WO2005107785A2 - Human complement c3 derivates with cobra venom factor-like function - Google Patents
Human complement c3 derivates with cobra venom factor-like function Download PDFInfo
- Publication number
- WO2005107785A2 WO2005107785A2 PCT/US2005/015119 US2005015119W WO2005107785A2 WO 2005107785 A2 WO2005107785 A2 WO 2005107785A2 US 2005015119 W US2005015119 W US 2005015119W WO 2005107785 A2 WO2005107785 A2 WO 2005107785A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- protein
- modified
- cvf
- complement
- human
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
- C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
- C07K14/472—Complement proteins, e.g. anaphylatoxin, C3a, C5a
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P11/00—Drugs for disorders of the respiratory system
- A61P11/06—Antiasthmatics
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P13/00—Drugs for disorders of the urinary system
- A61P13/12—Drugs for disorders of the urinary system of the kidneys
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P17/00—Drugs for dermatological disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/14—Drugs for disorders of the nervous system for treating abnormal movements, e.g. chorea, dyskinesia
- A61P25/16—Anti-Parkinson drugs
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P25/00—Drugs for disorders of the nervous system
- A61P25/28—Drugs for disorders of the nervous system for treating neurodegenerative disorders of the central nervous system, e.g. nootropic agents, cognition enhancers, drugs for treating Alzheimer's disease or other forms of dementia
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P29/00—Non-central analgesic, antipyretic or antiinflammatory agents, e.g. antirheumatic agents; Non-steroidal antiinflammatory drugs [NSAID]
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/04—Antibacterial agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
- A61P37/02—Immunomodulators
- A61P37/06—Immunosuppressants, e.g. drugs for graft rejection
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P9/00—Drugs for disorders of the cardiovascular system
- A61P9/10—Drugs for disorders of the cardiovascular system for treating ischaemic or atherosclerotic diseases, e.g. antianginal drugs, coronary vasodilators, drugs for myocardial infarction, retinopathy, cerebrovascula insufficiency, renal arteriosclerosis
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
- C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
- C07K14/463—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from amphibians
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K19/00—Hybrid peptides, i.e. peptides covalently bound to nucleic acids, or non-covalently bound protein-protein complexes
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2319/00—Fusion polypeptide
Definitions
- Complement C3 having a substitution of a portion of a human C3 protein with a corresponding portion of a Cobra Venom Factor (CVF) protein.
- CVF Cobra Venom Factor
- a portion of the alpha chain of C3 is substituted with the corresponding portion of CVF.
- C3b the activated form of C3, C3b, is a structural subunit of the C3 convertase. This bimolecular enzyme consists of C3b and Bb, the activated form of factor B.
- This enzyme is formed by the binding of C3b to factor B that is subsequently cleaved by factor D, resulting in the formation of the C3 convertase, C3b,Bb, and the release of the activation peptide Ba.
- the C3 convertase activates C3 by cleaving the molecule into C3b and the anaphylatoxin, C3a.
- the C3b molecule will bind to a cell or particle in close proximity to the C3 convertase. Eventually, the bound C3b will allow for the activation of C5 into C5b and the anaphylatoxin, C5a.
- C5 activation occurs by the same C3b,Bb enzyme that can cleave C5 when it is bound to an additional C3b molecule to produce a trimolecular complex composed of (C3b) 2 ,Bb.
- This C5- cleaving trimolecular enzyme is called C5 convertase.
- the enzyme is also called C3/C5 convertase; and only one EC number has been assigned (EC 3.4.21.47).
- Cobra venom contains a structural and functional analog of C3 called cobra venom factor (CVF).
- This molecule can bind factor B in human and mammalian serum to form the complex, CVF,B, which is also cleaved by factor D into the bimolecular enzyme CVF,Bb and Ba.
- the bimolecular complex CVF,Bb is a C3/C5 convertase that activates C3 and C5 analogously to the C3/C5 convertase formed with C3b.
- the two C3/C5 convertases, C3b,Bb and CVF,Bb share the same molecular architecture, the active site-bearing Bb subunit, and the substrate specificity, the two enzymes exhibit significant functional differences.
- CVF,Bb enzyme is physiochemically far more stable than C3b,Bb, it is resistant to inactivation by the regulatory proteins factors H and I, it exhibits different kinetic properties, and it does not require additional C3b for C5 cleavage.
- CVF and mammalian C3 have been shown to exhibit several structural similarities including immunologic cross-reactivity, amino acid composition, circular dichroism spectra, secondary structure, electron microscopic ultrastructure, and amino acid sequence. Nevertheless, significant structural differences exist between the two molecules.
- CVF is a three-chain molecule with an apparent molecular mass of 149 kDa that resembles C3c, one of the physiologic activation products of C3.
- Another significant structural difference between C3 and CVF lies in their glycosylation: CVF has a 7.4% (w/w) carbohydrate content consisting mainly of N-linked complex-type chains with unusual ⁇ -galactosyl residues at the non- reducing termini.
- human and rat C3 exhibit a lower extent of glycosylation with different structures of their oligosaccharide chains.
- CVF,Bb and C3b,Bb are both C3/C5 convertases, they exhibit important differences.
- the CVF-containing enzyme is far more stable than the C3-containing enzyme. Both convertases will spontaneously decay into their two respective subunits.
- the intrinsic half-life (stability) of the CVF-containing convertase is approximately 7 hours at 37 °C, several hundred times longer than the C3-containing enzyme with an intrinsic half-life of approximately 1.5 minutes.
- the CVF-containing enzyme as well as free CVF are not subject to regulation by the complement regulatory proteins factors H and I.
- Some embodiments include one or more modified human complement C3 proteins, which can have a substitution of a portion of a human C3 protein, with a corresponding portion of a Cobra Venom Factor protein of a sequence substantially related thereto.
- the substituted portion of the CVF can be within the alpha chain of C3.
- the substituted portion of the CVF can be a C-terminal portion of the alpha chain of C3.
- the substituted C-terminal portion can include amino acid 1663 of the human C3 protein.
- the substituted C-terminal portion can be an internal portion that does not extend through the entire C-terminus of the human C3 protein.
- the modified protein can have substantially the same number of amino acid residues as an unmodified human C3 protein.
- the substitution can include any positions within amino acid positions 700 - 1663 of the human C3 protein.
- Other embodiments are human complement C3 proteins, which can have a substitution of a portion of a human C3 protein, with a corresponding portion of a Cobra Venom Factor protein of a sequence substantially related thereto and which can have at least two substitutions.
- the substitution has a selected beginning position and a selected last position; in some such embodiments, the beginning position can be, for example, 749, 874, 936, 994, 1264, 1348, 1496, 1504, 1550, and the like; the last position can be, for example, 784, 921, 970 1324, 1550, 1617, 1663, and the like.
- the one or more substitutions can include any of amino acids: 1550-1663, 1504-1663, 1348-1663, 1550-1617, 1504-1617, 1496-1663, 1348-1617, 1496-1617, 1264-1324, 749-784, 874-921, 994-1663, 994-1550 and 936-970.
- the substituted portion of CVF can be within the beta chain of C3. [0010]
- the modified C3 protein can have an affinity for factor
- the resulting convertase can cleave C3 and not C5.
- the convertase can have an intrinsic half-life between about 1.5 minutes and about 7 hours at 37°C.
- the resulting convertase can have an intrinsic half-life of at least about 7 hours at 37°C.
- the modified C3 protein can be expressed as a single chain protein.
- the modified C3 protein can be cleaved into at least two chains in a form that resembles C3.
- the modified C3 protein can be cleaved to release a C3a portion therefrom.
- the modified protein can have an additional 1 to about 19 amino acids at the N-terminus that are not encoded by C3 or CVF.
- the modified protein can include a non-C3 signal peptide, such as a Drosophila Bip signal sequence.
- the modified C3 protein can have modified affinity for factor B and/or factor D.
- the modified protein can show partial or complete resistance to Factor H and/or Factor I.
- the modified C3 protein can be substantially non-immunogenic.
- Other embodiments can include a method for depleting complement by administering a modified C3 protein to a patient in an amount effective for the depletion of complement. In some embodiments, the administration can be local.
- the local administration can be into an organ, subcutaneously, into a cavity, or into a tissue.
- the local administration can employ a targeting function capable of concentrating the modified C3 protein in a desired location.
- the targeting function can include using an antibody conjugated to the modified C3 protein.
- the administration can be a systemic administration, such as intravenous or intraperitoneal.
- Further embodiments can be methods for avoiding or ameliorating reperfusion injury in a patient by delivering a modified C3 protein to the patient, sufficient to deplete complement; and permitting reperfusion in the patient.
- the delivering step can include injecting the modified C3 protein into an artery.
- the delivering step can include a local delivery of the modified C3 protein. In other embodiments, the delivering step can include a systemic delivery of the modified C3 protein. In some embodiments, reperfusion can include opening a blocked artery. In some embodiments, the reperfusion can occur in connection with transplantation of an organ. [0014] Some embodiments can include methods for increasing the efficiency and/or effectiveness of gene therapy by delivering a modified C3 protein in an amount sufficient to deplete complement, providing the gene therapy; and observing an enhanced result therefrom. [0015] Some embodiments can include methods of increasing delivery of a therapeutic or diagnostic agent by delivering a modified C3 protein sufficient to increase blood flow; and providing the therapeutic or diagnostic agent.
- the method can include chemically linking the modified C3 protein to an antibody with an affinity for a specific tissue prior to the delivering step.
