WO2005090569A1 - Cancer et acides nucleiques et proteines de testicule vsm1 et vsm2, et leurs utilisations - Google Patents

Cancer et acides nucleiques et proteines de testicule vsm1 et vsm2, et leurs utilisations Download PDF

Info

Publication number
WO2005090569A1
WO2005090569A1 PCT/AU2005/000437 AU2005000437W WO2005090569A1 WO 2005090569 A1 WO2005090569 A1 WO 2005090569A1 AU 2005000437 W AU2005000437 W AU 2005000437W WO 2005090569 A1 WO2005090569 A1 WO 2005090569A1
Authority
WO
WIPO (PCT)
Prior art keywords
seq
cancer
protein
fragment
hvsm2
Prior art date
Application number
PCT/AU2005/000437
Other languages
English (en)
Inventor
V. Nathan Subramaniam
Original Assignee
The Council Of The Queensland Institute Of Medical Research
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Priority claimed from AU2004901544A external-priority patent/AU2004901544A0/en
Application filed by The Council Of The Queensland Institute Of Medical Research filed Critical The Council Of The Queensland Institute Of Medical Research
Publication of WO2005090569A1 publication Critical patent/WO2005090569A1/fr

Links

Classifications

    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K39/0005—Vertebrate antigens
    • A61K39/0011—Cancer antigens
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
    • G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
    • G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
    • G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
    • G01N33/574—Immunoassay; Biospecific binding assay; Materials therefor for cancer
    • G01N33/57484—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites
    • G01N33/57488—Immunoassay; Biospecific binding assay; Materials therefor for cancer involving compounds serving as markers for tumor, cancer, neoplasia, e.g. cellular determinants, receptors, heat shock/stress proteins, A-protein, oligosaccharides, metabolites involving compounds identifable in body fluids
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/46—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates
    • C07K14/47—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals
    • C07K14/4701—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans from vertebrates from mammals not used
    • C07K14/4702—Regulators; Modulating activity
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3023—Lung
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K16/00—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies
    • C07K16/18—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans
    • C07K16/28—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
    • C07K16/30—Immunoglobulins [IGs], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
    • C07K16/3069—Reproductive system, e.g. ovaria, uterus, testes, prostate
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q1/00—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions
    • C12Q1/68—Measuring or testing processes involving enzymes, nucleic acids or microorganisms; Compositions therefor; Processes of preparing such compositions involving nucleic acids
    • C12Q1/6876—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes
    • C12Q1/6883—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material
    • C12Q1/6886—Nucleic acid products used in the analysis of nucleic acids, e.g. primers or probes for diseases caused by alterations of genetic material for cancer
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K39/00—Medicinal preparations containing antigens or antibodies
    • A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/136—Screening for pharmacological compounds
    • C—CHEMISTRY; METALLURGY
    • C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
    • C12Q—MEASURING OR TESTING PROCESSES INVOLVING ENZYMES, NUCLEIC ACIDS OR MICROORGANISMS; COMPOSITIONS OR TEST PAPERS THEREFOR; PROCESSES OF PREPARING SUCH COMPOSITIONS; CONDITION-RESPONSIVE CONTROL IN MICROBIOLOGICAL OR ENZYMOLOGICAL PROCESSES
    • C12Q2600/00—Oligonucleotides characterized by their use
    • C12Q2600/154—Methylation markers
    • G—PHYSICS
    • G01—MEASURING; TESTING
    • G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
    • G01N2500/00—Screening for compounds of potential therapeutic value

