WO2005063992A1 - 新規血清型のストレプトコッカス ミュータンスおよびその利用 - Google Patents
新規血清型のストレプトコッカス ミュータンスおよびその利用 Download PDFInfo
- Publication number
- WO2005063992A1 WO2005063992A1 PCT/JP2004/019631 JP2004019631W WO2005063992A1 WO 2005063992 A1 WO2005063992 A1 WO 2005063992A1 JP 2004019631 W JP2004019631 W JP 2004019631W WO 2005063992 A1 WO2005063992 A1 WO 2005063992A1
- Authority
- WO
- WIPO (PCT)
- Prior art keywords
- strain
- serotype
- streptococcus mutans
- mutans
- detecting
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Ceased
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
-
- G—PHYSICS
- G01—MEASURING; TESTING
- G01N—INVESTIGATING OR ANALYSING MATERIALS BY DETERMINING THEIR CHEMICAL OR PHYSICAL PROPERTIES
- G01N33/00—Investigating or analysing materials by specific methods not covered by groups G01N1/00 - G01N31/00
- G01N33/48—Biological material, e.g. blood, urine; Haemocytometers
- G01N33/50—Chemical analysis of biological material, e.g. blood, urine; Testing involving biospecific ligand binding methods; Immunological testing
- G01N33/53—Immunoassay; Biospecific binding assay; Materials therefor
- G01N33/569—Immunoassay; Biospecific binding assay; Materials therefor for microorganisms, e.g. protozoa, bacteria, viruses
- G01N33/56911—Bacteria
- G01N33/56944—Streptococcus
-
- C—CHEMISTRY; METALLURGY
- C07—ORGANIC CHEMISTRY
- C07K—PEPTIDES
- C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
- C07K14/195—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria
- C07K14/315—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from bacteria from Streptococcus (G), e.g. Enterococci
Definitions
- the present invention relates to a novel serotype of Streptococcus mutans (S. mutans), an antibody specific to the novel serotype, a method for producing the antibody, and a novel method using the antibody. Methods and kits for detecting strains; and
- the present invention relates to a polynucleotide encoding an enzyme involved in the biosynthesis of a polysaccharide antigen specific to a novel serotype strain of mutans, a method and a kit for detecting the novel strain using the polynucleotide. Specifically, hybridization is performed by immunoreacting the antibody with the surface polysaccharide antigen extracted from the subject sample, or using the polynucleotide to the genomic DNA extracted from the subject sample.
- the present invention relates to a method for detecting the presence of a novel serotype strain of S. mutans in a subject by performing or performing a PCR reaction using the above polynucleotide, and a kit for performing the detection method.
- Streptococcus mutans force Famous as a causative bacterium of caries (cavities).
- Caries is a disease in which teeth are eluted by the acid generated by S. mutans.
- S. mutans proliferates in the oral cavity and secretes the enzyme dalcosyltransferase. This enzyme breaks down sugars in food to produce insoluble polysaccharide glucans. The produced glucan adheres to the tooth surface together with the S. mutans cells to form plaque (plaque).
- S. mutans metabolizes sugars in plaques to produce acids such as lactic acid. This acid elutes the enamel calcium on the tooth surface and, as a result, caries progresses.
- caries is one of the important diseases in the dental field, and research on the treatment and prevention of caries has been advanced.
- RNA RNA
- rRNA RNA
- Mutans streptococci are based on the composition of their cell wall polysaccharides and the differences in their linkages.
- Type d, g Streptococcus cncetus serotype a, Streptococcus rattus (serotype b), Streptococcus ferus (serotype c), Streptococcus macacae (serotype c), and Streptococcus downei (serotype h) in total of eight sera Classified into types.
- S. mutans may be separated from the blood of patients with infectious endocarditis (IE).
- Infectious endocarditis is one of the best known systemic diseases in the dental field. Infective endocarditis is a fatal infection that is predisposed to patients who have undergone heart valve replacement or have congenital malformations in the heart. Infectious endocarditis is caused by the invasion of the causative bacteria into the patient's blood by dental treatment, forming a bacterial mass on the endocardium and causing inflammation.
- the causative bacterium is often a streptococci present in the oral cavity (especially Streptococcus sanguinis), but S. mutans can also be mentioned as a causative bacterium.
- antibiotics are used to prevent infectious endocarditis.
- sacillin a benicillin antibiotic
- a benicillin antibiotic is available at a dose of 100 mg per dose for a 25 kg child. It is administered preoperatively in the form of powder or powder.
- one strain is serotype e
- one strain is serotype f
- the remaining two strains are of known serotypes (c, e, or f). It did not belong to any, and was serologically undefined.
- a serotype-specific polysaccharide antigen that determines the serotype of the S. mutans strain is a rhamnose glucose polymer having a basic rhamnose skeleton and an ⁇ - or ⁇ -linked darcoside group side chain.
- the serologic uncertainty of the TW295 and TW871 strains was shown to be due to a decrease in the amount of glucose side chains in the sera-specific polysaccharide antigen.
- the serotype-specific polysaccharide antigens in the serologically variable strains (for convenience referred to as serotyped strains of S. mutans) TW295 and TW871 bind to the gluA gene (the immediate precursor of the glucose side chain donor).
- the serotype of the S. mutans strain has been shown to have as high hydrophobicity and sucrose-dependent adhesive ability as the strain isolated from the oral cavity, and to be less susceptible to phagocytosis. It was revealed.
- the serotype of S. mutans is stable in blood, and as a result, patients infected with the serotype of S. mutans may develop infectious endocarditis. Is considered high. S. mutans serotypes are thought to be important from the perspective of preventing the development of infectious endocarditis, which can result in death. Identification is particularly desired.
- An object of the present invention is to provide a method for separating and identifying the serotype-variable strain of S. mutans, and for efficiently and efficiently determining whether or not the strain is present in a subject. Disclosure of the invention
- the present inventors have conducted intensive studies in view of the above problems, and as a result, by improving the immunization method, obtained an antiserum against an S. mutans serovar, and obtained a S. mutans serovar.
- a new serotype (type k).
- the present inventors PCR-amplify a tissue sample obtained from a subject using primers designed based on a nucleotide sequence specific to a k-type strain of S. mutans found in rgpF. As a result, the present inventors have found that it is possible to effectively and efficiently detect the presence of an indeterminate serotype of S. mutans in the subject, and have completed the present invention.
- the polynucleotide of the present invention or a fragment thereof is a base sequence specific to a Streptococcus myutans strain in which the amount of glucose side chains of a serotype-specific polysaccharide antigen of Streptococcus mutans is reduced, or a complementary sequence of the base sequence. It is characterized by including.
- the polynucleotide or a fragment thereof of the present invention is a polynucleotide encoding a polypeptide that reduces the glucose side chain amount of a Streptococcus mutans-specific polysaccharide antigen.
- the polynucleotide is a polynucleotide characterized by its strength.
- the polynucleotide may also include
- the polynucleotide comprises a nucleotide sequence represented by any one of SEQ ID NOS: 1 to 4.
- the oligonucleotide of the present invention is serotype-specific for Streptococcus mutans. It is characterized by containing a base sequence specific to the Streptococcus mutans strain in which the amount of the glucose side chain of the polysaccharide antigen is reduced or a complementary sequence of the base sequence.
- the oligonucleotide is characterized by containing at least 12 consecutive nucleotide sequences of the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4, or a complementary sequence thereof.
- the oligonucleotide preferably contains the nucleotide sequence shown in SEQ ID NOS: 8 to 10 or a complementary sequence thereof.
- the polypeptide of the present invention is characterized in that the amount of a glucose side chain of a Streptococcus mutans-specific polysaccharide antigen is reduced.
- the polypeptide of the present invention is characterized by being encoded by the polynucleotide or a fragment thereof.
- polypeptide of the present invention is characterized in that it is encoded by a polynucleotide consisting of the nucleotide sequence shown in any one of SEQ ID NOS: 1 to 4.
- the Streptococcus mutans strain of the present invention is characterized in that the amount of glucose side chain of the Streptococcus mutans-specific polysaccharide antigen is reduced.
- the Streptococcus mutans strain of the present invention is a novel serotype in which the amount of the glucose side chain of the serotype-specific polysaccharide antigen of Streptococcus mutans is reduced.
- the Streptococcus mutans strain of the present invention preferably has the above-mentioned polynucleotide,
- Streptococcus mutans strain of the present invention preferably expresses the above polypeptide.
- the present invention relates to Streptococcus mutans having a known serotype. It is possible to provide new strains and to provide a Streptococcus mutans strain useful for treating and / or preventing a powerful disease that cannot be elucidated only by Streptococcus mutans having a known serotype.
- the antibody of the present invention provides a Streptococcus in which the amount of a glucose side chain of a polysaccharide antigen specific to a serotype c, e, or f strain of Streptococcus mutans is reduced. It is characterized by specifically binding to the polysaccharide antigen of the mutans strain.
- the antibody of the present invention is characterized in that it binds to a polysaccharide antigen specific to a Streptococcus mutans strain in which the amount of glucose side chains of a serotype-specific polysaccharide antigen of Streptococcus mutans is reduced.
- the antibody of the present invention is characterized in that it specifically binds to the serotype-specific polysaccharide antigen of the above Streptococcus mutans strain.
- the method of the present invention for detecting a Streptococcus mutans strain in a subject sample includes a step of performing a PCR reaction using the above oligonucleotide as a primer.
- the method of the present invention for detecting a Streptococcus mutans strain in a subject sample comprises the steps of separating bacteria from the subject sample and extracting genomic DNA or total RNA of the separated bacteria. Is further included.
- the tissue sample is preferably obtained from blood, saliva, or plaque.
- the primer comprises an oligonucleotide having a nucleotide sequence represented by SEQ ID NO: 8 and a nucleotide represented by SEQ ID NO: 9 or 10 It is preferable that the oligonucleotide has an arraying power. That is, according to the above configuration, the presence of a gene encoding an enzyme important for the biosynthesis of a serotype-specific polysaccharide antigen of a Streptococcus mutans strain having a novel serotype is detected, and the presence of the novel serotype strain is detected. You can know.
- the method for detecting a Streptococcus mutans strain in a subject sample of the present invention comprises, in order to solve the above-mentioned problems, a step of performing a hybridization reaction using the oligonucleotide as a probe. It is characterized by including.
- the method for detecting a Streptococcus mutans strain in a subject sample of the present invention comprises the steps of separating bacteria from the subject sample and extracting genomic DNA or total RNA of the separated bacteria. Is further included.
- the tissue sample is preferably obtained from blood, saliva, or plaque.
- the oligonucleotide preferably comprises a base sequence represented by any one of SEQ ID NOS: 8 to 10.
- the step of isolating the bacterium uses the antibody.
- the method of the present invention for determining the serotype of Streptococcus mutans by the hybridization reaction is intended to solve the above-mentioned problems by using the Streptococcus mutans probe as a probe used in the hybridization reaction.
- An oligonucleotide containing a nucleotide sequence specific to the Streptococcus mutans strain in which the amount of glucose side chains of the serotype specific polysaccharide antigen is reduced or a complementary sequence of the nucleotide sequence is used, and the specific nucleotide sequence described above is used. It is characterized in that it is a nucleotide sequence that is at least 12 consecutive nucleotide sequences of any one of SEQ ID NOs: 1 to 4.
