WO2005082938A2 - Anti-human tenascin monoclonal antibody - Google Patents
Anti-human tenascin monoclonal antibody Download PDFInfo
- Publication number
- WO2005082938A2 WO2005082938A2 PCT/IT2005/000078 IT2005000078W WO2005082938A2 WO 2005082938 A2 WO2005082938 A2 WO 2005082938A2 IT 2005000078 W IT2005000078 W IT 2005000078W WO 2005082938 A2 WO2005082938 A2 WO 2005082938A2
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- antibody
- biotinylated
- fragments
- derivatives
- tenascin
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
- C07K16/28—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants
- C07K16/30—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans against receptors, cell surface antigens or cell surface determinants from tumour cells
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P37/00—Drugs for immunological or allergic disorders
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/18—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies against material from animals or humans
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K16/00—Immunoglobulins [IG], e.g. monoclonal or polyclonal antibodies
- C07K16/46—Hybrid immunoglobulins
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K39/00—Medicinal preparations containing antigens or antibodies
- A61K2039/505—Medicinal preparations containing antigens or antibodies comprising antibodies
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/50—Immunoglobulins specific features characterized by immunoglobulin fragments
- C07K2317/56—Immunoglobulins specific features characterized by immunoglobulin fragments variable (Fv) region, i.e. VH and/or VL
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K2317/00—Immunoglobulins specific features
- C07K2317/90—Immunoglobulins specific features characterized by (pharmaco)kinetic aspects or by stability of the immunoglobulin
- C07K2317/92—Affinity (KD), association rate (Ka), dissociation rate (Kd) or EC50 value
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10—TECHNICAL SUBJECTS COVERED BY FORMER USPC
- Y10S—TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y10S435/00—Chemistry: molecular biology and microbiology
- Y10S435/81—Packaged device or kit
Definitions
- the present invention relates to anti-human tenascin monoclonal antibodies, methods and materials for obtaining them, the use of said antibodies in diagnostic and treatment procedures for tumours expressing tenascin and materials containing said antibodies suitable for use in the medical field.
- tumour therapy often constitutes a limiting factor in determining the success of the treatment.
- the onset of toxic effects and the reduced tolerability of a number of anticancer agents limit their use and the quality of life of the patients.
- Monoclonal antibodies are the ideal instrument for specifically localising the tumour and, when combined with the avidin/biotin amplification system, constitute an extremely potent method for directing active molecules to the tumour site.
- Tenascin is a molecule of the extracellular matrix, expressed during embryogenesis and in adult tissues during the processes of scar formation and tumour development, as well as in newly formed blood vessels. Tenascin is virtually absent in normal adult tissues, whereas it is expressed in the stroma of many solid tumours such as gliomas (Burdon, et al, Cancer Res., 43:2796-2805, 1983), carcinomas of the breast (Chiquet-Ehrismann, et al., 1986), lung (Natali, et al., Intl. J. Cancer, 54:56-68, 1989), fibrosarcomas and squamous-cell carcinomas (Ramos, DM. et al, Intl. J.
- Three-step pre-targeting treatment is based on the sequential intravenous administration of a biotinylated anti-tenascin monoclonal antibody, streptavidin and 90 Y-biotin, with administrations of avidin and biotinylated albumin prior to the streptavidin and 90 Y-biotin, respectively ("chase" step), to reduce the circulating levels of the antibody and of streptavidin.
- the selectivity of the 3-step pre-targeting method is due to the use of the anti-tenascin monoclonal antibody.
- the targeting of extracellular matrix molecules presents the advantage, compared to targeting aimed at cell surface antigens, of not being affected by modulation of antigen expression by the tumour cell itself.
- the doses, administration times and "chases" of the pre-targeting treatment have been established for the purposes of obtaining optimal tumour to non-tumour biodistribution ratios.
- biotinylated anti-tenascin antibody The role of the biotinylated anti-tenascin antibody is to localise in the tumour and mediate, via the biotinylated molecule, the accumulation of avidin and subsequently of 90 Y-biotin, directing the radioisotopes directly into the interior of the tumour.
- Anti-tenascin antibodies are already the object of patents and patent applications: US 5,624,659, Duke University; JP 2219590, Rikagaku; WO 92/04464, Wistar; and WO 03/072608, Sigma-Tau.
- BC-2 The clone used for the generation of said antibody in the above-cited studies is called BC-2.
- the applicant has demonstrated that the clone BC-2 is not suitable for industrial development, in that it produces an additional non-functional light chain (probably deriving from the parent myeloma line) whose level of expression increases during development of the production process on a large scale, preventing industrial-scale purification of the antibody.
- antibody ST2485 presents the advantage of binding to tenascin in addition to antibody ST2146, thus proving useful in pre-targeting methods involving the combined use of the two antibodies.
- An anti-human tenascin monoclonal antibody has now been found which solves the above-mentioned problems, since it does not possess a non-functional light chain and presents the advantage of additivity when used in combination with another anti-tenascin antibody.
- This antibody is the object of the present invention, together with the method for obtaining it and its use in therapy, in particular for the preparation of a product useful for the treatment of diseases characterised by the expression of tenascin, such as, for instance, tumours.
- the present invention relates to the antibody and to antibody fragments, optionally containing additional markers and diagnostic agents, to processes for obtaining said antibody and antibody fragments, to pharmaceutical compositions containing said antibody and its fragments and to diagnostic and therapeutic methods making use of them, as well as kits useful for implementing said methods.
- the present invention also relates to the DNA encoding said antibody or fragments thereof, to vectors containing such DNA, to host cells containing such vectors, to the protein coded for by the nucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2, to the DNA encoding the protein and the fragments, to the specific complementary determining regions (CDRs) and proteins containing such CDRs.