Definitions

  • nucleic acids and proteins for use in diagnosis, treatment and/or prevention of cancer and/or reproductive abnormalities.
  • the invention relates to use of nucleic acids and proteins encoding VSM1 and/or VSM2, preferably hVSMl and/or hVSM2, and antibodies capable of binding said proteins.
  • BACKGROUND OF THE INVENTION SNAREs soluble N-ethylmaleimide-sensitive factor attachment protein receptors
  • these proteins are responsible for forming the complexes that link opposing membrane domains (see references 1 -4 for recent reviews).
  • Vsm1 (v-SNARE Master 1 , YER143w) is a yeast protein implicated in regulating protein trafficking to the vacuole (5) and is postulated to function as a negative regulator of exocytosis though its interaction with v- SNAREs (vesicle SNAREs).
  • Overexpression of Vsm1 in yeast results in an accumulation of secretory vesicles and a decrease in the growth rate of cells and a slight decrease in secretory activity. Alternatively, deletion of the gene results in increased secretion of proteins.
  • Membrane fractionation and immunofluorescence studies suggested that Vsm1 is associated with the plasma membrane. Western blot of endogenous protein detects a doublet of 52/54 kDa.
  • Vsm1 binds tightly to the v-SNARE Snc2 and less tightly to Snd as determined using co-immunoprecipitation experiments. Recent studies have shown that Vsm1 may modulate the ability of Sso t-SNAREs (target SNAREs) to enter into viable SNARE complexes (6).
  • Vsm1 is identical to Ddi1 (DNA damage-inducible 1), a yeast protein induced upon DNA damage. Ddi1 is a protein expressed when S. cerevisiae are exposed to DNA damaging agents such as high temperature and hydroxyurea (7). In yeast, Ddi1 interacts with Rad23 to prevent the passage of cells from S to G1 phase of cell cycle until the damaged DNA is repaired.
  • Yeast and mammalian homologues of Rad23 comprise two UBA (ubiquitin-associated) domains, one internal and one at the carboxyl terminus.
  • Ddi1 comprises a single UBA domain at its carboxyl terminus (8).
  • UBA domains are capable of binding ubiquitin and polyubiquitin chains (9).
  • the UBA domains are also required for the Rad23/Ddi1 heterodimerization (8).
  • Both proteins also have a UBL (ubiquitin- like domain) at the amino terminus.
  • the UBL domain of Rad23 is essential for its nucleotide-excision-repair function and also binding to the proteasome (9, 10).
  • DDI1 is located upstream of MAG1, a 3-methyladenine DNA glycosylase, which functions to protect cells from killing by methylmethanesulfonate (MMS)-induced DNA replication blocks.
  • MMS methylmethanesulfonate
  • the upstream activation sequence oiMAGI lies within the protein-coding region of DDI1 (11).
  • VSM1 and VSM2 are expressed in other organisms, including for example, macaque, mouse, rat, Xenopus, C. elegans, Drosophila, Anopheles, Arabidopsis thaliana, Plasmodium, Leishmania and Neurospora. Information in relation to cellular and tissue expression patterns and role of VSM1 and VSM2 were previously unknown until the present invention. Accordingly, there were no known uses of these proteins and nucleic acids. The inventors have discovered that mammalian VSM1 is highly expressed in the testis and specifically in the Sertoli cells and that VSM2 is also expressed, but at a lower level. High level of expression was also detected in several tumour cell lines and in cancer tissue biopsy samples.
  • the invention provides a method for detecting a presence or absence of an anti-VSM antibody in an isolated biological sample including the steps of:- (a) combining a VSM protein, homolog, variant or fragment thereof with the isolated biological sample; and (b) detecting presence or absence of an antibody bound to the VSM protein, homolog, variant or fragment thereof.
  • the VSM protein, homolog, variant or fragment thereof comprises hVSMl or hVSM2. More preferably, the hVSMl protein comprises an amino acid sequence as set forth in SEQ ID NO: 1.
  • the hVSMl protein fragment comprises an amino acid sequence selected from the group consisting of GQQQQRTPAAQRSQGLAS (SEQ ID NO: 7), VYCVRRDLS (SEQ ID NO:8) and VTFSLQ (SEQ ID NO: 9).
  • the hVSMl protein fragment consists of an amino acid sequence selected from the group consisting of GQQQQRTPAAQRSQGLAS (SEQ ID NO: 7), VYCVRRDLS (SEQ ID NO: 8) and VTFSLQ (SEQ ID NO: 9).
  • the hVSM2 protein comprises an amino acid sequence as set forth in SEQ ID NO: 3.
  • the hVSM2 protein fragment comprises an amino acid sequence selected from the group consisting of AEDAGIWDGQTLQYLLLMGKPGKCGLQKG (SEQ ID NO: 6), VYCVRRDLS (SEQ ID NO: 8) and VTFSLQ (SEQ ID NO: 9).
  • the hVSM2 protein fragment consists of an amino acid sequence selected from the group consisting of AEDAGIWDGQTLQYLLLMGKPGKCGLQKG (SEQ ID NO: 6) VYCVRRDLS (SEQ ID NO: 8) and VTFSLQ (SEQ ID NO: 9).
  • the anti-VSM antibody preferably comprises an antibody capable of binding to hVSMl , hVSM2, or fragment thereof.
  • the biological sample is isolated from solid tissue, blood, plasma, serum, extract, fluid or secretion of an animal.
  • an amount of the detected binding in step (b) is compared with a reference amount.
  • the reference amount is determined according to an amount of antibody bound to VSM protein, homolog, variant or fragment thereof in a normal sample.
  • An amount of the detected binding compared to the reference amount preferably is indicative of a disorder in the animal.
  • a greater amount of the detected binding compared to the reference amount preferably is indicative of a disorder in the animal.
  • the disorder comprises cancer.
  • the cancer is selected from the group consisting of lung cancer, colon cancer, rectal cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bone cancer, cervical cancer, skin cancer, breast cancer and other known cancers.
  • the animal is a mammal.
  • the mammal is human.
  • the invention provides a method for detecting a presence or absence of a VSM protein, variant, homolog or fragment thereof in an isolated biological sample including the steps of:- (a') combining an antibody and/or antibody fragment capable of binding to the VSM protein, variant, homolog or fragment thereof with the biological sample; and (b') detecting presence or absence of the VSM protein, variant, homolog or fragment thereof bound to the antibody and/or antibody fragment.
  • the anti-VSM antibody and/or antibody fragment comprises a polyclonal antibody or monoclonal antibody. More preferably, the anti-VSM antibody and/or antibody fragment comprises a monoclonal antibody.
  • the antibody is capable of binding to hVSMl and/or hVSM2.
  • the VSM protein, homolog, variant or fragment thereof comprises hVSMl or hVSM2.
  • the hVSMl protein comprises an amino acid sequence as set forth in SEQ ID NO: 1.
  • the hVSM2 protein comprises an amino acid sequence as set forth in SEQ ID NO: 3.
  • the biological sample is isolated from tissue, plasma, serum, cell, cell line, extract, fluid or secretion of an animal. More preferably, the tissue is selected from the group consisting of testis, lung, colon, rectum, stomach, liver, bone, cervix, skin, breast and blood.
  • the cell comprises a tumor cell.
  • an amount of the detected binding in step (b') is compared with a reference amount.
  • the reference amount is determined according to an amount of the antibody and/or antibody fragment bound to hVSMl and/or hVSM2 protein, or respective variant, homolog or fragment thereof in a normal sample.
  • a difference between the amount of the detected binding in step (b') and the reference amount preferably indicates presence of a disorder in the animal.
  • a greater value of the detected amount of binding compared with the reference amount preferably is indicative of a disorder in the animal.
  • the disorder preferably comprises cancer.
  • the cancer is selected from the group consisting of testicular cancer, lung cancer, colon cancer, rectal cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bone cancer, cervical cancer, skin cancer, breast cancer and other known cancers.
  • the disorder comprises a reproductive
  • the amount of the detected binding is binding of hVSMl protein, variant, homolog or fragment thereof in the sample.
  • the amount of the detected binding of the hVSMl protein, variant, homolog or fragment thereof is less than the reference amount.
  • the value of the detected binding is binding of hVSM2 protein, variant, homolog or fragment thereof in the sample.
  • the amount of the detected binding of the hVSM2 protein, variant, homolog or fragment thereof is greater than the reference amount.
  • the sample comprises testis. More preferably, the sample comprises a Sertoli cell.
  • the animal is a mammal. More preferably, the mammal is human.
  • the disorder is selected from the group consisting of idiopathic oligozoospermia, Sertoli cell tumours and Carney's complex.
  • the invention provides a method for detecting a presence or absence of a hVSM nucleic acid, fragment or homolog thereof in an isolated biological sample including the step of: (i) isolating the biological sample; and (ii) detecting presence or absence of the hVSM nucleic acid, fragment or homolog thereof in said isolated biological sample.
  • the hVSM nucleic acid, fragment or homolog thereof comprises hVSMl or hVSM2.
  • the nucleic acid comprises RNA and/or DNA.
  • the DNA comprises under methylated genomic DNA.
  • the RNA is detected by methods including Northern blot analysis, PCR, RT-PCR, real time RT-PCR, in situ hybridisation or microarray analysis.
  • RNA is detected by use of one or more nucleic acid primers capable of hybridizing to hVSMl and/or hVSM2.
  • the nucleic acid primer comprises a nucleotide sequence selected from the group consisting of: 5' CGATATCGTGGTTTTACTGCA 3' (SEQ ID NO: 11 ); 5' CTGTCCAGGGTGCTGTG 3' (SEQ ID NO: 12); 5' CTGGACATGCTTAAACGGCA 3' (SEQ ID NO: 13); 5' TACCCATCAATAACAAGTATTGAA 3' (SEQ ID NO: 14); 5' CCGGGATCCCAAGTGACGATGCTC 3' (SEQ ID NO: 15); 5' GGCTCGAGTTAATGCTCTTTTCGT 3' (SEQ ID NO: 16); 5' TTT CAC TGG GTC TGG GTC G 3' (SEQ ID NO: 17); 5' CGT TGA TGA TGG TGA TAA TGG T 3' (SEQ ID NO: 18); 5' TAC GGC CAG AGG AAA TTG CA 3' (SEQ ID NO: 19); and 5' ACT CCA GCT GCA G
  • the biological sample is isolated from tissue, plasma, serum, cell, cell line, extract, fluid or secretion of an animal. More preferably, the tissue is selected from the group consisting of testis, lung, colon, rectum, stomach, liver, bone, cervix, skin, breast, blood and other tissues.
  • the cell comprises a tumor cell.
  • an amount of the detected hVSM nucleic acid, fragment or homolog in said sample in step (ii) is compared with a reference amount. The reference amount preferably is determined according to a detected amount of hVSMI and/or hVSM2 nucleic acid, fragment or homolog in a normal sample.
  • a difference between the amount of the detected hVSM nucleic acid, fragment or homolog of step (ii) and the reference amount indicates presence of a disorder in the animal.
  • a greater value of the detected amount of hVSM nucleic acid of step (ii) compared with the reference amount is indicative of a disorder in the animal.
  • the disorder comprises cancer. More preferably, the cancer is selected from the group consisting of testicular cancer, lung cancer, colon cancer, rectal cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bone cancer, cervical cancer, skin cancer, breast cancer and other known
  • the disorder comprises a reproductive disorder.
  • the detected hVSM nucleic acid, fragment or homolog thereof of step (ii) is hVSMI . More preferably, the amount of the detected hVSMI is less than the reference amount. In another preferred form, the detected hVSM nucleic acid, fragment or homolog thereof of step (ii) is hVSM2. More preferably, the amount of the detected hVSM2 is greater than the reference amount.
  • the sample comprises testis. More preferably, the sample comprises a Sertoli cell.
  • the animal is a mammal. More preferably, the mammal is human.
  • the disorder is selected from the group consisting of idiopathic oligozoospermia, Sertoli cell tumours and Carney's complex.
  • the invention provides a pharmaceutical composition comprising an isolated hVSMI and/or hVSM2 nucleic acid, fragment, homolog, derivative or variant thereof in combination with a pharmaceutically acceptable carrier or diluent.
  • the invention provides a pharmaceutical composition comprising an isolated hVSMI and/or hVSM2 protein, fragment, homolog, derivative or variant thereof in combination with a pharmaceutically acceptable carrier or diluent.
  • the pharmaceutical composition comprises an immunotherapeutic composition. More preferably, the immunotherapeutic composition comprises a vaccine.
  • the invention provides a pharmaceutical composition comprising an anti-hVSM1 and/or anti-hVSM2 antibody or fragment thereof in combination with a pharmaceutically acceptable carrier or diluent.
  • the anti-hVSM1 antibody or fragment thereof specifically binds hVSMI protein.
  • the anti-hVSM2 antibody or fragment thereof specifically binds VSM2 protein.
  • the respective anti-hVSM1 and/or anti-hVSM2 antibodies or fragments thereof are capable of binding to both hVSMI and hVSM2 proteins.
  • the antibody or antibody fragment comprises a monoclonal antibody. More preferably, the monoclonal antibody comprises a humanized antibody.
  • the humanized antibody comprises a radioactive isotope or toxin.
  • the radioactive isotope is selected from the group consisting of terbium-149, bismuth-213 and actinium-225.
  • the toxin comprises pseudomonas exotoxin A and
  • the invention provides a method for preventing, ameliorating or treating a mammal of a disorder, including the step of administering a pharmaceutically effective amount of a pharmaceutical composition of any one of the above aspects to said mammal.
  • the disorder comprises cancer.
  • the cancer is selected from the group consisting of lung cancer, colon cancer, rectal cancer, colorectal cancer, stomach cancer, liver cancer, pancreatic cancer, bone cancer, cervical cancer, skin cancer, breast cancer and other known cancers
  • the mammal is human.
  • the invention provides a method for screening an active as a potential cancer therapeutic including the steps of: (1 ) administering the active to the organism; and (2) determining modulation of expression of VSM1 and/or VSM2 antibody, protein and/or nucleic acid in the organism after step (1 ); wherein modulation in expression level of VSM1 and/orhVSM2 antibody, protein and/or nucleic acid is an indication that the active is efficacious.
  • a decrease in expression level of VSM1 and/or VSM2 antibody, protein and/or nucleic acid in the organism after step (1) is an indication that the active is efficacious.
  • the active comprises a component of the pharmaceutical composition of any one of the above aspects.
  • the organism comprises an animal, tissue, cell or part thereof.
  • the organism comprises a primate, rat or mouse.
  • the cell comprises a cell line.
  • the cell line is selected from the groups consisting of SK Hep1 , HuTU ⁇ O, Huh7, LMTK, NIH3T3 and C1C12.
  • the invention provides an isolated peptide consisting essentially of an amino acid sequence selected from the group consisting of: AEDAGIWDGQTLQYLLLMGKPGKCGLQKG (SEQ ID NO: 6); GQQQQRTPAAQRSQGLAS (SEQ ID NO: 7); VYCVRRDLS (SEQ ID NO: 8); and VTFSLQ (SEQ ID NO: 9).
  • the isolated peptide comprises at least 6 additional amino acids at either or both carboxyl and/or amino terminal ends, more preferably at least 5, 4, 3, 2 or 1 amino acids.
  • the invention provides an isolated peptide consisting of an amino acid sequence selected from the group consisting of: AEDAGIWDGQTLQYLLLMGKPGKCGLQKG (SEQ ID NO: 6); GQQQQRTPAAQRSQGLAS (SEQ ID NO: 7); VYCVRRDLS (SEQ ID NO: 8); and VTFSLQ (SEQ ID NO: 9).
  • the invention provides an isolated nucleic acid consisting essentially of a nucleotide sequence selected from the group consisting of: 5' CGATATCGTGGTTTTACTGCA 3' (SEQ ID NO: 11); 5' CTGTCCAGGGTGCTGTG 3' (SEQ ID NO: 12); 5' CTGGACATGCTTAAACGGCA 3' (SEQ ID NO: 13); 5' TACCCATCAATAACAAGTATTGAA 3' (SEQ ID NO: 14); 5' CCGGGATCCCAAGTGACGATGCTC 3' (SEQ ID NO: 15); 5 - GGCTCGAGTTAATGCTCTTTTCGT 3' (SEQ ID NO: 16); 5' TTT CAC TGG GTC TGG GTC G 3' (SEQ ID NO: 17); 5' CGT TGA TGA TGG TAA TGG T 3' (SEQ ID NO: 18); 5' TAC GGC CAG AGG AAA TTG CA 3' (SEQ ID NO: 19); and 5'
  • the isolated nucleic acid comprises at least 10 additional nucleotides at either or both 5' and/or 3' terminal ends, more preferably at least 9, 8, 7, 6, 5, 4, 3, 2 or 1 nucleotides.
  • the invention provides an isolated nucleic acid consisting of a nucleotide sequence selected from the group consisting of: 5' CGATATCGTGGTTTTACTGCA 3' (SEQ ID NO: 11); 5' CTGTCCAGGGTGCTGTG 3' (SEQ ID NO: 12); 5' CTGGACATGCTTAAACGGCA 3' (SEQ ID NO: 13); 5' TACCCATCAATAACAAGTATTGAA 3' (SEQ ID NO: 14) 5' CCGGGATCCCAAGTGACGATGCTC 3' (SEQ ID NO: 15) 5 - GGCTCGAGTTAATGCTCTTTTCGT 3' (SEQ ID NO: 16) 5' TTT CAC TGG GTC TGG GTC G 3' (SEQ ID NO: 11)
  • the invention contemplates recombinant hVSM1/2 nucleic acids, including genetic constructs, expression vectors for expressing recombinant hVSM1/2 nucleic acids, proteins and fragments thereof.
  • Expression vectors may be suitable for expression in prokaryotic and/or eukaryotic organisms.
  • HVSM1/2 nucleic acids include both RNA and DNA.
  • Such expression vectors in one form express antisense nucleic acids in a host.
  • the host is human.
  • recombinantly expressed nucleic acids, proteins and fragments thereof are also contemplated.
  • the word "comprise”, and variations such as “comprises” or “comprising”, will be understood to imply the inclusion of the stated integers or group of integers or steps but not the exclusion of any other integer or group of integers.
  • a nucleic acid or protein comprising an indicated sequence may include any number of additional residues at either or both ends of said nucleic acid or protein.
  • FIG. 1A shows a deduced amino acid sequence of homo sapiens hVSMI (SEQ ID NO: 1);
  • FIG. 2A shows a deduced amino acid sequence of homo sapiens hVSM2 (SEQ ID NO: 3);
  • FIG.2B shows a nucleotide sequence of homo sapiens hVSM2
  • FIG. 4 shows an amino acid sequence alignment of hVSMI (SEQ ID NO: 1 ), hVSM2 (SEQ ID NO: 3) and yeast ScVSMI (SEQ ID NO: 5) VSM proteins;
  • FIG. 4 shows a schematic diagram depicting the structural similarities between yeast and hVSMI and hVSM2 proteins. A similar domain structure is present in the mouse ortholog (not shown);
  • FIG. 4 shows a schematic diagram depicting the structural similarities between yeast and hVSMI and hVSM2 proteins. A similar domain structure is present in the mouse ortholog (not shown); FIG.
  • FIG. 5A shows a Northern Blot analysis for hVSMI in human tissues showing that hVSMI mRNA transcript expression is restricted to testis (indicated with an arrow), hVSMI was detected using a hVSM1-RPA domain specific probe; lane 1 is brain, lane 2 is heart, lane 3 is lung, lane 4 is liver, lane 5 is spleen, lane 6 is kidney, lane 7 is small intestine, lane 8 is testis, lane 9 is ovary, lane 10 is uterus, lane 11 is breast, lane 12 is placenta; FIG. 5B shows Northern hybridization using a GAPDH probe for a loading control; FIG.
  • FIG. 6A shows a Western blot of mouse tissue homogenates using an anti-hVSM1 antibody; lane 1 is molecular marker, lane 2 is brain, lane 3 is eye, lane 4 is gut lane 5 is heart, lane 6 is kidney, lane 7 is liver, lane 8 is lung, lane 9 is pancreas, lane 10 is skeletal muscle, lane 11 is spleen, and lane 12 is testis; FIG. 6B shows a Coomassie stain of a gel as in FIG. 6A to identify a total amount of protein loaded on the SDS PAGE; FIG.
  • FIG. 7 shows in panels (A, B) human, (C, D) rat and (E, F) mouse (E,F) testis sections by indirect immunofluorescence and confocal microscopy using antibodies against hVSMI (A,C,E) and rabbit IgG (B,D,F);
  • FIG. 8 shows immunofluorescence and confocal microscopy analysis of rat primary culture Sertoli cells using antibodies against hVSMI and transferrin receptor 1 , cells were either: (A, B, C) untreated (C) ortreated with: (D, E, F) Brefeldin A (BFA), (G, H, I) chloroquine (Chi), or (J, K. L)
  • FIG. 9 shows analysis of hVSMI in transfected cells, hVSMI was cloned into mammalian expression vectors and expressed in HEK-293 cells either as a (A) GFP-fusion protein, (B) an N-terminal or (C) a C-terminal myc epitope tagged fusion protein; FIG.
  • 10A shows Western blotting analysis of mouse cell lines using an anti-hVSM1 antibody; lane 1 is molecular weight marker, lane 2 is GCT, lane 3 is Tera2, lane 4 is HEK293, lane 5 is LoVo, lane 6 is Hutu ⁇ O, lane 7 is HepG2, lane 8 is Huh7, lane 9 is SK Hep1 , lane 10 is U20S, lane
  • FIG. 11 is Hela
  • lane 12 is MCF7
  • lane 13 is MCF10a
  • FIG. 10B shows Western blotting analysis of human cell lines using an anti-hVSM1 antibody
  • lane 1 is molecular weight marker
  • lane 2 is TM3
  • lane 3 is TM4
  • lane 4 is RAW264.7
  • lane 5 is LMTK
  • lane 6 is NIH3T3
  • lane 7 is C2C12
  • lane 8 is AML12
  • lane 9 is Hepa1-6
  • FIG. 11 shows immunofluorescence analysis of human and mouse cell lines using an anti-hVSM1 antibody; human A549, A431 , SK Hep1 , 292 and mouse cell lines C2C12, TM4, RAW 264.7 are shown, hVsml localisation is determined relative to c/ ' s-Golgi using a GS28 antibody,
  • the scale is 20 ⁇ m, an example of an aggresome showing the large
  • FIG. 12 shows expression of hVSM in human lung cancer sections: (A-D) adenocarcinoma and (E, F) squamous cell carcinoma using immunofluorescence and confocal microscopy using antibodies that bind hVSMI (A,C,E) or rabbit IgG (B.D.F); FIG.
  • FIG. 13 shows co-localisation of hVsml and ubiquitin with ALLN treatment in SK Hep1 , SKHepl were transiently transfected with either ubiquitin wildtype or ubiquitin mutant, the transfected cells were then either treated with ALLN or the negative control DMSO, confocal images showing overlay are displayed as follows: endogenous hVsml expression with ubiquitin wildtype, ALLN treated (A) hVsml (B) ubiquitin wildtype (C) overlay. Endogenous hVsml expression with ubiquitin wildtype, treated with DMSO control (D)hVsm1 (E) ubiquitin wildtype (F) overlay.