- the antibody can be attached to the modified C3 by recombinant DNA technology.
- the antibody can be a monoclonal antibody.
- Some embodiments include methods of treating an autoimmune disease, comprising administering the modified C3 protein sufficient to deplete complement.
- the administration can be episodic and corresponds to periods of at least one elevated disease symptom.
- the autoimmune disease can be any of asthma, systemic lupus erythematosus, glomerulonephritis, rheumatoid arthritis, Alzheimer's disease, multiple sclerosis, myocardial ischemia, reperfusion, sepsis, hyperacute rejection, transplant rejection, cardiopulmonary bypass, myocardial infarction, angioplasty, nephritis, dermatomyositis, pemphigoid, spinal cord injury and Parkinson's disease.
- Some embodiments include methods of mimicking the properties of CVF in a human protein, by, for example, substituting a portion of a human complement C3 protein with the corresponding portion of a Cobra Venom Factor (CVF) protein.
- the portion can be within the alpha chain of C3.
- the portion can be a C- terminal portion of the alpha chain of C3.
- the C-terminal portion can include amino acid 1663 of the human C3 protein.
- the substituted C- terminal portion can be an internal portion that does not extend through the entire C-terminus of the human C3 protein.
- Other embodiments include methods of selecting a modified C3 protein, by characterizing at least one property of the modified C3 protein to form a function profile of the modified protein; and matching the function profile with a disease or condition to be treated.
- at least one property can be selected from the group consisting of: convertase activity, convertase formation, convertase stability, susceptibility to Factor H, susceptibility to Factor I, ability to cleave C3, and ability to cleave C5.
- the selected C3 protein participates in formation of a convertase adapted for treatment of a chronic condition.
- the adaptation can include any of, for example, long plasma half-life, high stability, resistance to Factor H, resistance to Factor I, and the like.
- the convertase can be adapted for treatment of a reperfusion injury.
- the adaptation can be any of, for example, high convertase activity, resistance to Factor H, resistance to Factor I and the like.
- Some embodiments include a nucleic acid sequence encoding a modified C3 protein, and/or a vector including the nucleic acid and/or a host cell containing the vector.
- the host cell can be any of: a Drosophila S2 cell, an Sf9 cell, a CHO cell, a COS-7 cell, a HiFive cell, a yeast cell, a BHK cell, an HEK293 cell, and an E. coli cell.
- a composition that can include the modified human complement C3 protein and a pharmaceutically acceptable carrier and/or the nucleic acid.
- Some embodiments include an expression system expressing the modified
- the expression system include a cell selected from the group consisting of: a Drosophila S2 cell, an Sf9 cell, a CHO cell, a COS-7 cell, a HiFive cell, a yeast cell, a BHK cell, an HEK293 cell, and an E. coli cell.
- FIG. 1 depicts the chain structures of C3 and CVF with shaded portions present in the mature proteins.
- FIG. 2 shows a map of the original CVF/cobra C3 hybrid proteins, showing the region of CVF that was substituted with cobra C3 sequences in each of the five hybrid proteins..
- FIGS. 3A-3G show the cDNA and derived amino acid sequence of CVF1
- FIG. 4 shows results of a complement depletion assay in human serum of the three modified human C3 proteins (HC3-1348, HC3-1504, and HC3-1550) as compared to CVF. [0026] FIG.
- FIG. 5 shows results of an assay to measure the ability of the modified human C3 proteins (HC3-1348, HC3-1504, and HC3-1550) to activate factor B and to form a C3/C5 convertase as compared to CVF and C3b.
- FIG. 6 shows results of an assay to measure the activity of C3/C5 convertase to activate C3 for the three modified human C3 proteins (HC3-1348, HC3-1504, and HC3-1550) as compared to CVF.
- FIG. 7 shows results of an assay to measure C3 cleavage (using 20% of the amount of convertase used in the experiment in Fig.6) of the modified human C3 protein HC3- 1348 as compared to CVF.
- FIG. 8 is a summary of the results for the activity measurements of the three modified human C3 proteins: HC3-1348, HC3-1504, and HC3-1550 as compared to CVF and Human C3b.
- FIG. 9 is a graph showing the results of complement depletion of Natural
- FIG. 10 is a graph showing the results of Cleavage of factor B by C3b
- FIG. 11 is a graph showing the results of C3 cleavage of Natural CVF and a variety of modified human C3 proteins. The inset graph is of the same reaction performed using 20% of the convertase in the main graph.
- FIG. 12 is a graph showing the results of cleavage of selected hybrid proteins by factors H and I.
- FIG. 13 is a picture of a gel showing the results of C5 conversion by Human
- C3 modified human complement C3 proteins
- CVF Cobra Venom Factor protein
- the C3 protein may be the pro-protein (a single chain protein) or the cleaved protein by removal of four arginine residues. An additional two chain form may be formed by the removal of the C3a portion.
- the C3 protein can be manipulated to contain at least one of the following CVF functions: increased ability to form the C3 convertase, increased stability of the C3 convertase, increased resistance to the actions of factors H and/or I, increased activity to cleave C3 and C5, and increased plasma half- life.
- the C-terminal portion of the alpha chain of C3 is substituted with a corresponding portion of a CVF protein.
- a wide variety of specific regions and specific chimerae are disclosed herein.
- a method of identifying and/or selecting a modified C3 protein is disclosed which involves characterizing the properties of the modified C3 protein to form a function profile of the modified protein, and matching the function profile with a disease or condition to be treated.
- the function profile may include one or more of the following functions: ability to form a convertase, susceptibility to H and/or I, the ability to cleave C3, the ability to cleave C5, the relative activity of the convertase, the stability of the convertase, and the plasma half-life.
- the modified C3 protein also referred to as a chimeric C3 protein, a C3/CVF chimera, or a C3/CVF hybrid protein, can be used to treat a variety of diseases and/or conditions that result from local or systemic complement activation.
- the complement system and disease include, but are not limited to: reperfusion injury, autoimmune diseases such as rheumatoid arthritis and lupus, and myasthenia gravis and other diseases that result from antibodies that recognize and direct an immune reaction against proteins or structures of the human body.
- the complement system and disease [0037]
- the complement system is a component of the vertebrate immune system which is involved in maintaining health through its roles in host defense and immune response. However, complement activation is also involved in the pathogenesis of a multitude of diseases. Examples of these diseases include autoimmune hemolytic anemias, rheumatoid arthritis and other immune complex diseases, and reperfusion injuries in which tissue damage occurs after blood flow has been temporarily suspended.
- Examples of reperfusion injuries are tissue damage after the reopening of blocked vessels (e.g. heart attack, stroke) and reperfusion with a recipient's blood after organ transplantation.
- tissue damage after the reopening of blocked vessels (e.g. heart attack, stroke) and reperfusion with a recipient's blood after organ transplantation.
- the complement system Based on the involvement of the complement system in multiple diseases, including diseases of major prevalence, the last decade has seen the development of multiple anti-complementary agents to interfere with the unwanted complement activation process in these disease states. All of these drug development attempts are based on inhibiting the activation of complement.
- Cobra Venom Factor CVF Cobra Venom Factor CVF.
- C3 The third component of complement, plays a pivotal role in both the classical and alternative pathways of complement activation, and many of the physiological C3 activation products have important functions in the immune response and host defense (for review see M ⁇ ller-Eberhard, H.J. (1988) "Molecular Organization and Function of the Complement System," Ann. Rev. Biochem., 57:321-347, herein incorporated by reference in its entirety).
- Human C3 is a two-chain glycoprotein with a molecular weight of approximately 185,000. It is synthesized as single-chain pre-pro-C3 which undergoes subsequent processing by removal of four arginine residues between the ⁇ - and ⁇ -chains.
- the primary sequence of human C3 is known from molecular cloning. Full or partial sequence information of C3 from other mammalian species as well as non-mammalian species is available including mouse, rat, guinea pig, chicken, cobra, Xenopus, and lamprey.
- the human C3 gene is 42 kb in length and includes 41 exons, ranging in size from 52 to 213 bp.
- the major activation product of C3 is C3b.
- C3b plays a central role in the formation of the alternative pathway C3/C5 convertase. The formation of this enzyme requires initial binding of C3b to Factor B.
- the weak complex C3b,B is subsequently cleaved by Factor D in the presence of Mg 2+ , resulting in the enzymatically active C3/C5 convertase C3b,Bb and in release of the activation peptide Ba.
- the C3b,Bb enzyme is very labile, exhibiting spontaneous decay-dissociation into the two subunits C3b and Bb with an intrinsic half life of 1.5 minutes at 37°C.
- the C3b,Bb enzyme is stabilized by properdin.
- the C3/C5 convertase cleaves C3 and C5 by hydrolyzing a single peptide bond in the ⁇ -chains of the two substrates.
- C5 has to be bound to another C3b molecule bound to the convertase.
- the C3b,Bb enzyme is subject to stringent control.
- the enzyme is disassembled by Factor H, and C3b is inactivated by the combined action of factors H and I.
- Factor H Factor I cleaves the ⁇ ' -chain of C3b at two cleavage sites.
- the resulting C3b derivative, called iC3b can no longer form a convertase with Factor B.
- Factor I can cleave the ⁇ '-chain at a third site, which causes the generation of the two C3 fragments C3c and C3dg.
- the C3b receptor, CR1 serves as co-factor.