- the object of the present invention is also the hybridoma that produces said monoclonal antibody.
- the antibody which is the object of the present invention is characterised by the sequences of the variable region of the light and heavy chains SEQ ID NO: 1 and SEQ ID NO: 2, respectively, shown in Figures 17 and 18.
- the antibody which is the object of the present invention will be identified by the name ST2485.
- fragments of ST2485 or its chimeric or recombinant derivatives can be produced and used within the scope of the present invention.
- objects of the present invention are the proteolytic fragments of said antibody capable of binding to an antigenic epitope within the Al- 4-D region of human tenascin.
- antibody fragments are those fragments capable of binding to an antigenic epitope within the A1-4-D region of human tenascin C.
- said antibody or proteolytic fragments are preferably biotinylated.
- Another object of the present invention consists in the hybridoma cell line, called cST2485, producing the antibody ST2485.
- the hybridoma cell line was deposited at the Centro di Biotecnologie Avanzate, Largo Rossana Benzi 10, Genoa, Italy, on 12 November 2003 in accordance with the provisions of the Budapest Treaty, under deposit number PD03003.
- the recombinant derivatives of antibody ST2485 which may optionally be biotinylated.
- the recombinant derivatives preferred are those in which the murine constant region is replaced by its human counterpart (Ferrer, C, et ⁇ ., J. Biotechnol, 52: 51-60, 1996), or those in which the murine constant region is replaced by a biologically active component, such as, for example, a member of the avidin family (Penichet ML., Manuel, L., et al, J.
- a growth factor useful for stimulating tumour-directed immunological effectors for example, G- CSF, GM-CSF
- a growth factor useful for stimulating tumour-directed immunological effectors for example, G- CSF, GM-CSF
- a pharmacologically active component such as, for example, a superantigen, a toxin, a cytokine or any other protein useful for enhancing the anticancer therapeutic efficacy
- a pharmacologically active component such as, for example, a superantigen, a toxin, a cytokine or any other protein useful for enhancing the anticancer therapeutic efficacy
- Another object of the present invention consists in conjugated derivatives of antibody ST2485, optionally biotinylated.
- the conjugated derivatives preferred are those in which the biologically active component is bound to the antibody by means of conventional systems.
- biologically active compounds are the members of the avidin family, a growth factor useful stimulating tumour-directed immunological effectors (for example, G-CSF, GM- CSF), or those in which the murine constant region is replaced by a pharmacologically active component, such as, for example, a superantigen, a toxin, a cytokine or any other protein useful for enhancing the anticancer therapeutic efficacy, anticancer drugs, and radioisotopes.
- a pharmacologically active component such as, for example, a superantigen, a toxin, a cytokine or any other protein useful for enhancing the anticancer therapeutic efficacy, anticancer drugs, and radioisotopes.
- a further object of the present invention consists in the use of the antibody or its derivatives for the preparation of a pharmaceutical product useful in a method for cancer radioimmunotherapy carried out preferably according to the method called three-step pre-targeting, also known by the trade-mark PAGRIT ® , including the administration to a subject suffering from a cancer expressing the tenascin antibody ST2485 or proteolytic fragments thereof, preferably biotinylated.
- Recombinant derivatives of the antibody which is the object of the present invention and its conjugates can be used to advantage in cancer therapy. Therefore, the use of the antibody and its fragments or derivatives in the preparation of a medicine for the treatment of tumours expressing tenascin constitutes a further object of the present invention.
- the systemic kit consists of 5 vials, including vial 1 containing the biotinylated antibody or fragments or derivatives thereof according to the present invention; vial 2 containing avidin; vial 3 containing streptavidin; vial 4 containing biotinylated human albumin; and vial 5 containing biotin DOTA (or derivatives of biotin described in WO 02/066075).
- the locoregional kits consists of 3 vials, corresponding to vials 1, 2 and 5 of the systemic kit.
- the vials are prepared so as to be suitable for injection in the subject to be treated, preferably a human subject.
- IART Intraoperative Avidination for Radionuclide Treatment
- reagents which are the object of the present invention, either alone or in combination with other components of the PAGRIT ® kit.
- the specific container preferably in the form of a vial suitable for injection containing the antibody or its fragments in biotinylated form, constitutes a further object of the present invention.
- the biotinylated antibody in the therapeutic kits is combined with other anti- tenascin antibodies, preferably directed at the EGF-like region of the protein.
- the biotinylated antibody can be coupled to other antibodies specific to the tumour.
- EP 0 496 074 European Journal of Nuclear Medicine Vol.26, No4; April, 1999,348-357, US 5,968,405.
- Another object of the present invention is the use of the monoclonal antibody ST2485 for obtaining images for subsequent diagnostic purposes ("imaging") by means of in- ⁇ i ⁇ o immunolocalisation in the tumour.
- Another object of the present invention is the use of the monoclonal antibody ST2485 in combination with a second anti-tenascin antibody in a test for the production of a diagnostic kit for determining circulating levels of tenascin.
- Figure 1 schematic representation of human tenascin C and the strategy adopted to generate the BC-2-like antibody.
- FIG. 2 SDS-PAGE (a, b) and Western blot (c, d) analysis of antibody ST2485 in reducing and non-reducing conditions. In reducing conditions, a double band is observed at the level of the light chain of the antibody (b, d).
- FIG. 3 SDS-PAGE analysis of antibody ST 2485 subjected to deglycosylation by digestion with the enzyme PNGaseF (Peptide-N- Glycosidase from Flavobacterium): disappearance of the high molecular weight light chain band is observed.