  • FIG. 14 shows laser scanning confocal microscopy images of single labeling immunofluroscence experiment: (A) mock, (B) pEGFPCI vector, (C) pEGFPN2 vector, (D) pEGFPNI hVsml full-length, (E1) UbLCC pEGFPCI , (E2) UbLCC pEGFPCI and (F) Rvp pEGFPCI , scale bar is 40mm; FIG. 15 shows locations of nucleotide primers(SEQ ID NOS: 11 and 12), shown with underlines that hybridise to hVSMI coding nucleic acid (SEQ ID NO: 10); FIG.
  • FIG. 16 shows locations of nucleotide primers (SEQ ID NOS: 13 and 14), shown with underlines that hybridise to hVSM2 (SEQ ID NO: 4);
  • FIG. 17A shows an amino acid sequence for rat VSM1 (SEQ ID NO: 21), similar to cG4420-PA [Rattus norvegicus], accession no. XP_345896;
  • FIG. 17B shows a nucleotide sequence for rat VSM1 (SEQ ID NO: 22), rattus norvegicus similar to CG4420-PA (LOC367012) mRNA, accession no. XM_345895;
  • FIG. 18A shows an amino acid sequence for mouse VSM1 (SEQ ID NO: 23), unnamed protein [Mus musculus], accession no. BAB24297;
  • FIG. 18B shows a nucleotide sequence for mouse VSM1 (SEQ ID NO: 23), unnamed protein [Mus
  • FIG. 19A shows an amino acid sequence for rat VSM2 (SEQ ID NO: 25), similar to RIKEN cDNA 1700027M01 [Rattus norvegicus], accession no. XP__233612; FIG.
  • FIG. 19B shows a nucleotide sequence for rat VSM2 (SEQ ID NO: 26), Rattus norvegicus similar to RIKEN cDNA 1700027M01 (LOC313668), mRNA, accession no. XM_233612;
  • FIG. 20A shows an amino acid sequence for mouse VSM2 (SEQ ID NO: 27);
  • FIG.20B shows a nucleotide sequence for mouse VSM2 (SEQ ID NO: 28), Mus musculus RIKEN cDNA 1700027M01 gene, mRNA (cDNA clone MGC:29408 IMAGE:5004537), complete eds, accession no. BC021415;
  • FIG. 20A shows an amino acid sequence for mouse VSM2 (SEQ ID NO: 27);
  • FIG.20B shows a nucleotide sequence for mouse VSM2 (SEQ ID NO: 28), Mus musculus RIKEN cDNA 1700027M01 gene,
  • FIG. 21 A shows an amino acid sequence for zebrafish VSM2 (SEQ ID NO: 29), Zebrafish VSM2 DNA-damage inducible protein 2 [Danio rerio], accession no. AAQ97767;
  • FIG. 21 B shows a nucleotide sequence for zebrafish VSM2 (SEQ ID NO: 30), Danio rerio clone RK355A1 F02 DNA-damage inducible protein 2 (DDI2) mRNA, complete eds, accession no. AY398334;
  • FIG. 21 A shows an amino acid sequence for zebrafish VSM2 (SEQ ID NO: 29), Zebrafish VSM2 DNA-damage inducible protein 2 [Danio rerio], accession no. AAQ97767;
  • FIG. 21 B shows a nucleotide sequence for zebrafish VSM2 (SEQ ID NO: 30), Danio rerio clone RK355A
  • FIG. 22 shows quantitative real-rime PCR analysis of expression of mVsml and mVsm2 in mouse tissues, mVSM1 is expressed highly in testis with some expression in muscle, mVsm2 is expressed in all tissues at varying levels;
  • FIG. 23 shows quantitative real-rime PCR analysis of expression of mVsml and mVsm2 in testis at various developmental stages, mVsml is expressed very highly in adult testis, mVsm2 is expressed at all stages but is decreased in the adult;
  • FIG. 24 shows comparison of expression of VSMs with other testis markers; FIG.
  • FIG. 25 shows expression of VSM in testis sections and colocalisation with vimentin
  • FIG. 34 shows an alignment with a hVSM2 fragment (SEQ ID NO: 54) and a protein similar to RIKEN cDNA 1700027M01 from Rattus norvegicus, accession no.233
  • FIG. 36 shows an alignment with a
  • FIG. 39 shows an alignment with a hVSM2 fragment (SEQ ID NO: 73) and a hypothetical protein AN6741.2 from Aspergillus nidulans FGSC A4, accession no. gi
  • FIG. 40 shows an alignment with a hVSM2 fragment (SEQ ID NO: 76) and a DNA-damage inducible protein DD11 -like protein form
  • FIG. 42 shows an alignment with a hVSM2 fragment
  • FIG. 43 shows an alignment with a hVSM2 fragment (SEQ ID NO:
  • TABLE 1 lists orthologues of hVSMI (identified by BLASTp search, sequence results are incorporated by reference);
  • TABLE 2 lists proteins comprising similarity with hVSMI , however, only one form of the protein has been identified in the indicated species and the protein has more homology with hVSM2, sequence results are incorporated by reference;
  • TABLE 3 shows orthologues of hVSM2 (identified by BLASTP and TBLASTN search, sequence results are incorporated by reference);
  • VSM refers generally to "v-SNARE master” nucleic acid and protein from any species and any homolog thereof, for example human VSM1 (hVSMI ), human VSM2 (hVSM2), mouse VSM1 (mVSM1), mouse VSM2 (mVSM2) and yeast VSM1 (ScVSMI ).
  • VSM may be used interchangeably with “DDI” (DNA-damage inducible) from any species and any homolog thereof.
  • hVSMI human protein
  • hDDM human nucleic acid
  • hVSM2 human protein
  • hDDI2 human nucleic acid
  • hVSM1/2 refers to both hVSMI and hVSM2, for example an antibody may bind to both hVSMI 12 via a conserved amino acid sequence region between proteins as shown for example in FIG. 3.
  • isolated is meant material that has been removed from its natural state or otherwise been subjected to human manipulation. Isolated material may be substantially or essentially free from components that normally accompany it in its natural state, or may be manipulated so as to be in an artificial state together with components that normally accompany it in its natural state. Isolated material includes material in native and recombinant form.
  • hVSMI and/or hVSM2 nucleic acids and encoded polypeptides have been respectively isolated from human, mouse, rat, zebra fish, Plasmodium, plants and yeast.
  • a biological sample may also be isolated, for example from an organism such as a human, mouse, rat or the like.
  • endogenous nucleic acid or polypeptide is meant a nucleic acid or polypeptide that may be found in a native cell, tissue or animal in isolation or otherwise.
  • Protein and Polypeptide By “protein” is also meant “polypeptide”, either term referring to an amino acid polymer, comprising natural and/or non-natural amino acids, including L- and D-isomeric forms, as are well understood in the art.
  • hVSMI and hVSM2 may be referred to as both a protein or polypeptide.
  • Protein may refer to a peptide, polypeptide, or fragments thereof.
  • a "fragment' includes an amino acid sequence that constitutes less than 100% of an entire protein, inclusive of all percent values less than 100% an more than 0%.
  • a fragment for example, preferably comprises less than 99%, 98%, 97%, 96%, 95%, 94%, 93%, 92%, 91 %, 90%, 80%, 70%, 60%, 50%, 40%, 30%, 20% and even less than 10% of the entire protein.
  • An examples of a fragment includes AEDAGIWDGQTLQYLLLMGKPGKCGLQKG (SEQ ID NO: 6), an amino acid
  • hVSM2 not found in hVSMI
  • GQQQQRTPAAQRSQGLAS SEQ ID NO: 7
  • P, Q 30 comprising an amino acid sequence u nique for either hVSMI orhVSM2 may be a biological fragment useful for distinguishing between the respective homologs. It is understood that the fragment may be derived from either a native or a recombinant polypeptide or peptide.
  • the biologically active fragment constitutes at least greater than 1 % of the biological activity of the entire polypeptide or peptide, preferably at least greater than 5%, 10%, 15% or 20% biological activity, more preferably at least greater than 25%, 35%, 45% biological activity and even more preferably at least greater than 50%, 60%, 70%, 80%, 90% and even 95% or 99% or 100% biological activity of the entire protein.
  • Biological activity may be greater than 100% of a full- length protein, for example, if one or more inhibitory domains is deleted or mutated, for example by deletion, substitution and/or addition of an amino acid.
  • a biologically active fragment used as an antigen to elicit an antibody response
  • the biologically active fragment may be bound by an antibody with an affinity less than the full-length protein and still be useful as a reagent, for example as a reagent in a pharmaceutical composition and/or diagnosis of a disorder such as cancer and/or a reproductive disorder.
  • a "fragment" is a small peptide, for example of at least 6, preferably at least 10 and more preferably at least 20 amino acids in length, which comprises one or more antigenic determinants or epitopes. Larger fragments comprising more than one peptide are also contemplated, and may be obtained through the application of standard recombinant nucleic acid techniques or synthesized using conventional liquid 29
  • a fragment may comprise amino acids shared between hVSMI and hVSM2, but not ScVSMI (SEQ ID NO: 5), for example, VYCVRRDLS (SEQ ID NO: 8) corresponding to amino acids 5-13 of hVSMI and 2; VTFSLQ (SEQ ID NO: 9) corresponding to amino acids 15- 20 of hVSMI and hVSM2; a fragment comprising amino acids 157-174 of hVSMI comprises amino acids substantially similar between hVSMI and hVSM2 and distinct from ScVSMI ; and other fragments comprising contiguous amino acids may be selected by a skilled person as shown in FIG. 3.
  • a fragment also includes a sub-fragment, such as a fragment of a fragment.
  • the fragment may also include a "biologically active fragment' which retains biological activity of a given polypeptide or peptide.
  • a biologically active fragment of hVSMI and/or hVSM2, and respective homologs thereof may comprise any number of preferably contiguous amino acids as described above, or one or more domains including: Rvp, UbL and/or CC.
  • the hVSMI Rvp domain comprises amino acids 239-343 and the UbL domain comprises amino acids 1-79;
  • the hVSM2 Rvp domain comprises amino acids 231-335 ad the UbL domain comprises amino acids 1-79.
  • a biologically active fragment may comprise amino acids suitable for use as an antigen for producing antibodies, either monoclonal and/or polyclonal.
  • the fragments described herein that comprise amino acid sequences shared between VSM1 and VSM2, preferably hVSMI and hVSM2 may be useful to detecting both homologs.
  • a fragment or solid phase synthesis techniques For example, reference may be made to solution synthesis or solid phase synthesis as described, for example, in Chapter 9 entitled “Peptide Synthesis” by Atherton and Shephard that is included in a publication entitled “Synthetic Vaccines" edited by Nicholson and published by Blackwell Scientific Publications.
  • peptides can be produced by digestion of a polypeptide of the invention with a suitable proteinases.
  • variant polypeptides are polypeptides of the invention in which one or more amino acids have been replaced by different amino acids. It is well understood in the art that some amino acids may be changed to others with broadly similar properties without changing the nature of the activity of the polypeptide (conservative substitutions). Substantial changes in function are made by selecting substitutions that are less conservative or non-conservative as is known in the art. Generally, the substitutions which are likely to produce the greatest changes in a polypeptide's properties are those in which (a) a hydrophilic residue (e.g.
  • a hydrophobic residue e.g. Leu, lie, Phe or Val
  • a cysteine or proline is substituted for, or by, any other residue
  • a residue having an electropositive side chain e.g., Arg, His or Lys
  • an electronegative residue e.g., Glu or Asp
  • a residue having a bulky side chain e.g., Phe or Trp
  • one having a smaller side chain e.g., Ala, Ser
  • no side chain e.g., Gly
  • Variant may also comprise one or more amino acid deletions.
  • sequence relationships between respective nucleic acids and polypeptides include “comparison window”, “sequence identity”, “percentage of sequence identity” and “substantial identity”. Because respective nucleic acids/polypeptides may each comprise (1) only one or more portions of a complete nucleic acid/polypeptide sequence that are shared by the nucleic acids/polypeptides, and (2) one or more portions which are divergent between the nucleic acids/polypeptides, sequence comparisons are typically performed by comparing sequences over a "comparison window" to identify and compare local regions of sequence similarity.
  • a “comparison window” refers to a conceptual segment of typically at least 6, 10 15 or even 20 or more contiguous residues that is compared to a reference sequence.
  • the comparison window may comprise additions or deletions (i.e., gaps) of about 20% or less as compared to the reference sequence (which does not comprise additions or deletions) for optimal alignment of the respective sequences.
  • Optimal alignment of sequences for aligning a comparison window may be conducted by computerised implementations of algorithms (for example TBLASTN, ECLUSTALW and BESTFIT provided by NCBI, WebAngis GCG, 2D Angis, GCG and GeneDoc programs, incorporated herein by reference) or by inspection (for example visual inspection) and the best alignment (i.e., resulting in the highest percentage homology over the comparison window) generated by any of the various methods selected.
  • the ECLUSTALW program may used to align multiple sequences. This program calculates a multiple alignment of nucleotide or amino acid sequences according to a method by Thompson, J.D., Higgins,
  • sequence identity is used herein in its broadest sense to include the number of exact nucleotide or amino acid matches having regard to an appropriate alignment using a standard algorithm, having regard to the extent that sequences are identical over a window of comparison.
  • a “percentage of sequence identity” is calculated by comparing two optimally aligned sequences over the window of comparison, determining the number of positions at which the identical nucleic acid base (e.g., A, T, C, G, U) occurs in both sequences to yield the number of matched positions, dividing the number of matched positions by the total number of positions in the window of comparison (i.e., the window size), and multiplying the result by 100 to yield the percentage of sequence identity.
  • sequence identity may be understood to mean the "match percentage” calculated by the DNASIS computer program (Version 2.5 for windows; available from Hitachi Software engineering Co., Ltd., South San Francisco, California, USA).
  • a “homolog” shares a definable nucleotide or amino acid sequence relationship with a nucleic acid or polypeptide of the invention as the case may be, for example hVSMI and hVSM2 are homologs, and other homologs are shown in tables 1-3.
  • Polypeptide homologs preferably share at least 30% or more sequence identity with an amino acid sequence of interest.
  • a peptide homolog of hVSMI and/or hVSM2 preferably shares at least 30% sequence identity with the respective protein, more preferably at least 32%, 40%, 49%, 50%, 60%, 70%, 73%, 74%, 75%, 80% 90%, and even more preferably at least 95%, 98% and even 99% sequence identity with the amino acid sequences of hVSMI and/or hVSM2.
  • a hVSMI homolog comprises a percent identity greater than 49% and a hVSM2 homolog comprises a percent identity greater than 50%.
  • the hVSMI and/or hVSM2 homolog comprises between greater than 50% identity and less than 100% identity, including all values therebetween.
  • a polypeptide homolog comprises a protein homolog and peptide homolog, including a fragment thereof.
  • hVSMI and hVSM2 are examples of polypeptide homologs, preferably the percent homology between hVSMI and hVSM2 is about 74% or greater. Included within the scope of homologs are "orthologs", which are functionally-related polypeptides and their encoding nucleic acids, isolated from other organisms.
  • orthologs of hVSMI and/or hVSM2 include proteins obtainable from Xenopus laevis, Rattus norvegicus, Mus musculus, Macac fascicularis, Drosophila melanogaster, Arabidopsis thaliana, Plasmodium, S.
  • homologs and orthologs may be identified by searching databases using programs such as BLASTp, as used herein and shown in FIGS.26-44. It will be appreciated that a skilled person would be able to identify peptide fragments comprising amino acid sequences that are conserved between species that may biological activity, for example in generating antibodies and/or capturing antibodies. Also, a skilled person would be able to identify regions that are divergent between species that may be useful in preparing peptide fragments unique for a selected protein of a selected species..
  • a high amino acid similarity and identity between hVSMI and hVSM2 with respective homologs thereof allows for use of a VSM1 and/or VSM2 protein or peptide from one species as an antigen to raise antibodies capable of detecting an VSM 1 and/or VSM2 homolog.
  • antibodies generated against hVSMI may be used to detect homologous, or orthologous, proteins in mouse and rat.
  • proteins and peptides homologous to hVSMI and/or hVSM2 may be used as both antigens to generate antibodies capable of binding hVSMI and/or hVSM2 and also as capture reagents to bind anti-hVSM1 and/or anti-hVSM2 antibodies.
  • polypeptide variants these can be created by mutagenising a polypeptide or by mutagenising an encoding nucleic acid, such as by random mutagenesis or site-directed mutagenesis.
  • nucleic acid mutagenesis methods are provided in Chapter 9 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, Ausubel et al., supra which is incorporated herein by reference. It will be appreciated by the skilled person that site-directed mutagenesis is best performed where knowledge of the amino acid residues that contribute to biological activity is available. In many cases, this information is not available, or can only be inferred by molecular modeling approximations, for example. In such cases, random mutagenesis is contemplated. Random mutagenesis methods include chemical modification of proteins by hydroxylamine (Ruan et al., 1997, Gene 188 35), incorporation of dNTP
  • derivative polypeptides are polypeptides of the invention which have been altered, for example by conjugation or complexing with other chemical moieties or by post-translational modification techniques as would be understood in the art. Such derivatives include amino acid deletions and/or additions to polypeptides of the invention, or variants thereof. "Additions" of amino acids may include fusion of the peptide or polypeptides or variants thereof with other peptides or polypeptides.
  • Such peptides include amino (N) and carboxyl (C) terminal amino acids added for use as "tags".
  • N amino
  • C carboxyl
  • myc-epitope tag amino (N) and carboxyl (C) terminal amino acids added for use as "tags”.
  • N-terminal and C-terminal tags include known amino acid sequences which bind a specific substrate, or bind known antibodies,
  • pRSET B vector ProBondTM; Invitrogen
  • derivatives contemplated by the invention include, modification to side chains, incorporation of unnatural amino acids and/or their derivatives during peptide or polypeptide synthesis and the use of cross linkers and other methods which impose conformational constraints on the polypeptides, fragments and variants of the invention.
  • side chain modifications contemplated by the present invention include modifications of amino groups such as by acylation with acetic anhydride; acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; amidination with methylacetimidate; carbamoylation of amino groups with cyanate; pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction with NaBH 4 ; reductive alkylation by reaction with an aldehyde followed by reduction with NaBH 4 ; and trinitrobenzylation of amino groups with 2, 4, 6-trinitrobenzene sulphonic acid (TNBS).
  • modifications of amino groups such as by acylation with acetic anhydride; acylation of amino groups with succinic anhydride and tetrahydrophthalic anhydride; amidination with methylacetimidate; carbamoylation of amino groups with cyanate; pyridoxylation of lysine with pyridoxal-5-phosphate followed by reduction
  • the carboxyl group may be modified by carbodiimide activation via O-acylisourea formation followed by subsequent derivitization, byway of example, to a corresponding amide.
  • the guanidine group of arginine residues may be modified by formation of heterocyclic condensation products with reagents such as 2,3- butanedione, phenylglyoxal and glyoxal.
  • Sulphydryl groups may be modified by methods such as performic acid oxidation to cysteic acid; formation of mercurial derivatives using 4-chloromercuriphenylsulphonic acid, 4-chloromercuribenzoate; 2- chloromercuri-4-nitrophenol, phenylmercury chloride, and other mercurials; formation of a mixed disulphides with other thiol compounds; reaction with maleimide, maleic anhydride or other substituted maleimide; carboxymethylation with iodoacetic acid or iodoacetamide; and carbamoylation with cyanate at alkaline pH.
  • Tryptophan residues may be modified, for example, by alkylation of the indole ring with 2-hydroxy-5-nitrobenzyl bromide or sulphonyl halides or by oxidation with N-bromosuccinimide.
  • Tyrosine residues may be modified by nitration with tetranitromethane to form a 3-nitrotyrosine derivative.
  • the imidazole ring of a histidine residue may be modified by N- carbethoxylation with diethylpyrocarbonate or by alkylation with iodoacetic acid derivatives.
  • Examples of incorporating unnatural amino acids and derivatives during peptide synthesis include, use of 4-amino butyric acid, 6- aminohexanoic acid, 4-amino-3-hydroxy-5-phenylpentanoic acid, 4-amino-3- hydroxy-6-methylheptanoic acid, t-butylglycine, norleucine, norvaline, phenylglycine, ornithine, sarcosine, 2-thienyl alanine and/or D-isomers of amino acids.
  • Peptides in relation to the invention such as hVSMI and hVSM2 (inclusive of fragments, variants, derivatives and homologs in general) may be prepared by any suitable procedure known to those of skill in the art.
  • the polypeptide may be prepared by a procedure including the steps of: (i) preparing an expression construct which comprises a recombinant VSM nucleic acid operably linked to one or more regulatory nucleotide sequences, for example a T7 promoter; (ii) transfecting or transforming the expression construct into a suitable host cell, for example E. coli; and (iii) expressing the polypeptide in said host cell.
  • the recombinant nucleic acid encodes an hVSMI or hVSM2 polypeptide or fragment thereof.
  • Recombinant proteins may be conveniently expressed and purified by a person skilled in the art using commercially available kits, for
  • nucleic acid designates single or double stranded mRNA, RNA, unprocessed RNA, heterolgous RNA, cRNA and DNA, said DNA inclusive of cDNA and genomic DNA.
  • a nucleic acid may be native or recombinant and may comprise one or more artificial nucleotides, e.g. nucleotides not normally found in nature.
