 cells) in binding buffer at 4°C for 18 h.
• binding buffer 100 mmol/1 Hepes, (pH 7.6) , 120 mmol/1 NaCl, 5
• a cell line overexpressing ErbBl receptors, or CHO cells overexpressing the ErbB4 receptor were grown to confluence in 10 cm dishes and subsequently incubated for 12-14 h in serum-free medium and the cells then stimulated with 10 nmol/1 BTC, BTC- ⁇ 4 or a combination of both for 10 min at room temperature.
• lysis buffer 50 mmol/1 Tris-Cl pH 7.4, 150 mmol/1 NaCl, 1% deoxycholate, 1% Triton X-100, 0.1% SDS, 5 mmol/1 sodium orthovanadate, 10 mmol/1 sodium fluoride, 1 mmol/1 EGTA and complete protease inhibitorsTM.
• Cell lysates were cleared by centrifugation (20 min, 15 000 g at 4 0 C) and ErbBl or ErbB4 immunoprecipitated by incubating the lysate with 1 ⁇ g rabbit polyclonal anti-ErbBl antibody (1005) , Santa Cruz or rabbit polyclonal anti-ErbB4 antibody, respectively for 2 h at 4°C with gentle shaking.
• blots were stripped and re-probed with rabbit polyclonal anti-ErbBl or rabbit polyclonal anti-ErbB4 antibodies and HRP-conjugated rabbit anti-sheep antibody.
• Anti-ErbBl (1005), anti-ErbB4 (C-18) and anti-phosphotyrosine (PY20) antibodies were purchased from Santa Cruz and HRP-conjugated rabbit anti-sheep antibody from Zymed Laboratories.
• BTC- ⁇ 4 does not stimulate cell proliferation
• our findings suggest that BTC- ⁇ 4 would present a lower risk of inducing cancer than does authentic BTC.
• BTC- ⁇ 4 exerts its effect via an as-yet unidentified receptor, rather than via ErbBl or ErbB4 receptors. Further investigations may be pursued using methods described herein, or using BIAcore assays.
• Native BTC is known to stimulate the differentiation of pancreatic / S-cells (Mashima et al . , 1996; Watada et al . , 1996; Yamamoto et al . , 2000; Li et al., 2001; Li L et al . , 2003; Li et al . , 2004) , and there is some evidence to suggest that this may occur through a unique non-ErbB cell surface receptor (Ishiyama et al . , 1998) .
• BTC- ⁇ 4 To examine the effect of BTC- ⁇ 4 on the differentiation of pancreatic / S-cells as assessed by induction of insulin expression, we used the model cell line AR42J-B20, a subclone of AR42J, an amylase-secreting pancreatic tumour cell line.
• BTC acts coordinately with activin A and converts them to insulin- secreting cells (Mashima et al . , 1996) .
• activin A converts amylase-secreting AR42J-B20 into pancreatic polypeptide (PP) -producing endocrine cells.
• Activin A also induces apoptosis in these cells and, in the absence of a survival factor, many of the activin-treated cells die by apoptosis after their conversion to PP-producing cells (Furukawa et al . , 1999) .
• BTC exerts two effects in AR42J-B20 cells: firstly it inhibits apoptosis induced by activin A, and secondly it converts them to insulin-producing cells (Mashima et al . , 1996; Furukawa et al . , 1999) .
• AR42J-B20 cells were cultured in DMEM medium containing 10% fetal calf serum as described previously (Mashima et al . , 1996) .
• To assess differentiation into insulin-producing cells cells were incubated for 48 hrs with 2 nmol activin A and either 1 nmol BTC or BTC- ⁇ 4. Cells were then fixed, stained with anti-insulin antibody as described previously (Mashima et al . , 1996) and the number of insulin-positive cells was counted. Nuclei were stained with DAPI.
• Apoptosis was assessed by using the terminal deoxynucleotidyl transferase (TUNEL) technique (Wako Pure Chemicals, Osaka, Japan) . Changes in the number of viable cells were assessed by using 3- [4, 5-dimethylthiazole-2-yl] - 2, 5, -diphenyltetrazolium) bromide (MTT) (Carmichael et al . , 1987) .
• TUNEL terminal deoxynucleotidyl transferase
• BTC- ⁇ 4 was as effective as BTC in stimulating the differentiation of AR42J-B20 cells; however, BTC- ⁇ 4 was much less potent in promoting survival of these cells.
• Example 7 BTC- ⁇ 4 administration to STZ-treated rats reduces the plasma glucose concentration and improves glucose tolerance .
• BTC- ⁇ 4 administration to STZ-treated rats reduces the plasma glucose concentration and improves glucose tolerance .
• the experimental protocol was approved by the Animal Care Committee of Gunma University.
• One-day-old Sprague-Dawley (SD) rats were injected intraperitoneally (ip) with 85 ⁇ g/g streptozotocin (STZ) freshly dissolved in 0.05 mmol/1 citrate buffer (pH 4.5) . The pups were left with their mothers until 4 weeks of age.
• Neonatal STZ-treated rats were injected with 3 pmol/g BTC- ⁇ 4, BTC or saline every day for five days starting from day 0.
• the fasting blood glucose concentration and the body weight were measured daily for the first week, and then once a week for up to 8 weeks. Two months after the STZ-treatment, an ip glucose tolerance test (2 g/kg body weight) was performed after 14 h of fasting.
• bromodeoxyuridine (BrdU) labeling reagent per 100 g of body weight (cell proliferation kit, Amersham Pharmacia Biotech, U.K.) and decapitated after 3 h.