- PNGaseF Peptide-N- Glycosidase from Flavobacterium
- Figure 4 hydrox patite chromatography profiles of antibodies ST2485 and BC-2.
- Figure 5 binding specificity of ST2485 for human tenascin and for the Tn (A(i- )-D) fragment by means of Western blot analysis.
- Figure 6 Competitive ELISA between ST2485 and BC-2 for binding to tenascin C (a) or to the Tn (A(i- )-D) fragment (b).
- Figure 7 immunore activity of ST2485 compared to BC-2 on tenascin C (a) and on the Tn (A(i-4)-D) fragment (b).
- Figure 8 immunore activity of biotinylated ST2485 and BC-2 on tenascin C (a) and on the Tn (A(i- 4 )-D) fragment (b).
- Figure 9 cross-reactivity of antibody ST2485 with the murine tenascin expressed in LMM3 tumour (murine breast cancer) and in normal murine intestine.
- Figure 10 protocol adopted for the ST2485 biodistribution study in nude mice.
- Figures 11 and 11a biodistribution of ST2485 at various administration doses compared with BC-2.
- the accumulation of ST2485 in the tumour, at all doses administered, is at least twice as much as that of BC-2.
- Figures 12 and 12a tumour to non-tumour ratios of ST2485 compared with BC-2. These ratios are higher for antibody ST2485, at all doses administered.
- Figure 13 in- ⁇ itro interference (a) and additivity testing (b) of anti- tenascin antibodies ST2485 and ST2146 by means of ELISA test.
- Figures 14 and 14a in- ⁇ itro additivity test of antibodies ST2485 and ST2146 by means of BiaCore analysis.
- Figure 15 scheme adopted in the in- ⁇ i ⁇ o additivity study of antibodies ST2485 and ST2146.
- Figure 16 in- ⁇ i ⁇ o additivity of antibodies ST2485 and ST2146, expressed in ng of antibody localised per gram of tumour.
- Figure 17 SEQ ID NO: 1 sequence of the variable region of the light chain of ST2485 (VL). Encoded amino acid sequence shown in SEQ ID NO: 3.
- Figure 18 SEQ ID NO: 2 sequence of the variable region of the heavy chain of ST2485 (VH). Encoded amino acid sequence shown in SEQ ID NO: 4.
- the inventors have prepared a new anti-human tenascin antibody called ST2485, whose light and heavy chain variable region sequences are SEQ ID NO: 1 and SEQ ID NO: 2, respectively, produced from the hybridoma cell line cST2485.
- the antibody is capable of binding to an antigenic epitope within the A(i-4)-D region of human tenascin.
- proteolytic fragments of the antibody according to the present invention are capable of binding to an antigenic epitope within the A(i- 4)-D region of human tenascin.
- Recombinant derivatives of the antibody according to the present invention are obtained according to conventional methods which are well known to experts in the field.
- the recombinant derivatives preferred are those in which the murine constant region is replaced by its human counterpart, or by a biologically or pharmacologically active component, or by a member of the avidin family.
- the conjugated derivatives are obtained by means of conventional methods well known in this field.
- the preferred conjugated derivatives are those in which a biologically active portion is bound to the antibody.
- biologically active portions are the members of the avidin family, a growth factor useful for stimulating tumour-directed immunological effectors (such as G- CSF, GM-CSF), a pharmacologically active portion, such as, for example, a toxin, superantigen, cytokine or any other protein useful for enhancing the therapeutic anticancer effect, anticancer drugs, and radioisotopes.
- recombinant or conjugated derivatives of the monoclonal antibody are also referred to as "derivatives”.
- the antibody, its fragments and derivatives can be biotinylated.
- the antibody according to the present invention can also advantageously contain additional markers and diagnostic agents.
- the present invention also includes the DNA encoding the monoclonal antibody or its fragments as defined above.
- the invention also comprises a vector containing said DNA, and a host cell containing said vector.
- Vectors and host cells fall within the sphere of the common knowledge pertaining this field.
- the present invention also comprises the protein coded for by the nucleotide sequences SEQ ID NO: 1 and SEQ ID NO: 2 or its fragments, and the DNA encoding it.
- the present invention also comprises specific CDRs (Complementary Determining Regions) of the above-mentioned antibody and proteins containing said CDRs.
- the process for preparing the antibody according to the present invention consists of the following stages: a) immunisation of an animal, preferably a mouse, with the A(i- 4)-D fragment of human tenascin; b) fusion of the somatic spleen cells of said animal with myeloma cells not producing immuno globulins; c) selection of the monoclonal antibody.
- the monoclonal antibody ST2485 is produced from the hybridoma cell line cST2485, identified above.
- the antibody or its fragments or its derivatives, optionally biotinylated are used for the preparation of a pharmaceutical product useful for the treatment and diagnosis of diseases characterised by expression of tenascin.
- diseases are tumours, and more particularly include glioma, breast cancer, lung cancer, fibrosarcoma and squamous cell carcinoma.
- the above-mentioned pharmaceutical product is used in the two-stage perioperative therapy of solid tumours, described in the International application WO 03/07268.
- the biotinylated antibody is administered, followed by avidin, thus constructing the "artificial receptor" for the actual subsequent anticancer agent.
- the anticancer agent will be delivered by biotin, which will be contained in a chemical compound suitable for forming a complex with the anticancer agent and hereinafter referred to as the biotin compound, and will be administered systemically in the postoperative phase.
- biotin in fact, will localise only where avidin is present and in this case we can be sure that avidin is present in the area we are interested in treating, in that it is introduced by the surgeon a few hours earlier (e.g. 4 to 72 hours) during the operation. This is an advantage in that it drastically reduces the time elapsing between removal of the primary tumour and adjuvant therapy.