  • Nucleic acid encompasses modified purines (for example, inosine, methylinosine and methyladenosine) and modified pyrimidines (thiouridine and methylcytosine).
  • isolated nucleic acid refers to a nucleic acid subjected to in vitro manipulation into a form not normally found in nature. Isolated nucleic acid includes both native and recombinant (non- native) nucleic acids. For example, a nucleic acid isolated from human or mouse.
  • a "polynucleotide” is a nucleic acid having eighty (80) or more contiguous nucleotides, while an “oligonucleotide” has less than eighty (80) contiguous nucleotides.
  • a nucleic acid "fragment' comprises a nucleotide sequence that constitutes less than 100% of a nucleic acid of the invention, for example, less than or equal to: 99%, 98%, 95%, 90%, 85%, 80%, 75%, 70%, 65%, 60%, 55%, 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 8%, 6%, 4%, 2% or even 1%. It will be appreciated that a fragment comprises all integer values less than 100%, for example the percent value as set forth above and others.
  • a full length nucleic acid includes a full length nucleotide sequence of hVSMI or hVSM2 as set forth as SEQ ID NOS: 2, 4 and 10.
  • a fragment also includes a polynucleotide, oligonucleotide, probe, primer and an amplification product, eg. a PCR product.
  • a fragment may comprise only a few nucleotides as exemplified by nucleic acid primers described herein.
  • a "probe” may be a single or double-stranded oligonucleotide or polynucleotide, suitably labeled for the purpose of detecting complementary sequences in Northern or Southern blotting. For example labeled with 32 P- ⁇ -dCTP.
  • a suitable probe for Northern blot analysis was
  • a “primer” is usually a single-stranded oligonucleotide, preferably having 20-50 contiguous nucleotides, which is capable of annealing to a complementary nucleic acid "template” and being extended in a template-dependent fashion by the action of a DNA polymerase such as Taq polymerase, RNA-dependent DNA polymerase or SequenaseTM.
  • a DNA polymerase such as Taq polymerase, RNA-dependent DNA polymerase or SequenaseTM.
  • the PCR primers: RVP-F 5'-
  • nucleic acid "variant' means a nucleic acid of the invention, the nucleotide sequence of which has been mutagenized or otherwise altered so as to encode substantially the same, or a modified protein.
  • nucleotide sequence alterations may be introduced so as to modify biological activity of an encoded protein. These alterations may include deletion or addition of one or more nucleotide bases, or involve non-conservative substitution of one base for another. Such alterations can have profound effects upon biological activity of an encoded protein, possibly increasing or decreasing biological activity. In this regard, mutagenesis may be performed in a random fashion or by site-directed mutagenesis in a more "rational" manner.
  • the recombinant nucleic acid is operably linked to one or more regulatory sequences in an expression vector, for example a T7 promoter.
  • An "expression vector” may be either a self-replicating extra- chromosomal vector such as a plasmid, or a vector that integrates into a host genome.
  • expression vectors include: pDmyc-Neo, pCDNAmyc/His 3.1 and pEGFP-N1 (clontech) and pGEX-KG and derivations thereof.
  • operably linked is meant that said regulatory nucleotide sequence(s) is/are positioned relative to the recombinant nucleic acid of the invention to initiate, regulate or otherwise control transcription. Regulatory nucleotide sequences will generally be appropriate for the host cell used for expression. Numerous types of appropriate expression vectors and suitable regulatory sequences are known in the art for a variety of host cells.
  • said one or more regulatory nucleotide sequences may include, promoter sequences, leader or signal sequences, ribosomal binding sites, transcriptional start and termination sequences, translational start and termination sequences, and enhancer or activator sequences.
  • Constitutive or inducible promoters as known in the art are contemplated by the invention.
  • the promoters may be either naturally occurring promoters, or hybrid promoters that combine elements of more than one promoter.
  • the lac promoter is inducible by IPTG.
  • the expression vector may further comprise a selectable marker gene to allow the selection of transformed host cells. Selectable marker genes are well known in the art and will vary with the host cell used.
  • an ampicillin resistance gene for selection of positively transformed host cells when grown in a medium comprising ampicillin.
  • the expression vector may also include a fusion partner (typically provided by the expression vector) so that the recombinant polypeptide of the invention is expressed as a fusion polypeptide with the fusion partner.
  • fusion partners are that they assist identification and/or purification of the fusion polypeptide. Identification and/or purification may include using a monoclonal antibody or substrate specific for the fusion partner, for example a 6X-His tag, myc epitope, green fluorescent protein or GST.
  • a fusion partner may also comprise a leader sequence for directing secretion of a recombinant polypeptide, for example an alpha-factor leader sequence.
  • fusion partners include hexahistidine (6X-HIS)-tag, myc epitope, N-Flag, Fc portion of human IgG, glutathione-S- transferase (GST) and maltose binding protein (MBP), which are particularly useful for isolation of the fusion polypeptide by affinity chromatography.
  • relevant matrices for affinity chromatography may include nickel-conjugated or cobalt-conjugated resins, fusion polypeptide specific antibodies, glutathione-conjugated resins, and amylose-conjugated resins respectively.
  • Some matrices are available in "kit” form, such as the ProBondTM Purification System (Invitrogene Corp.) which incorporates a 6X-His fusion vector and purification using ProBondTM resin.
  • ProBondTM Purification System Invitrogene Corp.
  • 6X-His fusion vector 6X-His fusion vector and purification using ProBondTM resin.
  • the fusion partners may also have protease cleavage sites, for example enterokinase (available from Invitrogen Corp. as
  • polypeptides of the invention may be produced by culturing a host cell transformed with an expression construct comprising a nucleic acid encoding a polypeptide, or polypeptide homolog, of the invention. The conditions appropriate for polypeptide expression will vary with the choice of expression vector and the host cell.
  • a nucleotide sequence of the invention may be modified for successful or improved polypeptide expression in a given host cell. Modifications include altering nucleotides depending on preferred codon usage of the host cell. Alternatively, or in addition, a nucleotide sequence of the invention may be modified to accommodate host specific splice sites or lack thereof. These modifications may be ascertained by one skilled in the art.
  • Host cells for expression may be prokaryotic or eukaryotic.
  • Useful prokaryotic host cells are bacteria.
  • a typical bacteria host cell is a strain of E. coli.
  • Useful eukaryotic cells are yeast, SF9 cells that may be used with a baculovirus expression system as described herein, and other mammalian cells.
  • the recombinant polypeptide may be conveniently prepared by a person skilled in the art using standard protocols as for example described in Sambrook, et al., MOLECULAR CLONING. A Laboratory Manual (Cold Spring Harbor Press, 1989), incorporated herein by reference, in particular Sections 16 and 17; CURRENT PROTOCOLS IN MOLECULAR BIOLOGY Eds. Ausubel et al., (John Wiley & Sons, Inc. 1995-1999), incorporated herein by reference, in particular Chapters 10 and 16; and CURRENT PROTOCOLS IN PROTEIN SCIENCE Eds. Coligan et al., (John Wiley &
  • Nucleic acid homologs include nucleic acids having one or more codon sequences altered by taking advantage of codon sequence redundancy.
  • a particular example of this embodiment is optimization of a nucleic acid sequence according to codon usage as is well known in the art. This can effectively "tailor" a nucleic acid for optimal expression in a particular organism, or cells thereof, where preferential codon usage has been established.
  • Organisms include, for example, human, mouse, rat, fish, yeast and the like.
  • nucleic acid homologs share at least 30%, 50% or 60%, preferably at least 70%, more preferably at least 80%, and even more preferably at least 90%, 95% 98% and even 99% sequence identity with the nucleic acids of the invention.
  • nucleic acid homologs hybridise to nucleic acids of the invention under at least low stringency conditions, preferably under at least medium stringency conditions and more preferably under high stringency conditions. "Hybridise and Hybridisation” is used herein to denote the pairing of at least partly complementary nucleotide sequences to produce a DNA-DNA, RNA-RNA or DNA-RNA hybrid. Hybrid sequences comprising complementary nucleotide sequences occur through base-pairing.
  • Modified purines for example, inosine, methylinosine and methyladenosine
  • modified pyrimidines thiouridine and methylcytosine
  • Stringency refers to temperature and ionic strength conditions, and presence or absence of certain organic solvents and/or detergents during hybridisation. The higher the stringency, the higher will be the required level of complementarity between hybridizing nucleotide sequences.
  • String conditions designates those conditions under which only nucleic acid having a high frequency of complementary bases will hybridize.
  • Reference herein to low stringency conditions includes and encompasses:- (i) from at least about 1 % v/v to at least about 15% v/v formamide and from at least about 1 M to at least about 2 M salt for hybridisation at 42°C, and at least about 1 M to at least about 2 M salt for washing at 42°C; and (ii) 1% Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHP0 4 (pH 7.2), 7% SDS for hybridization at 65°C, and (i) 2xSSC, 0.1 % SDS; or (ii) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0 4 (pH 7.2), 5% SDS for washing at room temperature.
  • BSA Bovine Serum Albumin
  • Medium stringency conditions include and encompass:- (i) from at least about 16% v/v to at least about 30% v/v formamide and from at least about 0.5 M to at least about 0.9 M salt for hybridisation at 42°C, and at least about 0.5 M to at least about 0.9 M salt for washing at 42°C; and (ii) 1 % Bovine Serum Albumin (BSA), 1 mM EDTA, 0.5 M NaHP0 4 (pH 7.2), 7% SDS for hybridization at 65°C and (a) 2 x SSC, 0.1% SDS; or (b) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0 4 (pH 7.2), 5% SDS for washing at 42°C.
  • BSA Bovine Serum Albumin
  • High stringency conditions include and encompass:- (i) from at least about 31 % v/v to at least about 50% v/v formamide and from at least about 0.01 M to at least about 0.15 M salt for hybridisation at 42°C, and at least about 0.01 M to at least about 0.15 M salt for washing at 42°C; (ii) 1 % BSA, 1 mM EDTA, 0.5 M NaHP0 4 (pH 7.2), 7% SDS for hybridization at 65°C, and (a) 0.1 x SSC, 0.1% SDS; or (b) 0.5% BSA, 1 mM EDTA, 40 mM NaHP0 4 (pH 7.2), 1 % SDS for washing at a temperature in excess of 65°C for about one hour; and (iii) 0.2 x SSC, 0.1 % SDS forwashing at or above 68°C for about 20 minutes.
  • T m of a duplex DNA decreases by about 1°C with every increase of 1% in the number of mismatched bases.
  • stringent conditions are well known in the art, such as described in Chapters 2.9 and 2.10 of Ausubel et al., supra, which are herein incorporated by reference.
  • a skilled addressee will also recognize that various factors can be manipulated to optimize the specificity of the hybridization. Optimization of the stringency of the final washes can serve to ensure a high degree of hybridization.
  • complementary nucleotide sequences are identified by blotting techniques that include a step whereby nucleotides are immobilized on a matrix (preferably a synthetic membrane such as nitrocellulose), a hybridization step, and a detection step.
  • Examples include: Southern blotting, Northern blotting, dot blotting and slot blotting use for identify complementary DNA/DNA, DNA/RNA or RNA/RNA polynucleotide sequences.
  • nucleic acid-protein blotting is well known in the art and is contemplated by the invention. Such techniques are well known by those skilled in the art, and have been described in Ausubel etal., supra, at pages 2.9.1 through 2.9.20, herein incorporated by reference.
  • An alternative blotting step is used when identifying complementary nucleic acids in a cDNA or genomic DNA library, such as through the process of plaque or colony hybridisation.
  • nucleic acids are blotted/transferred to a synthetic membrane, as described above.
  • a nucleotide sequence of the invention is labeled as described above, and the ability of this labeled nucleic acid to hybridise with an immobilized nucleotide sequence analysed.
  • Methods for detecting labeled nucleic acids hybridised to an immobilised nucleic acid are well known to practitioners in the art. Such methods include autoradiography, chemiluminescent, fluorescent and colourimetric detection.
  • Nucleic acid homologs of the invention may be prepared according to the following procedure: (i) obtaining a nucleic acid extract from a suitable host, for example a bacterial species; (ii) creating primers which are optionally degenerate wherein each comprises a portion of a nucleotide sequence of the invention; and (iii) using said primers to amplify, via nucleic acid amplification techniques, one or more amplification products from said nucleic acid extract.
  • an "amplification product” refers to a nucleic acid product generated by nucleic acid amplification techniques.
  • Suitable nucleic acid amplification techniques are well known to the skilled addressee, and include PCR (including RT-PCR and real time PCR) as for example described in Chapter 15 of Ausubel et al. supra, which is incorporated herein by reference; strand displacement amplification (SDA) as for example described in U.S. Patent No 5,422,252 which is incorporated herein by reference; rolling circle replication (RCR) as for example described in Liu etal., 1996, J. Am. Chem. Soc.
  • nucleic acid sequence-based amplification as for example described by Sooknanan et al. , 1994, Biotechniques 17 1077, which is incorporated herein by reference
  • ligase chain reaction LCR as for example described in International Application WO89/09385 which is incorporated herein by
  • Antibodies The invention also provides antibodies capable of binding hVSMI and/or hVSM2 and fragments thereof. Also contemplated are antibodies capable of binding hVSMI and hVSM2 homologs, variants and derivatives thereof.
  • fragments of hVSMI and/or hVSM2 may be selected as antigens so that an antibody raised against such peptides may be specific for either hVSM 1 or hVSM2, for example a peptide comprising an amino acid sequence not present in hVSMI or alternatively not present in hVSM2 as discussed herein.
  • a peptide may be selected as an antigen so that an antibody raised against said antigen is capable of binding both hVSMI and hVSM2, for example a peptide comprising an amino acid sequence conserved between hVSMI and hVSM2.
  • the peptide comprising a conserved amino acid sequence between hVSMI and hVSM2 may be distinct from other VSM's, or example distinct from ScVSM as described herein.
  • a homolog or variant of hVSMI and/or hVSM2 may be used as an antigen.
  • yeast ScVSMI SEQ ID NO: 5
  • an antibody generated therefrom may be used to bind hVSMI and/or hVSM2, for example by binding to a conserved region between the proteins.
  • recombinant hVSMI protein was bacterially expressed as a GST-fusion protein and purified using glutathione- sepharose beads.
  • Antibodies of the invention may be polyclonal or monoclonal. In a preferred form, the antibodies are monoclonal antibodies. Well-known protocols applicable to antibody production, purification and use may be found, for example, in Chapter 2 of Coligan et al., CURRENT PROTOCOLS IN IMMUNOLOGY (John Wiley & Sons NY, 1991 -1994) and Harlow, E. & Lane, D. Antibodies: A Laboratory Manual, Cold Spring Harbor, Cold Spring Harbor Laboratory, 1988, which are both herein incorporated by reference. Generally, antibodies of the invention bind to or conjugate with a polypeptide, fragment, variant or derivative of the invention.
  • the antibodies may comprise polyclonal antibodies.
  • Such antibodies may be prepared for example by injecting a polypeptide, fragment, variant or derivative of the invention into a production species, which may include mice, goat, or rabbits, to obtain polyclonal antisera.
  • Methods of producing polyclonal antibodies are well known to those skilled in the art. Exemplary protocols which may be used are described for example in Coligan et al., CURRENT PROTOCOLS IN IMMUNOLOGY, supra, and in Harlow & Lane, 1988, supra.
  • monoclonal antibodies may be produced using the standard method as for example, described in an article by K ⁇ hler & Milstein, 1975, Nature 256, 495, which is herein incorporated by reference, or by more recent modifications thereof as for example, described in Coligan etal., CURRENT PROTOCOLS IN IMMUNOLOGY, supra by immortalizing spleen or other antibody producing cells derived from a production species which has been inoculated with one or more of the polypeptides, fragments, variants or derivatives of the invention.
  • the invention also includes within its scope antibodies which comprise Fc or Fab fragments of the polyclonal or monoclonal antibodies referred to above.
  • the antibodies may comprise single chain Fv antibodies (scFvs) against the peptides of the invention.
  • scFvs single chain Fv antibodies
  • Such scFvs may be prepared, for example, in accordance with the methods described respectively in United States Patent No 5,091 ,513, European Patent No 239,400 or the article by Winter & Milstein, 1991 , Nature 349293, which are incorporated herein by reference.
  • the antibodies of the invention may be used for affinity chromatography in isolating natural or recombinant polypeptides of the invention. For example, reference may be made to immunoaffinity chromatographic procedures described in Chapter 9.5 of Coligan et al.,
  • Antibodies may be purified from a suitable biological fluid of the animal by ammonium sulfate fractionation, affinity purification or by other methods well known in the art. Exemplary protocols for antibody purification are given in Sections 10.11 and 11.13 of Ausubel et al., supra, which are herein incorporated by reference. Immunoreactivity of the antibody against the native or parent polypeptide may be determined by any suitable procedure such as, for example, Western blot, immunohistochemistry, immunofluorescence, protein array, lateral flow assay, ELISA and other protein and antibody based assays as are well known in the art.
  • compositions A further feature of the invention is use of the polypeptide, fragment, variant or derivative thereof or nucleic acid, fragment or homolog of the invention, preferably hVSMI and/or hVSM2, as actives in a pharmaceutical composition.
  • the actives may be "immunogenic agents" which are capable of eliciting an immune response in an animal.
  • An immunogenic agent may comprise a vaccine or antigen presenting cell loaded or pulsed with an antigen.
  • the antigen presenting cell may be loaded or pulsed with antigen by contacting the cell with an antigen, for example a polypeptide, fragment, variant or derivative of the invention.
  • the antigen presenting cell may be, for example a dendritic cell.
  • Immunotherapy A further feature of the invention is the use of hVSMI and hVSM2 protein and/or nucleic acid, including fragments, homologs (e.g orthologs), variants or derivatives thereof referred to herein as "immunogenic agents", as actives in a pharmaceutical composition.
  • a composition may be suitable for immunotherapy or vaccination of an animal, preferably a mammal, more preferably a human.
  • An immunogenic agent when administered to an animal, for example a human, is capable of eliciting an immune response in said animal against the immunogenic agent.
  • An immunogenic agent need to provide protective immunity to be useful and merely eliciting an immune response in a subject may be beneficial.
  • a pharmaceutical composition includes an immunotherapeutic composition.
  • An immunotherapeutic composition includes a vaccine.
  • the pharmaceutical composition comprises a pharmaceutically-acceptable carrier.
  • pharmaceutically-acceptable carrier diluent or excipient
  • a pharmaceutically-acceptable carrier diluent or excipient
  • a variety of carriers well known in the art may be used. These carriers may be selected from a group including sugars, starches, cellulose and its derivatives, malt, gelatine, talc, calcium sulfate, vegetable oils, synthetic oils, polyols, alginic acid, phosphate buffered solutions, emulsifiers, isotonic saline, and pyrogen-free water.
  • any suitable route of administration may be employed for providing a patient with the pharmaceutical composition of the invention.
  • oral, rectal, parenteral, sublingual, buccal, intravenous, intra- articular, intra-muscular, intra-dermal, subcutaneous, inhalational, intraocular, intraperitoneal, intracerebroventricular, transdermal and the like may be employed.
  • Intra-muscular and subcutaneous injection is appropriate for administration of immunogenic agents of the present invention.
  • Dosage forms include tablets, dispersions, suspensions, injections, solutions, syrups, troches, capsules, suppositories, aerosols, transdermal patches and the like.
  • dosage forms may also include injecting or implanting controlled releasing devices designed specifically for this purpose or other forms of implants modified to act additionally in this fashion.
  • Controlled release of the therapeutic agent may be effected by coating the same, for example, with hydrophobic polymers including acrylic resins, waxes, higher aliphatic alcohols, poiylactic and polyglycolic acids and certain cellulose derivatives such as hydroxypropylmethyl cellulose.