• the pancreas was excised, weighed, and divided into two parts. One portion from the splenic segment was fixed with 4% paraformaldehyde/PBS overnight at 4 0 C and processed for paraffin embedding. Four series of sections from each pancreas were cut at intervals of 100 ⁇ m in neonates and 300 ⁇ m in adults for immunostaining and histochemistry.
• the second portion was homogenized in cold acid-ethanol, heated for 5 min in 70 0 C water bath, centrifuged and the supernatant stored at -20 0 C prior to assaying for insulin. Insulin was measured by time-resolved immunofluorometric assay as described previously (Mashima et al . , 1996) .
• Quantitation of the /3-cell mass was performed on insulin-stained sections using image analysis software (NIH image) by means of an AX70 Epifluorescence microscope (Olympus, Tokyo, Japan) equipped with a PXL 1400 cooled- charge-coupled device camera system (Photometries, Arlington, AZ) operated with IP Lab Spectrum software (Signal Analysis, Vienna, VA) . At least random 40 fields (magnification x 200) from one section (three sections from different series per block) were measured for the area of insulin-positive cells. The /3-cell mass was calculated as described elsewhere (Li L, Seno M, Yamada H, Kojima I. Promotion of /3-cell regeneration by betacellulin in ninety percent pancreatectomized rats.
• Neonatal STZ-treated rats were treated with BTC, BTC- ⁇ 4 or saline and various parameters were measured at 8 weeks. *P ⁇ 0.05 vs the STZ group. **P ⁇ 0.01 vs the STZ group.
• BTC-treated rats glucose tolerance was improved, but the effect of BTC was less than that of BTC- ⁇ 4 (Figure HB) .
• the insulin content and the /3-cell mass were significantly increased in BTC- ⁇ 4-treated rats (Table 1) , and histological analysis of pancreatic tissue on day 4 indicated that BTC- ⁇ 4 significantly increased the number of PDX-1-positive ductal cells and ICCs ( Figure 12, when printed in colour) .
• Epidermal growth factor and betacellulin mediate signal transduction through co-expressed ErbB2 and ErbB3 receptors.
• ErbB-2 is a common auxiliary subunit of NDF and EGF receptors: implications for breast cancer.
• Bohren KM Nadkarni V, Song JH, Gabbay KH, Owerbach D.
• a M55V polymorphism in a novel SUMO gene (SUMO-4) differentially activates heat shock transcription factors and is associated with susceptibility to type I diabetes mellitus.
• Neuregulin-2 a new ligand of ErbB3/ErbB4-receptor tyrosine kinases .
• Neuregulin-4 a novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene 1999 18(17) 2681-9.
• Betacellulin improves glucose metabolism by promoting conversion of intraislet precursor cells to ⁇ -cells in streptozotocin-treated mice. Am J Physiol 285: E577-E583, 2003
• Glial growth factors are alternatively spliced erbB2 ligands expressed in the nervous system. Nature 1993 362:312-8. Marquardt H, Hunkapiller MW, Hood LE, Todaro GJ. Rat transforming growth factor type 1 : structure and relation to epidermal growth factor. Science 1984 223 1079-82.
• Betacellulin and activin A coordinately convert amylase- secreting pancreatic AR42J cells into insulin-secreting cells. J Clin Invest 97: 16647-1654, 1996;
• the oncogenic ErbB-2/ErbB-3 heterodimer is a surrogate receptor of the epidermal growth factor and betacellulin.
• Betacellulm activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulin-beta.
• the epidermal growth factor receptor couples transforming growth factor-alpha, heparin-bmding epidermal growth factor-like factor, and amphiregulm to Neu, ErbB-3, and
• Betacellulm activates the epidermal growth factor receptor and erbB-4, and induces cellular response patterns distinct from those stimulated by epidermal growth factor or neuregulm-beta. Oncogene 1996 12 (2) :345-53.
• An amphicrine pancreatic cell line AR42J cells combine exocrine and neuroendocrine properties. Eur. J. Cell Biol 59: 80-91 Sasada R, Ono Y, Taniyama Y, Shing Y, Folkman J, Igarashi K.
• Epidermal growth factor and a new derivative Rapid isolation procedures and biological and chemical characterization.
• the Arg972 variant in insulin receptor substrate-1 is associated with an increased risk of secondary failure to sulfonylurea in patients with type 2 diabetes Diabetes Care 2004 27(6) :1394-8
• Betacellulin a mitogen from pancreatic beta cell tumors. Science 1993 259 (5101) : 1604-7. Shoyab M, Plowman GD, McDonald VL, Bradley JG, Todaro GJ. Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science. 1989 243(4894 Pt l) :1074-6.
• Epiregulin A novel epidermal growth factor with mitogenic activity for rat primary hepatocytes. J Biol Chem. 1995 270 (13) : 7495-500.
• ErbB2 expression increases the spectrum and potency of ligand-mediated signal transduction through ErbB4.
• PDX-I induces insulin and glucokinase gene expression in BTC clone 6 cells in the presence of betacellulin. Diabetes
• Recombinant betacellulin promotes neogenesis of ⁇ cells and ameliorates glucose intolerance in mice with diabetes induced by selective alloxan perfusion.
• Neuregulin-3 (NRG3) : a novel neural tissue-enriched protein that binds and activates ErbB4. Proc Natl Acad Sci U S A. 1997 94(18) : 9562-7.