- the method of the present invention for determining the serotype of Streptococcus mutans by a hybridization reaction further comprises the step of using the serotype of Streptococcus mutans as a probe used in the hybridization reaction.
- the nucleotide sequence having at least 12 consecutive nucleotide sequences specific to the strain c, e or f is characterized in that an oligonucleotide containing a complementary sequence of the nucleotide sequence is used.
- the method of the present invention for determining the serotype of Streptococcus mutans by a hybridization reaction further comprises obtaining chromosomal DNA or total RNA from a tissue sample of the subject. You.
- the method for determining a serotype of Streptococcus mutans by a hybridization reaction of the present invention is further characterized in that the tissue sample is obtained from blood, saliva, or plaque.
- the method for determining the serotype of Streptococcus mutans by the hybridization reaction of the present invention of the present invention comprises a step of separating bacteria from saliva, saliva or plaque. It is characterized by
- the method of the present invention for detecting a Streptococcus mutans strain in which the amount of the stalk-specific polysaccharide antigen of Streptococcus mutans sarcoid antigen is reduced in the side chain of the Streptococcus mutans strain is intended to solve the above-mentioned problems. And a step of carrying out an immune reaction using the method.
- the method for detecting a Streptococcus mutans strain in a subject sample of the present invention comprises:
- the method of the present invention for determining the serotype of a Streptococcus mutans strain in a subject is characterized by using the above-described method for detecting a Streptococcus mutans strain.
- the method of the present invention for determining the serotype of S. mutans by the PCR reaction comprises, as a primer used in the PCR reaction, a serotype-specific polysaccharide of S. mutans to solve the above-mentioned problems.
- a specific nucleotide sequence of the S. mutans strain in which the amount of the glucose side chain of the antigen has been reduced or an oligonucleotide containing a complementary sequence of the nucleotide sequence is used. 4.
- the method of the present invention for determining a serotype of Streptococcus mutans by a PCR reaction further comprises, as a primer used in the PCR reaction, a strain of serotype c, e or f of Streptococcus mutans An oligonucleotide containing at least 12 consecutive base sequences of a base sequence specific to or a complementary sequence to the base sequence is used.
- the method of the present invention for determining the serotype of Streptococcus mutans by a PCR reaction further comprises obtaining chromosomal DNA or total RNA from a tissue sample of a subject.
- the method of the present invention for determining the serotype of Streptococcus mutans by a PCR reaction is further characterized in that the tissue sample is obtained from blood, saliva, or plaque.
- the method for determining the serotype of Streptococcus mutans by the PCR reaction of the present invention is characterized by including a step of separating bacteria from saliva, saliva or plaque.
- a Streptococcus mutans serotype excellent in specifically detecting a Streptococcus mutans strain in which the amount of the dulcorse tsukuda j chain of the serotype-specific polysaccharide antigen of Streptococcus mutans is reduced is provided.
- a method of determining can be provided.
- the method of the present invention for determining the serotype of Streptococcus mutans in order to solve the above-described problems, has a reduced amount of the glucose side chain of the serotype-specific polysaccharide antigen of Streptococcus mutans. Characterized by using an antibody that specifically binds to the strain of the strain.
- the method for determining the serotype of Streptococcus mutans of the present invention further comprises the step of specifically determining the amount of the glucose side chain of the serotype-specific polysaccharide antigen of Streptococcus mutans, which is specific to the Streptococcus mutans strain. It is characterized in that an antibody that binds to is used.
- a Streptococcus mutans serotype excellent in specifically detecting a Streptococcus mutans strain in which the amount of the dulcose tsukuda j chain of the serotype-specific polysaccharide antigen of Streptococcus mutans is reduced is excellent.
- a method of determining can be provided.
- the screening method of the Streptococcus mutans strain of the present invention is characterized by using the above-described method for detecting a Streptococcus mutans strain.
- the method of the present invention for screening for a Streptococcus mutans strain in which the amount of the stalk-specific polysaccharide antigen of Streptococcus mutans mutated in the side chain of the glucosidase is reduced uses the above-described polynucleotide or a fragment thereof.
- the method of screening for a Streptococcus mutans strain in which the amount of the side chain of the Dulcose of the Streptococcus mutans serotype-specific polysaccharide antigen of the present invention is reduced comprises the step of: It is characterized by being used.
- the method of screening for a Streptococcus mutans strain of the present invention in which the amount of the side chain of the dulose of the serotype-specific polysaccharide antigen of Streptococcus mutans is reduced, the above-described polynucleotide or a fragment thereof is hybridized. It is characterized by being used in the Zession reaction.
- a method of screening for a Streptococcus mutans strain of the present invention in which the amount of the side chain of the dulose of the serotype-specific polysaccharide antigen of Streptococcus mutans has been reduced uses the above antibody.
- the Streptococcus mutans strain of the present invention is characterized by being obtained by the above-described screening method.
- the Streptococcus mutans strain in which the amount of the stalk-specific polysaccharide antigen of the Streptococcus mutans serotype-specific polysaccharide antigen of the present invention is reduced is separated by the above-described screening method.
- a Streptococcus mutans strain in which the amount of the side chain of the serotype-specific polysaccharide antigen of the Streptococcus mutans mutans of the present invention is reduced is screened by the above-mentioned screening method to solve the above-mentioned problems. Is characterized by
- a Streptococcus mutans strain having a novel serotype can be further provided.
- kits for detecting a Streptococcus mutans strain of the present invention is characterized by comprising the above-mentioned oligonucleotide.
- the oligonucleotide is preferably an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 9.
- the kit for detecting a Streptococcus mutans strain of the present invention preferably further comprises an oligonucleotide having a nucleotide sequence represented by SEQ ID NO: 8.
- the kit for detecting a Streptococcus mutans strain of the present invention preferably further comprises an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 10.
- the kit for detecting a Streptococcus mutans strain of the present invention can be used for PCR reaction or the like. Or for a hybridization reaction.
- the kit for determining the serotype of Streptococcus mutans of the present invention has reduced the amount of glucose side chains of the serotype-specific polysaccharide antigen of Streptococcus mutans in order to solve the above problems.
- the base sequence that is specific to the Streptococcus mutans strain is provided with an oligonucleotide containing a complementary sequence to the base sequence, and the specific base sequence is any one of SEQ ID NOs: 1 to 4. Characterized in that it is a nucleotide sequence that is at least 12 consecutive nucleotide sequences of the nucleotide sequence shown in (1).
- the kit for determining the serotype of Streptococcus mutans according to the present invention further comprises at least 12 base sequences specific to strains of serotype c, e, or f of Streptococcus mutans
- An oligonucleotide comprising a continuous base sequence or its complementary sequence is provided.
- the kit for determining a serotype of Streptococcus mutans of the present invention further comprises a reagent for obtaining chromosomal DNA or total RNA from a tissue sample of a subject, You.
- the kit for determining the serotype of Streptococcus mutans of the present invention is characterized in that the tissue sample is obtained from blood, saliva, or plaque.
- the kit for determining the serotype of Streptococcus mutans of the present invention further comprises a reagent for separating bacteria from saliva or plaque.
- the kit for determining a serotype of Streptococcus mutans of the present invention further comprises a reagent for use in a PCR reaction.
- the kit for determining the serotype of Streptococcus mutans of the present invention further comprises a reagent for use in a hybridization reaction.
- the kit for determining the serotype of Streptococcus mutans of the present invention is further characterized in that the oligonucleotide is labeled.
- the serotype specific polysaccharide antigen of Streptococcus mutans A kit for judging the serotype of Streptococcus mutans, which is excellent in specifically detecting Streptococcus mutans strains in which the amount of the kuzukuda j-chain is reduced, can be provided.
- the kit for determining the serotype of Streptococcus mutans of the present invention has a reduced amount of glucose side chains of the serotype-specific polysaccharide antigen of Streptococcus mutans in order to solve the above problems.
- An antibody that specifically binds to a Streptococcus mutans strain is provided.
- the kit for determining the serotype of Streptococcus mutans of the present invention comprises the above-mentioned antibody that specifically binds to a Streptococcus mutans strain having a novel serotype. .
- the kit for determining the serotype of Streptococcus mutans of the present invention further comprises a Streptococcus mutans strain in which the amount of the glucose side chain of the serotype-specific polysaccharide antigen of Streptococcus mutans is reduced. It is characterized by having an antibody that specifically binds to a polysaccharide antigen.
- a Streptococcus mutans strain in which the amount of the side chain of the Dulcose of the serotype-specific polysaccharide antigen of Streptococcus mutans is reduced that is, a Streptococcus mutans strain having a novel serotype is specifically detected.
- a particularly excellent kit for determining the serotype of Streptococcus mutans can be provided.
- the method for producing an antibody of the present invention is characterized by improving a conventional immunization method to solve the above-mentioned problems.
- the method for producing an antibody of the present invention includes a step of injecting the above-mentioned Streptococcus mutans strain suspended in phosphate-buffered physiological saline into the auricular pinna vein for 5 consecutive days. Is preferred,.
- the method for producing an antibody of the present invention comprises repeating the above Streptococcus mutans strain suspended in phosphate-buffered saline for 5 days a week for an additional 2 weeks after an interval of 1 week.
- the method further comprises the step of injecting.
- Streptococcus mutans strains in which the amount of the side chain of the Dulcose serotype-specific polysaccharide antigen of Streptococcus mutans is reduced, ie, specifically bind to Streptococcus mutans strains having a novel serotype A method for producing an antibody can be provided.
- the bacteria detection device of the present invention is characterized in that an oligonucleotide containing a base sequence specific to a Streptococcus mutans strain having a novel serotype or a complementary sequence thereof is immobilized on a substrate.
- the base sequence is a base sequence of a polynucleotide encoding an enzyme important for biosynthesis of a polysaccharide antigen specific to a Streptococcus mutans strain having a novel serotype. And at least 12 consecutive nucleotide sequences of
- a Streptococcus mutans strain having a novel serotype contained in a sample can be detected and identified.
- FIG. 1 A-E represents antiserum specific to S. mutans TW295 and antiserum specific to TW871, strain TW295, TW871, c-type, e-type and f-type.
- FIG. 2 is a view showing a reaction with a run-to-landol (RR) antigen prepared from a type strain.
- A-C is the expression of PA, CA-GTF and CF-GTF in S. mutans. It is a figure showing the result of a tongue plot.
- FIG. 3 shows phagocytosis rates of oral and blood isolates of S. mutans.
- FIG. 4 is a view showing the presence of a mutation by comparing the base sequence of the first half of the rgpF gene between serotypes c and k of S. mutans.
- FIG. 5 is a diagram comparing the nucleotide sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows a continuation of FIG. 4.
- FIG. 6 is a diagram comparing the nucleotide sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows the continuation of FIG.
- FIG. 7 is a diagram comparing the base sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows the continuation of FIG. 6.
- FIG. 8 is a diagram comparing the base sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows the continuation of FIG. 7.
- FIG. 9 is a diagram comparing the nucleotide sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows the continuation of FIG.
- FIG. 10 is a diagram comparing the nucleotide sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows the continuation of FIG.
- FIG. 11 is a diagram comparing the base sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows a continuation of FIG. 10.