  • the controlled release may be effected by using other polymer matrices, liposomes and/or microspheres.
  • compositions of the present invention suitable for administration may be presented as discrete units such as vials, capsules, sachets or tablets each containing a pre-determined amount of one or more immunogenic agent of the invention, as a powder or granules or as a solution or a suspension in an aqueous liquid, a non-aqueous liquid, an oil-in-water emulsion or a water-in-oil liquid emulsion.
  • Such compositions may be prepared by any of the methods of pharmacy but all methods include the step of bringing into association one or more immunogenic agents as described above with the carrier which constitutes one or more necessary ingredients.
  • compositions are prepared by uniformly and intimately admixing the agents of the invention with liquid carriers or finely divided solid carriers or both, and then, if necessary, shaping the product into the desired presentation.
  • Immunotherapeutic and Vaccine Antigen-specific cancer therapy
  • the above compositions may be used as an immunotherapeutic or prophylactic vaccine comprising a polypeptide and/or nucleic acid of the invention, or respective fragments thereof.
  • the vaccine comprises an immunogenic agent as described above.
  • the vaccine prevents, ameliorates or treats a human cancer, for example testicular, liver cancer, lung cancer, colorectal cancer, duodenal cancer, lymphoma, bone cancer, cervical, cancer breast and/or other known cancers.
  • a pharmaceutical composition comprising hVSMI and/or hVSM2 protein and/or peptide fragments thereof may be prepared, for example, as in J Immunol. 2004 Mar 1 ;172(5):3289-96, incorporated herein by reference. Accordingly, the invention extends to the production of vaccines comprising as actives one or more of the immunogenic agents of the invention. Any suitable procedure is contemplated for producing such vaccines. Exemplary procedures include, for example, those described in NEW GENERATION VACCINES (1997, Levine et al., Marcel Dekker, Inc. New York, Basel Hong Kong) which is incorporated herein by reference.
  • An immunogenic agent according to the invention can be mixed, conjugated or fused with other antigens, including B orTcell epitopes of other antigens. In addition, it can be conjugated to a carrier.
  • a haptenic peptide of the invention i.e., a
  • peptide which reacts with cognate antibodies, but cannot itself elicit an immune response can be conjugated with an immunogenic carrier.
  • immunogenic carriers include for example: thyroglobulin; albumins such as human serum albumin; toxins, toxoidsorany mutant cross reactive material (CRM) of the toxin from tetanus, diptheria, pertussis, Pseudomonas, E.
  • coli coli, Staphylococcus, and Streptococcus; polyamino acids such as poly(lysine:glutamic acid); influenza; Rotavirus VP6, Parvovirus VP1 and VP2; hepatitis B virus core protein; hepatitis B virus recombinant vaccine and the like.
  • a fragment or epitope of a carrier protein or other immnogenic polypeptide may be used.
  • a haptenic peptide of the invention can be coupled to a T cell epitope of a bacterial toxin, toxoid or CRM.
  • U.S. Patent No 5,785,973 which is incorporated herein by reference.
  • the vaccines can also contain a physiologically-acceptable carrier, diluent or excipient such as water, phosphate buffered saline and saline.
  • the vaccines and immunogenic agents may include an adjuvant as is well known in the art. Suitable adjuvants include, but are not limited to adjuvants for use in human for example SBAS2, SBAS4, QS21 or ISCOMs.
  • the immunogenic agents of the invention may be expressed by attenuated viral hosts.
  • attenuated viral hosts is meant viral vectors that are either naturally, or have been rendered, substantially avirulent.
  • a virus may be rendered substantially avirulent by any suitable physical (e.g., heat treatment) or chemical means (e.g., formaldehyde treatment).
  • Attenuated viral hosts may comprise live viruses or inactivated viruses.
  • Attenuated viral hosts which may be useful in a vaccine according to the invention may comprise viral vectors inclusive of adenovirus, cytomegalovirus and preferably pox viruses such as vaccinia (see for example Paoletti and Panicali, U.S. Patent No. 4,603,112 which is incorporated herein by reference) and attenuated Salmonella strains (see for example Stacker, U.S.
  • Multivalent vaccines can be prepared from one or more different epitopes of hVSMI and/or hVSM2.
  • a recombinant vaccinia virus may be prepared to express a nucleic acid according to the invention. Upon introduction into a host, the recombinant vaccinia virus expresses the immunogenic agent, and thereby elicits a host CTL response.
  • U.S. Patent No 4,722,848, incorporated herein by reference which describes vaccinia vectors and methods useful in immunization protocols.
  • nucleic acid of the invention may be used as a vaccine in the form of a "naked DNA" vaccine as is known in the art.
  • an expression vector of the invention may be introduced into a mammal, where it causes production of a polypeptide in vivo, against which the host mounts an immune response as for example described in Barry, M. et al., (1995,
  • DC Dendritic cells
  • DCs are antigen presenting cells capable of initiating an antigen-specific T-cell response in an animal.
  • DCs may be isolated from various locations of an animal's body, including peripheral blood. Methods for in vitro proliferation and expansion of DC precursors have been described, for example in US Patent No. 5,994,126, incorporated herein by reference.
  • Dendritic cell therapy refers to therapeutic cancer vaccines or cellular vaccines used for tumour immunotherapy as a method for treating cancer.
  • Dendritic cell therapy typically involves isolating DC from a patient, culturing the isolated DC in the presence of a tumour-associated antigen or transfecting the isolated DC with a nucleic acid encoding a tumour- associated antigen ("antigen loading or pulsing"), and administering the antigen loaded or transfected DCs to the patient.
  • a tumour-associated antigen or transfecting the isolated DC with a nucleic acid encoding a tumour- associated antigen
  • antigen loading or pulsing a nucleic acid encoding a tumour- associated antigen
  • Preferred forms of immunotherapy include: expressing hVSMI and/or hVSM2 protein or fragments thereof in DCs (preferably DCs isolated from a patient to receive DC therapy), exposing the DCs to autologous T cells to generate cytotoxic T cells (CTLs) and administering the CTLs to the patient; and fusing tumour cells expressing hVSMI and/or hVSM2 with DCs and used to induce immune response and increase tumour vaccine immunogenicity.
  • DCs preferably DCs isolated from a patient to receive DC therapy
  • CTLs cytotoxic T cells
  • MCM Monocyte-conditioned media
  • Adherent monocytes are cultured in 1 ,000 U/ml GM-CSF and 800 U/ml IL-4 and MCM is added to mature the CDs.
  • MCM is preferably supplemented with 10 ng/ml GMP-rhu TNF- ⁇ .
  • the mature DCs are pulsed with hVSMI and/or hVSM2 or fragments thereof as antigen.
  • a recall antigen is included in one embodiment.
  • the recall antigen is tentanus toxoid (TT) or tuberculin.
  • the DCs preferably are cultured in the presence of the antigens for the last 6-48 hours of culturing before harvest, preferably the last 8-24 hours, more preferably the DCs are cultured in recall antigen for the last 24 hours and hVSM1/2 antigen for the last 8 hours of culture.
  • the DCs are preferably harvested at day 7 and pulsed again with antigen for 60 minutes.
  • One or more vaccinations are administered to a subject.
  • the vaccinations into the skin preferably comprise 1.5 x10 6 - 3.0x10 6 pulsed DCs and IV vaccinations preferably comprise 6-12x10 6 pulsed DCs.
  • composition comprising Antibodies Capable of
  • Binding hVSMI and/or hVSM2 or fragment thereof Humanized/chimerized monoclonal antibodies, or fragments thereof, capable of binding to hVSMI and/or hVSM2 native and recombinant protein or fragments thereof may be used to target tumours by: (1 ) conjugation directly or indirectly to radioactive isotopes (eg terbium-149, bismuth-213 or actinium-225 or other suitable isotopes known in the art) or (2) conjugation directly or indirectly to toxins (eg. pseudomonas exotoxin A) or chemicals - targeted chemotherapy or chemoimmunotherapy (eg geldanamycin conjugated to antibody, Gemtuzumab ozogamicin).
  • radioactive isotopes eg terbium-149, bismuth-213 or actinium-225 or other suitable isotopes known in the art
  • toxins eg. pseudomonas exotoxin A
  • isotopes and toxins including chemicals, known in the art may be selected by a skilled person for a particular application.
  • Humanized antibodies themselves capable of binding either or both hVSMI and/or hVSM2 may be particularly therapeutic if hVSM1/2 is shown to be involved in tumorigenesis.
  • Such antibodies preferably comprise monoclonal antibodies, more preferably, monoclonal antibodies conjugated or otherwise coupled to a radioactive isotope or toxin as discussed above.
  • anti-hVSM1 and anti-hVSM2 antibodies may lack a radioactive isotope or toxin, and a secondary antibody capable of binding to the anti-hVSM1 and anti-hVSM2 antibodies may comprise a radioactive isotope or toxin.
  • the invention also extends to a method of identifying an immunoreactive fragment of a polypeptide, variant or derivatives according to the invention.
  • This method essentially comprises generating a fragment of the polypeptide, variant or derivative, administering the fragment to a mammal; and detecting an immune response in the mammal.
  • a variety of predictive methods may be used to deduce whether a particular fragment can be used to obtain an antibody that cross- reacts with the native antigen. These predictive methods may be based on amino-terminal or carboxy-terminal sequence as for example described in Chapter 11.14 of Ausubel et al., supra. Alternatively, or in addition, these predictive methods may be based on predictions of hydrophilicity as for example described by Kyte & Doolittle 1982, J. Mol. Biol. 157 105 and Hopp
  • a peptide fragment consisting of 10 to 15 residues provides optimal results. Peptides as small as 6 or as large as 20 residues have worked successfully. Such peptide fragments may then be chemically coupled to a carrier molecule such as keyhole limpet hemocyanin (KLH) or bovine serum albumin (BSA) as for example described in Sections 11.14 and 11.15 of Ausubel et al., supra).
  • KLH keyhole limpet hemocyanin
  • BSA bovine serum albumin
  • the peptides may be used to immunize an animal as for example discussed above.
  • Antibody titers against the native or parent polypeptide from which the peptide was selected may then be determined by, for example, radioimmunoassay or ELISA as for instance described in Sections 11.16 and 11.14 of Ausubel et al., supra. Detection Methods and Diagnosis of a Disorder It will be well understood by a skilled person that detection of expression of hVSMI and/or hVSM2 may be performed using any of a variety of techniques, such as nucleic acid and protein based methods. Such methods include, for example, PCR, RT-PCR, real time RT-PCR, in
  • the sample comprises a biological sample isolated from an organism, including, for example, mammal (preferably human), fish, amphibian, plant, insect, yeast and parasite as described herein.
  • reagents including proteins, peptides, antibodies and nucleic acids, are selected based on the organism being examined.
  • nucleic acids and antibodies capable of binding hVSMI and/or hVSM2 are preferably used so that optimal binding and hybridisation are provided.
  • mouse homologs are preferably used.
  • hVSMI and/or hVSM2 proteins, nucleic acids and antibodies capable of binding hVSMI and/or hVSM2 may be used for non- human organisms, such as mice, rats, yeast, etc and vice versa.
  • Aberrant VSM1 and/or VSM2 expression in a subject, preferably a human may indicate presence of a disorder in the subject.
  • aberrant expression preferably comprises an increase in expression of either or both VSM 1 and/or VSM2 when compared with normal expression.
  • detection and/or an increase in anti-VSM1 and/or anti-VSM2 antibodies in blood of an animal preferably correlates with a disease or likelihood of a positive diagnosis of a disease.
  • the disease is preferably a cancer, as described herein.
  • An increase in expression comprises an increase from undetectable levels to a detectable level and from a low level to higher level of expression.
  • Aberrant expression may be detected by any method known in the art, including methods described herein. For example, in situ hybridisation, Western blot, ELISA, Northern blot and protein and nucleic acid arrays.
  • the disorder preferably comprises cancer, development and/or reproductive disorder. Diagnosis of a disorder hVSM1/2 has been shown herein to be expressed in the testis and in cancer cell lines and biopsy samples.
  • hVSM1/2 appear to share characteristics of Cancer-Testis (CT)-proteins, which usually elicit an antibody response to a CT-protein in a patient diagnosed with cancer. Accordingly, a healthy patient not having cancer is not expected to express antibodies to hVSMI or hVSM2 (and may be used as a negative control sample for a negative reference value), however, a cancer patient is likely to express antibodies to hVSMI and/or hVSM2. As such, the hVSM1/2 proteins (full-length protein or fragment thereof) may be used to detect antibodies against hVSMI and/or hVSM2 in blood, plasma and/or serum of a patient.
  • CT Cancer-Testis
  • hVSMI and/or hVSM2 protein fragments, variants and homologs may also be suitable for capturing an anti- VSM1 and/or hVSM2 antibody or antibody fragment in a sample.
  • Such hVSMI and/or hVSM2 protein fragments, variants and homologs may accordingly recognize or be capable of binding to anti-hVSM1 and/or anti- hVSM2 antibodies, for example, due to same or similar amino acid sequences.
  • the antibodies may be isolated or partially purified, for example, by affinity binding to a protein-A and/or protein G, ammonium sulfate precipitation and other methods known in the art, before assessing presence or absence of anti-hVSM1 and/or anti-hVSM2 antibodies in a sample.
  • Suitable detection methods may include ELISA, Western blotting, protein array and lateral flow strips.
  • one or more hVSMI and/or hVSM2 proteins, fragments, variants or homologs may be immobilized or attached to a solid surface such as a well of a plate, bead, chip or other surface known for such assays.
  • the assay may comprise capture and competition assays as are well known in the art.
  • appropriately labeled regents may be directly or indirectly coupled to primary and secondary antibodies and hVSMI and/or hVSM2 proteins, fragments, variants or homologs.
  • Labeled reagents include those known in the art, for example radioactive labels, color labels, fluorescent labels, gold, dendrimers and the like.
  • An hVSMI or hVSM2 fragment may comprise an amino acid sequence common to both hVSMI and hVSM2 so that antibodies capable of binding either hVSMI or hVSM2 may be detected.
  • the fragment may comprise an amino acid sequence specific for either hVSMI or hVSM2 so that an antibody specific for either hVSMI or hVSM2 may be detected.
  • Such protein fragments may be useful to also determine a relative ratio of anti-hVSM1 and anti-hVSM2 antibodies in a sample.
  • the sample may include, for example tissue, blood, serum plasma or other suitable sample.
  • the antibody in the sample is preferably selected from the group consisting of IgG, IgM, IgA and other immunoglobulin molecule or fragment thereof.
  • An assay for detecting anti-VSM1 and/or anti-VSM2 antibodies in a sample preferably includes the step of comparing results of an amount of binding, or lack of binding, of antibodies or fragments thereof in the sample with a reference amount.
  • the reference amount preferably includes a positive and negative control for binding.
  • a negative reference amount may preferable comprise an amount of anti-hVSM1 and/or anti-hVSM2 antibody in a normal sample or sample known to be lacking anti- VSMI and/or anti-VSM2 antibodies and a positive reference amount may comprise a sample known to comprise anti-VSM1 and/or anti-VSM2 antibodies.
  • a reference amount of VSM1 and/or VSM2, preferably hVSMI and/or hVSM2 protein, homolog, variant and fragment thereof is preferably determined from an amount of hVSMI and/or hVSM2 protein, homolog, variant and fragment thereof in a normal sample. It will be appreciated that an amount includes a concentration.
  • hVSMI and/or hVSM2 protein expression in a tissue sample preferably tissues suspected for comprising aberrant cells, preferably cancerous cells may also be detected by ELISA, Western blotting, immunohistochemistry, immunofluorescence, lateral flow assays, protein arrays and other protein (including antibody) based technologies known in the art to detect protein expression using anti-hVSM1 and/or hVSM2 antibodies.
  • the sample may comprise any suitable tissue including blood and solid tissue, for example tissue isolated by biopsy.
  • Antibodies, polyclonal and/or monoclonal, capable of binding and thereby detect hVSMI and/or hVSM2 may be generated by methods described herein and known in the art.
  • An antigen used for generating the anti-hVSM1 and/or anti-hVSM2 antibodies preferably comprises hVSMI and/or hVSM2, or fragments thereof, for example fragments unique for either hVSMI or hVSM2.
  • hVSMI and/or hVSM2 homologs, variants and derivatives may also be suitable antigen for generating antibodies capable of binding hVSMI and/or hVSM2.
  • Nucleic acid based method may also be used to detect hVSMI and/or hVSM2 for diagnosis of cancer.
  • expression of hVSM1/2 RNA can be detected and measured by Northern blotting, RT-PCR, real-time RT-PCR, in-situ hybridization, microarray and other nucleic acid based methods known in the art.
  • a nucleic acid amplification based method may comprise primers capable of hybridising with target nucleic acids of hVSMI and/or hVSM2.
  • the primers may hybridize with both hVSMI and hVSM2, such as nucleic acids 5'- CCGGGATCCCAAGTGACGATGCTC-3' (SEQ ID NO: 15) and 5'-GGCTCGAGTTAATGCTCTTTTCGT-3' (SEQ ID NO: 16) or the primers may be specific for hVSMI , for example 5' CGATATCGTGGTTTTACTGCA 3' (SEQ ID NO: 11 ) and 5' CTGTCCAGGGTGCTGTG 3' (SEQ ID NO: 12) or specific for hVSM2, for example 5' CTGGACATGCTTAAACGGCA 3' (SEQ ID NO: 13) and 5' TACCCATCAATAACAAGTATTGAA 3' (SEQ ID NO: 14).
  • hVSMI and/or hVSM2 Analysis of methylation pattern of hVSM1/2 genes in genomic DNA from cancer tissues (biopsies) may indicate expression of these proteins. Aberrant expression of either or both of these genes may indicate presence of cancer in a subject. Methods common in the art may be used to assess methylation of hVSMI and/or hVSM2, which preferably is correlated with a disorder, preferably a cancer as described herein. Detecting Reproductive disorders Reproductive disorders, in particular testicular disorders maybe determined by examining expression of hVSMI and/or hVSM2 in the testis, preferably in Sertoli cells, using any one or more of the protein or nucleic acid based detection methods known in the art, and those described herein.
  • Aberrant expression of either or both hVSMI and/or hVSM2 may diagnose or provide an indication of a reproductive disorder.
  • Aberrant expression comprises a different level and/or pattern of expression of hVSMI and/or hVSM2 in a sample when compared with a normal sample.
  • a lack of expression, or a lack of an increase in expression, of hVSMI in testis during onset of spermatogenesis preferably indicates a reproductive disorder.
  • a lack of a reduction of hVSM2 expression in testis during onset of spermatogenesis indicates a reproductive disorder.
  • the sample may be isolated from the testis, for example as a biopsy, and preferably assessed by in situ methods or other methods known in the art.
  • the disorder preferably comprises idiopathic oligozospermia, Sertoli cell tumours and Carney's complex.
  • a presence and/or absence or decrease in a concentration, or amount, of antibodies in blood from a patient may be used as a measure of efficacy of a treatment or therapy.
  • antibodies may be detected in a patient's blood or serum before and during treatment by a pharmaceutical composition.
  • a decrease in antibody concentration for hVSM1/2 may provide an indication that the pharmaceutical composition may be providing a positive effect.
  • Antibodies may be detected using any suitable method as described herein, for example, ELISA, Western blotting, protein array, lateral flow assay comprising hVSM1/2 proteins orfragments, including methods described herein.
  • a cell line that expresses hVSMI and/or hVSM2, preferably high levels of hVSMI and/or hVSM2, may be identified using above techniques.
  • SK Hep1 human hepatocarcinoma
  • Other useful cell lines preferable include HuTU ⁇ O, Hun7, LMTK, NIN3T3 or C1C12.
  • Such cell lines may be used to screen actives, agents or compounds for potential use as pharmaceutical compositions for treating or improving health of a patient, preferably a cancer patient, or preventing a disorder, preferably cancer in a person.
  • hVSMI and/or hVSM2 can be monitored by any one or more of the nucleic acid and/or protein based methods described herein, for example, ELISA, Western blotting, immunofluorescence; Northern blotting, RT-PCR, Real-time RT-PCR, methylation analysis and the like.
  • a modulation, preferably a decrease in hVSMI and/or hVSM2 expression, protein and/or nucleic acid, after administration of the active or the pharmaceutical preferably correlates with the active or pharmaceutical as being capable of improving, preventing and/or treating a disorder, such as cancer.
  • Other organism alternatively or in addition to a cell line may be used to screen for an active, preferably an active as a potential cancer therapeutic.
  • a level of VSM protein, nucleic acid or anti-VSM antibody is determined in an organism, the active is administered to the organism and the level of VSM protein, nucleic acid or anti-VSM antibody is determined after administration of the putative active.