- the antibody described herein will be suitably formulated in pharmaceutical compositions or therapeutic or diagnostic kits, according to normal practice in the pharmaceutical field.
- kits are entirely of the type which is conventional in this field and can be prepared by experts in the field even only on the basis of common knowledge. Examples of pharmaceutical compositions are provided in the references cited in the present invention. The same is true of the kits. Particularly preferred are the kits for tumour radioimmunotherapy, as described in the above-mentioned studies by Paganelli et al., and in EP 0 496 074, WO 02/066075, WO 03/072608, and WO 03/075960. A particular use of the radioimmunotherapy kit can be implemented with the device described in WO 03/069632.
- compositions containing the antibody or its derivatives or fragments, optionally biotinylated in mixtures with at least one pharmaceutically acceptable excipient or vehicle are included in the scope of the present invention.
- kits are supplied for systemic radioimmunotherapy, particularly three-step pre- targeting radioimmunotherapy, containing 5 vials, vial 1 containing an antibody or its fragments or recombinant derivatives or its conjugates or analogues, optionally biotinylated; vial 2 containing avidin; vial 3 containing streptavidin; vial 4 containing biotinylated human albumin; and vial 5 containing biotin DOTA.
- kits are for locoregional radioimmunotherapy and contain 3 vials which are the same as vials 1, 2 and 5 of the systemic kit.
- vial containing biotin in the vial containing biotin
- said biotin DOTA is the formula (I) compound (I) in which Q is a -(CH 2 )n- group, where n is a whole number from 4 to 12, in which case R' is not present, or Q is selected from the group consisting of -(CH2) a -CH(R')b-(CH2)b-, where a and b are independently whole numbers from 0 to n, R' is as defined here below, or Q is cyclohexyl, phenyl, in which case R' is a substituent on the cyclohexyl or phenyl ring;
- R is hydrogen or - ⁇ where - ⁇ is a formula (II) macrocycle, (II) where the various Ys, which may be the same or different, are selected from the group consisting of hydrogen, straight or branched C1-C4 alkyl, -(CH2)m-COOH, where m is a whole number from 1 to 3, X is hydrogen, or the group -CH2-U, where U is selected from the group consisting of methyl, ethyl, and p-aminophenyl, or X is the group - (CHW)o-Z, where o is a whole number from 1 to 5, W is hydrogen, methyl or ethyl, Z is a 5- or 6-member heterocyclic group containing one or more heteroatoms selected from O, N-Ri, where Ri is hydrogen or straight or branched C1-C4 alkyl, and S; or Z is selected from the group consisting of -NH2, or -S-R2, where R 2 is straight or branched C
- R' is selected from the group consisting of hydrogen, straight or branched C1-C4 alkyl, -(CH2VT, in which T is selected from the group consisting of -S-CH3, -OH, -COOH, and q is the number 1 or 2;
- R" has the same meanings as R', upon the following conditions: if R is - ⁇ , R" is hydrogen; if R is hydrogen, R" is - ⁇ , or R and R" are, respectively, -(CE_2)_- ⁇ (for R), where r is a whole number from 4 to 12, and - ⁇ (for R'), Q being a -(CH2) - group, where n is a whole number from 4 to 12.
- the latter in the vial containing avidin, is an avidin dimer in which two molecules of avidin are bound via -NH2 groups by means of suberate, or an avidin dimer in which two molecules of avidin are bound via -COOH groups by means of polyethylene glycol with a molecular weight of 3,400, as described in WO 03/075960.
- the antibody, its proteolytic fragments, its derivatives, optionally biotinylated can be in combination with other anti-tenascin antibodies, preferably targeting the EGF-like region of the protein, or in combination with other tumour-specific antibodies. All the aspects of this invention, in addition to applying to the therapy of tumours expressing tenascin, also apply to the diagnosis of tumours and particularly tumour immunolocalisation procedures, e.g. imaging.
- Another object of the present invention is a container, preferably in the form of a vial suitable for injection, containing an antibody or its proteolytic fragments or its derivatives, optionally biotinylated, and/or radiolabelled.
- the antibody or its fragments, recombinant derivatives, or analogues are used in combination with a second tenascin-specific antibody, in a sandwich-type in- ⁇ itro ELISA assay, in conditions in which said second antibody binds to a second antigenic epitope of tenascin, for the purposes of determining circulating tenascin levels, and particularly the isoforms containing the A(i-4)-D region.
- Balb/c mice were immunised with the A(i-4)-D fragment of human tenascin, containing the epitope recognised by BC-2 (Siri, A., et al, Nucl. Acid Res., 19(3):525-531, 1991; Balza, E., et al, FEBS, 332:39-43, 1993).
- the schematic representation of human tenascin C and the strategy adopted to generate the BC-2-like antibody are illustrated in Figure 1.
- Spleen cells of mice immunised with the Tn (A(i -4 )-D) fragment were fused with myeloma cells not producing immunoglobulins Sp2/0-Agl4 according to standard methods (Cianfriglia, M., et al, Methods Enzymol, 121:193-210, 1986), and the hybridoma population obtained was subjected to screening by means of the ELISA test on purified tenascin from SK-Mel 28 human melanoma cells (ICLC HTL99010).
- hybridomas secreting anti-tenascin antibodies were cloned twice by means of limiting dilutions in growth medium containing FCS and twice in protein-free medium of animal origin (Animal Derived Component Free Medium H Clone, HyQR Perbio).
- Production of the ST2485 reference material was achieved by culturing the cST2485 hybridoma cells in a 2-litre bioreactor; two successive limiting dilution subclonings of the cST2485 Post Production Cell Bank (PPCB) led to the selection of the subclone cST2485/A3e/Al2f, used for the production of the Master Cell Bank (MCB) and the Working Cell Bank (WCB).