- FIG. 12 is a diagram comparing the nucleotide sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows the continuation of FIG. 11.
- FIG. 13 is a diagram comparing the base sequences of the first half of the rgpF gene in serotypes c and k of S. mutans, and shows a continuation of FIG.
- FIG. 14 is a view in which the nucleotide sequences of the serotypes c and k of S. mutans were aligned and the nucleotide sequences of the first half of the rgpF gene were compared.
- FIG. 15 is a view showing optimal PCR conditions.
- FIG. 17 shows the results of PCR amplification using serotype-specific primers with S. mutans strains of various serotypes and genomic DNA extracted from various streptococcal strains as templates. .
- FIG. 18 shows the results of PCR amplification using serotype-specific primers with genomic DNA from which saliva sample power was also extracted as a template.
- FIG. 19 shows Western immunoblot detection of CA-GTF expression and CF-GTF expression in S. mutans.
- the present inventors have isolated and characterized a new S. mutans strain of serotype k from human blood and oral samples.
- the serological characteristics of the serotype k strain were found to be similar to those of the MT8148 gluA-inactivated mutant strain (MT8148GD).
- MT8148GD has sucrose-dependent adhesion to glass surface, sucrose-independent adhesion to saliva-coated hydroxyapatite, dextran-binding activity, and ceU-associated darcosyltransferase (GTF) Significantly lower biological activity, such as activity, than the parent strain MT8148.
- an antiserum against a serotype k strain of S. mutans was obtained by improving the conventional immunization method.
- the sequence of the genes involved in the biosynthesis of the serotype-specific polysaccharide antigen of S. mutans strains was identified, and serotype k was compared with known strains. Mutations were identified in the sequence of the rgpF gene.
- the present invention provides a polynucleotide encoding a polypeptide that reduces the glucose side chain content of a Streptococcus mutans-specific polysaccharide antigen.
- a polypeptide that reduces the amount of the side chain of the Darcose of a Streptococcus mutans-specific polysaccharide antigen is “a polysaccharide specific to a serotype k S. mutans strain. It is used interchangeably with "a polypeptide involved in the biosynthesis of an antigen” or "a polypeptide involved in the biosynthesis of a serotype-specific polysaccharide antigen of a serotype k S. mutans strain”.
- the present invention provides a polynucleotide having the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4, or a fragment thereof.
- polynucleotide is used interchangeably with “nucleic acid” or “nucleic acid molecule,” and is intended to mean a polymer of a nucleotide.
- base sequence is used interchangeably with “nucleic acid sequence” or “nucleotide sequence” and refers to deoxyribonucleotide. (Shown as A, G, C and T).
- a polynucleotide or a fragment thereof comprising the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4" means each of the deoxynucleotides A, G, C and Z or T of SEQ ID NOs: 1 to 4.
- a polynucleotide comprising the indicated sequence or a fragment thereof is contemplated.
- the polynucleotide according to the present invention can exist in the form of RNA (eg, mRNA) or DNA (eg, cDNA or genomic DNA).
- DNA can be double-stranded or single-stranded.
- Single-stranded DNA or RNA can be the coding strand (also known as the sense strand) or it can be the non-coding strand (also known as the antisense strand).
- oligonucleotide is intended to mean a linkage of several or dozens of nucleotides, and is used interchangeably with “polynucleotide”. Oligonucleotides are short, dinucleotides (dimers), trinucleotides (trimers) and V, and long ones are 30 or 100 mer with! /, And polymerize like! /, It is expressed by the number of nucleotides. Oligonucleotides may be produced as fragments of longer polynucleotides or may be chemically synthesized.
- Fragments of the polynucleotides of the invention may be at least 12 nt (nucleotides), preferably about 15 nt, and more preferably at least about 20 nt, even more preferably at least about 30 nt, and even more preferably at least about 40 nt long. Fragments are intended. For example, ⁇ a fragment having a length of at least 2 Ont of the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4 '' is 20 or more of the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4. Fragments containing contiguous bases of are contemplated.
- nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4 is provided, so that those skilled in the art can easily produce such a DNA fragment.
- restriction endonuclease cleavage or ultrasonic shearing can be readily used to create fragments of various sizes.
- fragments can be made synthetically.
- Biosystems Incorporated (ABI, 850 Lincoln Center Dr., Foster City, CA 94404) Synthesized by a 392 type synthesizer or the like.
- the present invention relates to a polynucleotide involved in the biosynthesis of a polysaccharide antigen specific to a serotype k S. mutans strain.
- the present invention relates to a polynucleotide which has at least 12 consecutive sequences of the base sequence shown in any one of SEQ ID NOS: 1 to 4 or a complementary sequence thereof, regardless of whether or not it encodes a peptide. Even if the particular polynucleotide does not encode a polypeptide involved in the biosynthesis of a polysaccharide antigen specific to a serotype k S.
- mutans strain of serotype k one skilled in the art will appreciate that the polynucleotide power, e.g., polymerase, It is readily understood that it can be used as a primer for a chain reaction (PCR), or as a hybridization probe.
- the polynucleotide of the present invention can specifically PCR-amplify a polynucleotide encoding a polypeptide involved in the biosynthesis of a polysaccharide antigen specific to a serotype k S. mutans strain.
- polynucleotide encoding a polypeptide involved in the biosynthesis of a polysaccharide antigen specific to a serotype k S. mutans strain.
- Other uses of the polynucleotides of the invention that do not encode a polypeptide involved in the biosynthesis of a polysaccharide antigen specific to the serotype k S. mutans strain include Verma, Human Chromosomes: a Manual of Basic
- a portion of a polynucleotide that is "at least 20 nt in length” 20 or more adjacent nucleotides from the nucleotide sequence of the reference polynucleotide are contemplated.
- such parts of the invention are used as primers for amplification of the target sequence by polymerase chain reaction (PCR) or as probes according to conventional DNA hybridization technology. Diagnostically useful.
- the present invention relates to the polynucleotide of the present invention (for example, the base sequence shown in any one of SEQ ID NOS: 1 to 4) under stringent hybridization conditions.
- stringent conditions, hybridization conditions refers to a hybridization solution (50% formamide, 5 ⁇ SSC (1 (Including 50 mM NaCl, 15 mM trisodium citrate), 50 mM sodium phosphate (pH 7.6), 5X dendenoate solution, 10% dextran sulfate, and 20 gZml of denatured sheared salmon sperm DNA) It is intended to wash the filters in 0.1 XS SC at about 65 ° C after incubation at 42 ° C.
- nt nucleotides
- a polynucleotide that hybridizes to about 30-70 nt is contemplated. These are useful as diagnostic primers and probes as discussed in more detail herein.
- Polynucleotides of the invention that encode a polypeptide involved in the biosynthesis of the serotype-specific polysaccharide antigen of the S.
- mutans strain of serotype k include, but are not limited to, the following: A polynucleotide encoding the amino acid sequence of a polypeptide; a coding sequence for a mature polypeptide and additional sequences (eg, a sequence encoding a leader sequence) (eg, a pre-protein sequence or a pro-protein sequence or a pre-protein sequence) Introns, non-coding 5 'and non-coding 3' sequences (eg, transcribed, untranslated sequences that play a role in transcription, mRNA processing (including splicing and polyadullation signals)); Additional coding sequences encoding amino acids.
- a sequence encoding a polypeptide can be fused to a marker sequence (eg, a sequence encoding a peptide that facilitates purification of the fused polypeptide).
- the chimeric amino acid sequence is a hexar histidine peptide (eg, a tag provided in a pQE vector (Qiagen, Inc.)); Many of them are publicly and Z or commercially available. Hexahistidine provides for convenient purification of the fusion protein, as described, for example, in Gentz et al., Proc. Natl. Acad. Sci. USA 86: 821-824 (1989).
- the ⁇ HA '' tag is another peptide useful for purification corresponding to the epitope from the influenza hemagglutinin (HA) protein, which is described by Wilson et al., Cell 37: 767 (1984). I have.
- Other such fusion proteins are specific for the serotype k S. mutans strain fused to Fc at the N- or C-terminus. Includes polypeptides or fragments thereof involved in sugar antigen biosynthesis.
- the polynucleotide of the present invention which encodes a polypeptide involved in the biosynthesis of a serotype-specific polysaccharide antigen of a serotype k S. mutans strain or a fragment thereof, is useful for growth in host cells. It can be linked to a vector containing a selectable marker. Generally, the plasmid vector is introduced in a precipitate, such as a calcium phosphate precipitate, or in a complex with a charged lipid. Further, as described in detail below, the DEAE dextran method and the electoration port method may be used. If the vector is a virus, the vector can be packaged in vitro using a suitable knocking cell line and then transduced into host cells.
- the present invention further relates to a variant of the polynucleotide of the present invention, which encodes a polypeptide involved in the biosynthesis of a serotype-specific polysaccharide antigen of a serotype k S. mutans strain.
- Variants can occur naturally, such as naturally occurring allelic variants.
- allelic variant is intended one of several interchangeable forms of a gene that occupy a given locus on the chromosome of an organism.
- Non-naturally occurring variants can be generated, for example, using mutagenesis techniques known in the art.
- Such variants include those produced by one or several nucleotide substitutions, deletions or additions in the polynucleotides of the present invention. Substitutions, deletions, or substitutions can include one or more nucleotides. Variants can be altered in the coding or non-coding region, or both. Mutations in the coding region can produce conservative or non-conservative amino acid substitutions, deletions, or additions.
- the polynucleotide according to the present invention may be at least a force containing the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4 or a mutant thereof.
- the base sequence of the polynucleotide according to the present invention may be linked by a polynucleotide encoding an appropriate linker peptide.
- an object of the present invention is to provide a polynucleotide encoding a polypeptide involved in biosynthesis of a polysaccharide antigen specific to a serotype k S. mutans strain, and a polynucleotide used for detecting the polynucleotide. It is intended to provide nucleotides (oligonucleotides), and may not be included in the polynucleotide production method and the like specifically described in this specification. Absent. Therefore, a polynucleotide encoding a polypeptide involved in the biosynthesis of a polysaccharide antigen specific to a serotype k S. mutans strain obtained by a method other than those described above, and used for detecting the polynucleotide. It should be noted that polynucleotides (oligonucleotides) that fall within the scope of the present invention.
- the present inventors have discovered a novel serotype (k-type) strain of S. mutans, and have found that there is a mutation in rgpF, one of the enzymes involved in the biosynthesis of the polysaccharide antigen that defines this serotype.
- k-type a novel serotype strain of S. mutans
- polypeptide is used interchangeably with “peptide” or "protein.”
- a “fragment” of a polypeptide is intended to be a partial fragment of the polypeptide.
- the polypeptides of the present invention may also be isolated from natural sources or may be chemically synthesized.
- isolated polypeptide or protein is intended to refer to a polypeptide or protein that has been removed from its natural environment.
- recombinantly produced polypeptides and proteins expressed in a host cell can be isolated, as can native or recombinant polypeptides and proteins that have been substantially purified by any suitable technique. It is thought that there is.
- the polypeptides of the present invention include natural purified products, products of chemical synthesis procedures, and prokaryotic or eukaryotic hosts (eg, bacterial cells, yeast cells, higher plant cells, insect cells, and Includes products produced by recombinant techniques (including mammalian cells).