- An unusual structural property of C3 is the presence of an intramolecular thioester in the ⁇ -chain. Upon activation of C3 to C3b, the thioester becomes highly reactive and is responsible for the covalent attachment of C3b to cellular and other particular targets. The structural change which accompanies cleavage of the thioester allows the subsequent binding of Factor B and its activation.
- iC3 The thioester in C3 undergoes slow spontaneous hydrolysis, resulting in the formation of a form of C3 called iC3 or C3(H 2 0).
- iC3 assumes C3b-like functions and can form a fluid-phase convertase with Factors B and D in serum.
- the resulting convertase iC3,Bb is similarly labile as the C3b,Bb convertase and subject to control by factors H and I.
- C3 is a highly unusual multi-functional protein.
- the protein including its various activation products specifically interacts with approximately twenty different plasma proteins or cell surface receptors. This multifunctionality has spurred significant interest in a detailed structure/function analysis of the molecule.
- Cobra venom contains a structural and functional analog of C3 called cobra venom factor (CVF). Functionally, CVF resembles C3b in that it can bind Factor B in human serum and virtually all vertebrate sera to form a weak complex CVF,B, which is subsequently cleaved by Factor D in the presence of Mg 2+ into the bimolecular enzyme CVF,Bb and Ba.
- CVF cobra venom factor
- CVF,Bb is a C3/C5 convertase that activates C3 and C5 analogously to the C3/C5 convertase formed with C3b.
- CVF is a three-chain glycoprotein with a molecular mass of approximately
- CVF and mammalian C3 have been shown to exhibit several structural similarities including immunological cross-reactivity, amino acid composition, circular dichroism spectra and secondary structure, and electron microscopic ultrastructure.
- Initial N-terminal amino acid sequence comparisons have demonstrated sequence homology with C3 and have led to the suggestion that CVF structurally resembles C3c.
- the structural homology between CVF and C3 and the chain relationships were confirmed by the molecular cloning of CVF, which revealed an overall similarity at the protein level of approximately 70 percent to mammalian C3s and over 90 percent when compared to cobra C3.
- the two molecules and the resulting convertases exhibit important functional differences: 1.
- Both enzymes exhibit spontaneous decay-dissociation into the respective subunits which abolishes the enzymatic activity.
- the C3b,Bb enzyme is very short-lived and decays with an intrinsic half-life of 1.5 minutes at 37°C
- the CVF,Bb enzyme is orders of magnitude more stable, decaying with an intrinsic half-life of approximately seven hours.
- the C3b,Bb enzyme is subject to regulation by factors H and I.
- CVF,Bb and CVF are completely resistant to the regulatory actions of these two proteins.
- the C3b,Bb enzyme generated during complement activation is surface bound.
- the CVF,Bb enzyme is a fluid-phase enzyme (like iC3,Bb). 4.
- C5 convertase activities Another functional difference between C3b,Bb and CVF,Bb lies in the C5 convertase activities.
- C5 In order for C5 to be cleaved by a C5 convertase, it needs to be bound to either C3b or CVF.
- C5 cleavage to occur by the C3b,Bb enzyme C5 has to be bound to a different C3b molecule than the one that is part of the C3b,Bb enzyme.
- C5 is bound by the same CVF molecule that carries the Bb catalytic subunit.
- CVF is a complement inhibitor that acts through a mechanism of exhaustive activation which subsequently leads to depletion. As a matter of fact, CVF is frequently used as the standard to evaluate the anti-complement activity of other drugs.
- CVF exhibits this powerful anti-complement activity
- it is not suitable for human application because of its immunogenicity.
- a number of human C3 derivatives have been produced and/or designed, in which portions of the C3 sequence were replaced with homologous CVF sequences, mainly sequences in the CVF beta chain.
- CVF and C3 have been successfully expressed by recombinant means in eukaryotic expression systems.
- the other line of work involved the limited proteolysis of the CVF protein (Mol. Immunol. 30, Suppl. 1, 113 (1993) U.S. Patent No. 5,174,344, incorporated herein by reference in its entirety).
- the three human C3 derivatives are referred to as HC3-1550, HC3-1504, and HC3-1348.
- the three human C3 derivatives were shown to exhibit the desired CVF activity: all three proteins are able to form an active C3/C5 convertase. This is demonstrated by the ability of the three proteins to support the activation of factor B, and by the ability of the three resulting convertases to cleave C3. All three proteins form stable convertases, although the intrinsic stability and at least one (HC3-1550) exhibits a lower intrinsic stability compared to CVF.
- the human C3 derivative HC3-1550 differs from human C3 in less than 4% of the amino acid residues, which greatly reduces or eliminates its predicted immunogenicity compared to CVF.
- Various C3 hybrids can be preferred, based upon their various characteristics, depending upon the disease to be treated. For example, for the treatment of chronic diseases, the objective is to provide a C3 hybrid having extremely low or no immunogenicity and high convertase stability, facilitating its persistence in the body of the patient suffering from the chronic disease. In such a situation, the other characteristics, such as the activity of the convertase, are of comparatively less importance. In contrast, for treatment to avoid complement-associated reperfusion injury, a high convertase activity is of greater importance than convertase stability.
- the present invention relates to modified complement C3 proteins that exhibit at least one of the following CVF or CVF.Bb qualities: decaying with an intrinsic half-life of longer than 1.5 minutes, increased resistance to the regulatory actions of factors H and/or I, fluid-phase C3 convertase and fluid-phase C5 convertase activity.
- the catalytic efficiency may be reduced relative to C3b,Bb, since the catalytic efficiency is approximately eight-fold greater for C3b,Bb compared to CVF,Bb.
- the catalytic efficiency is not reduced or is elevated in comparison to C3b,Bb. Although many preferred C3 hybrids have little or no immunogenicity, other embodiments, which are nevertheless suitable for many applications, may display detectable to moderate immunogenicity in some cases. [0050] In some embodiments, the intrinsic half-life of the convertase formed with the modified C3 protein is greater than 1.5 minutes, preferably greater than 10 minutes.
- the intrinsic half-life can fall generally between that of the CVF-containing convertase (7 hours or longer) and that of C3 (1.5 minutes), including but not limited to about: 2 minutes, 10 minutes, 20 minutes, 30 minutes, 40 minutes, 50 minutes, 60 minutes, 90 minutes, 2 hours, 2.5 hours, 3 hours, 3.5 hours, 4 hours, 4.5 hours, 5 hours, 5.5 hours, 6 hours, 6.5 hours and 7 hours, or more.
- Modified C3 proteins with short convertase intrinsic half-lives and/or short plasma half-lives will be useful for some applications, while C3 proteins with long convertase intrinsic half-lives and/or long plasma half-lives will be useful for different applications.
- the resistance of the C3 hybrid to factors H and/or I is greater than that for the unmodified C3 and is in some embodiments as good as the resistance of CVF. However, in some embodiments, further modification in other parts of the molecule can be necessary to achieve resistance to factors H and or I.
- substitutions described herein are directed to specific substitutions of one or more discrete regions of C3 with corresponding regions of CVF, other embodiments include substitutions employing a sequence that is substantially related, but not identical, to a CVF sequence.
- the catalytic activity of convertase containing the modified C3 protein is in some embodiments at least 50% that of the convertase containing CVF, and may be greater than that of the convertase containing unmodified C3. In a further embodiment, the catalytic activity is 60%, 70%, 80% 90% or 100% that of the CVF convertase. Both enzymes have been shown to differ somewhat in their kinetics of C3 hydrolysis.
- convertases containing the modified C3 can have a catalytic activity that falls between the two, or that exceeds the activity of the convertase containing unmodified C3.
- activity of the convertase containing the modified C3 can be from 10% to 1000%, or more, that of the convertase containing CVF, including but not limited to 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 110%, 135%, 150%, 200%, 300%, 400%, 500%, 750%, 1000% and more.
- the catalytic efficiency is approximately eight-fold greater for C3b,Bb compared to CVF,Bb when cleaving C3.
- the catalytic efficiency of convertase containing the modified C3 protein is in some embodiments at least 50% that of the convertase containing CVF, and may be greater than that of the convertase containing unmodified C3b. Both enzymes have been shown to differ somewhat in their kinetics of C3 hydrolysis.
- convertases containing the modified C3 can have a catalytic efficiency that falls between the two, or that exceeds the efficiency of the convertase containing unmodified C3.
- such efficiency of the convertase containing the modified C3 can be from 10% to 1000%, or more, that of the convertase containing CVF, including but not limited to 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, and 110%, 135%, 150%, 200%, 300%, 400%, 500%, 750%, 1000% and more.
- the C5 cleaving activity of the modified C3 proteins is increased.
- the C5 cleaving activity can be from about 10% to 400% of the activity of CVF or C3, including but not limited to: 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100%, 150%, 200%, 250%, 300%, 350%, and 375%.
- the binding of the modified C3 proteins to Factor B and/or its subsequent cleavage by factor D may be reduced. However, as long as at least a functional amount of the catalytic activity and the complement depleting activity remain, the modified C3 protein is useful.
- convertases having the modified C3 proteins exhibit substantially the same complement-activating activity of those containing natural CVF.
- the C3 derivatives of the present invention have from 0.1 to 97%, preferably from 50 to 97%, preferable from 80 to 97% of the level of the complement activating activity of natural CVF as measured by the method of Cochran et al. ((1970) J. Immunol. 105(1)), 55-69, herein incorporated by reference in its entirety).
- the modified complement C3 proteins are C3 molecules in which some or all of the C-terminal region has been replaced with the corresponding region of CVF.