Landscapes

• Health & Medical Sciences (AREA)
• Life Sciences & Earth Sciences (AREA)
• Animal Behavior & Ethology (AREA)
• Bioinformatics & Cheminformatics (AREA)
• Public Health (AREA)
• Engineering & Computer Science (AREA)
• Veterinary Medicine (AREA)
• Pharmacology & Pharmacy (AREA)
• Medicinal Chemistry (AREA)
• Diabetes (AREA)
• Chemical & Material Sciences (AREA)
• General Health & Medical Sciences (AREA)
• Gastroenterology & Hepatology (AREA)
• Epidemiology (AREA)
• Proteomics, Peptides & Aminoacids (AREA)
• Zoology (AREA)
• Immunology (AREA)
• Obesity (AREA)
• Emergency Medicine (AREA)
• Hematology (AREA)
• Endocrinology (AREA)
• Chemical Kinetics & Catalysis (AREA)
• General Chemical & Material Sciences (AREA)
• Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
• Organic Chemistry (AREA)
• Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
• Peptides Or Proteins (AREA)

Priority Applications (2)

Applications Claiming Priority (2)

Publications (1)

Family

ID=35786836

Family Applications (1)

Country Status (4)

Cited By (2)

Families Citing this family (5)

Citations (3)

• 2005
  • 2005-08-05 CN CNA2005800324194A patent/CN101090732A/zh active Pending
  • 2005-08-05 WO PCT/AU2005/001180 patent/WO2006012707A1/en active Application Filing
  • 2005-08-05 EP EP05769913A patent/EP1781322A4/en not_active Withdrawn
  • 2005-08-05 JP JP2007524137A patent/JP2008509093A/ja not_active Withdrawn

Patent Citations (3)

Non-Patent Citations (2)

Also Published As

Similar Documents

Legal Events