- prokaryotic or eukaryotic hosts eg, bacterial cells, yeast cells, higher plant cells, insect cells, and Includes products produced by recombinant techniques (including mammalian cells).
- the polypeptides according to the invention can be glycosylated or non-glycosylated.
- the polypeptides according to the invention may also comprise, in some cases, as a result of a host-mediated process, an altered starting methionine residue.
- the present invention provides an rgpF polypeptide of a k-type S. mutans strain.
- rgpF polypeptide of k-type S. mutans strain intends rgpF polypeptide which is an enzyme involved in the biosynthesis of a polysaccharide antigen of a novel serotype k S. mutans strain. Is done.
- the present invention provides a polypeptide encoded by the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4.
- Preferred polypeptides of the present invention include mature polypeptides, extracellular domains, transmembrane domains, intracellular domains, or extracellular and intracellular domains lacking all or part of the transmembrane domain. Including polypeptides.
- the present invention further provides a mutant of the rgpF polypeptide of the k-type S. mutans strain, which exhibits substantial rgpF polypeptide activity of the k-type S. mutans strain.
- the present invention relates to a k-type wherein one or several amino acids are substituted, added or deleted in the polypeptide encoded by the nucleotide sequence shown in any one of SEQ ID NOs: 1 to 4.
- polypeptide variants that exhibit rgpF polypeptide activity of a mutans strain.
- rgpF polypeptide activity of a k-type S. mutans strain refers to a polysaccharide antigen that is not present on a known serotype of the S. mutans strain, ie, k-type S.
- rgpF polypeptide that are involved in the biosynthesis of polysaccharide antigens specific to mutans strains are contemplated.
- Such variants include deletions, insertions, inversions, repetitions, and type substitutions (eg, replacement of a hydrophilic residue with another residue (typically replacing a strongly hydrophilic residue with a strongly hydrophobic residue). Sex residues). "Neutral" amino acid substitutions generally have little effect on activity.
- any base of a polynucleotide encoding a polypeptide can be mutated.
- a deletion mutant or an addition mutant can be prepared by designing a primer corresponding to an arbitrary site of the polynucleotide encoding the polypeptide.
- it can be easily determined whether or not the produced mutant has a desired activity.
- Preferred variants have conservative or non-conservative amino acid substitutions, deletions, or additions. Preferred are silent substitutions, additions and deletions, and particularly preferred are conservative substitutions. They do not alter the rgpF polypeptide activity of the k-type S. mutans strain.
- conservative substitutions include the substitution of one amino acid for another in the amino acids Ala, Val, Leu, and lie of the aliphatic amino acids; Substitution of acidic residues Asp and Glu, substitution of amide residues Asn and Gin, substitution of basic residues Lys and Arg, and substitution of aromatic residues Phe and Tyr.
- polypeptide according to the present invention can be recombinantly expressed in a modified form such as a fusion protein.
- regions of additional amino acids, especially charged amino acids may be used to improve stability and durability in the host cell, during purification, or during manipulation and storage following purification. It can be added to the N-terminus of the peptide.
- the rgpF polypeptide of the k-type S. mutans strain of the present invention is, for example, a tag label (tag), which is a sequence encoding a peptide that facilitates purification of the fused polypeptide. Sequence or marker sequence) can be added to the N-terminus or C-terminus. Such sequences may be removed prior to final preparation of the polypeptide.
- the tag amino acid sequence is a hexar histidine peptide (eg, a tag provided in a pQE vector (Qiagen, Inc.)), and among others, Many are publicly and Z or commercially available.
- Hexahistidine is a fusion protein. It provides easy purification of
- the "HA" tag is another peptide useful for purification corresponding to an epitope from influenza hemagglutinin (HA) protein, which is described in Wilson et al., Cell 37: 767 (1984) (herein incorporated by reference). Described by) It is.
- Other such fusion proteins include the rgpF polypeptide of the k-type S. mutans strain or a fragment thereof according to this embodiment fused to Fc at the N- or C-terminus.
- the rgpF polypeptide of the k-type S. mutans strain according to the present invention may be recombinantly produced or chemically synthesized as described in detail below.
- Recombinant production can be performed using methods well known in the art, for example, using vectors and cells as described in detail below.
- Synthetic peptides can be synthesized using known methods of chemical synthesis. For example, Houg hten has been developed for the synthesis of large numbers of peptides, such as 10-20 mg of 248 different 13 residue peptides, representing single amino acid variants of the HA1 polypeptide segment prepared and characterized in less than 4 weeks. A simple way is described. Houghten, R.A., Proc. Natl. Acad. Sci. USA 82: 5131-5135 (1985). This "Simultaneous Multipie Peptide Synthesis (SMPS)" process is further described in U.S. Pat. No. 4,631,211 to Houghten et al. (1986).
- SMPS Simultaneous Multipie Peptide Synthesis
- the present invention relates to a polypeptide having an amino acid sequence of an epitope-bearing portion of a rgpF polypeptide of a k-type S. mutans strain described herein.
- the polypeptide having the amino acid sequence of the peptide-containing portion of the rgpF polypeptide of the k-type S. mutans strain of the present invention is a polypeptide having at least 6, 7, 8, 9, or 10 amino acids. Any portion up to the length of the entire amino acid sequence of the rgpF polypeptide of the k-type S. mutans strain of the present invention encoded by the nucleotide sequence shown in any one of SEQ ID NOS: 1 to 4 Epitope-bearing partial polypeptides of length (inclusive) are also included.
- the epitope portion of the rgpF polypeptide of the k-type S. mutans strain of the present invention is identified by a method known in the art.
- Geysen et al. (1984) disclose a procedure for the rapid synthesis of hundreds of peptides simultaneously on a solid support that are sufficiently pure for reaction in an enzyme-linked immunosorbent assay. The interaction of the synthetic peptides with the antibodies then It is easily detected without removal from the support.
- peptides bearing the immunogenic epitope of the desired protein can be readily identified by those skilled in the art.
- the immunologically important epitope in the coat protein of the hoof disease virus is
- an "immunogenic epitope” is defined as a portion of a protein that elicits an antibody response when the whole protein is an immunogen. These immunogenic epitopes are thought to be restricted to a few focal points on the molecule. On the one hand, the region of the protein molecule to which an antibody can bind may be defined as an "antigenic epitope”. The number of immunogenic epitopes of a protein is generally less than the number of antigenic epitopes. See, for example, Geysen, H. M. et al., Proc. Natl. Acad. Sci. USA 81: 3998-4002 (1984).
- the antigenic epitope-containing peptide of the present invention is useful for raising antibodies including monoclonal antibodies that specifically bind to the polypeptide of the present invention.
- the majority of hybridomas obtained by fusion of spleen cells from a donor immunized with an antigen epitope-bearing peptide generally secrete antibodies reactive with the native protein.
- Antibodies elicited by peptides with antigenic epitopes are useful for detecting mimetic proteins and are used to track the path of various regions of protein precursors that undergo post-translational processing to antibodies against different peptides Can be done.
- peptides and anti-peptide antibodies have been developed for mimetic proteins.
- Qualitative or quantitative assays such as competitive assays. See, e.g., Wilson, IA, et al., Cell 37: 767-778 (1984) 777. Teru.
- the anti-peptide antibodies of the present invention are also useful for the purification of mimetic proteins (eg, by adsorption chromatography using methods well known in the art).
- the antigenic epitope-bearing peptide of the present invention designed according to the above guidelines preferably has at least 7, more preferably at least 9, and most preferably about 15 contained in the amino acid sequence of the polypeptide of the present invention.
- a peptide or polypeptide comprising a greater portion of the amino acid sequence of the polypeptide of the invention, including any length and up to about 30 to about 50 amino acids or the entire amino acid sequence of the polypeptide of the invention. are also considered to be peptides of the invention, and are also useful for inducing antibodies that react with the mimetic protein.
- the amino acid sequence of the epitope-bearing peptide is selected to provide substantial solubility in aqueous solvents (i.e., the sequence contains relatively hydrophilic residues and is highly hydrophobic). Sex sequences are preferably avoided); and sequences containing proline residues are particularly preferred.
- the epitope-bearing peptide of the present invention can be produced by any conventional means for producing a peptide including a recombinant means using the polynucleotide of the present invention.
- a short epitope-bearing amino acid sequence can be fused to a larger polypeptide that acts as a carrier during recombinant production and purification, and during immunization to produce anti-peptide antibodies.
- Epitope-bearing peptides can also be synthesized using known methods of chemical synthesis.
- the peptide having an epitope of the present invention is used to induce an antibody by a method well known in the art. For example, Chow, M. et al., Proc. Natl. Acad. Sci. USA 82:
- mice can be immunized with free peptide; however, anti-peptide antibody titers can be determined by coupling the peptide to a macromolecular carrier (eg, keyhole limpet mosinin (KLH) or tetanus toxoid). It can be boosted.
- a peptide containing cysteine can be coupled to a carrier using a linker such as m-maleimidobenzoyl N-hydroxysuccinimide ester (MBS), while other peptides are daltaraldehydes.
- a linker such as m-maleimidobenzoyl N-hydroxysuccinimide ester (MBS), while other peptides are daltaraldehydes.
- Coupling to the carrier using a more common linking agent such as Can be done.
- Animals such as herons, rats, and mice can be injected intraperitoneally and Z or intradermally with either free or carrier-coupling peptides, e.g., an emulsion containing approximately 100 g of peptide or carrier protein and Freund's adjuvant.
- Immunized with Some booster injections can be used, e.g., for about 2 weeks to provide useful titers of anti-peptide antibody that can be detected by ELIS A assay using a free peptide adsorbed on a solid surface, for example. May be required at intervals.
- the titer of the anti-peptide antibody in serum from the immunized animal is increased by selection of the anti-peptide antibody, for example, by adsorption to the peptide on a solid support and elution of the selected antibody by methods well known in the art. obtain.
- the present invention relates to vectors used to produce rgpF polypeptides of the k-type S. mutans strain.
- the vector according to the present invention may be a vector used for in vitro translation or a vector used for recombinant expression.
- the present invention also relates to a host cell transformed with a recombinant construct comprising the polynucleotide of the present invention for recombinantly producing the rgpF polypeptide of the k-type S. mutans strain of the present invention. And a method for producing a rgpF polypeptide of a k-type S. mutans strain or a fragment thereof by recombinant techniques.
- Recombinant constructs can be introduced into host cells using well-known techniques such as infection, transduction, transfection, electoporation, and transformation.
- the vector as a recombinant construct can be, for example, a phage vector, a plasmid vector, a vinoresbetter, or a retroviral vector.
- Retroviral vectors can be replicable or replication-defective. In the latter case, propagation of the virus generally occurs only in complementing host cells.
- a polynucleotide encoding a polypeptide of interest to be expressed can be obtained using a method well known in the art.
- the partial sequence of a known protein can be easily obtained in a cell by designing a primer for a desired site and performing PCR amplification to obtain a corresponding polynucleotide, and then inserting it into an expression vector.
- a vector containing a cis-acting control region for the inserted polynucleotide of interest is preferable. Good. Appropriate trans-acting factors may be supplied by the host, may be supplied by a complementing vector, or may be supplied by the vector itself upon introduction into the host.