- only the C-terminal portion of the alpha chain of C3 is replaced with the corresponding region of CVF.
- amino acids 700-1663 are replaced, including but not limited to regions of from 20 to about 1000 amino acids, including but not limited to: 30, 40, 50, 60, 70, 80, 90, 100, 110, 120, 130, 150, 175, 180, 190, 200, 250, 275, 300, 350, 375, 400, 450, 475, 500, 550, 575, 600, 650, 675, 700, 750, 775, 800, 850, 875, 900, 950 975, 1000.
- the beta chain of C3 is intact, that is, is the same as in natural C3.
- substitutions in the alpha chain of C3 can be made to provide such functions as increased stability (for example, the sites which relate to Factor H binding and Factor I cleavage can be mutated or substituted).
- Specific substitutions include but are not limited to amino acids 1550-1663, 1504-1663, 1348-1663, 1550-1617, 1504-1617, 1470-1663, 1348-1617, 1470-1617, 1264-1324, 1348-1386, 749-784, 874-921, 1496-1663, 1496-1617 and 936-970.
- still smaller substitutions in these areas can correspond to smaller regions that result in a C3 with the desired CVF functions or qualities.
- the modified C3 protein is substantially non- immunogenic.
- substantially non-immunogenic means that the protein can still exhibit complement activating function when injected into a human patient.
- the modified C3 protein may be as non-immunogenic as C3 or may be from about 75% non-immunogenic to about 100% non-immunogenic, including but not limited to 80%, 85%, 90%, 95%, and 99%.
- the modified human complement C3 proteins produced by the methods disclosed herein can be used to deplete complement locally or systemically as follows: [0061] Local treatment may be effected in a number of ways to produce a result of depletion of complement or activation of complement, depending on the desired effect. In one embodiment, local depletion is effected when the modified C3 proteins are administered locally to an organ, tissue, cavity, or intradermally. This results in a temporary and complete depletion of complement in the area. Local depletion or activation may also be effected using an insulin- type pump that produces an intermittent or constant flow of the modified C3 protein to a selected site.
- local activation of complement may employ a specific monoclonal antibody which, when chemically attached to the modified C3, can localize it to a specific tissue, a disease, or an infected cell to cause continuous activation of complement in that area.
- the antibody can be attached to the modified C3 protein via recombinant DNA technology.
- modified human C3 proteins used in each of these cases and in specific disease states can vary considerably. For example, in those cases when an immediate, but temporary removal of complement is desired, a modified protein which has a shorter plasma half-life and/or stability, but high complement activation activity (high C3/C5 convertase activity) would be most suited. In the case where a chronic disease is being treated, a long plasma half-life and/or stability and a low or sluggish activity would be most suitable.
- Convertase activities/functions When producing and analyzing the best use for the modified C3 proteins herein, a number of functions and activities can be used for such an analysis, including but not limited to the following: [0065] Affinity for Factor B - Differences in how efficiently the modified C3 proteins support the activation of factor B (cleavage into Ba and Bb) can be detected and taken advantage of. There are multiple factors beyond just affinity for factor B that go into supporting factor B activation, but once the convertase is formed, the subsequent key properties that are generally most important are stability, regulation by H and I, and activity of cleaving C3 and C5.
- CVF-specific sequences are minimal, modified C3 can exhibit significantly reduced or even absent immunogenicity as compared with CVF.
- a transferase enzyme is produced in cobras that transfers an alpha-bonded galactose to the end of CVF oligosaccharide chains. Because humans do not produce this transferase, the alpha bonded galactose residues are seen as non-self and are highly immunogenic.
- anti- alpha-gal antibodies are produced that recognize the specific CHO moieties produced on CVF.
- Human C3 and CVF lack identity at 52% of their positions, and carbohydrate differences are even more pronounced.
- the C3 hybrids of the invention are significantly less immunogenic.
- the C3 hybrids of the preferred embodiments are significantly less immunogenic than CVF.
- the C3 hybrids of the preferred embodiments are at least 50% less immunogenic than CVF.
- the recombinant proteins are produced in either insect or mammalian cell lines, which will result in carbohydrate moieties that are either simple or very similar to what would be found in humans.
- the human C3 molecules in Table 1 are engineered to contain specific CVF sequences so as to create human C3 derivatives with CVF functions. Some embodiments of the invention provide smaller substitutions in these areas, to define small regions that result in modified C3 proteins that can form a relatively stable convertase and that exhibit little or no immunogenicity.
- modified C3 proteins also called hybrid proteins or chimerae
- site-directed mutagenesis was produced by site-directed mutagenesis as described below. Briefly, for site-directed mutagenesis replacing small portions of human C3 sequence with CVF, the procedure of Ho et al. was used (Ho, S.N., Hunt, H.D., Horton, R.M., Pullen, J.K. and Pease, L.R. (1989) "Site-Directed Mutagenesis by Overlap Extension Using the Polymerase Chain Reaction" Gene, 77:51-59, herein incorporated by reference in its entirety). In this method, two PCR reactions were performed, one with a forward primer somewhere upstream from the site of the desired mutation. The second, reverse primer contained the mutation.
- the second PCR of this round had a forward primer containing the desired mutation, with the reverse primer being downstream from the mutation site. At least one unique restriction site is preferably present in each of the PCR products from this step so that it is possible to transfer the modified DNA back into the original clone. Amplification was done using a large amount of template DNA, and a low number of cycles to minimize mutations introduced by the PCR process. More specifically, the first round of PCR, the reaction for the 5 ' product used a human C3 plasmid as the template, while the other PCR used a CVF plasmid. In this case the middle, "mutagenesis" primers partially consisted of C3 sequences and partially of CVF sequences, providing a "bridge" between the two sequences.
- the two products were purified by gel electrophoresis and isolated from the gel using a Qiaquick Gel extraction kit from Qiagen. Then, the fragments were combined, and another PCR reaction done, using the two fragments as the template, and the outside primers as the amplification primers. Again, the PCR reaction was performed using a high concentration of template DNA and only cycled for a few cycles to minimize PCR-caused mutations. The resulting PCR product was cut with the two unique restriction enzymes, size purified on an agarose gel, and the fragment of interest isolated using the Qiaquick column.
- the fragments were then cut with the appropriate enzymes, and cloned into either pBS-HuC3 or pHC3-1550(-sig) that had been cut with the same enzymes.
- the first hybrid plasmid, pHC3-1550 contained CVF sequences replacing the homologous C3 sequences from position 1550 to the C-terminus of the protein.
- the second hybrid plasmid, pHC3-1504 codes for a hybrid protein containing CVF sequences replacing human C3 sequences from position 1504 to the C-terminus of the protein.
- the third hybrid plasmid, pHC3-1348 contained CVF sequences replacing the homologous C3 sequences from position 1348 to the C terminus of the protein.
- both hybrids had about 19 amino acid vector-coded sequence having some or all of the following RSPWPGVPTSPVWWNSADA (SEQ ID NO:5). Because of the method of cloning of the C3 gene, these amino acids coded for by the cloning vector, were N- terminal to the N-terminus of human C3. These extra amino acids did not affect the activity of the protein, so they could be removed with no ill effect.
- the first plasmid was prepared using pBS-HC3-2 as a template, and using the following oligonucleotides as primers: HC3H5-1 (GGATGCCACTATGTCTATATTGGACATATCC - SEQ ID NO:6), and HC3H5-2 (TCTTCTATTCGAACCAGTCGGGTCTTGTAC - SEQ ID NO:7).
- the second PCR used pCVF-FL3 ⁇ as a template, and the following oligonucleotides as primers: HuC3H5-3 (GTACAAGACCCGACTGGTTCGAATAGAAGAACAAG - SEQ ID NO:8) and HuC3H5-4 (TATCATGTAAGCGGCCGCGTATAAACAATTTAAGGG - SEQ ID NO:9). Both reactions were performed in an Eppendorf thermocycler, using the following program: 95 °C for 5 min., followed by five cycles of 95 °C for 30 sec, 58 °C for 30 sec. (gradient from 50 to 65 °C), and 72 °C for 1 min., followed by 20 cycles of 95 °C for 30 sec, 57.5 °C for 30 sec.
- the PCR fragment was purified as described above, cut with BsrGI and Notl, gel purified, and isolated using a Qiagen Gel Isolation kit. This fragment was cloned into pBS-HuC3-2 that had been cut with the same enzymes, and the resulting clones were screened for insertion of the correct fragment by digestion with EcoRI. All clones with the correct EcoRI digestion pattern were sequenced to ascertain that no PCR-induced mutations were inserted. A large-scale preparation of one clone (pHC3-1550) with the expected sequence was performed, and the insert excised by digestion with HindlEt (and end repaired with T4 DNA polymerase) and Notl.
- the fragment was purified by gel electrophoresis, isolated from the gel as described above, and cloned into the Drosophila expression vector, pMT/V5-HisA that had been cut with EcoRV and Notl. Attempts to obtain expression of hybrid proteins from this construct resulted in very low yields of protein. For this reason, a construct was made having the human C3 signal sequence removed from pHC3-1550, while inserting a new, unique Afel site. To do this, pHC3-1550 was amplified with the following two primers: HC3SigRemF;
- AGATCTCCATGGAAGCTTAGCGCTGGGAGTCCCATGTACTCTATCATC (SEQ ID NO: 10, and HC3SigRemR: GCGTCCCGCCTTCAACAGCC (SEQ ID NO: 11).
- the fragment was purified as described above, cut with Hindlll and Spel.