  • a modulation, preferably a decrease, in the level of VSM protein, nucleic acid or anti-VSM antibody preferably indicates that the active is potentially efficacious.
  • the active is efficacious as a cancer therapeutic.
  • the organism comprises fish, mammal, bird, cell, parasite and the like. More preferably, the organism comprises a laboratory animal, preferably a primate or rodent, such as a mouse or rat.
  • the fish comprises zebra fish.
  • an endogenous form of VSM1 and/or VSM2 protein, nucleic acid or anti-VSM1 and/or anti-VSM2 antibody is measured in the organism.
  • mVSM1 and/or mVSM2 protein, nucleic acid or anti-mVSM1 and/or anti-mVSM2 antibody is measured in mouse.
  • non-human cells preferably non-human cell lines, may be used that preferably express VSM1 and/or VMS2. It is preferred that an endogenous form of VSM1 and/or VSM2 protein, nucleic acid or antibody is measured, for example mVSM1 and/or mVSM2 in a mouse cell line.
  • a microarray uses hybridization-based technology that, for example, may allow detection and/or isolation of a nucleic acid by way of hybridization of complementary nucleic acids.
  • a microarray provides a method of high throughput screening for a nucleic acid in a sample that may be tested against several nucleic acids attached to a surface of a matrix or chip.
  • a skilled person is referred to Chapter 22 of CURRENT PROTOCOLS IN MOLECULAR BIOLOGY (Eds. Ausubel et al. John Wiley & Sons NY, 2000).
  • One feature of the invention relates to an array comprising nucleic acids encoding at least a part of hVSMI , hVSM2 or a homolog or ortholog thereof.
  • the nucleic acids may be of any length, for example a polynucleotide or oligonucleotide as defined herein. Each nucleic acid occupies a known location on an array. A nucleic acid target sample probe is hybridised with the array of nucleic acids and an amount or relative abundance of target nucleic acid hybridised to each probe in the array is determined. High-density arrays are useful for monitoring gene expression. Fabrication and use of high density arrays in monitoring gene expression have been previously described, for example in WO 97/10365, WO 92/10588 and US Patent No. 5,677,195, all incorporated herein by reference.
  • high-density oligonucleotide arrays are synthesised using methods such as the Very Large Scale Immobilised Polymer Synthesis (VLSIPS) described in US Patent No. 5,445,934, incorporated herein by reference.
  • VLSIPS Very Large Scale Immobilised Polymer Synthesis
  • DGGE also exploits T m differences, but uses differential electrophoretic migration through gradient gels as a means of distinguishing subtle nucleotide sequence differences between alleles. Examples of DGGE methods can be found in Fodde & Losekoot, 1994, and United States Patents 5,045,450 and 5,190,856.
  • Detection Kits The present invention also provides a kit for detection of expression of hVSMI and/or hVSM2 in a biological sample.
  • kits will comprise one or more agents described above depending upon the nature of the test method employed.
  • the kits may include one or more of a polypeptide, fragment, variant, derivative, antibody, antibody fragment or nucleic acid according to the invention.
  • the kits may also optionally include appropriate reagents for detection of labels, positive and negative controls, washing solutions, dilution buffers and the like.
  • an antibody- based detection kit may include (i) a polypeptide, or fragment or variant thereof according to the invention (which may be used as a positive control or capture agent), (ii) an antibody according to the invention (preferably a monoclonal antibody) which binds to hVSMI and/or hVSM2 or fragment thereof in (i), and (iii) a suitable means for detecting a complex formed between a target (eg. hVSM1/2 in a sample) and the antibody in (ii), the detection means may include, for example colloidal gold, enzyme, radioactive isotope and/or florescent compound.
  • a detection means comprises a detectable agent.
  • Such a kit may comprise components selected by a skilled person to perform a desired detection assay.
  • the kit may comprise one or more VSM1 and/or VSM2 proteins, including fragments, variants and homologs thereof to capture an antibody in the sample.
  • Appropriate secondary antibodies and labelling reagents may be used to detect binding between the antibody in the sample and the capture protein or peptide.
  • standard competition assays that are common in the art may be used, for example, an anti-VSM1 and/or anti- VSM2 antibody may be labelled directly or indirectly, which may compete with an antibody in the sample for binding to a VSM1 and/or VSM2 peptide.
  • a decrease in binding between the labelled antibody and the VSM1 and/or VSM2 capture peptide indicates presence of anti-VSM1 and/or anti-VSM2 antibodies in the sample.
  • the VSM1 and/or VSM2 peptide may be immobilised on a surface, for example, bead, chip, lateral flow strip, and the like as is known in the art.
  • a kit may also comprise components for an in situ hybridisation assay as described herein.
  • a nucleic acid based detection kit will contain one or more particular agents, for example hVSM1/2 nucleic acids and fragments thereof as described above.
  • a nucleic acid amplification based kit may comprise primers capable of hybridising with target nucleic acids of hVSMI and/or hVSM2.
  • the primers may hybridize with both hVSMI and hVSM2, such as nucleic acids 5'- CCGGGATCCCAAGTGACGATGCTC-3' (SEQ ID NO: 15) and 5'-GGCTCGAGTTAATGCTCTTTTCGT-3' (SEQ ID NO: 16) or the primers may be specific for hVSMI , for example 5' CGATATCGTGGTTTTACTGCA 3' (SEQ ID NO: 11 ) and 5' CTGTCCAGGGTGCTGTG 3' (SEQ ID NO: 12) or specific for hVSM2, for example 5' CTGGACATGCTTAAACGGCA 3' (SEQ ID NO: 13) and 5' TACCCATCAATAACAAGTATTGAA 3' (SEQ ID NO: 14).
  • Primers may also comprise those set forth as SEQ ID NOS: 17-20 and 31-38. It will also be appreciated that for an amplification based kit, nested primers may be used as is known in the art.
  • a target nucleic acid may comprise a region of known divergence between homologs and orthologs, for example a region wherein the nucleotide sequence is not conserved between hVSMI and hVSM2 as described above.
  • the nucleic acid may be amplified according to methods known in the art, for example PCR, RT-PCR, real time RT-PCR and the like. The amplified nucleic acid can be compared with reference nucleic acids.
  • PCR products may also be hybridised with a detectable agent or probe, for example a gold-labelled, enzymatically labelled or radioactively labelled nucleic acid.
  • a detectable agent or probe for example a gold-labelled, enzymatically labelled or radioactively labelled nucleic acid.
  • Monoclonal antibodies against transferrin receptor were purchased from Zymed Laboratories, San Francisco, CA. Antibodies against syntaxin 6 and EEA1 were purchased from Transduction Laboratories (Kentucky). Brefeldin A, nocodazole, chloroquine, rabbit IgG, mouse IgG, and serum agarose were purchased from Sigma-Aldrich Chemicals, Castle Hill, Australia. All secondary antibodies were purchased from Molecular Probes, Eugene, OR. Oligonucleotides were obtained from Sigma Genosys, Castle Hill, Australia. All cell culture media and reagents were purchased from Invitrogen, Mulgrave, Australia. Fetal calf serum was a product of Hyclone.
  • Hybond C+, GST- and CNBr-activated Sepharose were obtained from Amersham Biosciences, Castle Hill, Australia.
  • Northern Blot Analysis A probe corresponding to the RVP domain of human VSM1 was generated by PCR using the following primers: RVP-F (5'- CCGGGATCCCAAGTGACGATGCTC-3'; SEQ ID NO: 6) and VSM1-R (5'- GGCTCGAGTTAATGCTCTTTTCGT-3'; SEQ ID NO: 7) and cloned into the pGEX-KG vector after digestion with Bam ⁇ and Xho ⁇ . The probe was excised from the vector and gel purified using the QIAEX II gel purification kit
  • the probe was incubated with a NeverFail hi 03 human multiple tissue Northern blot (RNWAY Laboratories, Seoul, Korea) overnight in ExpressHyb hybridization solution (BD Biosciences, Palo Alto, CA, USA).
  • the blot was washed as follows: three times 15 minutes in 2x SSC, 0.1 % SDS at room temperature, two times 15 minutes in 0.5x SSC, 0.1 % SDS at room temperature, two times 15 minutes in 0.2x SSC, 0.1 % SDS at room temperature and two times 15 minutes in 0.1x SSC, 0.1 % SDS at room temperature.
  • the blot was wrapped and exposed to X-ray film.
  • hVSMI was cloned into three different mammalian expression vectors- pDmyc-Neo, pCDNAmyc/His 3.1 (clontech, and pEGFP-N1 (Clontech). The first two vectors were used for generating protein with a myc-epitope tag, one at its amino terminal and the other at its carboxyl terminal. The pEGFP-N1 vector was used to tag the protein with the green fluorescent protein (GFP). DNA sequence of these constructs were confirmed and the constructs were transfected into the human embryonic kidney cell line, HEK-293. Stable cell lines were obtained by selection with G418. Recombinant protein
  • hVSMI was amplified by PCR, digested with BamH ⁇ and Xho ⁇ and ligated into the corresponding sites of the pGEX-KG vector to generate an amino terminal GST-fusion protein.
  • Recombinant protein was purified using GST-Sepharose beads as previously described. Purified protein on GST-beads were cleaved with thrombin to generate recombinant protein without the GST tag. Thrombin cleavage of the recombinant protein also resulted in cleavage of hVSMI after amino acid 83. resulting in retention of all of the GST tag on the beads and release of the remainder of the protein in the supernatant. Antibodies
  • Antibodies to the purified recombinant protein were raised in rabbits. Antibodies were affinity purified by sequential passage of serum though a GST- and a GST-hVSM1 -cyanogen bromide-activated Sepharose column essentially as described. After extensive washing, hVSMI -specific antibodies were eluted with glycine buffer, dialyzed against PBS and stored at -20°C in 10% glycerol.
  • HEK-293 human embryonic kidney
  • LoVo colonal adenocarcinoma
  • HuTu 80 duodenal adenocarcinoma
  • HepG2 hepatocellular carcinoma
  • Huh 7 hepatoma
  • SK Hep-1 hepatic adenocarcinoma
  • U-2 OS bone osteosarcoma
  • HeLa cervical adenocarcinoma
  • MCF7 p53-deficient breast adenocarcinoma
  • MCF10a p53-positive breast adenocarcinoma
  • A549 and NCI292 lung cancer
  • Mouse cell lines used were: TM3 (normal testis, Leydig), TM4 (normal testis, Sertoli), RAW 264.7 (macrophage), LMTK- (adipose), NIH3T3 (embryonic fibroblast), C2C12 (myof ibroblast), AML-12 (normal hepatocye) and Hepa 1- 6 (hepatoma).
  • testis tissue was gently disrupted on ice using a Dounce homogenizer with IMDM containing 5% FBS. Cell suspensions were then pooled and briefly allowed to settle on ice. The supernatant was then placed in a fresh tube and stored on ice until incubation with lectin. Preparation of lectin coated dishes
  • Datura Stramonium agglutinin (Sigma-Aldrich Chemicals, Castle Hill, Australia) was used at a concentration of 5ug/ml in PBS. 25cm 2 tissue culture flasks were coated by incubation with 1 ml of lectin coating the bottom surface for 1 hour at 37°C, followed by extensive washing with PBS supplemented with 0.5% FBS. Sertoli cell purification
  • the mixed population of cells obtained by enzymatic digestion was plated on lectin coated dishes at a concentration of 4x10 5 cells/ml and incubated for 1 hour at 37°C, 5% C0 2 . After incubation, non adhering cells were removed by washing twice with medium. Cells were then grown overnight in supplemented IMDM supplemented with HEPES (15mM), nonessential
  • Sertoli cells were grown overnight on coverslips, the media removed and replaced with IMDM containing 5% FBS and either chloroquine (100mM),
  • anti-hVSM1 10 ⁇ g/ml
  • anti-transferrin receptor 10 ⁇ g/ml
  • anti-syntaxin 6 anti-transferrin 6
  • EEA1 (2 ⁇ g/ml) in FDB (5% fetal bovine serum, 5% normal goat serum, 2%
  • Sections were incubated with the hVSMI antibody, at a concentration of 10ug/ml, overnight at 4°C. Negative controls were treated with rabbit IgG at a concentration of 10ug/ml. The sections were washed extensively, and then incubated with goat anti-rabbit Alexa 488 secondary antibody. Slides were mounted using Vectashield aqueous mountant and stored at 4°C until viewing. ALLN drug treatment of transfected cells
  • Cells were grown to 70% confluency and transfected with myc-tagged wildtype ubiquitin (C7) and myc-tagged mutant ubiquitin (C8) constructs. Twenty-four hours after the transfection, the cells were treated with either 10
  • ALLN 0.2% DMSO
  • DMSO 0.2% DMSO
  • Both ALLN and DMSO were diluted in RPMI with 10% FCS.
  • Indirect Immunofluorescence Assay Cells were grown on 2.5cm 2 coverslips in 30mm dishes until they were 50-70% confluent. Cells were rinsed 2 to 3 times in PBSCM (PBS with 1 mM CaCI 2 and 1 mM MgCI 2 ) and fixed in ice cold 3% paraformaldehyde (PFA) in PBS for 15 minutes followed by two more washes in PBSCM. The cells were then treated with 100 mM ammonium chloride for 5 minutes and then rinsed twice again with PBSCM. Cells were then permeabilised with 0.1 % saponin in PBSCM for 15 minutes. The cells were incubated for 1 hour with 10
  • FDB fluorescence dilution buffer
  • mice Alexa 594 for 45 minutes The cells were washed with 0.1% saponin in PBSCM to remove non-specifically bound secondary antibody. A final wash in PBSCM was given to the cells before being mounted onto glass slides with Vectashield mounting media and sealed with nailpolish.
  • Indirect immunofluorescence microscopy images were captured using a Leica TCS SP2 confocal microscope with a 63X oil-immersion objective. Lasers used were the Krypton/Argon and Helium/Neon.
  • hVSMI and hVSM2 are homologs of yeast VSM1
  • FIGS. 1 and 2 depict the nucleotide and deduced amino acid sequence of hVSMI and hVSM2 respectively. A number of other orthologs of both hVSMI and hVSM2 have been identified by similar homology searches. These are detailed in Tables 1 and 2. At the time this study was initiated, only human EST clones corresponding to hVSMI were available. An IMAGE clone corresponding to hVSMI was purchased and sequenced.
  • hVSMI has a transcript length of 2589 bp and is composed of 396 amino acids with an estimated molecular weight of 44,124. It has a negative charge of -5.5 and a pi of 5.4890.
  • Figure 3 shows a comparison of human VSM1 , VSM2 and yeast VSM1 EXAMPLE 3
  • VSM1 is located directly upstream of the MAG1 gene. Both VSM1 and MAG1 are differentially regulated.
  • a search of the Ensembl database using the human nucleotide sequences shows that hVSMI is present on chromosome 11q22.3 between markers D11S4670 and D11S2909. (ENSEMBL ace number Q8WTU0), juxtaposed to a number of genes implicated in DNA damage repair including ATM1 and NPAT. This region of the chromosome has also been implicated in a number of clinical conditions where it has been found to be transposed or lost (OMIM 603040, 105580)).
  • hVSMI is present as an intronless single exon gene and is situated in intron 1 in the opposite orientation of the
  • SCDGFB1 spinal cord-derived growth factor ⁇ -isoform 1
  • SCDGFB1 has a gene length of 227 kb, 8 exons, and an mRNA of 4084 bp which encodes a protein of 370 amino acids.
  • the mouse ortholog, mVSM1 is also present on the syntenic chromosome 9 A1 and has a similar genomic organisation, a single exon with a transcript of 1227 bp encoding a protein of 408 amino acids. It has 79% identity to hVSMI .
  • hVSM2 is located on chromosome 1 p36.13. It comprises 4 exons and encodes a transcript of about 1500 bp.
  • chromosome 1 This region in chromosome 1 has also been implicated in clinical conditions such as breast cancer, melanoma, susceptibility to prostate and brain cancer, myelodysplastic syndrome, ovarian adenocarcinoma, non-Hodgkin's lymphoma, lung cancer (OMIM 222410, 155600, 603688).
  • mVSM2 is located on the syntenic chromosome 4D3.
  • Yeast VSM1 is 428 amino acids in length and has a calculated molecular weight of 47,300 with an isoelectric point of 4.79.
  • Human VSM1 is 396 amino acids long, has a calculated molecular weight of 44,100 and an isoelectric point of 5.42.
  • hVSM2 is 419 amino acids in length with a calculated size of 46.5 kDa and an isoelectric point of 4.83.
  • the primary amino acid sequences of yeast and human VSM proteins were analysed by similarity and homology searches using the GCG Bestfit and Protein Family (Pfam) programs.
  • Yeast VSM1 has an N-terminal Ubiquitin-like domain (UBL, UBQ), an aspartic acid retroviral protease-like (RVP) domain stretching from amino acids 199 to 302 and a C-terminal ubiquitin associated (UBA) domain from residues 390 to 428. Low complexity regions stretch from amino acid 338 to 389.
  • FIG. 4 is a schematic diagram that compares the structural similarity of human orthologs to yeast Vsm1.
  • hVSMI and 2 have similar domain structures.
  • hVSMI has a amino terminal UBL domain from amino acids 1 to 79 and a RVP domain from 239 to 343.
  • hVSM2 has an N-terminal UBL domain from 1 to 79 and a C-terminal RVP domain from amino acids 231 to 335. It has two regions with a weak propensity to form coiled coil (CC) domains between amino acids 180 and 208.
  • FIG. 4 presents a schematic diagram of hVSMI , hVSM2 and ScVSMI .
  • hVSMI and 2 both possess an amino terminal ubiquitin-like domain (UBL, UBQ) and a carboxyl-terminal retroviral aspartyl protease-like domain. Both proteins also have regions with a weak propensity to form coiled-coil domains. These structures have been implicated in protein-protein interactions.
  • hVSMI and hVSM2 are 74.% identical over 375 amino acid overlap
  • yeast VSM has 49% identity to hVSMI and 50% to hVSM2 over a 175 amino acid overlap.
  • a thrombin cleavage site in hVSMI present between amino acids 83 and 84, can potentially be used to distinguish hVSMI and hVSM2.
  • hVSM1/2 by assessed by Northern blot analysis.
  • a 300 bp radioactive probe corresponding to the C-terminal of hVSMI was hybridized to a commercial Northern blot of RNA isolated from 12 different tissues. As seen in FIG. 5, a band of approximately 2 kb was detected only in the RNA from testis (lane 8). The probe was designed so as to detect both hVSMI and 2.
  • a Glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA probe was used as a loading control.
  • Glyceraldehyde phosphate dehydrogenase (GAPDH) cDNA probe was used as a loading control.
  • VSM1 mammalian testis .
  • the expression of VSM1 was confined exclusively to one cell type within the seminiferous tubules, identifed as Sertoli cells, based on their morphology and location within the tubule.
  • Sertoli cells are tall columnar cells with very indented, irregular cell outline. The nucleolus lies near the base of the cell, which is attached to the basement membrane of the seminiferous tubule. Sertoli cells are arranged such that they can maintain physical contact with germ cells throughout spermatogenesis.
  • Sertoli cells can cordon off germ cell populations into environmentally distinct compartments of the seminiferous epithelium, and regulate the biochemical surroundings of the germ cells.
  • Sertoli cells provide critical factors necessary for the successful progression of germ cells into spermatozoa. These critical factors may be in the form of physical support, junctional complexes or barriers, or they may be biochemical stimulation in the form of growth factors or nutrients. Sertoli cells make specific products that are necessary for germ cells survival and those products combine to form a unique and essential environment in the adluminal compartment of the seminiferous tubule (14).
  • the staining observed in human, rat and mouse testis was perinuclear and extended through the cytoplasm of the cell towards the centre of the lumen in the form of filamentous structures. In some of the paraffin sections this appeared as very granular cytoplasmic staining, which is due to the fixation process, which is known to affect protein conformation and structure. Testes of C57bl/6 mice aged day one, three weeks, and five
  • hVSMI was detected at all time points. At day 1 the neonate's seminiferous tubules consist of spermatogonia, the germ cell of the testis, and still dividing Sertoli cells. Immunofluorescence analysis showed strong basolateral staining at intervals around the inner edge of the seminiferous tubule, where Sertoli cells would be expected. No cytoplasmic staining was observed, which is unsurprising, as it is probable that hVSMI has some transport role within the Sertoli cell in trafficking molecules to the haploid spermatocytes.
  • Sertoli cells in culture retain the morphology observed in vivo, with a tendency to polarise, that is the nucleolus at one end of the cell, and the cytoplasm extending away from the nucleolus. When allowed to grow to confluency, tubule-like structures develop as the cells retain some level of structural organisation in the absence of spermatogonial cells.
  • hVSM1/2 expression in vitro is identical to that described in the testes, with perinuclear localisation, and long, filamentous fibres extending away from the nucleolus towards the apex of the cell.
  • hVSM1/2 was colocalised with markers of various organelles. Syntaxin 6, a TGN marker, was found in close proximity to the perinuclear and part of the cytoplasmic staining for hVSM1/2. No colocalisation was present, but Syn ⁇ appeared to be contained within the hVSMI "fibres". EEA1 , an early endosomal antigen, did not colocalise with hVSM1/2. The filamentous staining pattern of hVSM1/2 throughout the cytoplasm occasionally resulted in some overlap of the two signals, however this appeared incidental. Transferrin receptor (TfR1), a recycling endosome marker, again showed some proximity to hVSM1/2, particularly in the perinuclear region.
  • TfR1 Transferrin receptor
  • HEK-293 cells were transfected with myc- and GFP-tagged hVSMI .
  • Stably expressing cell lines were analysed by confocal immunofluorescence microscopy, see FIG. 9.
  • the myc epitope was cloned fused to either its N- or C-terminal.
  • a similar expression pattern in the cells was observed with both proteins.
  • GFP-hVSM1 was also observed to give a similar staining pattern. Staining was observed in a juxtanuclear pattern with tubules originating from the structure.