- the vector is preferably one that provides inducibility and specific expression, which may be Z or cell type specific. Particularly preferred among such vectors are vectors which are inducible by environmental factors which are easy to manipulate such as temperature and nutrient additives.
- Expression vectors useful in the present invention include chromosomal vectors, episomal vectors, and viral-derived vectors (for example, bacterial plasmids, nocteriophages, yeast episomes, yeast chromosomal elements, viruses (for example, baculo Viruses, papovavirus, vaccinia virus, adenovirus, avian box virus, pseudorabies virus, and retrovirus), and vectors derived from the combination thereof (eg, cosmids and phagemids).
- viral-derived vectors for example, bacterial plasmids, nocteriophages, yeast episomes, yeast chromosomal elements, viruses (for example, baculo Viruses, papovavirus, vaccinia virus, adenovirus, avian box virus, pseudorabies virus, and retrovirus), and vectors derived from the combination thereof (eg, cosmids and phagemids).
- the DNA input is transferred to an appropriate promoter (eg, the phage ⁇ PL promoter, E. coli lac promoter, trp promoter, and tac promoter, the SV40 early and late promoters, and the promoter of the retrowinolaes LTR). Should be operably linked. Other suitable promoters are known to those skilled in the art.
- the expression construct further contains sites for transcription initiation, termination, and a ribosome binding site for translation in the transcribed region.
- the coding portion of the mature transcript expressed by the construct contains a transcription initiation codon at the beginning of the polypeptide to be translated and a stop codon at the end, which is appropriately located.
- the expression vector preferably contains at least one selectable marker.
- markers include the dihydrofolate reductase or neomycin resistance gene for eukaryotic cell culture and the tetracycline or ampicillin resistance gene for cultures in E. coli and other bacteria.
- suitable hosts include bacteria (eg, E. coli cells, Streptomyces cells, and Salmonella typ himurium cells); fungal cells (eg, yeast cells); insect cells (eg, Drosophila S2 cells and Spodoptera Sf9 cells); animal cells (eg, CHO cells, COS cells, And Bowes melanoma cells); and plant cells. Suitable culture media and conditions for the above host cells are well known in the art.
- the vector of the present invention can express the rgpF polypeptide of the k-type S. mutans strain of the present invention in bacteria (especially, E. coli).
- bacteria especially, E. coli.
- preferred vectors for use in bacteria are pQE70, pQE60, and pQE-9 (available from Qiagen); pBS, Phagescript, Bluescript, pNH8A, pNH16a, pNH18A, pNH46A (available from Stratagene); And ptrc99a, PKK223-3, pKK233-3, pDR540, pRIT5 (available from Pharmacia).
- Known bacterial promoters suitable for use in the present invention include the E. coli lacl and lacZ promoters, the T3 and T7 promoters, the gpt promoter, the ⁇ PR promoter and the ⁇ PL promoter, and the trp promoter. It is. Suitable eukaryotic promoters include the CMV immediate early promoter, the HSV thymidine kinase promoter, the early and late SV40 promoters, the promoter of the retrovirus LTR (eg, the promoter of the Rous sarcoma virus (RSV)), and the metamouth thionine. Promoters (eg, mouse metamouth thionine I promoter).
- RSV Rous sarcoma virus
- the vector of the present invention is capable of expressing the rgpF polypeptide of the k-type S. mutans strain of the present invention in higher eukaryotic cells. Transcription of DNA by higher eukaryotic cells can be increased by inserting the gene into the vector.
- Enhancers are cis-acting elements of DNA, usually about 10-300 bp, that serve to increase the transcriptional activity of a promoter in a given host cell type. Examples of enhancers include the SV40 enhancer (which is located at 100-27 Obp on the late side of the replication origin), the cytomegalovirus early promoter enhancer, and polio on the late side of the replication origin. One enhancer, and an adenovirus enhancer.
- Preferred eukaryotic vectors include pWLNEO, pSV2CAT, pOG44, ⁇ 1, and pSG (available from Stratagene); and pSVK3, pBPV, pMSG, and And pSVL (available from Phrmacia). Other suitable vectors are well-known to those of skill in the art.
- Introduction of the construct into the host cell can be effected by calcium phosphate transfection, DEAE dextran-mediated transfection, cationic lipid-mediated transfection, electoral poration, transduction, infection or other methods. . Such methods are described in many standard laboratory manuals, such as Davis et al., Basic Methods In Molecular Biology (1986), which is incorporated herein by reference.
- Enzymes are cis-acting elements of DNA, usually about 10-300 bp, that serve to increase the transcriptional activity of a promoter in a given host cell type.
- enhancers include the SV40 enhancer (which is located 100-270 bp on the late side of the replication origin), the cytomegalovirus early promoter, and the polioma on the late side of the replication origin. Enhancers, and adenovirus agents.
- a polypeptide can be expressed in a modified form, such as a fusion protein, and can also include additional heterologous functional regions beyond just secretion signals.
- regions of additional amino acids, especially charged amino acids may be used to improve stability and durability in host cells during purification or during subsequent manipulation and storage. It can be added to the N-terminus of the peptide.
- peptide moieties can be added to the polypeptide to facilitate purification. Such regions can be removed prior to final preparation of the polypeptide.
- the attachment of peptide moieties to polypeptides to produce secretion or excretion, to improve stability, and to facilitate purification is well known in the art and routine. Technology.
- Preferred fusion proteins contain heterologous regions from immunoglobulins that are useful for solubilizing the protein.
- EP A 0 464 533 also Canada Corresponding application 2045869 discloses a fusion protein comprising various parts of the constant region in an immunoglobulin molecule together with another human protein or part thereof.
- the Fc part in the fusion protein is sufficiently advantageous for use in therapy and diagnosis, and thus results, for example, in improved pharmacokinetic properties (EP A 0232 262).
- it is desirable that the Fc portion can be deleted after being expressed, detected, and purified in the advantageous manner described.
- the rgpF polypeptide of the k-type S. mutans strain can be synthesized by known methods (eg, ammonium sulfate precipitation or ethanol precipitation, acid extraction, anion or cation exchange chromatography, phosphocellulose chromatography, hydrophobic interaction, Recombinant cell culture power can also be recovered and purified by chromatography, affinity chromatography, hydroxyapatite chromatography, and lectin chromatography). Most preferably, high performance liquid chromatography (“HPLC”) is used for purification.
- HPLC high performance liquid chromatography
- the vector according to the present invention may include at least the polynucleotide according to the present invention. That is, it should be noted that vectors other than expression vectors are also included in the technical scope of the present invention.
- the cell according to the present invention may contain at least the vector according to the present invention. That is, it should be noted that primary cultured cells other than commercially available cells are also included in the technical scope of the present invention.
- an object of the present invention is to provide a vector containing the polynucleotide of the present invention and a cell containing the vector, and each of the individual cells specifically described in the present specification is provided. It does not depend on the vector type and cell type, and the vector production method and cell introduction method. Therefore, other vector types and cell types It should be noted that vectors and cells obtained using the vector production method and the cell introduction method also belong to the scope of the present invention.
- the present invention provides an isolated serotype k S. mutans strain.
- the serotype k S. mutans strain of the present invention is isolated from a biological sample using an antibody that specifically binds to a serotype k S. mutans strain as described in detail below. Is done.
- Preferred serotype k S. mutans strains include two blood isolates (TW295 and TW871) and 154 oral isolates (FT1-FT51, SU1-SU51, and YK1-YK50, and ATI and YT1). Is not limited to these.
- the term "biological sample” refers to any organism obtained from an individual, body fluid, cell line, tissue culture, or other source containing the serotype k S.
- mutans strain protein or its DNA or mRNA A biological sample is intended.
- Biological samples include body fluids containing serotype k S. mutans strain proteins (eg, blood, saliva, plaque, serum, plasma, urine, synovial fluid, and cerebrospinal fluid) or serotype k.
- Mutant strains Tissue sources that may express the protein include.
- tissue sample intends a biological sample obtained from a tissue source. Mammalian Power Methods for obtaining tissue biopsies and body fluids are well known in the art. If the biological sample contains mRNA, a tissue biopsy is the preferred source.
- sample includes, in addition to the biological sample and the tissue sample, a genomic DNA sample and a Z or total RNA sample extracted from the biological sample and the tissue sample. Are also mentioned.
- the present invention provides an S. mutans strain in which the amount of a glucose side chain of a serotype-specific polysaccharide antigen of S. mutans has been reduced.
- the term ⁇ reduced amount of glucose side chains of polysaccharides specific to serotype c, e or f strains of S. mutans '' refers to the serotype of S. mutans. It is contemplated that it cannot be detected using known antibodies specific for strains c, e or f. Thus, with reference to this specification, the term does not mean that there is no glucose side chain of the polysaccharide antigen specific to the strain of S. mutans serotype c, e, or f.
- the present invention provides an antibody that specifically binds to a strain of a serotype c, e, or f strain of S. mutans that has a reduced amount of the darcose side chain of a polysaccharide antigen specific to the strain.
- the invention provides an antibody that specifically binds to a serotype k S. mutans strain.
- the term "antibody” refers to immunoglobulins (IgA, IgD, IgE, IgG, IgM and their Fab fragments, F (ab ') fragments, Fc fragments) and is taken as an example.
- Examples include, but are not limited to, polyclonal antibodies, monoclonal antibodies, single chain antibodies, anti-idiotype antibodies, and humanized antibodies.
- the antibody of the present invention has been obtained by repeatedly devising a powerful immunization method that could not be obtained by a conventional immunization method.
- the antibody of the present invention is produced using a mutant strain obtained by preparing a known S. mutans strain having a serotype other than the k-type using a known glucose side chain deletion method.
- the antibody of the present invention is prepared using the polypeptide of the present invention as an antigen.
- Antibodies of the invention may be useful for the detection and Z or diagnosis of S. mutans strains of serotype k.
- antibodies to serotype k S. mutans strains refers to complete molecules and antibodies capable of specifically binding to serotype k S. mutans strain antigens. Fragment (eg, Fab and F (ab,) fragments). Fab and F (ab,)
- the 22 fragment lacks the Fc portion of the whole antibody, is more rapidly removed by circulation, and has little to no nonspecific tissue binding of the whole antibody (Wahl et al., J. Nucl. Med. 24: 316-325 (1983). Thus, these fragments are also preferred.
- additional antibody potency that can bind to serotype k S. mutans strain antigens can be produced in a two-step procedure through the use of anti-idiotypic antibodies.
- Such a method makes use of the fact that the antibody itself is an antigen, and thus makes it possible to obtain an antibody that binds to a secondary antibody.
- an S. mutans strain-specific antibody of serotype k is used to immunize an animal, preferably a mouse.
- the spleen cells of such animals are then used to produce hybridoma cells, and the hybridoma cells have the ability to bind serotype k S. mutans strain-specific antibodies.
- Such antibodies include anti-idiotype antibodies to serotype k S. mutans strain-specific antibodies and are used to immunize animals to induce the formation of additional serotype k S. mutans strain-specific antibodies. obtain.
- Fab and F (ab ') 2 and other fragments of the antibodies of the invention are disclosed herein.
- Such fragments are typically papain (to produce Fab fragments) or pepsin (F (ab ') fragment).
- serotype k S. mutans strain-binding fragments can be produced by the application of recombinant DNA technology or by synthetic chemistry.