- the 150 bp band was gel isolated, and cloned into pHC3-1550 that had been cut with the same enzymes.
- DNA from transformants was screened by cutting with Afel, and all positive clones were confirmed by DNA sequencing. This plasmid was called pHC3-1550(-sig).
- the insert was excised from the plasmid by digestion with Afel, Dral (to fragment the plasmid), and Notl.
- the digest was run on a gel, and the 5 kb fragment isolated as described above. It was then ligated into pMT-Bip/V5-HisA that had been digested with EcoRV and Notl. The resulting plasmid was called pMB/HC3-1550.
- the plasmid for the production of the second hybrid protein, HC3-1504 was produced in a similar manner, as follows. Two PCR reactions were performed to obtain the human C3 and CVF portions of the coding sequence.
- pBS-HuC3-2 was used as a template, with the following oligonucleotides used as primers: HC3H5-3- F1(TCTGTGTGGCAGACCCCTTCGAGG - SEQ ID NO: 12) and HC3H5-3-R1 (CGTTACCAATACATATCTTGTTCAGCTTTCCATCC - SEQ ID NO: 13).
- the second PCR used pCVF-FL3 ⁇ as a template, and the following oligonucleotides as primers: HuCC3H5-3-F2 (GGATGGAAAGCTGAACAAGATATGTATTGGTAACG - SEQ ID NO: 14), and HuC3H5-3- R2 (CATCCATGACATAGATATCATTACCATCTTG - SEQ ID NO: 15).
- HuCC3H5-3-F2 GGATGGAAAGCTGAACAAGATATGTATTGGTAACG - SEQ ID NO: 14
- HuC3H5-3- R2 CATCCATGACATAGATATCATTACCATCTTG - SEQ ID NO: 15.
- the product was purified using a Qiagen PCR cleanup kit, it was then cut with NspV, and cloned into pHC3- 1550(-sig) that had been cut with the same enzyme and that had also been treated with Calf intestine alkaline phosphate. Resulting clones were cut with EcoRI to determine the orientation of the insert and sequenced to ascertain that no PCR induced modifications were present. The resulting plasmid was called pHC3-1504. The insert from this plasmid was then isolated as described above, and cloned into pMT-Bip/V5-HisA as described above. This plasmid was called pMB/HC3-1504.
- the plasmid for the production of the third construct, HC3-1348 was constructed in a similar manner to that used for HC3-1504. The only difference is that the two mutation primers were HuC3H5-5-lR (GCAACTGTGCGTTATACATTGTCACCACCGAC - SEQ ID NO: 16) and HuC3H5-5-2F (GTCGGTGGTGACAATGTATAACGCACAGTTGC - SEQ ID NO: 17).
- the primers used were HuC3H5-3-lF and HuC3H5-5-lR, and the template was pBS-HuC3-2, while the primers used for the second primary PCR reaction were HuC3H5-5-2F and HuC3H5-3-2R, using pCVF-FL3 ⁇ as the template.
- the two fragments were purified and used as templates for the secondary PCR reaction as described for the construction of pHC3-1504.
- the secondary PCR reaction product was purified, cut with NspV, and cloned into pHC3-1550, the sequence confirmed and the insert cloned into pMT-Bip V5-HisA) as described above.
- the plasmid for the production of the fourth hybrid protein, HC3-1496 was produced in a similar manner, as follows. Two PCR reactions were performed to obtain the human C3 and CVF portions of the coding sequence. In the first, pBS-HuC3-2 was used as a template, with the following oligonucleotides used as primers: HC3H5-3- F1(TCTGTGTGGCAGACCCCTTCGAGG - SEQ ID NO: 12) and HC3H5-4-R1 GAGAAGGCCTGTTCCTTTATCCGGATGGTAGAACCGGGTAC (SEQ ID NO: 18) and.
- the second PCR used pCVF-FL3 ⁇ as a template, and the following oligonucleotides as primers: HuCC3H5-4-F2 CCGGTTCTACCATCCGGATAAAGGAACAGGCCTTC (SEQ ID NO: 19), ' and HuC3H5-3-R2 (CATCCATGACATAGATATCATTACCATCTTG - SEQ ID NO:20).
- HuCC3H5-4-F2 CCGGTTCTACCATCCGGATAAAGGAACAGGCCTTC (SEQ ID NO: 19)
- ' and HuC3H5-3-R2 CATCCATGACATAGATATCATTACCATCTTG - SEQ ID NO:20.
- the resulting two PCR products were joined in a PCR reaction, using HuC3H5-3-Fl and HuC3H5-3- R2 as primers, and the two PCR fragments as the template.
- the product was purified using a Qiagen PCR cleanup kit.
- pHC3-1550 was amplified, using the following two primers; HuC3H5-Fl GGATGCCACTATGTCTATATTGGACATATCC (SEQ ID NO:21), and HuC3H5-2Rl, CCCGATGATGTAGCTGAGTTTATCTTTCGTGGG (SEQ ID NO:22).
- the second PCR was performed using pCVF-FL3 ⁇ as the template, and HuC3H5-2F2 (CCCACGAAAGATAAACTCAGCTACATCATCGGG - SEQ ID NO:23) and HuC3H5-2-R2 (AATTGGAGCTCCACCGCGGTGG - SEQ ID NO:24) as the primers.
- HuC3H5-Fl and HuC3H5-2-R2 as the primers, and the two PCR fragments as the template.
- the amplified fragment was purified using Qiagen PCR purification columns, cut with BsrGI and Notl, and cloned into pHC3-1550(-sig) that had been cut with the same enzymes.
- the resulting plasmid was sequenced to ascertain the correct sequence. It was called pHC3-1550/1617.
- the insert was isolated as described above and cloned into pMT-Bip/V5-HisA as described above. This plasmid was called pMB/HC3-1550/1617.
- portions of the human C3 are additionally exchanged with
- modified C3 proteins are generated wherein CVF-specific sequence is inserted in more than one region, or known regions are mutagenized by various means.
- CVF-specific sequence is inserted in more than one region, or known regions are mutagenized by various means.
- Factor I-resistant mutants of human C3 have been successfully described previously by Fecke, et al., 1998 (Fecke, W., Farries, T.C., D'Cruz, L.G., Napper, CM., and Harrison, R.A.
- Drosophila Bip signal sequence for secretion of the proteins was transfected into Drosophila S2 cells using the calcium phosphate method of Chen and Okayama (Chen, C, and Okayama, H. (1987) Mol. Cell. Biol. 7(8), 2745-2752, herein incorporated by reference in its entirety). S2 cells were transfected with a mixture of expression plasmid and pCoBlast, using a ratio of 19: 1 (w:w).
- EXAMPLE 3 Results of the activity measurements of the modified human complement C3 proteins [0085] The purified modified human C3 protein hybrids were subjected to a number of functional analyses as follows. Complement depletion: [0086] This assay measures the ability of a protein to deplete complement in human
- the assay was done in two steps. In the first step, the protein of interest was diluted to the desired concentrations in buffer, usually by serial dilution (typically from less than a nanogram/microliter up to approximately 320 ng/microliter or 3.2 ⁇ g in the 10 microliters used in the assay). Then, a 10 ⁇ l aliquot of the diluted protein was mixed with undiluted serum. The mixture was incubated at 37 °C for 3 hours, which allows the protein to activate complement by forming a C3 convertase. The convertases formed were then able to activate C3 in the serum.
- hybrid proteins were less active, requiring about 3-4 ⁇ g of protein to partially deplete 10 ⁇ l of human serum of complement.
- One hybrid protein, HC3-1550/1617 was apparently unable to deplete complement at the concentrations examined. [0088] Unexpected was the observation that two of the proteins (HC3-1550 and
- HC3-1348 were actually able to deplete complement in guinea pig serum, although this activity was clearly less than that of CVF.
- preferred embodiments HC3-1550, HC3-1504, HC3- 1496 and HC3-1348 were all able to deplete complement in human serum.
- Factor B Activation Assay This was an assay to measure the ability of a hybrid protein to activate factor
- HC3-1550 and HC3 1550/1617 were able to convert factor B much more rapidly than CVF, but slower than C3b. This was probably a result of the convertase being less stable than the CVF containing enzyme, but more stable than the C3b containing convertase. In addition, it is likely that the initial binding of factor B by HC3-1550 is much more rapid than by CVF. Finally, HC3-1348 supports the cleavage of factor B less well than the other proteins discussed. This is probably a combination of the resulting convertase being more stable than the C3b containing enzyme, and the initial binding of factor B being less rapid.
- C3 Convertase Activity Assay measures the activity of C3/C5 convertases containing hybrid proteins to activate human C3, by cleaving off the C3a peptide.
- convertases were formed as described above, and the reaction stopped by the addition of EDTA.
- the convertase was then mixed with human C3, and the reaction incubated at 37°C. At the indicated times, aliquots were removed, and the reaction stopped by mixing with gel loading buffer containing SDS and ⁇ -mercaptoethanol. The SDS denatures the proteins, and the ⁇ - mercaptoethanol reduces the disulfide bonds between cysteines in the proteins.
- the reaction products were separated by reducing SDS-PAGE, and the gel was stained with Coomassie Blue dye, and the relative amounts of the C5 ⁇ -chain and C5 ⁇ '-chain quantified as described above. None of the current proteins are able to form an active C5 convertase.