- PPCB Post Production Cell Bank
- ST2485 is a mouse immunoglobulin of IgGl/k isotype.
- FIG. 2 shows the SDS-PAGE (a, b) and Western blot (c, d) analysis of the antibody ST2485 in reducing and non-reducing conditions.
- reducing conditions b, d
- Western blot analysis demonstrates that the two bands are immunoreactive as light chains of immunoglobulin.
- Hydroxy apatite chromatographic analysis of antibody ST2485 shown in Figure 3, confirms a mild heterogeneity of the antibody through the slightly asymmetrical peak.
- the antibody BC-2 presents a distinctly heterogeneous profile, in which three peaks can be distinguished, of which only peak 1 corresponds to the totally functional homogeneous antibody.
- variable region of the kappa light chain was amplified by the circularised cDNA using a pair of primers (5' GGGAAGATGGATACA- GTTGGTG (SEQ ID NO: 5), 5' CAAGAGCTTCAACAGGAATGAG) (SEQ ID NO: 6) that recognise the constant region of the antibody as described by M. Sassano et al. Nucl Ac. Res. (1994) 22, 1768-1769.
- ST2485 binding to the A(i-4)-D region of tenascin is specific, as demonstrated by the Western blot analysis presented in Figure 5.
- the antibody binds to human tenascin and to the A(i- 4 )— D fragment, but not to the EGF-like fragment of the same protein, containing the epitope recognised by the BC-4 antibody.
- Antibody ST2485 binds human tenascin in a distinct epitope or in one partly shared with BC-2, as demonstrated by the competitive ELISA assay between the two antibodies illustrated in Figure 6.
- the biotinylated antibody BC-2 at a concentration established in preliminary experiments, is dispensed with non-biotinylated BC-2 (curve 1) or ST2485 (curve 2) in increasing concentrations on plates sensitised with the antigen tenascin C (a), or Tn A(i-4)-D fragment (b).
- the binding of the biotinylated antibody is measured after addition of HRP-streptavidin and the related chromogenic substrate TMB.
- Antibody ST2485 causes 40% inhibition of BC-2 binding to tenascin C or the Tn A(i-4)-D fragment.
- the immunore activity of ST2485 was evaluated in comparison with BC-2 by ELISA assay on tenascin C and on the Tn A(i-4)-D fragment, as shown in Figure 7.
- the antibodies ST2485 and BC-2 and the normal mouse immunoglobulins (nMIgG) were dispensed at increasing concentrations on plates sensitised with tenascin C (a) or with the Tn A(i- 4 )-D fragment (b); the addition of the secondary antimouse antibody labelled with alkaline phosphatase and the related chromogenic substrate (pNPP) made it possible to determine the dose-response curve of the antibodies.
- the amount of ST2485 necessary to obtain 1.0 OD is approximately 13 times less than the amount of BC-2 on whole tenascin (a), and approximately 10 times less than the amount of BC-2 on the Tn (A1-4-D) fragment (b).
- the affinity of antibody ST2485 was evaluated both on tenascin C and on the Tn (A ⁇ -4-D) fragment by means of BIAcore analysis.
- biotinylated ST2485 (8.3 biotins/molecule) was evaluated by ELISA and BIAcore assays in comparison with biotinylated BC-2 (7.6 biotins/molecule).
- the antibodies ST2485 and BC-2, biotinylated and non-biotinylated, and the normal mouse immunoglobulins (nMIgG) were dispensed at increasing concentrations on plates sensitised with tenascin C (a) or with the Tn A(i-4)-D fragment (b); the addition of the secondary anti- mouse antibody labelled with alkaline phosphatase and the related chromogenic substrate (pNPP) made it possible to determine the dose- response curve of each biotinylated antibody compared to the non- biotinylated one (residual immunore activity).
- pNPP related chromogenic substrate
- the residual immunore activity of biotinylated ST2485 and BC-2 on tenascin C is equal to 76% and 88%, respectively.
- the residual immunore activity for ST2485 and BC-2 is 73% and 83%, respectively.
- Biotinylated ST2485 thus maintains good immunore activity and affinity characteristics, conserving an affinity for tenascin approximately 100 times greater than that of biotinylated BC-2.
- the animals were subcutaneously inoculated with 4 x 10 6 human colon carcinoma HT-29 cells in 0.1 ml of sterile saline solution. After 15 days, when the tumour had reached a mass of approximately 200 mg, groups of five animals received intravenous administrations of 125 I-BC2, 125 I- ST2485, or normal mouse 125 I-immunoglobulins (nMIg), all biotinylated (7-9 biotins/mol) and at five different doses: 0.2-0.5-1-2-5 ⁇ g/mouse in 100 ⁇ l of sterile PBS. Five days after administration of the antibodies the animals were sacrificed and samples of blood, spleen, kidney, liver and tumour were taken for determining the radioactivity present. Twenty-four hours prior to the sacrifice the animals received an intravenous administration of avidin in 100 ⁇ l of sterile PBS, at doses 100 times greater than that of the antibody (chase).
- nMIg normal mouse 125 I-immunoglobulin
- the tumour :blood ratio for ST2485 is greater than 20 (optimal dose), whereas for the antibody BC-2 this ratio never exceeds 6 at any of the doses assayed.
- the tumour to non-tumour ratios for ST2485 at the dose of 1 ⁇ g/mouse are 9, 26, and 43 in relation to the spleen, kidney and liver, respectively.
- BC- 2 on the other hand, these ratios are always lower than 7, at all the doses assayed.
- the tumour to non-tumour ratios are shown in Figures 12 and 12a.