- a "humanized" chimeric monoclonal antibody When in vivo imaging is used to detect elevated levels of a serotype k strain of S. mutans for diagnosis in humans, it may be preferable to use a "humanized" chimeric monoclonal antibody.
- Such antibodies can be produced using genetic constructs derived from hybridoma cells that produce the monoclonal antibodies described above. Methods for producing chimeric antibodies are known in the art. For a review, see Morrison, Science 229: 1202 (1985); Oi et al., BioTechniques 4: 214 (1986); Cabilly et al., U.S. Patent No.
- the antibody of the present invention only needs to have at least the antibody fragment (for example, Fab and F (ab,) fragment) that recognizes the k-type S. mutans strain of the present invention.
- the antibody fragment for example, Fab and F (ab,) fragment
- an immunoglobulin comprising an antibody fragment that recognizes the k-type S. mutans strain of the present invention and an Fc fragment of a different antibody molecule is also included in the present invention.
- an object of the present invention is to provide an antibody that recognizes the k-type S. mutans strain of the present invention, and the individual immunoglobulins specifically described in the present specification are provided. (IgA, IgD, IgE, IgG or IgM), methods for producing chimeric antibodies, methods for producing peptide antigens, and the like. Therefore, it should be noted that antibodies obtained by methods other than the above-described methods also fall within the scope of the present invention. [0192] (2) Serotype k S. mutans strain detection and diagnostic methods
- the method for detecting and diagnosing a serotype of S. mutans according to the present invention is to detect and diagnose a serotype k S. mutans strain that may be present in a subject.
- the present invention relates to the biosynthesis of polysaccharide antigens specific for S. mutans strains of serotype k in biological samples, particularly in tissues or other cells or body fluids obtained from subjects.
- a method of diagnosing a serotype k S. mutans strain-related disorder by detecting a polynucleotide encoding the enzyme involved.
- Attachment to nucleic acids can be as simple as Northern blot hybridization, using radiolabeled probes to detect the presence of polynucleotides (nucleic acid molecules), or can be achieved by sequencing hybridization techniques. It ranges from using the polymerase chain reaction (PCR) to amplify very small amounts of a particular nucleic acid sequence to the point where it can be used for detection.
- Nucleotide probes can be labeled using commercially available dyes or enzymatic, fluorescent, chemiluminescent, or radioactive labels. These probes are used to detect the expression of genes or related sequences in cells or tissue samples by hybridization, where the genes are normal components, and to detect diseases resulting from infection of organisms.
- Primers can be used to screen serum or tissue samples from humans suspected of having. Primers can also be prepared using reverse transcriptase, or DNA polymerase and polymerase chain reaction, and used for detection of polynucleotides present in very small amounts in tissues or fluids.
- PCR polymerase chain reaction
- the present invention provides a serotype k comprising a step of performing a PCR reaction using, as a primer, an oligonucleotide having at least 12 consecutive nucleotide sequences of the nucleotide sequences shown in SEQ ID NOs: 1 to 4 or a complementary sequence thereof. And a method for detecting the S. mutans strain of the present invention.
- PC R reagents and methodologies p er kin Elmer, 761 Main Ave., Norwalk, Conn 06850;. Or Roche Molecular Systems, 1145 Atlantic Ave., is Suite 100, Alameda, CA 94501 force et available.
- a preferred PCR reaction is a 20 ml PCR reaction solution (5 ⁇ l of 20 ng Z1 genomic DNA, 21 dNTP mixture, 10 X PCR buffer 21, 1, forward primer (20 !! 101/1) 11, reverse Primer (20 11101/1) 11 1, 811 1 ⁇ & Gold 0.1 ⁇ 1, containing MilliQ water 8.91) at 94 ° C for 5 minutes, then at 94 ° C for 30 seconds Perform 30 cycles of 60 ° C for 30 seconds and 72 ° C for 30 seconds !, then! For 7 minutes at 72 ° C. Force is not limited to this.
- the term "at least 12" refers to an integer of 12, 13, 14, 15, or more. According to the present invention, it is possible to effectively and efficiently determine whether or not a serotype k strain of S. mutans is present in a sample obtained from a subject.
- PCR and the hybridization process have been performed as separate tasks. There are several advantages gained by combining PCR and the hybridization process: (i) only a single reagent-added step is required, It is possible to allow this combined reaction to proceed without the need to open the reaction tube, thereby reducing the chance of sample confusion and sample contamination; (ii) less reagent is required Yes; (iii) less reagent addition steps are required to make automation easier; and (iv) in the in situ method, to protect the integrity of cell samples during thermal cycling. There is no need to disassemble the sample containment assembly used.
- One existing method that combines PCR with the hybridization process in a single reaction is a technique known as “Taqman”. See, e.g., Holland et al., Proc. Natl. Acad. Sci. USA 88: 7276-7280 (1991). That.
- In situ PCR is performed on fixed cells such that the specific amplified nucleic acid is substantially contained within the cell or subcellular structure that originally contained the target nucleic acid sequence.
- PCR amplification The cells may be in an aqueous suspension or may be part of a tissue sample (eg, a histological section or a cytochemical smear).
- the term “histological ligament section” is a frozen or chemically fixed, hardened by embedding in wax or plastic, a thin plate (typically, Refers to a solid sample of biological tissue sliced to a thickness of a few microns) and attached to a solid support (eg, a microscope slide), and the term “cytochemical smear” is chemically fixed and A suspension of cells (eg, blood cells) attached to a microscope slide.
- the cells are rendered permeable to the PCR reagent by proteinase digestion, liquid extraction with detergents or organic solvents, or other such as permeabilization methods.
- the term "fixed cell” is used to enhance the cell structure (particularly the membrane) against rupture due to solvent changes, temperature changes, mechanical stress, or drying.
- a sample of biologically treated biological cells The cells can be either fixed in suspension or fixed as part of a tissue sample.
- Cell fixatives are generally chemicals that crosslink protein components of the cellular structure, most commonly by reacting with protein amino groups. Preferred fixatives include buffered formalin, 95% ethanol, formaldehyde, paraformaldehyde, and glutaraldehyde. Permeability of fixed cells can be increased by treatment with proteinases, or detergents, or organic solvents that dissolve membrane lipids.
- the present invention provides a serotype further comprising a step of performing a hybridization reaction using, as a probe, an oligonucleotide having at least 12 consecutive nucleotide sequences of the nucleotide sequences shown in SEQ ID NOs: 1 to 4 or a complementary sequence thereof.
- the present invention provides a method for detecting k S. mutans strains. According to the present invention, S. mutans strains present in a sample obtained from a subject can be determined effectively and efficiently.
- the oligonucleotide of the present invention is obtained by in situ hybridization with a chromosome. It is also useful as a probe for gene mapping and for detecting the expression of a serotype k S. mutans strain in human fibroblasts, for example by Northern blot analysis. As described in detail below, detecting changes in serotype k S. mutans strain gene expression in particular tissues may be indicative of particular diseases and Z or disorders.
- the oligonucleotide of the present invention is labeled.
- suitable labels include, for example, enzymes from the oxidase group that catalyze the production of hydrogen peroxide by reaction with a substrate.
- Glucose oxidase is particularly preferred because it has good stability and its substrate (glucose) is readily available.
- the activity of the oxidase label can be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody z substrate reaction.
- enzymes and other suitable labels include radioisotopes (e.g., iodine (125 iota, 121 iota), carbon (14 c), Iou (35 s), tritium
- An assay for a protein can further result in a binding reaction between the molecule (usually an antibody) and the protein to be detected, or the activity of the enzyme, which can cleave a substrate that produces a detectable color change.
- Many binding assays include dyes, enzymes or radioactive or fluorescent labels to enhance detection.
- Antibodies to the protein can be obtained from patients, immunized animals, or antigen-specific monoclonal cell lines. These antibody assays include such assays as sandwich ELISA assays, western blots, radioimmunoassays, and immunodiffusion assays. Other assays use molecules such as avidin and biotin for immobilization and detection of the molecules. Techniques for preparing these reagents and methods for using them are known to those skilled in the art.
- the present invention provides an antibody that specifically binds to a serotype strain in which the amount of a glucose side chain of a polysaccharide specific to a strain of Streptococcus mutans serotype c, e, or f is reduced. And a method for detecting a serotype k strain of S. mutans comprising a step of performing an immune reaction.
- the term “immune response” refers to a sandwich ELISA Examples include, but are not limited to, assays such as atsay, western blot, radioimmunoassay, and immunodiffusion assay. According to the present invention, it is possible to effectively and efficiently determine whether or not a serotype k strain of S. mutans is present in a sample obtained from a subject.
- the present invention further provides a method of diagnosing a serotype k S. mutans strain using an antibody that specifically binds to a serotype k S. mutans strain described herein.
- Assay methods using antibodies include assays such as sandwich ELISA assays, western immunoblots, radioactive immunoassays, and immunodiffusion assays. Other assays use molecules such as avidin and biotin for immobilization and detection of molecules. Techniques for preparing these reagents and methods for using them are known to those skilled in the art.
- the assay of serotype k S. mutans strain protein levels in a biological sample can be performed using any method known in the art. Antibody-based techniques are preferred for assessing serotype k S. mutans strain protein levels in biological samples. For example, the expression of serotype k S. mutans strain proteins in tissues can be studied by traditional immunohistological methods, including Western blot or dot plot assays. In these cases, specific recognition is provided by the primary antibody (polyclonal or monoclonal), while secondary detection systems may utilize fluorescence, enzymes, or other conjugated secondary antibodies. The result is immunohistological staining of tissue sections for pathology testing.
- Other antibody-based methods useful for detecting serotype k S. mutans strain protein levels include immunoassays (eg, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA)). Including.
- immunoassays eg, enzyme-linked immunosorbent assay (ELISA) and radioimmunoassay (RIA)
- ELISA enzyme-linked immunosorbent assay
- RIA radioimmunoassay
- a serotype k S. mutans strain-specific monoclonal Antibodies can be used both as immunosorbents and as enzyme-labeled probes to detect and quantify serotype k S. mutans strain proteins.
- the amount of serotype k S. mutans strain protein present in a sample can be calculated by comparison to the amount present in a standard preparation using a linear regression computer algorithm.
- ELISA for detecting antigens is described in Iacobelli et al., Breast Cancer Research and Treatment 11: 19-30 (1988).
- two different specific monoclonal antibodies can be used to detect serotype k S. mutans strain proteins in biological fluids. In this assay, one antibody is used as an immunosorbent and the other is used as an enzyme-labeled probe.
- Suitable enzyme labels include, for example, those from the group of oxidases that catalyze the production of hydrogen peroxide by reaction with a substrate.
- Glucose oxidase is particularly preferred because it has good stability and its substrate (glucose) is readily available.
- the activity of the oxidase label can be assayed by measuring the concentration of hydrogen peroxide formed by the enzyme-labeled antibody Z substrate reaction.
- radioisotopes e.g., iodine (125 iota, 121 iota), carbon (14 c), Iou (35 s), Torichi ⁇ beam (3 H), indium (112 In), and technetium (99m Tc)
- fluorescent labels eg, include Furuoresein and rhodamine
- Piochin e.g., iodine (125 iota, 121 iota), carbon (14 c), Iou (35 s), Torichi ⁇ beam (3 H), indium (112 In), and technetium (99m Tc)
- fluorescent labels eg, include Furuoresein and rhodamine
- serotype k S. mutans strains can also be detected in vivo by image analysis.