- the assay for degradation of the proteins by factors H and I was performed essentially according to the method of Oran and Isenman ((1999) J. Biol. Chem. 274 (8), 5120- 5130, herein incorporated by reference in its entirety). In this method, 12 ⁇ g of each protein was incubated with 4.3 ⁇ g factor H and 0.3 ⁇ g factor I at 37°C in a total volume of 60 ⁇ l.
- Systemic depletion is effected when the modified C3 proteins are administered systemically, for example, intravenously or intraperitoneally. This results in a temporary and complete depletion of complement systemically.
- This method can be used for reperfusion injury, coronary heart surgery, transplantation and/or systemic disease, particularly during a flare-up of symptoms or during episodical activity.
- modified human C3 proteins used in each of these cases and in specific disease states can vary considerably. For example, in those cases for which an immediate, but temporary depletion of complement is desired, a modified protein having a shorter plasma half-life and/or lower stability, but high complement activation activity is preferred. In treating a chronic disease, a long plasma half-life and/or high stability, even if accompanied by a low or sluggish activity, would be preferred. Further, a modified C3 molecule that does not activate C5 can be particularly advantageous for certain therapies as it prevents the generation of the pro-inflammatory C5a anaphylatoxin.
- EXAMPLE 5 A method for the treatment of reperfusion injury
- reperfusion injuries are tissue damage after the reopening of blocked vessels (e.g. after a heart attack or ischemic stroke), and reperfusion of a transplanted organ with a recipients' blood.
- tissue damage after the reopening of blocked vessels (e.g. after a heart attack or ischemic stroke)
- reperfusion of a transplanted organ with a recipients' blood For a clogged coronary artery or for reperfusion after organ transplantation, it can be desirable in many cases to deplete the complement before the transplant is reperfused or before the opening of the blocked vessel.
- the ability to avoid complement activation can avoid the tissue damage it causes, so the only remaining primary source of tissue damage is oxygen starvation.
- tissue damage due to complement activation during reperfusion is twice as great as tissue damage due to oxygen starvation — that is, roughly 2/3 of tissue damage is attributable to complement activation while 1/3 is attributable to oxygen starvation.
- reperfusion injury can be greatly diminished by depleting complement prior to reperfusion, as is possible with embodiments of the present invention.
- the stability of the convertase is less important than it would be for a chronic disease.
- the methods of these embodiments of the invention involve administering an effective amount of a modified C3 protein systemically allowing enough time for depletion of complement, and then performing the surgery.
- EXAMPLE 6 A method for increasing the effectiveness and/or efficiency of gene therapy [0101] This method relies on the depletion of complement in order to help prolong survival of a useful virus in the body. Because complement has been found to help the removal from the body of certain viral vectors used in gene therapy, it is desirable to reduce the amount of circulating complement prior to administration of a gene therapy vector. This may be done locally or systemically depending upon the type of gene therapy that is being used. [0102] The method involves administering an effective amount of a modified C3 protein systemically or to the local area where the gene therapy is being administered, allowing time for depletion of complement, and then administering the gene therapy.
- EXAMPLE 7 A method for increasing delivery of a therapeutic ( " e.g.
- a modified C3 protein is chemically linked to a monoclonal antibody with an affinity for the tissue of choice.
- the modified C3 is one that forms a highly active C3/C5 convertase.
- the modified C3/antibody is targeted to the tissue, resulting in local complement activation in the region, causing vessel permeability due to complement activation.
- the vessel permeability continues as long as the active convertase/antibody complexes are bound to the target, because new, non-activated complement is continually supplied by the blood arriving at the target.
- a modified C3 protein-monoclonal antibody hybrid is administered to a lung cancer patient, using a monoclonal antibody that recognizes a lung-specific antigen.
- the antibody binds to lung tissue and activates complement locally. This increases the vessel permeability in the lung, permitting the chemotherapeutic agent to more efficiently and effectively act on the lung cancer.
- this method permits continuous local activation of complement, which permits a persistent local elevation in blood-vessel permeability.
- EXAMPLE 8 A method of treating rheumatoid arthritis, lupus, and other autoimmune or immune complex diseases [0105]
- This method uses the example of rheumatoid arthritis as one of several conditions in which pain and inflammation arise from complement activation in a local area.
- a modified C3 protein is administered systemically or locally, diminishing the complement response/activation by depleting the complement. This can reduce the symptoms of the disease and the progression of the disease. It can also be beneficial to have episodical depletion in combination with a longer term lowering of the activity of the complement system, especially when there are episodes of exacerbation of the symptoms of the disease.
- this method can be used with other diseases with circulating immune complexes, such as lupus and other autoimmune diseases.
- diseases such as lupus and other autoimmune diseases.
- a complement-activating autoantibody when produced and is directed against the body's own proteins, the disease effect is primarily due to the binding of the antibody to the target causing complement activation and tissue damage as well as other interference with normal function.
- Myasthenia Gravis is an example of this type of disease.
- Autoantibody binds to the neuromuscular endplate where the nerve comes into contact with the muscle. Complement is activated and blocks the neurotransmitter, resulting in paralysis.
- EXAMPLE 9 Method of selecting a modified C3 protein
- Various modified C3 proteins are useful for different diseases, and methods of treatment. Thus, it is useful to analyze the functional qualities of the modified C3 proteins of embodiments of the invention and to use them accordingly. The following methods are employed to analyze the function of purified modified C3 proteins produced as in Example 2. The methods described herein, as well as others that are known to those of skill in the art, may be used.
- Assays to determine convertase activity In addition to the specific assays as mentioned below, two hemolytic assays for depletion of serum complement activity and induction of bystander lysis can be employed for screening.
- Complement depletion assay To measure the anticomplementary
- complement consumption activity of modified C3 proteins a small volume of human serum is incubated with CVF or hybrid proteins for three hours or shorter periods of time at 37°C at a protein concentration of 5 ⁇ g/ml, to allow the proteins to deplete complement.
- the remaining complement hemolytic activity is subsequently measured using sensitized sheep erythrocytes using methods known to one of skill in the art including that of Cochrane et al., 1970 (Cochrane et al., 1970, J. Immunol 117:630-4, herein incorporated by reference in its entirety).
- Bystander lysis assay The bystander lysis assay is performed by incubating
- a hybrid protein (at 1 ⁇ M) is incubated for up to twenty four hours in the presence of a three-fold molar excess of Factor B and 0.5 ⁇ M of Factor D in the presence of MgCl 2 at 37°C.
- the reaction mixtures are analyzed by electrophoresis on 7.5% (w/v) SDS polyacrylamide gels under non-reducing conditions to monitor the disappearance of Factor B and the appearance of the cleavage products Ba and Bb. If necessary, a subsequent western blot can be performed to detect the Ba and Bb cleavage fragments.
- Controls can include native CVF, pro- CVF, cobra C3, iC3, human C3, iC3, C3b, and EDTA (Vogel and M ⁇ ller-Eberhard, 1982, J. Biol. Chem. 257:8292-9, herein incorporated by reference in its entirety).
- C3 cleaving activity To examine C3 cleaving activity, a C3 convertase is pre-formed as described herein, in reference to "C3 convertase formation/Factor B activation," using the hybrid proteins and human Factor B and Factor D.
- the convertase formation is stopped by the addition of EDTA, and purified human C3 is added
- the reaction mixture is incubated at 37°C for one hour or for any other appropriate period of time. Aliquots are taken and immediately transferred into an ice water bath to stop further C3 activation. C3 cleavage is monitored by the disappearance of the C3 ⁇ -chain and appearance of the C3 ⁇ '-chain by running the reaction products on a 7.5% (w/v) SDS polyacrylamide gel under reducing conditions. If necessary, a subsequent western blot using anti-C3 antiserum is performed. Controls include native CVF, pro- CVF, and human and cobra iC3 or C3b (Vogel and Muller-Eberhard, 1982, J. Biol.
- C5 cleaving assay The C5 cleaving assay is performed as described above for the C3 cleaving assay using purified human C5 as substrate (Petrella et al., 1987, J. Immunol. 164:4742-4751, herein incorporated by reference in its entirety). See, for example, Figure 12.
- Assay for convertase stability Bimolecular convertases are pre-formed using the hybrid proteins and purified human Factor B and Factor D as described above.
- the mixture is incubated at 37°C and aliquots are removed over a period of 24 hours or shorter periods of time if appropriate, and each aliquot is immediately placed in an ice water bath.
- the C3 convertase activity is determined by the C3 cleaving assay described above. From the reduction of the C3 cleaving activity over time, the half-life of the spontaneous decay-dissociation of the various convertases is calculated. If insufficient quantities of hybrid proteins for this assay are available, the enzymatic activity is determined using the fluorogenic tripeptide t-butyloxy-carbonyl-leucyl-glycyl-arginyl-aminomethylcoumarin.
- Factor H binding is determined using an ELISA assay. Hybrid proteins are adsorbed onto microtiter plates. After blocking with ovalbumin and BSA, purified human Factor H at 10 ⁇ g/ml is added and incubated for 30 minutes at room temperature. After washing, bound Factor H is detected with anti-Factor- H antibody followed with an appropriate phosphatase-linked secondary antibody. If factor H can bind to the protein, an appropriate color change is observed.
- Controls can include native CVF, pro-CVF, cobra and human C3, as well as cobra and human iC3 (Alsenz et al., 1992, Dev. Comp. Immunol. 16:63-76, herein incorporated by reference in its entirety).