- Figure 13b shows the additivity test, in which the biotinylated antibodies ST2485 and ST2146 were dispensed, in saturating doses, separately or together, on microplates sensitised with tenascin C: the mixture of the two antibodies produces a signal equal to the sum of the signals, thus demonstrating that the binding of the two antibodies is additive.
- the in- ⁇ itro additivity of the two antibodies was also assayed using BIACore analysis, as shown in Figures 14 and 14a.
- the tenascin was immobilised on the chip (CM5 sensor chip, Biosense) according to the method described (De Santis R.; et al; Br. J. Cancer, 88: 996-1003, 2003).
- Two consecutive injections of the first antibody were administered (ST2485 in a, ST2146 in c) at saturating concentrations (10 DM), followed by injection of the second anti-tenascin antibody (ST2146 in a; ST2485 in c).
- Sensorgrams a) and c) show that the two antibodies are capable of binding to the respective epitopes in an additive manner, as shown by the increase in the resonance signal produced by each single antibody.
- Sensorgrams b) and d) represent the injections of ST2485 and ST2146 respectively, each followed by the respective isotypical control antibodies, mIgG2b and mlgGl.
- the additivity study of the two antibodies ST2485 and ST2146 was also conducted in- ⁇ i ⁇ o in the previously described animal model.
- the study scheme is illustrated in Figure 15, whereas the results obtained are presented in Figure 16, expressed in ng of antibody per gram of tumour.
- the data confirm the additivity of the two antibodies also in the animal model.
- the mixture of the two labelled antibodies in fact, presents an accumulation in the tumour amounting to 93% of the theoretical value (mathematical sum of the two individual labelled antibodies).
- Groups of control animals were treated with mixtures of radiolabelled antibody and second "cold" antibody to avoid any interference.
- variable region of the kappa light chain was amplified starting from the circularised cDNA using a pair of primers (5' GGGAAGATGG- ATACAGTTGGTG 3' (SEQ ID NO: 5), 5' CAAGAGCTTCAACAGGAAT- GAG 3') (SEQ ID NO: 6) that recognise the constant region of the light chain of the antibody, as described by M. Sassano, et al, Nucl Ac. Res., (1994) 22, 1768-1769.
- variable region of the gamma heavy chain was amplified starting from the circularised cDNA using a pair of primers (5' ATGGAGTTAG- TTTGGGCAGCAG 3' (SEQ ID NO: 7), 5' GCACAACCACCATACTGAG- AAG 3') (SEQ ID NO: 8) that recognise the constant region of the heavy chain of the antibody, as described by M. Sassano, et al, Nucl. Ac. Res., (1994) 22, 1768-1769.
- Figure 17 shows the SEQ ID NO: 1 sequence of the variable region of the light chain (VL) of ST2485.
- Figure 18 shows the SEQ ID NO: 2 sequence of the variable region of the heavy chain (VH) of ST2485.
- Paganelli G. Bartolomei M., Ferrari M., Cremonesi M., Broggi G., Maira G., Sturiale C, Grana C, Prisco G., Gatti M., Caliceti P., Chinol M.
- Paganelli G. Grana C, Chinol M., Cremonesi M., De Cicco C, De Braud F., Robertson C, Zurrida S., Casadio C, Zoboli S., Siccardi A. G., Veronesi U. Antibody-guided three step therapy for high grade glioma with yttrium-90 biotin. Eur. J. Nucl. Med., 26(4):348-357, 1999.
- Paganelli G. Magnani P., Zito F., Lucignani G., Sudati F., Truci G., Motti E., Terreni M., Polio B., Giovanelli M.
- Pre-targeted immunodetection in glioma patients tumor localization and single- photon emission tomography imaging of [99mTc]PnAO-biotin. Eur. J. Nucl. Med., 21(4):314-21, 1994.
Landscapes
- Health & Medical Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Organic Chemistry (AREA)
- Life Sciences & Earth Sciences (AREA)
- Immunology (AREA)
- General Health & Medical Sciences (AREA)
- Medicinal Chemistry (AREA)
- Biochemistry (AREA)
- Biophysics (AREA)
- Genetics & Genomics (AREA)
- Molecular Biology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Public Health (AREA)
- Veterinary Medicine (AREA)
- General Chemical & Material Sciences (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Pharmacology & Pharmacy (AREA)
- Animal Behavior & Ethology (AREA)
- Cell Biology (AREA)
- Engineering & Computer Science (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Apparatus Associated With Microorganisms And Enzymes (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
Priority Applications (12)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| EP05718988.8A EP1718678B1 (en) | 2004-02-27 | 2005-02-16 | Anti-human tenascin monoclonal antibody |
| BRPI0508082A BRPI0508082A8 (pt) | 2004-02-27 | 2005-02-16 | Anticorpo monoclonal de tenascina antihumano |
| HK07108522.3A HK1100848B (en) | 2004-02-27 | 2005-02-16 | Anti-human tenascin monoclonal antibody |
| MXPA06009674A MXPA06009674A (es) | 2004-02-27 | 2005-02-16 | Anticuerpo monoclonal de tenascina antihumano. |