- Antibody labels or markers for in vivo image analysis of serotype k S. mutans strains include those detectable by radiography, NMR, or ESR.
- suitable labels include radioisotopes, such as barium or cesium, which emit detectable radiation but are not clearly harmful to the subject.
- Suitable markers for NMR and ESR include those having a detectable characteristic rotation, such as deuterium, that can be incorporated into the antibody by labeling the relevant hybridoma nutrients.
- radioisotopes eg, 131 I, i In, 99m Tc
- radio-opaque substrates or substances detectable by nuclear magnetic resonance
- a serotype k S. mutans strain-specific antibody or antibody fragment, labeled with a moiety is introduced (eg, parenterally, subcutaneously, or intravenously) into the mammal being tested for the disorder.
- the size of the subject and the image analysis system used will determine the amount of image analysis portion required to produce a diagnostic image.
- the amount of radioactivity injected is 99 mTc, usually in the range of about 5-20 millicuries.
- the labeled antibody or antibody fragment then accumulates preferentially at locations of cells containing the serotype k S. mutans strain.
- In vivo tumor image analysis is described in SW Burchiel et al., "Immunopharmacokinetics of Radiolaoeiea Antibodies and Their Fragments J (Turner Imaging No. 13: The Radiochemical Detection of Cancer, Burchiel, SW and Rhodes, BA, Masson Publishing Inc. (1982). Has been described.
- Labels more suitable for the serotype k S. mutans strain-specific antibodies of the present invention are provided below.
- suitable enzyme labels include malate dehydrogenase, staphylococcus nuclease, yeast alcohol dehydrogenase, ⁇ -glycerol phosphate dehydrogenase, triose phosphate isomerase, peroxidase, alkaline phosphatase, asparaginase, glucose oxidase, and j8-galatatosidase.
- radioisotope labels examples include 3 H, i In, 125 I, 131 I, 32 P, 35 S, 14 C, 51 Cr, 57 To, 58 Co, 59 Fe ⁇ 75 Se ⁇ 15 3 ⁇ 4u, 9 ° Y, 67 Cu, 217 Ci ⁇ 211 At, 212 Pb, 4? Sc ⁇ 109 Pd.
- ⁇ ln is a preferred isotope when in vivo imaging is used. Since this is because to avoid 125 iota or 131 1-labeled monoclonal antibody that by the liver de Harogeni spoon problems. Furthermore, this radionuclide has a more favorable gamma emission energy for imaging (Perkins et al., Eur. J.
- non-radioactive isotope labels examples include 157 Gd, 55 Mn, 162 Dy, 52 Tr, and 56 Fe.
- fluorescent labels 15 3 ⁇ 4U label, Furuoresein label, Isochioshiane preparative label, like a rhodamine label, a phycoerythrin label, Fikoshianin label, ⁇ b Fi waist ⁇ Nin label, o- phthalaldehyde label, and Furuoresamin label
- rhodamine label a rhodamine label
- Fikoshianin label a phycoerythrin label
- ⁇ b Fi waist ⁇ Nin label o- phthalaldehyde label
- Furuoresamin label can be any fluorescent labels, 15 3 ⁇ 4U label, Furuoresein label, Isochioshiane preparative label, like a rhodamine label, a phycoerythrin label, Fikoshianin label, ⁇ b Fi waist ⁇ Nin label, o- phthalaldehyde label, and Furuoresamin label
- Suitable toxin labels include diphtheria toxin, ricin, and cholera toxin.
- chemiluminescent label examples include a luminal label, an isoluminal label, an aromatic atalydi-pium ester label, an imidazole label, an ataridi-pium salt label, an oxalate ester label, a luciferin label, a luciferase label, and an equorin label. Is mentioned.
- nuclear magnetic resonance contrast agents include heavy metal nuclei such as Gd, Mn, and Fe.
- the present invention provides a method of screening for a S. mutans strain of serotype k with a biological sample strength.
- the present invention relates to a strain specific to a serotype comprising a base sequence shown in SEQ ID NOs: 1 to 4 and having a reduced amount of glucose side chain of a serotype-specific polysaccharide antigen of S. mutans.
- a method for screening a serotype strain in which the amount of a glucose side chain of a serotype-specific polysaccharide antigen of S. mutans is reduced, using a polynucleotide having a base sequence or a complementary sequence thereof or a fragment thereof.
- the serotype strain in which the amount of the glucose side chain of the serotype-specific polysaccharide antigen of S. mutans is reduced is a serotype k S. mutans strain.
- the screening method of the present invention comprises a step of confirming the serotype of the S. mutans strain using the antibody of the present invention. Is further included.
- the present invention provides a method for producing a serotype of S. mutans using an antibody that specifically binds to a strain of a serotype in which the amount of glucose side chains of the serotype-specific polysaccharide antigen of S. mutans is reduced.
- the serotype strain in which the amount of glucose side chains of the S. mutans serotype-specific polysaccharide antigen is reduced is a serotype k S. mutans strain.
- the screening method of the present invention further comprises a step of confirming the serotype of the S. mutans strain using the polynucleotide of the present invention or a fragment thereof.
- the present invention further provides a serotype strain in which the amount of the glucose side chain of the serotype-specific polysaccharide antigen of S. mutans has been identified using the above-described screening method.
- the serotype strain in which the amount of the glucose side chain of the serotype-specific polysaccharide antigen of S. mutans is reduced is a serotype k S. mutans strain.
- the S. mutans strain of serotype k includes, but is not limited to, TW295, TW871, FT1-FT51, SU1-SU51, YK1-YK50, FT1GD, YK1R, ATI and YT1. Not done.
- the S. mutans serotype determination kit of the present invention determines whether or not the S. mutans strain to be determined is the above-mentioned k-type.
- the present invention provides a kit for detecting a serotype k strain of S. mutans, comprising an oligonucleotide having at least 12 consecutive base sequences of SEQ ID NOs: 1 to 4 or a complementary sequence thereof.
- the kit of the present invention further comprises an oligonucleotide that specifically binds to a c-type, e-type or f-type S. mutans strain. More preferably, said oligonucleotide is labeled.
- serotype k strains of S. mutans can be detected in cases that were below the detection limit.
- the oligonucleotide is a PCR primer.
- the kit of the present invention is a reagent for use in a PCR reaction. It further contains drugs.
- the oligonucleotide is a hybridization probe.
- the kit of the present invention further comprises reagents for use in a hybridization reaction.
- the kit of the present invention is characterized by comprising an oligonucleotide having the nucleotide sequence shown in SEQ ID NO: 9.
- the kit according to the present embodiment preferably further comprises an oligonucleotide having the nucleotide sequence represented by SEQ ID NO: 8, and more preferably further comprises an oligonucleotide having the nucleotide sequence represented by SEQ ID NO: 10. .
- the present invention further provides a kit for detecting a serotype k S. mutans strain, which comprises an antibody that specifically binds to a polysaccharide antigen of a serotype k S. mutans strain.
- the oligonucleotide is labeled. According to the present invention, it is possible to easily identify whether or not a patient has a serotype k S. mutans strain. In particular, S. mutans strains of serotype k can be detected in cases that were below the detection limit.
- the bacteria detection device is a device for detecting and identifying bacteria in a sample, in which an oligonucleotide based on a nucleotide sequence specific to a species or a genus to which the target bacteria belong is immobilized on a substrate surface.
- bacteria in a sample are detected and identified by hybridization between the oligonucleotide and a nucleic acid derived from the sample.
- the above-mentioned oligonucleotide comprises at least the nucleotide sequence of a polynucleotide encoding an enzyme involved in the biosynthesis of a polysaccharide antigen specific to the S.
- mutans strain of serotype k Includes 12 consecutive base sequences or their complementary sequences. Further, in the case of comprehensively testing other types of bacteria, it is preferable that oligonucleotides containing a base sequence specific to the other type of bacteria (they may be plural) are also immobilized on the substrate. As described above, by subjecting the sample to an assay using a sample containing a plurality of types of bacteria, it is possible to determine what kind of bacterial species the S. mutans strain of serotype k tends to coexist with.
- the material of the substrate used in the bacterium detection device according to the present invention may be any material as long as the oligonucleotide can be stably immobilized.
- synthetic resins such as polycarbonate and plastic, glass, and the like can be given, but are not limited thereto.
- the form of the substrate is not particularly limited, for example, a plate-like or film-like substrate can be suitably used.
- the oligonucleotide immobilized on the substrate surface of the bacterium detection device according to the present invention may be an oligonucleotide based on a base sequence specific to the species or genus to which the bacterium to be detected belongs.
- the establishment of hybridization between the oligonucleotide and the nucleic acid derived from the sample makes it possible to detect bacteria belonging to the target species or genus contained in the sample.
- the oligonucleotide based on the species or the base sequence specific to the genus to which the bacterium to be detected belongs is hereinafter appropriately referred to as “capture oligo”.
- the specific nucleotide sequence may be a nucleotide sequence or a species-specific nucleotide sequence of the genome of the bacterium to be detected, but may be a nucleotide sequence corresponding to the ribosomal RNA gene of the bacterium to be detected. Is preferred. Among them, the bacterial 16S ribosomal RNA gene is known to have a large number of genus- or species-specific nucleotide sequences. It is particularly preferred to find the base sequence. The base sequence of the ribosomal RNA gene can also be obtained from databases such as GenBank, EMBL, and DDBJ.
- the capture oligo may be designed based on the above-described genus or species-specific nucleotide sequence. Therefore, the nucleotide sequence may be the above-described genus or species-specific nucleotide sequence itself, or may contain a mutation as long as specific hybridization is established with the nucleic acid prepared from the bacteria to be detected. . The position of the mutation is not particularly limited.
- the length (number of bases) of the capture oligo is not particularly limited. If it is too short, detection of hybridization is difficult, and if it is too long, nonspecific hybridization is not performed. Yeong is tolerated.
- the inventors have repeatedly studied the optimization of the length of the capture oligo, and have set the standard length to 12 to 50 bases. Preferably, the length is 12 to 40 bases, more preferably Force that is 12 to 30 nucleotides in length, and still more preferably 13 to 22 nucleotides in length.
- the base length mainly depends on the sequence characteristics (specific base content, repeat of the same base), and it has good binding properties. It is possible that specific hybridization is possible even with short chains. Have been confirmed by the inventors.
- oligo force When it has a hairpin structure, a loop structure, or any other three-dimensional structure that interferes with hybridization with a sample-derived nucleic acid, one or more nucleotides constituting the capturing oligo may be removed.
- the three-dimensional structure can be released by substituting a nucleic acid that does not pair with inosine or an offset nucleotide.
- the method for synthesizing the capture oligo is not particularly limited, and is known in the art (for example, Maniatis, T. et al., Molecular Cloning A Laboratory Manual, Second Edition, Cola Spring Harbor Laboratory Press (1989)). And the like. Generally, it can be chemically synthesized using a commercially available DNA synthesizer.
- Control capture oligos include the positive control 'capture oligo' and the negative control capture oligo.
- the positive control capture oligo is used for judging whether the amplification reaction is successful or not in the probe preparation step described later.