- Assay for Factor I cleavage. Hybrid proteins are incubated with purified human Factor H and Factor I at 37°C for several hours. The reactions are analyzed by subsequent 4-20% (w/v) SDS polyacrylamide gel electrophoresis under reducing conditions. Factor I activity is determined by the reduction in the strength of the 105 kDa ⁇ '-chain band, and appearance of bands with a molecular weight of 37 and 40 kDa.
- Various methods can be used to analyze immunogenicity, including but not limited to, skin tests, testing the modified C3 protein in transgenic animals which have been genetically engineered to have human immune systems, in vitro methods, including RIA tests using serum generated in such transgenic animals, Radioimmunoprecipitation assays, ELISA assays, Electrochemiluminescence, and Surface Plasmon Resonance.
- mouse, rate or guinea pig analogs of some proteins are constructed, using either mouse, rate or guinea pig C3 and CVF sequences. These are injected into the appropriate animal, and serum is collected and analyzed for the production of antibodies against the hybrid proteins.
- EXAMPLE 10 Method of measuring plasma half-life
- There are many factors that can affect the plasma half-life of the modified C3 protein including but not limited to specific antibodies produced by the immune system, proteases circulating within the serum, non-specific immune responses, and specific regulatory factors such as Factors H and I.
- preferred C3 proteins will persist within human plasma for at least a minimum amount of time.
- This method measures the stability of the modified C3 protein in plasma in three ways.
- the first method measures the stability in serum in vitro. Human serum is isolated and separated from the whole blood of a patient. Aliquots of different concentrations of the modified C3 proteins are added to the serum and allowed to incubate. Aliquots of the serum are removed at various time intervals and the amount of modified C3 that persists is identified in an ELISA assay using a monoclonal antibody which is specific to C3.
- a second method allows for the identification of stability in serum in a humanized animal. The modified C3 protein is administered to the animal and blood samples are taken over time. The amount of modified C3 protein is identified in an ELISA assay using specific antibodies to the protein.
- a third method allows for the identification of stability in a human patient.
- the modified C3 is administered to the patient and blood samples are removed over time.
- the amount of modified C3 protein is identified using an ELISA assay. This will give a clear indication of how long the modified C3 protein circulates within the plasma of a patient.
- the antibody that is used need not be specific for the modified C3.
- antibodies that recognize normal C3 can be tested and used to identify the modified C3 in an ELISA procedure.
- EXAMPLE 11 C3 convertase formation of modified human complement C3 proteins as measured using surface plasmon resonance [0124] Table 2 shows relative binding of complement proteins to C3, CVF, and recombinant human C3/CVF proteins. In all cases, a higher number indicates that the protein interaction is tighter.
- the proteins (C3b, etc.) were bound to a BIACORE CHIPTM, and then contacted with complement factors.
- the amount of each of the complement factors bound to the chip (and thus bound to the modified C3 proteins) was determined by surface plasmon resonance. The results showed that: 1) Neither of the recombinant proteins bound C5, consistent with the inability to form a convertase capable of cleaving C5. 2) Both proteins bound factor H, though CVF does not.
- Factor H is one of the regulatory proteins that is capable of dissociating the C3b,Bb convertase complex and directing a second complement protein, factor I, to inactivate C3b through cleavage.
- Chip C5 Factor H (in EDTA) (with Mg) (with fD and Mg)
- Table 3 shows the stability of the C3 convertases formed by the modified human Complement C3 proteins as measured by surface plasmon resonance on a BIACORE machine at 25° C. The results showed that both proteins were able to form C3 convertases that were substantially more stable than the C3b-containing convertase. The table also shows that the HC3-1348-containing convertase was actually more stable than the CVF-containing enzyme. These results are consistent with other measurements of half life at higher temperatures which showed that CVF had a half life of 7 hours at 37°C and C3b had a half life of 1.5 minutes at 37°C
- Factor B cleavage of modified human complement C3 proteins [0127]
- the factor B cleavage graph in Figure 10 shows a time course of the ability of the modified human complement C3b proteins to mediate the cleavage of factor B in the presence of magnesium ion and factor D. This can be used to measure the ability of the protein to form a C3/C5 convertase.
- FIG. 11 shows the ability of the convertases to cleave C3, and shows a time course of the cleavage reaction.
- the inset is a time course performed with 20% of the convertase used in the main graph.
- the results showed that CVF and HC3-1550 formed convertases that were approximately equally efficient at C3 cleavage, while HC3-1348 and HC3-1496 both formed convertases that were approximately 5 -fold more efficient than CVF at cleaving C3. It is interesting that the HC3-1550/1617-containing convertase appeared to be quite unstable, and did not support C3 cleavage after about 10 minutes.
- EXAMPLE 14 Complement Depletion of modified human complement C3 proteins [0129]
- the data in the complement depletion chart in Figure 9 show that all proteins except HC3-1550/1617 were able to deplete complement, though with very different efficiencies.
- Both HC3-1550 and HC3-1504 were quite inefficient at the depletion of complement, while HC3- 1496 and HC3-1348 were able to deplete complement quite efficiently, though not quite as well as natural or recombinant CVF.
- HC3-1348 was formerly referred to as HC3-1325 in a previous application, but substitution mapping has subsequently shown that the substitution was at 1348 rather than 1325.
- HC3-1496 is an interesting protein because, although it only has an insert 8 amino acids longer than HC3-1504, it acts much more like HC3-1348 with respect to complement depletion and C3 cleavage and more like HC3-1504 with respect to factor B cleavage. It forms a convertase as well as HC3-1504 or CVF, but the resulting convertase is more active at cleaving C3. [0131] HC31550/1617 was made by replacing the region from 1550 to the end of C3 with the CVF region, then taking away the last 46 amino acids and replacing them with C3.
- variants of the modified C3 proteins are produced that have advantageous qualities. By advantageous it is meant that the variants enhance one or more activities of the protein, including but not limited to: C3 convertase activity, serum decomplementation, factor B binding, cleavage of C3, Binding of Bb and Binding of C3.
- the variants can include one or more mutations in each region and can include one or more amino acids.
- mutations are produced in the C-terminus (after aa 1617) of any modified C3 proteins.
- the mutations can be insertions, deletions, and substitutions. However, the mutations are preferably substitutions.
- the mutations stabilize the C3 convertase. Examples of mutations at the C terminus include but are not limited to: mutations at positions 1633, 1654, and 1658. Non- conservative as well as conservative mutations, in addition to amino acid changes that affect the conformation, are included among the embodiments. However, preferably the mutations result in a non-conservative amino acid change. [0134] There are three changes between CVF and human C3 in the span of 1496 and
- mutations between positions 1496 and 1504 of any of the modified C3 proteins are included that result in increased activity of the convertase in cleaving C3 and/or in decomplementing serum.
- the mutations can be changes to one or more amino acids within that region.
- the mutations are substitutions of one or more amino acids in that region, in particular, mutations that result in non-conservative amino acid changes.
- variants are produced in the amino acids from position 1570-1584 that result in an increased activity of the C3 convertase in cleaving C3 for the modified C3 proteins.