  • VSM1/2 Endogenous expression of VSM1/2 in a variety of human and mouse cell lines was determined by immunoblotting of total cell homogenates, see FIG. 10A and 10B and TABLE 4. A doublet of approximately 45-50 kDa was observed with varying levels of expression in both human and mouse cell lines.
  • highest expression was observed in SK- Hep1 , with moderate expression in HuTu 80, Huh7, HeLa and MCF7.
  • Minimal expression was observed in HEK-293, LoVo, HepG2, U2-OS and MCF10a.
  • LMTK NIH3T3 and C2C12 cells, with moderate expression in the TM4 cell line.
  • the human cancer cell lines examined and shown in TABLE 4 include GCT (Giant Cell Tumour, a lung fibrous histocytoma), Tera2 (lung embryonal carcinoma), HEK293 (human embryonic kidney), LoVo (colorectal adenocarcinoma), HuTu 80 (duodenal adenocarcinoma), Hep G2 (hepatocellular carcinoma), Huh7 (hepatoma), SK Hep1 (liver adenocarcinoma), U-2 OS (bone osteosarcoma), Hela (cervical adnocarcinoma, MCF7 (p53 deficient breast adenocarcinoma), and MCF10a (p53 positive breast adenocarcinoma).
  • GCT General Cell Tumour, a lung fibrous histocytoma
  • Tera2 lung embryonal carcinoma
  • HEK293 human embryonic kidney
  • LoVo colonrectal adenocarcinoma
  • HuTu 80 du
  • TM3 normal testis leydig
  • TM4 normal testis sertoli
  • RAW 264.7 macrophage
  • LMTK adipose
  • NIH3T3 embryonic fibroblast
  • C2C12 muscle fibroblast
  • AML 12 normal hepatocyte
  • Hepa1-6 Hepatoma
  • the relative levels of expression were quantitative and collectively grouped as five major levels. These levels showed no expression, low, moderate, high, or very high levels of expression.
  • Western blots analysis indicated high levels of endogenous expression of hVsml in the human SK Hep1 cell line (FIG. 10A) and the mouse LMTK, NIH3T3 and C2C12 cell lines (FIG. 10B). Moderate expression was found in the human HuTu ⁇ O, Huh7, Hela and MCF7 and in mouse TM4 cell lines.
  • hVSM1/2 was only detected in homogenates from testis varying levels of expression in a number of normal and tumour cell lines was observed, see FIG. 11. In testis expression was only in the Sertoli cells with a predominantly perinuclear staining reminiscent of the Golgi apparatus. Expression of hVSM1/2 was examined in four different cell lines from lung and liver that were shown to express either high and low levels of hVSM1/2 as shown by immunoblotting. SK Hep1 , a human hepatocarcinoma cell line of endothelial origin was found to express high levels of hVSM1/2. The expression pattern was different to that observed in Sertoli primary culture, with a large perinuclear mass present, forming a "watch band" pattern of expression. Filamentous patterns were present, however they were thicker that those seen in Sertoli cells, with an arcing pattern. A similar staining pattern was also observed in the lung cancer cell line, A549. EXAMPLE 12
  • VSM1/2 in human lung cancer biopsies Using indirect immunofluorescence and confocal microscopy the expression of VSM1/2 was assayed in lung cancer biopsy sections, see FIG. 12. Significant expression ofVSM1/2 was detected in a number of lung cancers, EXAMPLE 13 hVSMI and Ubiquitin Co-localisation It appears that hVSMI associates with ubiquitin under normal conditions. Ubiquitin does not colocalise with hVsm1/2 when treated with ALLN. This suggests that by increasing ubiquitin levels and the accumulated misfolded proteins as a result of blocked proteasomal degradation prevents the ubiquitin-hVsml interaction.
  • a lysine-48 mutant ubiquitin lacks an ability to bind a misfolded protein and did not co-localise with hVsm1/2 (FIG. 131 and 13L).
  • elevated levels of hVsml as a result of 12 hours ALLN treatment was shown not to have an affect on ubiquitin mutant levels (FIG. 13G to 131).
  • Mutant ubiquitin was used for this experiment as a control for wildtype ubiquitin as it lacks the ability to tag misfolded and mutant proteins to be degraded by the proteasome. It was shown that for ALLN treated mutant ubiquitin, aggresome-like structures could still form.
  • the mock and pcDNA controls demonstrated that the localisation of hVsml was similar to that of the untreated transfected cells, indicating that the altered hVsml expression and localisation may not be due to the transfection reagents but the wildtype ubiquitin. Furthermore for ALLN treated cells, the levels of hVsml expression among all transfected cells including the mock transfection was decreased.
  • the experiment needs to be optimised possibly using a different cell line with either high endogenous hVsml expression that also localises to large juxtanuclear structures as well as transfecting hVsm1/2 in no endogenous expressing cell lines.
  • the human homolog of Rad23, hHR23a is a protein that is involved in nucleotide excision repair and belongs to a class of proteins that comprise UbL domains.
  • UbL domains have been shown to bind with high affinity to the 26S proteasome. (Mueller and Feigon., 2003).
  • the UbL domain of Rad23 has been previously shown to compete with ubiquitin for the proteasome (Lambertson et al., 2003). Not being bound by theory, it is proposed that this may be a same mechanism for the UbL domain of both hHRD23 and hVsm1/2.
  • the results showed that hVsm1/2 co-localises at least moderately with wildtype ubiquitin when not in the presence of ALLN. If hVsm1/2 and wildtype ubiquitin were competing for the proteasome, it may be expected that there would be an increase in expression levels of both proteins.
  • confocal microscopy was used to monitor expression and localisation of endogenous hVsml after exposure to the proteasome inhibitor, ALLN, see for example Kopito etal., 2000, Trends Cell Biol, 10524 and Johnston et al.,
  • hVsml expression in the presence of ubiquitin and the proteasome inhibitor and localisation of hVsml and wildtype ubiquitin were compared in response to ALLN treatment. Expression was determined using indirect immunofluorescence. SK Hep1 cells that have been shown to express high endogenous levels of hVsml through Western blot and indirect immunofluorescence, were chosen for the transient transfection. Mutant ubiquitin (mutated at lysine-4 ⁇ ) was used as a control. SK Hep1 cells were transfected with wildtype and mutant ubiquitin separately to identify localisation in comparison to hVsml .
  • hVsml was localised to a single large structure with foci found throughout the cytoplasm. It was unclear if this large structure was juxtanuclear as found in SK Hepl for endogenous hVsml . In addition to this, there was no microtuble staining. This data suggests that the affects of ALLN on the mutant ubiquitin transfected cells did not have qualitative affect on hVsml expression and localisation. hVsml was shown to form a large structure similar to the untransfected 12 hour ALLN treatment in SK Hepl cells.
  • UbL-CC domains and the Rvp domains were compared.
  • UbL containing proteins share a close relationship with the ubiquitin- proteasome pathway. Coiled-coil regions are required for SNARE activity.
  • hVsml possesses an N-terminal UbL domain, two CC domains and a C- terminal Rvp domain. Together the UbL-CC domains comprise 244 amino acids whilst the Rvp comprises of 152 amino acids.
  • Genetic constructs comprising GFP tagged UbL-CC and Rvp were made and transfected into HEK293 cells.
  • the full-length hVsml pEGFPNI construct was previously generated and transfected into HEK293 as a positive control.
  • Vector controls pEGFPNI and pEGFPCI were used as negative controls for the full-length and UbL-CC and Rvp respectively.
  • HEK293 was identified as a cell line that expressed low levels of hVsml based on Western blot and immunofluorescence analyses, making it a suitable cell line for transfection. The results indicated that the full-length hVsml protein localisation was mimicked by the UbL-CC protein domains localisation whilst the Rvp was representative of the pEGFPCI and pEGFPN2 vector controls.
  • hVSM2 Specific peptide in hVSM2
  • the following 29 amino acid peptide fragment of hVSM2 is present in hVSM2 (residues 390 - 419) and is absent in hVSMI . Accordingly, this peptide can be used to distinguish between hVSMI and hVSM2.
  • An antibody capable of binding this specific peptide may be capable of detecting and distinguishing between at least hVSMI and hVSM2.
  • This peptide, or fragment thereof may be used to elicit an immune response in an animal, such as a mouse, rabbit, goat or other animal for production of polyclonal and monoclonal antibodies specific for hVSM2.
  • a peptide comprising amino acids GQQQQRTPAAQRSQGLAS (SEQ ID NO: 7) corresponding to amino acids 113-131 of hVSMI , and SEQ ID NOS: 8 and 9, are not found in hVSM2 or ScVSMI .
  • This peptide may be used to distinguish hVSMI from hVSM2 and ScVSMI .
  • an antibody capable of binding to this peptide, or fragment thereof may be capable of detecting and distinguishing between hVSMI and hVSM2 and/or ScVSMI .
  • This peptide, or fragment thereof may be used to elicit an immune response in an animal, such as a mouse, rabbit, goat or other animal for production of polyclonal and monoclonal antibodies specific for hVSMI .
  • Presence of thrombin cleavage site in hVSMI A thrombin cleavage site is located after amino acid 83 in hVSMI . This site is absent in hVSM2.
  • Enzymatic digestion of one or more proteins using thrombin, separation the digested proteins by SDS-PAGE and Western blotting can be used to distinguish hVSMI and hVSM2 in proteins.
  • An extract, isolated protein preparation, partially isolated protein preparation and other preparations comprising one or more protein may be digested with thrombin.
  • the preparation is predicted to comprise either hVSMI and/or hVSM2.
  • PCR amplification product is 134 base pairs in length.
  • PCR amplification product is 261 base pairs in length.
  • the abovementioned primers have been used to perform RT- PCR on RNA isolated from a number of cell lines and cell line transfected with the human VSM1 cDNA. When separated by gel electrophoresis, a specific nucleic acid band corresponding to expected product of hVSM2 (261 bp) was detected in HEK-293, HepG2, SK-Hep1 and Huh 7 cells lines. These cell lines were negative for the hVSMI PCR product. Only RNA isolated from hVSMI transfected into HEK-293 cells was positive for the hVSMI PCR product of 134 bp. EXAMPLE 19 Analysis of hVSM1/2 antibodies in serum
  • hVSM1/2 may be used to bind serum antibodies. For example, a peptide comprising amino acids unique to either hVSMI or hVSM2 as herein described.
  • Serum antibody responses against the purified recombinant protein were tested by standard Western blot analysis using 1 ⁇ g of the purified protein and human serum at 1 :1 ,000, 1 :10,000, and 1 :100,000 dilutions. Briefly one microgram of protein was electrophoresed on a 12 %
  • VSM1/2 obtainable from any species including for example human and mouse, in hepatocytes and/or respiratory structures.
  • Transgenic mice comprising these constructs can be used to express mVSM1/2 in an inducible manner by adding the inducer doxycycline in drinking water. Tissue specific expression will be assayed by Western blotting of tissues isolated for uninduced and induced mice. These mice will be screened with various actives and the effect on expression of mVSM1/2 assayed by ELISA andWestem blotting of serum and tissue using recombinant mVSM1/2. It will be appreciated that other methods of protein detection as described herein may be used.
  • Immunofluorescence staining was performed with the hVSMI antibodies described above, and vimentin.
  • OCT embedded testis harvested from C57bl/6 mice aged one, three, five, seven, fourteen, and thirty five days post partum. Cryosections were cut at 3um and stored at -70 °C until use. Slides were thawed and rehydrated in 1xPBS. Non-specific staining was blocked by a 30 minute incubation with FDB (PBS, 1mMCaCI 2 and Mg Cl 2 , 5% normal goat serum, 5% FBS, 2%BSA). Sections were incubated with the hVSMI and Vimentin antibodies, at a concentration of 10ug/ml, for 1 hour at room temperature.
  • FDB FDB
  • Negative controls were treated with rabbit IgG at a concentration of 10ug/ml. The sections were washed extensively, and then incubated with donkey anti-rabbit Alexa 4 ⁇ and donkey anti mouse Alexa 594 secondary antibodies. Slides were mounted using Vectashield aqueous mountant and stored at 4°C until viewing. Confocal Microscopy Indirect immunofluorescence microscopy images were captured using a Leica TCS SP2 confocal microscope with a 63X oil- immersion objective. Lasers used were the Krypton/Argon and Helium/Neon.
  • Real-time reaction mixes contained 2 ⁇ l of
  • cDNA diluted 1 :10 or 1 :20
  • 200nM of each primer and SYBR green PCR master mix (Applied Biosystems, Warrington, UK). Reactions were performed on the Rotorgene RG3000 (Corbett Research, Brisbane, Australia) using the following conditions: 2 min denature at 95°C followed by 50 cycles of 95°C for 30 seconds, 55°C for 30 seconds and 72°C degrees for 90569
  • Sertoli cells are the first cells to differentiate recognisably in the indifferent gonad.
  • the Sertoli cell also ensures regression of the mullerian ducts via secretion of anti-mullerian hormone, an important step in male sexual differentiation.
  • Postnatal the role of the Sertoli cell switches during pubertyto the support of spermatogenesis. Without the physical and metabolic support of the Sertoli cells, germ cell differentiation, meiosis and transformation into spermatozoa would not occur (Sharpe et al, 2003, Reproduction 125 769).
  • the blood testis barrier created by tight junctions between mature Sertoli cells creates a microenvironment within the seminiferous tubules, isolating the haploid spermatocytes in the adluminal compartment from the rest of the testis.
  • the spermatocytes developing in the adluminal compartment become effectively sealed off from direct access to many nutrients and thus become dependent on the secretion of such factors by Sertoli cells. From this it can be seen that Sertoli cells have a major role in trafficking nutrients and growth factors from the circulation into the adluminal compartment to the developing spermatocytes.
  • mVSMI is expressed highly in mature testis, but at much lower levels during postnatal maturation.
  • mVSM2 is ubiquitously expressed in all tissues screened, and at constant levels during testis maturation, but reduces significantly at the onset of spermatogenesis.
  • Quantitative Real Time PCR of mouse tissue cDNA The investigators analysed expression of mVSMI and 2 in ten mouse tissues. cDNA was generated from brain, bone marrow, duodenum, heart, liver, lung, skeletal muscle, spleen and testis.
  • mVSMI fixation artifacts. mVSMI was detected at all time points. At day one the neonate's seminiferous tubules consist of spermatogonia, the germ cell of the testis, and actively dividing Sertoli cells.
  • the expected staining pattern of perinuclear and cytoplasmic fibres is present, and the cytoplasm extends into the lumen of the tubules, supporting a growing range of developmental stages of spermatocytes. At thirty five days pp, the male mouse has reached sexual maturity. The staining pattern observed, is similar to that found in rat and human Sertoli cells. Vimentin, a type III intermediate filament (IF) protein, is a major component of IFs, and is expressed during development in a wide range of cells, including mesenchymal cells and in a variety of cultured cell lines and tumors.
  • IF intermediate filament
  • IFs are essential for structure and mechanical integration of the cellular space and a variety of cellular functions such as mitosis, locomotion, and organizational cell architecture, whilst Vimentin has also been suggested to be involved in protein trafficking, cellular motility, and intracellular signalling (Ermakova et al, 2005, J Biol Chem published on February 15, 2005 as Manuscript M414185200; Show et al, 2003, Endocrinology 144 5530). Sertoli cells express the Vimentin through out development and adulthood (Franke et al, 2004, Anat Embryol 209 169).
  • Vimentin As part of the investigations into a possible role of VSM1 in Sertoli cell function, in particular protein transport, the investigators used Vimentin as a marker to co-stain with VSM1 , see FIG.25.
  • vimentin filaments surround the nucleus, giving it a characteristic "halo" appearance, and radiate out from the nucleus to the cell periphery, terminating near points of contact between the Sertoli cell and adjacent cells.
  • the points of contact include the tight junctions found between neighbouring Sertoli cells, the desmosome-like junctions located between the Sertoli cells, and early germ cells (ie spermatagonia and spermatocytes, and the ectoplasmic specialization junctions found between seroli cells and more advanced germ cells (ie round to elongated spermatids) (Show et al, 2003, Endocrinology 144 5530) .
  • Vimentin has a very similar morphology to VSM1 , with perinuclear staining, and extensive branching and structure extending into the centre of the lumen in mature testis. In immature testis it localises to the perinuclear region, with occasional fine branching.
  • VSM1 The stages of spermatogenesis vary from tubule to tubule, and within different regions of a tubule, as can be seen in a cross section of a mature testis. This pattern agrees with our hypothesis that VSM1 is involved in protein transport and general gamete support, as the extensive branching would not be required after spermiation, as the stages of differentiating cells would be much earlier in the process, and therefore closer to the basement membrane. On day 1 , no specific vimentin staining was observed. There is no information in the literature about expression patterns of this protein during testis maturation. VSM1 has basolateral and perinuclear staining. No fibres/extending into the centre of the tubule, as there are no haploid gametes to support at this point.
  • the gonocytes (sperm stem cells) are migrating from the centre of the tubule to the basement membrane.
  • Day 3 shows a very similar staining pattern to day one, and the processes described as occurring on day 1 (gonocyte migration etc) are still occurring.
  • Sertoli cells are displaying high mitotic activity, and the gonocytes are settling in between the Sertoli cells on the basement membrane.
  • the vimentin antibody begins to stain specifically.
  • the centre of the tubules are now empty, and the gonocytes have settled onto the basement membrane.
  • the high rate of mitotic activity in Sertoli cells continues. Vimentin is localising strongly to the basement membrane of the Sertoli cells, but also faintly extending around gonocytes towards the centre of the tubule.
  • VSM1 has similar staining, but much stronger. The majority of colocalisation occurs on the basement membrane. Little or no colocalisation of the fibres was observed. On day 14 basolateral localisation is observed, and the thicker fibers are colocalising as well.
  • the fibres branch into "y" shapes, as the gonocytes, which by this stage have differentiated into type A and B spermatogonia undergo meiotic differentiation into haploid early round spermatids (double copy of chromatids). The mature phase of the Sertoli cell is about to begin. Vimentin has been shown to stain at cell-cell points of contact, and VSM1 matches this.
  • WT1 and sox9, as well as other proteins cooperate to regulate the expression of target genes, including AMH, that mediate male sexual differentiation (Kent et al, 1996, Development 122 2813). WT1 expression in the mouse testis has been shown to increase steadily after birth, reaching the highest expression levels at day 8 post partum, and decreasing slightly as the animal matures. Other investigators have shown this via in situ hybridisation (Pelletier et al, 1991 ,
  • AMH is one of the first genes to be switched on in Sertoli cells after their differentiation in foetal life and is a marker of prepubescent development. At puberty (approx day 20 pp (Russo et al, 1999 Biology of reproduction 61 12123), AMH expression is severely down regulated, coincident with the appearance of meiotic germ cells and the final maturation of Sertoli cells (Rey et al, 2003, Molecular and Cellular Endocrinology 211 21).
  • Sox9 is the earliest known marker of differentiating Sertoli cells in the foetus, and is a key component of mammalian testis determination. After birth, Sox9 expression persists in the Sertoli cells through to adulthood, but it is never detected in the ovary (Morrish and Sinclair, 2002, Reproduction 124447; Kent et al, 1996, Development 1222813).
  • the time period of Day one to day 20 is a time of high mitotic activity in immature Sertoli cells. Barker et al (Baker et al, 2001 , Reproduction 122 227) observed that between days 1 and 5 there was a 4 fold increase in Sertoli population. The period between Day five and 20 showed a 1.6 fold increase in Sertoli cell numbers. After this time, no increase in Sertoli population was observed (Baker et al, 2001 , Reproduction 122 227). Comparing these observations with our real time PCR results, it appears that mVSMI is expressed at low levels whilst the Sertoli cells undergo an intense period of mitosis, and is upregualted once they mature, cease mitiotic activity, and form tight junctions.
  • the Sertoli cells cease dividing, whilst the gonocytes enter spermatogenesis, undergoing meiosis from approximately day twelve onwards, but only generating haploid gametes at days twenty to twenty-one (Sharpe et al, 2003, Reproduction 125 769).
  • the mature Sertoli cell is required to support the haploid gametes, who are now isolated from the circulation and nutrients, and depend on the Sertoli cells for nutrients and externally produced growth factors.
  • VSMI's postulated role in protein transport it may be involved in the support of gametes would be downregulated during mitosis, and only upregulated once the gametes appear.
  • Clarke DJ Mondesert G, Segal M, Bertolaet BL, Jensen S, Wolff M, Henze M, Reed SI. Dosage suppressors of pdsl implicate ubiquitin- associated domains in checkpoint control. Mol Cell Biol. 2001 Mar;21(6):1997-2007.
  • Bertolaet BL Clarke DJ, Wolff M, Watson MH, Henze M, Divita G, Reed SI.
  • UBA domains mediate protein-protein interactions between two DNA damage-inducible proteins. J Mol Biol. 2001 Nov 9;313(5):955-63.