| CN2005800061324A CN1946740B (zh) | 2004-02-27 | 2005-02-16 | 抗人腱生蛋白单克隆抗体 |
| CA2558718A CA2558718C (en) | 2004-02-27 | 2005-02-16 | Anti-human tenascin monoclonal antibody |
| ES05718988.8T ES2654065T3 (es) | 2004-02-27 | 2005-02-16 | Anticuerpo monoclonal anti-tenascina humana |
| PL05718988T PL1718678T3 (pl) | 2004-02-27 | 2005-02-16 | Przeciwciało monoklonalne przeciw ludzkiej tenascynie |
| AU2005217237A AU2005217237B2 (en) | 2004-02-27 | 2005-02-16 | Anti-human tenascin monoclonal antibody |
| US10/590,936 US7989171B2 (en) | 2004-02-27 | 2005-02-16 | Anti-human tenascin monoclonal antibody |
| JP2007500356A JP5191036B2 (ja) | 2004-02-27 | 2005-02-16 | 抗ヒトテネイシンモノクローナル抗体 |
| KR1020067020062A KR101266389B1 (ko) | 2004-02-27 | 2006-09-27 | 항 인간 테나신 단클론 항체 |
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| ITRM2004A000105 | 2004-02-27 | ||
| IT000105A ITRM20040105A1 (it) | 2004-02-27 | 2004-02-27 | Anticorpo monoclonale antitenascina umana. |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| WO2005082938A2 true WO2005082938A2 (en) | 2005-09-09 |
| WO2005082938A3 WO2005082938A3 (en) | 2005-12-15 |
Family
ID=34897820
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/IT2005/000078 Ceased WO2005082938A2 (en) | 2004-02-27 | 2005-02-16 | Anti-human tenascin monoclonal antibody |
Country Status (15)
| Country | Link |
|---|---|
| US (1) | US7989171B2 (https=) |
| EP (1) | EP1718678B1 (https=) |
| JP (1) | JP5191036B2 (https=) |
| KR (1) | KR101266389B1 (https=) |
| CN (1) | CN1946740B (https=) |
| AR (1) | AR047819A1 (https=) |
| AU (1) | AU2005217237B2 (https=) |
| BR (1) | BRPI0508082A8 (https=) |
| CA (1) | CA2558718C (https=) |
| ES (1) | ES2654065T3 (https=) |
| IT (1) | ITRM20040105A1 (https=) |
| MX (1) | MXPA06009674A (https=) |
| PL (1) | PL1718678T3 (https=) |
| PT (1) | PT1718678T (https=) |
| WO (1) | WO2005082938A2 (https=) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8263545B2 (en) | 2005-02-11 | 2012-09-11 | Amylin Pharmaceuticals, Inc. | GIP analog and hybrid polypeptides with selectable properties |
| US8404637B2 (en) | 2005-02-11 | 2013-03-26 | Amylin Pharmaceuticals, Llc | GIP analog and hybrid polypeptides with selectable properties |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP2012031084A (ja) * | 2010-07-29 | 2012-02-16 | Tokyo Univ Of Science | 抗腫瘍剤 |
| WO2014113459A1 (en) * | 2013-01-15 | 2014-07-24 | Duke University | Hiv-1 neutralizing factor |
| US20160097771A1 (en) | 2013-05-21 | 2016-04-07 | NX Pharmagen | Use of tenascin-c as an extracellular marker of tumor-derived microparticles |
| GB201414021D0 (en) * | 2014-08-07 | 2014-09-24 | Nascient Ltd | Biological materials and uses thereof |
| GB201616596D0 (en) * | 2016-09-29 | 2016-11-16 | Nascient Limited | Epitope and antibodies |
| EP4536278A2 (en) | 2022-06-07 | 2025-04-16 | Actinium Pharmaceuticals, Inc. | Bifunctional chelators and conjugates |
| CN119019548B (zh) * | 2022-07-05 | 2025-06-24 | 东莞市朋志生物科技有限公司 | 抗甲型流感病毒抗体、检测甲型流感病毒的试剂和试剂盒 |
Family Cites Families (10)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5634076A (en) * | 1994-10-04 | 1997-05-27 | Analog Devices, Inc. | DMA controller responsive to transition of a request signal between first state and second state and maintaining of second state for controlling data transfer |
| US6014709A (en) * | 1997-11-05 | 2000-01-11 | Unisys Corporation | Message flow protocol for avoiding deadlocks |
| US6335014B1 (en) | 1998-06-17 | 2002-01-01 | The Institute Of Physical And Chemical Research | Medicament for suppressing cancer metastasis |
| US6521593B1 (en) * | 1999-02-01 | 2003-02-18 | Childrens Hospital Los Angeles | Methods for inhibiting brain tumor growth |
| AU4682100A (en) * | 1999-05-01 | 2000-11-17 | University Of Medicine And Dentistry Of New Jersey | Neurite outgrowth and guidance by tenascin-c |
| US7058750B1 (en) * | 2000-05-10 | 2006-06-06 | Intel Corporation | Scalable distributed memory and I/O multiprocessor system |
| JP3646159B2 (ja) | 2001-02-08 | 2005-05-11 | 国立大学法人三重大学 | 抗テネイシンcモノクローナル抗体及び当該抗体を産生するハイブリドーマ |
| ITRM20010079A1 (it) * | 2001-02-16 | 2002-08-16 | Sigma Tau Ind Farmaceuti | Amminoderivati della biotina e loro coniugati con chelanti macrociclici. |
| ES2352180T3 (es) * | 2002-02-26 | 2011-02-16 | Sigma-Tau Industrie Farmaceutiche Riunite S.P.A. | Anticuerpo monoclonal de anti-tenascina humana. |
| ITRM20020128A1 (it) | 2002-03-08 | 2003-09-08 | Sigma Tau Ind Farmaceuti | Dimeri di avidina efficaci nell'incrementare la concentrazione di biotina radioattiva nella immunoterapia con "pretargeting". |
-
2004
- 2004-02-27 IT IT000105A patent/ITRM20040105A1/it unknown
-
2005
- 2005-02-16 CN CN2005800061324A patent/CN1946740B/zh not_active Expired - Fee Related
- 2005-02-16 PL PL05718988T patent/PL1718678T3/pl unknown
- 2005-02-16 WO PCT/IT2005/000078 patent/WO2005082938A2/en not_active Ceased