- the variants are preferably amino acid substitutions of one or more amino acids in that region.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Biochemistry (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Immunology (AREA)
- Biomedical Technology (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Neurosurgery (AREA)
- Neurology (AREA)
- Gastroenterology & Hepatology (AREA)
- Toxicology (AREA)
- Zoology (AREA)
- Pulmonology (AREA)
- Urology & Nephrology (AREA)
- Psychiatry (AREA)
- Communicable Diseases (AREA)
- Hospice & Palliative Care (AREA)
- Psychology (AREA)
- Cardiology (AREA)
- Vascular Medicine (AREA)
- Heart & Thoracic Surgery (AREA)
- Transplantation (AREA)
- Oncology (AREA)
- Rheumatology (AREA)
- Pain & Pain Management (AREA)
Priority Applications (8)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP05743027A EP1755658A4 (en) | 2004-04-30 | 2005-04-29 | HUMAN COMPLEMENT C3 DERIVATIVES WITH COBRA FACTOR ARTIFICIAL FUNCTION |
| CA002565227A CA2565227A1 (en) | 2004-04-30 | 2005-04-29 | Human complement c3 derivates with cobra venom factor-like function |
| MXPA06012321A MXPA06012321A (es) | 2004-04-30 | 2005-04-29 | Derivados c3 del complemento humano con funcion similar al factor de veneno de cobra. |
| JP2007511077A JP2008502323A (ja) | 2004-04-30 | 2005-04-29 | コブラ毒因子様機能を有するヒト補体c3誘導体 |
| AU2005240096A AU2005240096A1 (en) | 2004-04-30 | 2005-04-29 | Human complement C3 derivates with cobra venom factor-like function |
| US11/579,235 US8632780B2 (en) | 2004-04-30 | 2005-04-29 | Human complement C3 derivates with cobra venom factor-like function |
| IL178905A IL178905A0 (en) | 2004-04-30 | 2006-10-26 | Human complement c3 derivatives with cobra venom factor-like function |
| US11/890,900 US20080234191A1 (en) | 2004-04-30 | 2007-08-07 | Human complement C3 derivates with cobra venom factor-like function |
Applications Claiming Priority (6)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US56706904P | 2004-04-30 | 2004-04-30 | |
| US60/567,069 | 2004-04-30 | ||
| US65324705P | 2005-02-14 | 2005-02-14 | |
| US60/653,247 | 2005-02-14 | ||
| US66735205P | 2005-03-31 | 2005-03-31 | |
| US60/667,352 | 2005-03-31 |
Related Child Applications (2)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| US11/579,235 A-371-Of-International US8632780B2 (en) | 2004-04-30 | 2005-04-29 | Human complement C3 derivates with cobra venom factor-like function |
| US11/890,900 Continuation US20080234191A1 (en) | 2004-04-30 | 2007-08-07 | Human complement C3 derivates with cobra venom factor-like function |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005107785A2 true WO2005107785A2 (en) | 2005-11-17 |
| WO2005107785A3 WO2005107785A3 (en) | 2005-12-15 |
Family
ID=35320733
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/US2005/015119 Ceased WO2005107785A2 (en) | 2004-04-30 | 2005-04-29 | Human complement c3 derivates with cobra venom factor-like function |
Country Status (9)
| Country | Link |
|---|---|
| US (2) | US8632780B2 (https=) |
| EP (1) | EP1755658A4 (https=) |
| JP (1) | JP2008502323A (https=) |
| KR (1) | KR20070036057A (https=) |
| AU (1) | AU2005240096A1 (https=) |
| CA (1) | CA2565227A1 (https=) |
| IL (1) | IL178905A0 (https=) |
| MX (1) | MXPA06012321A (https=) |
| WO (1) | WO2005107785A2 (https=) |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2010056399A1 (en) * | 2008-11-17 | 2010-05-20 | Incode Biopharmaceutics, Inc. | Method and composition for modulating the immune system and various inflammatory conditions comprising complement depletors |
| US8119769B2 (en) | 2003-07-03 | 2012-02-21 | PLS Design, GmbH | Complement depletion using recombinant human C-3 derivatives |
| US8632780B2 (en) | 2004-04-30 | 2014-01-21 | University Of Hawaii | Human complement C3 derivates with cobra venom factor-like function |
| WO2017060891A1 (en) * | 2015-10-07 | 2017-04-13 | Fritzinger David C | Modulators of complement function |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| RU2549468C2 (ru) * | 2013-08-09 | 2015-04-27 | Федеральное государственное бюджетное учреждение "Научно-исследовательский институт нормальной физиологии имени П.К. Анохина" Российской академии медицинских наук (ФГБУ "НИИНФ им. П.К. Анохина" РАМН") | Способ определения стабилизации с3-конвертазы классического пути активации комплемента человека |
| WO2015192101A1 (en) * | 2014-06-12 | 2015-12-17 | University Of Hawaii | Uses of humanized cobra venom factor for reducing or preventing immunogenicity |
| US20190016766A1 (en) * | 2015-10-07 | 2019-01-17 | Daniel E. Benjamin | Use of improved modulators of complement function as cancer therapeutics |
| CN106472359B (zh) * | 2016-10-21 | 2019-07-26 | 新希望六和饲料股份有限公司 | 一种1-3周龄雏鸡用饲料盘 |
| CN106472354B (zh) * | 2016-10-21 | 2019-05-31 | 新希望六和饲料股份有限公司 | 一种成年鸡用饲料盘 |
Family Cites Families (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4661347A (en) * | 1982-11-12 | 1987-04-28 | Scripps Clinic | Cytotoxic compositions |
| EP0695352A4 (en) * | 1993-04-07 | 2000-12-06 | Univ Georgetown Med Center | Dna encoding cobra c3, cvf1, and cvf2 |
| US5714344A (en) * | 1993-04-07 | 1998-02-03 | Georgetown University | Protease-derivatized CVF |
| JPH10505241A (ja) * | 1994-09-08 | 1998-05-26 | イムトラン・リミテッド | 改変タンパク質 |
| US6221657B1 (en) * | 1995-09-08 | 2001-04-24 | Imutran Limited | Modified human C3 DNA sequences and vectors |
| US5922320A (en) * | 1996-06-14 | 1999-07-13 | Georgetown University | Recombinant proCVF |
| US7553931B2 (en) * | 2003-07-03 | 2009-06-30 | Pls-Design Gmbh | Complement depletion using recombinant human C3-derivatives |
| MXPA06012321A (es) | 2004-04-30 | 2007-04-19 | Univ Hawaii | Derivados c3 del complemento humano con funcion similar al factor de veneno de cobra. |
| WO2008060634A2 (en) | 2006-11-15 | 2008-05-22 | University Of Hawaii | Human complement c3 derivatives with cobra venom factor-like function |
-
2005
- 2005-04-29 MX MXPA06012321A patent/MXPA06012321A/es not_active Application Discontinuation
- 2005-04-29 US US11/579,235 patent/US8632780B2/en active Active
- 2005-04-29 AU AU2005240096A patent/AU2005240096A1/en not_active Abandoned
- 2005-04-29 JP JP2007511077A patent/JP2008502323A/ja active Pending
- 2005-04-29 WO PCT/US2005/015119 patent/WO2005107785A2/en not_active Ceased
- 2005-04-29 EP EP05743027A patent/EP1755658A4/en not_active Withdrawn
- 2005-04-29 KR KR1020067025253A patent/KR20070036057A/ko not_active Ceased
- 2005-04-29 CA CA002565227A patent/CA2565227A1/en not_active Abandoned
-
2006
- 2006-10-26 IL IL178905A patent/IL178905A0/en unknown
-
2007
- 2007-08-07 US US11/890,900 patent/US20080234191A1/en not_active Abandoned
Non-Patent Citations (2)
| Title |
|---|
| None |
| See also references of EP1755658A4 |
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8119769B2 (en) | 2003-07-03 | 2012-02-21 | PLS Design, GmbH | Complement depletion using recombinant human C-3 derivatives |
| US8632780B2 (en) | 2004-04-30 | 2014-01-21 | University Of Hawaii | Human complement C3 derivates with cobra venom factor-like function |
| WO2010056399A1 (en) * | 2008-11-17 | 2010-05-20 | Incode Biopharmaceutics, Inc. | Method and composition for modulating the immune system and various inflammatory conditions comprising complement depletors |
| WO2017060891A1 (en) * | 2015-10-07 | 2017-04-13 | Fritzinger David C | Modulators of complement function |
Also Published As
| Publication number | Publication date |
|---|---|
| CA2565227A1 (en) | 2005-11-17 |
| US20080234191A1 (en) | 2008-09-25 |
| JP2008502323A (ja) | 2008-01-31 |
| EP1755658A4 (en) | 2008-11-05 |
| AU2005240096A1 (en) | 2005-11-17 |
| EP1755658A2 (en) | 2007-02-28 |
| US20080311132A1 (en) | 2008-12-18 |
| MXPA06012321A (es) | 2007-04-19 |
| IL178905A0 (en) | 2007-03-08 |
| WO2005107785A3 (en) | 2005-12-15 |
| KR20070036057A (ko) | 2007-04-02 |
| US8632780B2 (en) | 2014-01-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20080234191A1 (en) | Human complement C3 derivates with cobra venom factor-like function | |
| EP1346034B1 (en) | VON WILLEBRAND FACTOR (vWF) CLEAVING PROTEASE POLYPEPTIDE, NUCLEIC ACID ENCODING THE POLYPEPTIDE AND USE OF POLYPEPTIDE | |
| CA2791841C (en) | Chimeric inhibitor molecules of complement activation | |
| JPS63503275A (ja) | ファクター8:cの製造方法 | |
| EP1871801A2 (en) | Blood coagulation fviii analogues | |
| WO2003029401A2 (en) | Peptidoglycan recognition protein encoding nucleic acids and methods of use thereof | |
| US7084253B2 (en) | Protease-activated receptor PAR4 (ZCHEMR2) | |
| KR20110114587A (ko) | 세린 프로테아제 유도체 및 혈액응고 장애의 치료 또는 예방의 용도 | |
| US20100179092A1 (en) | Human complement c3 derivatives with cobra venom factor-like function | |
| JP4855627B2 (ja) | 医薬用途のためのトロンボモジュリン | |
| JP2003313199A (ja) | コラーゲン誘発血小板凝集抑制剤 | |
| EP1088069B1 (en) | Angiostatin-binding protein | |
| JP2001515720A (ja) | β−デフェンシン | |
| JPH08511157A (ja) | Xaファクター阻害活性を有する新規ポリペプチド | |
| US6833437B2 (en) | Complement receptor type 1 (CR1)-like sequences | |
| CN101014362A (zh) | 具眼镜蛇毒因子样功能的人补体c3衍生物 | |
| JPH06502541A (ja) | フォン・ウィルブランド因子の治療断片 | |
| US7122342B1 (en) | Protease-activated receptor PAR4 (ZCHEMR2) | |
| US6908898B1 (en) | Angiogenesis related molecules | |
| US20050244868A1 (en) | Ten-M3 polypeptides and polynucleotides and their methods of use | |
| JP2002508170A (ja) | 哺乳動物カルシトニン様ポリペプチド−1 | |
| WO2001000664A2 (en) | Secreted alpha-helical protein-36 | |
| MXPA00011922A (en) | Angiostatin-binding protein | |
| EP1084247A1 (en) | Disulfide core polypeptides | |
| CA2377788A1 (en) | Methods for modulating angiogenesis by using the anti-angiogenic angiotensin-7 and polynucleotides encoding therefor |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KM KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/012321 Country of ref document: MX Ref document number: 2005240096 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 178905 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2007511077 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2565227 Country of ref document: CA |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Ref document number: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 550972 Country of ref document: NZ |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005743027 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2005240096 Country of ref document: AU Date of ref document: 20050429 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005240096 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 6858/DELNP/2006 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2006142330 Country of ref document: RU Ref document number: 1020067025253 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580022128.7 Country of ref document: CN |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005743027 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020067025253 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 11579235 Country of ref document: US |