Landscapes

  • Health & Medical Sciences (AREA)
  • Life Sciences & Earth Sciences (AREA)
  • Chemical & Material Sciences (AREA)
  • Immunology (AREA)
  • Organic Chemistry (AREA)
  • General Health & Medical Sciences (AREA)
  • Medicinal Chemistry (AREA)
  • Proteomics, Peptides & Aminoacids (AREA)
  • Molecular Biology (AREA)
  • Genetics & Genomics (AREA)
  • Engineering & Computer Science (AREA)
  • Biochemistry (AREA)
  • Oncology (AREA)
  • Cell Biology (AREA)
  • Biophysics (AREA)
  • Microbiology (AREA)
  • Analytical Chemistry (AREA)
  • Pathology (AREA)
  • Zoology (AREA)
  • Public Health (AREA)
  • Physics & Mathematics (AREA)
  • Veterinary Medicine (AREA)
  • Mycology (AREA)
  • Wood Science & Technology (AREA)
  • Animal Behavior & Ethology (AREA)
  • Biotechnology (AREA)
  • Hospice & Palliative Care (AREA)
  • Biomedical Technology (AREA)
  • Hematology (AREA)
  • Urology & Nephrology (AREA)
  • Epidemiology (AREA)
  • Pharmacology & Pharmacy (AREA)
  • Bioinformatics & Cheminformatics (AREA)
  • Pregnancy & Childbirth (AREA)
  • Reproductive Health (AREA)
  • Gynecology & Obstetrics (AREA)
  • General Physics & Mathematics (AREA)
  • Food Science & Technology (AREA)
  • Gastroenterology & Hepatology (AREA)
  • Toxicology (AREA)

Abstract

La présente invention a trait à la découverte d'acides nucléiques et de protéines exprimés dans le testicule et des cellules cancéreuses, notamment, le VSM1 et le VSM2, de préférence le VSM1 humain et le VSM2 humain. Le découverte fournit des procédés et des compositions destinés à être utilisés dans le diagnostic, l'amélioration et/ou la prévention du cancer et/ou d'anomalies de reproduction. En particulier, l'invention a trait à l'utilisation d'acides nucléiques et de protéines codant pour le VSM1 humain et/ou le VSM2 humain et à des anticorps capables de se lier aux dites protéines.
PCT/AU2005/000437 2004-03-24 2005-03-24 Cancer et acides nucleiques et proteines de testicule vsm1 et vsm2, et leurs utilisations WO2005090569A1 (fr)

Applications Claiming Priority (2)

Application Number Priority Date Filing Date Title
AU2004901544A AU2004901544A0 (en) 2004-03-24 Cancer and testis proteins and uses thereof
AU2004901544 2004-03-24

Publications (1)

Publication Number Publication Date
WO2005090569A1 true WO2005090569A1 (fr) 2005-09-29

Family

ID=34993704

Family Applications (1)

Application Number Title Priority Date Filing Date
PCT/AU2005/000437 WO2005090569A1 (fr) 2004-03-24 2005-03-24 Cancer et acides nucleiques et proteines de testicule vsm1 et vsm2, et leurs utilisations

Country Status (1)

Country Link
WO (1) WO2005090569A1 (fr)

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105934666A (zh) * 2013-08-21 2016-09-07 道格拉斯·T·卡雷尔 用于确定精子表观基因组的年龄相关改变对后代表型的影响的系统和方法

Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001055320A2 (fr) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Acides nucleiques, proteines et anticorps
WO2002002610A2 (fr) * 2000-06-29 2002-01-10 Incyte Genomics, Inc. Molecules de circulation et de secretion
WO2002053585A2 (fr) * 2000-12-30 2002-07-11 Lion Bioscience Ag Cofacteur cf11 de recepteur nucleaire mammifere et ses methodes d'utilisation
WO2002053591A1 (fr) * 2000-12-30 2002-07-11 Lion Bioscience Ag Cofacteur de recepteur nucleaire mammalien cf12 et ses procedes d'utilisation
WO2002068579A2 (fr) * 2001-01-10 2002-09-06 Pe Corporation (Ny) Kits tels que des dosages d'acides nucleiques comprenant une majorite d'exons ou de transcrits humains, destines a detecter l'expression et pouvant avoir d'autres applications
EP1308459A2 (fr) * 2001-11-05 2003-05-07 Helix Research Institute Séquences d'ADN complementaires pleine longueur
WO2004053068A2 (fr) * 2002-12-05 2004-06-24 Incyte Corporation Molecules de modification et de maintenance de proteines
US20040219609A1 (en) * 2002-07-12 2004-11-04 Day Anthony G. Methods for modulating proteins not previously known as proteases

Patent Citations (8)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001055320A2 (fr) * 2000-01-31 2001-08-02 Human Genome Sciences, Inc. Acides nucleiques, proteines et anticorps
WO2002002610A2 (fr) * 2000-06-29 2002-01-10 Incyte Genomics, Inc. Molecules de circulation et de secretion
WO2002053585A2 (fr) * 2000-12-30 2002-07-11 Lion Bioscience Ag Cofacteur cf11 de recepteur nucleaire mammifere et ses methodes d'utilisation
WO2002053591A1 (fr) * 2000-12-30 2002-07-11 Lion Bioscience Ag Cofacteur de recepteur nucleaire mammalien cf12 et ses procedes d'utilisation
WO2002068579A2 (fr) * 2001-01-10 2002-09-06 Pe Corporation (Ny) Kits tels que des dosages d'acides nucleiques comprenant une majorite d'exons ou de transcrits humains, destines a detecter l'expression et pouvant avoir d'autres applications
EP1308459A2 (fr) * 2001-11-05 2003-05-07 Helix Research Institute Séquences d'ADN complementaires pleine longueur
US20040219609A1 (en) * 2002-07-12 2004-11-04 Day Anthony G. Methods for modulating proteins not previously known as proteases
WO2004053068A2 (fr) * 2002-12-05 2004-06-24 Incyte Corporation Molecules de modification et de maintenance de proteines

Non-Patent Citations (13)

* Cited by examiner, † Cited by third party
Title
DATABASE EMBL [online] 1 December 2001 (2001-12-01), Database accession no. (Q95J13) *
DATABASE EMBL [online] 1 March 2002 (2002-03-01), COLLINS F.S.: "Generation and initial analysis of more than 15,000 full-lenght human and mouse cDNA sequences", Database accession no. (QWTS3) *
DATABASE EMBL [online] 1 March 2002 (2002-03-01), Database accession no. (Q8WTU0) *
DATABASE EMBL [online] 1 March 2004 (2004-03-01), PUENTE X.S. ET AL: "Human and mouse proteases: a comperative genomic approach", Database accession no. (Q7RTZ0) *
DATABASE EMBL [online] 1 October 2003 (2003-10-01), Database accession no. (Q7Z4U6) *
DATABASE GENBANK [online] 13 February 2002 (2002-02-13), Database accession no. (AX360011) *
DATABASE GENBANK [online] 20 June 2003 (2003-06-20), Database accession no. (AX748060) *
DATABASE GENBANK [online] 3 February 2004 (2004-02-03), Database accession no. (CQ738213) *
GERST J.E.: "SNARE regulators: matchmakers and matchbreakers", BIOCHIMICA ET BIOPHYSICA ACTA, vol. 1641, 2003, pages 99 - 110, XP004446840 *
GERST J.E.: "SNAREs and SNARE regulators in membrane fusion exocytosis", CELLULAR AND MOLECULAR LIFE SCIENCES, vol. 55, 1999, pages 707 - 734, XP001010304 *
LUSTGARTEN V. ET AL: "Yeast VSM1 encodes a v-SNARE binding protein that may act as a negative regulator of constitutive exocytosis", MOLECULAR AND CELLULAR BIOLOGY, vol. 19, no. 6, 1999, pages 4480 - 4494 *
NATURE REVIEWS GENETICS, vol. 4, 2003, pages 544 - 558 *
PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, vol. 99, no. 26, 2002, pages 16899 - 16903 *

Cited By (1)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105934666A (zh) * 2013-08-21 2016-09-07 道格拉斯·T·卡雷尔 用于确定精子表观基因组的年龄相关改变对后代表型的影响的系统和方法

Similar Documents

Publication Publication Date Title
JP6434444B2 (ja) 腫瘍の診断と治療を目的とした表面会合抗原の同定
US9919036B2 (en) Identification of tumor-associated antigens for diagnosis and therapy
JP5922159B2 (ja) 腫瘍診断と治療のための表面関連抗原の同定
JP5144933B2 (ja) 診断および治療のための腫瘍関連細胞表面抗原の同定
JP2005514912A (ja) 乳がんに関連する核酸およびポリペプチドならびにその使用
JP4201712B2 (ja) Ｇｉｐ、グッドパスチャー抗原結合タンパク質と相互作用する転写因子活性を備えたポリペプチドのファミリー
JP4429269B2 (ja) アポトーシス誘導遺伝子およびその利用
WO2005090569A1 (fr) Cancer et acides nucleiques et proteines de testicule vsm1 et vsm2, et leurs utilisations
JPWO2001081401A1 (ja) 新規コレクチン
JP2002516576A (ja) 乳房の疾患の検出に有用な試薬および方法
JP4530631B2 (ja) 新規タンパク質および癌の予防・治療剤
JP2000503544A (ja) 腫瘍拒絶抗原前駆体ｍｅｌａｎ―ａに結合するモノクローナル抗体、およびその利用方法
JP4557886B2 (ja) 食道癌の抗原およびその利用
US20050176930A1 (en) Marker molecules associated with lung tumors
JPWO2003038097A1 (ja) 脳に存在するユビキチン特異的プロテアーゼ及びそれをコードするｄｎａ
EP1357181A1 (fr) Nouveaux genes et proteines associes a la dermatite atopique
MX2008003464A (en) Identification of tumor-associated antigens for diagnosis and therapy
JP2002065276A (ja) ヒト悪性黒色腫抗原

Legal Events

Date Code Title Description
AK Designated states

Kind code of ref document: A1

Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW

AL Designated countries for regional patents

Kind code of ref document: A1

Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG

121 Ep: the epo has been informed by wipo that ep was designated in this application
NENP Non-entry into the national phase

Ref country code: DE

WWW Wipo information: withdrawn in national office

Country of ref document: DE

122 Ep: pct application non-entry in european phase