- 2005-02-16 CA CA2558718A patent/CA2558718C/en not_active Expired - Fee Related
- 2005-02-16 US US10/590,936 patent/US7989171B2/en not_active Expired - Fee Related
- 2005-02-16 PT PT57189888T patent/PT1718678T/pt unknown
- 2005-02-16 EP EP05718988.8A patent/EP1718678B1/en not_active Expired - Lifetime
- 2005-02-16 MX MXPA06009674A patent/MXPA06009674A/es active IP Right Grant
- 2005-02-16 AU AU2005217237A patent/AU2005217237B2/en not_active Ceased
- 2005-02-16 BR BRPI0508082A patent/BRPI0508082A8/pt not_active IP Right Cessation
- 2005-02-16 ES ES05718988.8T patent/ES2654065T3/es not_active Expired - Lifetime
- 2005-02-16 JP JP2007500356A patent/JP5191036B2/ja not_active Expired - Fee Related
- 2005-02-24 AR ARP050100671A patent/AR047819A1/es not_active Application Discontinuation
-
2006
- 2006-09-27 KR KR1020067020062A patent/KR101266389B1/ko not_active Expired - Fee Related
Cited By (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US8263545B2 (en) | 2005-02-11 | 2012-09-11 | Amylin Pharmaceuticals, Inc. | GIP analog and hybrid polypeptides with selectable properties |
| US8404637B2 (en) | 2005-02-11 | 2013-03-26 | Amylin Pharmaceuticals, Llc | GIP analog and hybrid polypeptides with selectable properties |
| US8895498B2 (en) | 2005-02-11 | 2014-11-25 | Astrazeneca Pharmaceuticals, Lp | GIP and exendin hybrid polypeptides |
| US9133260B2 (en) | 2005-02-11 | 2015-09-15 | Amylin Pharmaceuticals, Llc | GIP analog and hybrid polypeptides with selectable properties |
Also Published As
| Publication number | Publication date |
|---|---|
| PL1718678T3 (pl) | 2018-05-30 |
| JP2008506355A (ja) | 2008-03-06 |
| JP5191036B2 (ja) | 2013-04-24 |
| ITRM20040105A1 (it) | 2004-05-27 |
| US7989171B2 (en) | 2011-08-02 |
| CA2558718A1 (en) | 2005-09-09 |
| KR101266389B1 (ko) | 2013-05-28 |
| AU2005217237A1 (en) | 2005-09-09 |
| WO2005082938A3 (en) | 2005-12-15 |
| MXPA06009674A (es) | 2007-03-21 |
| EP1718678A2 (en) | 2006-11-08 |
| HK1100848A1 (en) | 2007-09-28 |
| CN1946740B (zh) | 2012-09-05 |
| AU2005217237B2 (en) | 2011-12-22 |
| EP1718678B1 (en) | 2017-10-11 |
| CA2558718C (en) | 2015-01-13 |
| KR20070002029A (ko) | 2007-01-04 |
| ES2654065T3 (es) | 2018-02-12 |
| CN1946740A (zh) | 2007-04-11 |
| BRPI0508082A8 (pt) | 2017-12-26 |
| PT1718678T (pt) | 2017-12-29 |
| US20100297003A1 (en) | 2010-11-25 |
| BRPI0508082A (pt) | 2007-07-17 |
| AR047819A1 (es) | 2006-02-22 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8048417B2 (en) | Anti-human tenascin monoclonal antibody | |
| JP2023510905A (ja) | 抗trop-2抗体-エキサテカン類似体複合体及びその医薬用途 | |
| KR20200027971A (ko) | 항-cd166 항체 및 이의 용도 | |
| AU2022266934A1 (en) | Anti-nectin-4 antibody and anti-nectin-4 antibody-drug conjugate, and medicinal user thereof | |
| JP2023506805A (ja) | 抗cea抗体-エキサテカン類似体複合体及びその医薬用途 | |
| CN118159558A (zh) | 抗dll3抗体和其用途 | |
| AU2005217237B2 (en) | Anti-human tenascin monoclonal antibody | |
| US7384631B2 (en) | Methods of diagnosis and treatment by binding p75/AIRM1 | |
| CN116574187B (zh) | 针对gucy2c的抗体及其用途 | |
| CN118324916B (zh) | 一种抗人gprc5d的单克隆抗体及其制备方法和用途 | |
| HK1100848B (en) | Anti-human tenascin monoclonal antibody | |
| RU2833323C1 (ru) | Конъюгат антитела против cea и аналога эксатекана и его фармацевтическое применение | |
| CN121568723A (zh) | 抗psma抗体-药物偶联物及其医药用途 | |
| HK1011697A1 (en) | Monoclonal antibody active against cd44v6 |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A2 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SM SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A2 Designated state(s): GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 2005217237 Country of ref document: AU Ref document number: 2272/KOLNP/2006 Country of ref document: IN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2558718 Country of ref document: CA |
|
| WWE | Wipo information: entry into national phase |
Ref document number: PA/a/2006/009674 Country of ref document: MX |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200580006132.4 Country of ref document: CN Ref document number: 2007500356 Country of ref document: JP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10590936 Country of ref document: US |
|
| ENP | Entry into the national phase |
Ref document number: 2005217237 Country of ref document: AU Date of ref document: 20050216 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005217237 Country of ref document: AU |
|
| REEP | Request for entry into the european phase |
Ref document number: 2005718988 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005718988 Country of ref document: EP |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020067020062 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2005718988 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020067020062 Country of ref document: KR |
|
| ENP | Entry into the national phase |
Ref document number: PI0508082 Country of ref document: BR |