- the negative control 'capture oligo is used to confirm that non-specific hybridization has not occurred, that is, that a false-positive hybridization signal has been generated! /, Na! /. is there.
- the present invention also includes a bacterium detection device in which these positive control / capture oligo and negative control / capture oligo are immobilized on the substrate surface.
- the positive control 'capture oligo' may be any one that is designed based on the base sequence contained in the probe to be prepared. When multiple bacteria to be detected are detected simultaneously using the same bacteria detection device, a positive control 'capture oligo' may be designed for each of the bacteria to be detected. May be designed based on the base sequence common to the probes prepared from them! If there is no common nucleotide sequence for probes prepared from all bacteria to be detected, a positive control 'capture oligo may be designed for each of several groups. Alternatively, an artificial sequence having the same primer sequence but different from the target bacterial sequence can be designed, and a part of this sequence can be used as a positive control 'capture oligo'.
- a probe is prepared by using the above artificial sequence as a type I (in the present specification, such a probe is referred to as a control probe), and the sample force is also added to the prepared probe to obtain a hybridization. It is possible to verify the specificity.
- the probe will be described later.
- the negative control 'capture oligo' has at least one base in the base sequence of the positive control 'capture oligo and artificially generated within a range of less than 20% of the number of bases of the sequence. It is preferable to design to have a base sequence containing base substitution.
- the number of bases to be subjected to base substitution is determined in relation to hybridization conditions, and the number of bases may be selected so that the probe derived from the bacteria to be detected does not cause hybridization.
- the detection target bacterium is not particularly limited, and a bacterium to be detected may be appropriately selected from a target sample.
- a bacterium to be detected may be appropriately selected from a target sample.
- bacteria that may enter the food and contaminate the food. Harmful bacterial contamination of food is a huge public health problem.
- the presence of the food-contaminating bacteria and Z or the amount thereof the presence of the serotype k S. mutans strain of the present invention and the amount of Z or the amount thereof can be measured.
- Bacteria that contaminate foods include Lactobacillus, Pediocuccus, and S Economics. Tococcus (Streptococcus), me! Bacteria belonging to the genus Suffev (Megasphaera) and the genus Pectinatus can be mentioned.
- Lactobacillus brevis Lactobacillus brevis (Lactobacillus brevis, Lactobacillus nanoless' Coriniphonoremis (Lactobacillus coryniformis), Lactobacillus lactobacillus curvatus, Lactobacillus curvatus Delprukkii (Lactobacillus delbruecKi, Lactobacillus fermentum) , Lactobacillus lindneri, Lattobacillus malefermentans, Lactobacillus malefermentans, Lactobacillus casei Lactobacillus casei, Lactobacillus rhamnolus, Lactobacillus rhamnosus Lactobacillus rhamnosus, Lactobacillus rhamnosus Bacteria belonging to the genus Leuconostoc and Zymomonas, as well as Enterococcus durans and Lactococcus lactis. However, the detection target bacteria are not limited to these
- the capture oligos for detecting and identifying the above-mentioned bacteria include oligos based on sequences specific to each genus among the nucleotide sequences corresponding to the 16S ribosomal RNA genes of the bacteria listed above. Nucleotides include, but are not limited to.
- the capture oligo immobilized on the substrate surface of the bacterium detection instrument according to the present invention is not particularly limited as long as hybridization with a probe prepared from the bacterium of interest is established. What is not done.
- the bacterial detection device is most preferably a so-called microarray-type device in which a plurality of capture oligos corresponding to a target bacterial species or genus are fixed on one substrate.
- the method for immobilizing the oligonucleotide on the substrate surface is not particularly limited, and any known method may be appropriately selected and used.
- techniques used in general hybridization methods such as physical adsorption, electrical bonding, or molecular covalent bonding, can be used.
- a substrate having a carbodiimide group or an isocyanate group on the surface US Pat. No. 5,908,746, JP-A-8-23975
- oligonucleotides are preferably immobilized on the surface of the substrate to a size of 10-1,000 m in diameter.
- the method for spotting the oligonucleotide on the substrate is not particularly limited. For example, it can be carried out by spotting an oligonucleotide solution on a substrate using a spotting machine. Thereby, the oligonucleotide solution is generally spotted in a substantially circular shape.
- the causative bacteria can be detected in cases that have been below the detection limit. It is possible to limit individuals who carry strains that are at high risk of developing infectious endocarditis, thereby suppressing the large amount of antibiotics used to prevent infectious endocarditis, Can suppress the emergence of drug-resistant bacteria due to abuse of the drug. In addition, it is possible to know the correlation between the S. mutans strain that is the causative bacterium and the symptom, and to give a further blue report on the relationship with the other causative bacterium.
- strains obtained from 100 subjects (3 to 17 years old; average 8.9 years old) who visited the Pediatric Dentist in Osaka University Dental Hospital (Suita ⁇ , Osaka, Japan) in August 2002 were acquired.
- Randomly selected (NN 2000 series). These subjects included 88 healthy infants, 5 patients with cleft lip and palate, 3 patients with ventricular septal defect, and enamel dysplasia. Included were two patients with vertebrae, one with spina bifida, and one with autism.
- S. mutans blood isolates TW295 TW871 TW964 and TW1378 were serotyped, serotyped, and f, respectively. Strain and an e-type strain.
- S. mutans strains Table 2 shows the characteristics of MT8148 (c-type strain), MT4245 (e-type strain), and MT4251 (f-type strain), which are the above-mentioned oral isolates.
- Oral isolate obtained from a healthy girl of k10 years old obtained from a healthy girl of k10 years old
- Antiserum against S. mutans serovar was obtained.
- Antiserum against S. mutans a novel serotype, has significantly reduced antigenicity, and thus cannot be obtained by conventional methods.However, the present inventors devised an immunization method. By doing so, the high serum was successfully obtained.
- a glucose side chain deletion (GD) mutant of MT8148 was constructed by insertional inactivation of an antibiotic resistance gene into the gluA gene.
- AmpliTaq Gold polymerase along with a primer constructed based on the gluA sequence obtained from S. mutans strain Xc (GenBank accession no.AB001562) and the S. mutans genome database (GenBank accession no.AE014133) published by Oklahoma University
- the gluA gene and its adjacent regions were amplified by polymerase chain reaction (PCR) using (Applied Biosystems, Foster City, Calif). The amplified fragment was then cloned into the pST Blue-1 vector (Promega, Madison, Wis.) To generate plasmid pRNlOl.
- mutant MT8148GD exhibited typical biological characteristics of S. mutans. These features include coarse colonies on MS agar, positive sugar fermentation ability, expression of PA and GTF, and high levels of sucrose-dependent attachment and cell hydrophobicity.
- the middle pelle contains the RR extract obtained from the TW295 strain (Pell 1), and the outer pells contain the antiserum to the TW295 strain (Pell 2) and the antiserum to the TW871 strain (Pell 2). 3), as well as an antiserum specific to serotype c (Pell 4), an antiserum specific to serotype e (Pell 5), and an antiserum specific to serotype f (Pell 6). Also, the middle panel in FIG.
- 1B contains the antiserum against the TW871 strain (Pell 7), and the outer panel is the RR extract obtained from the TW295 strain (Pell 8) and the RR extract obtained from the TW871 strain (Pell 8). Strain 9), MT4251 strain (f) RR extract obtained from the strain (Shell 10), MT4245 strain (e) RR extract obtained from the strain (Sell 11) and RR extract also strain MT8148 (c) ( ⁇ El 12).
- the middle panel in FIG. 1C contains the RR extract that also obtained the FT1 strain (Pell 13), and the outer panel contains the antiserum specific to the TW871 strain (Pell 14) and the serotype c specific.
- the middle well in Figure 1D contains the antiserum specific for serotype c (well 18), and the outer wells from the RR extract from the MT8148 strain (well 19) and the MT8148 GD strain (c). RR extract (Pell 20).
- the middle panel of FIG. 1E contains the antiserum against the TW871 strain (Pell 21), and the outer panel of FIG. 1E shows the RR extract obtained from the TW295 strain (Pell 22) and the RR extract obtained also from the TW871 strain (Pell 22).
- L23 obtained from the FT1 strain Includes RR extract (Pell 24), RR extract obtained from SU1 strain (Pell 25), RR extract obtained from YK1 strain (Pell 26), and RR extract obtained from MT8148GD strain (Pell 27).
- the RR extract of MM8148GD formed a sedimentation band with the antiserum against TW871 (but did not form a sedimentation band with the serotype c-specific antiserum), and these bands were TW295, TW871, and FT1. , SU1 and YK1.
- Figs. 2A and 2B all cells were separated by 7% SDS polyacrylamide gel electrophoresis, and the rabbit antibody against S. mutans PA (Fig. 2A) or CA-GTF (Fig. 2B) was used. Reacted.
- Fig. 2C the cell supernatant concentrated by the ammonium sulfate precipitation (C)
- the protein transferred onto the PVDF membrane was separated by 7% SDS polyacrylamide gel electrophoresis, and CF-GTF (C) was reacted with a peas antibody.
- lane 1 is the MT8148 strain
- lane 2 is the FT1 strain
- lane 3 is the SU1 strain
- lane 4 is the YK1 strain.
- FT1 and SU1 strains have PA and three types of GT F was expressed.
- the FT1 and SU1 strains exhibited high levels of sucrose-dependent attachment and bacterial hydrophobicity (data not shown), and their 16S rRNA gene sequences were identified as NCTC10449 strains (GenBank accession no. X58303 and S70538). ) And the 16S rRNA gene sequence. Furthermore, the RR extract of the FT1 strain formed a sedimentary band with the antiserum against the TW871 and TW295 strains, and this band also fused with the sedimentation band of the RR extract of TW871 and the antiserum against TW871. In addition, 50 strains obtained from each of the subjects with the FT1 and SU1 strains were not reactive with the antisera specific for c, e or f.o
- both of these strains are characterized by coarse colonies on MS agar medium, bacitracin resistance, gamma hemolysis on blood agar, mannitol, sorbitol, raffinose and melibiose, which are characteristics of S. mutans. Showed positive saccharide fermentation ability and negative dextran agglutination.
- Table 3 shows the serotype distribution of 2500 of the above isolates of S. mutans (of which 2450 were classified as c-type, e-type or f-type).
- RR extracts of the other 50 strains obtained from a single subject (a girl with Down syndrome) formed a sedimentation band with the antiserum against TW871. This band also fused with the sedimentation bands of RR extracts of TW295, TW871, FT1 and SU1.
- Table 4 shows the serotype distribution pattern in individual subjects, most of which had only S. mutans serotype c, followed by only 50 serotype e subjects. Five of them were found to have multiple serotypes.
- the organism was cultured in Brain Heart Inlusion broth (Difco) at 37 ° C. for 18 hours. After washing the cells, the cell concentration was adjusted to 1.0 ⁇ 10 8 CFU / ml with PBS.
- Human peripheral blood 500 mu 1
- Human peripheral blood 500 mu 1
- healthy volunteers collected from healthy volunteers and incubated bacteria 500 ⁇ ⁇ (5. OX 10? CFU) and the monitor 37 ° C for 10 minutes.
- the ratio was determined. The ratio was expressed by the average value of phagocytosed PMN per 100 PMNs (500 PMNs tested).
- Fig. 3 ⁇ ⁇ ⁇ shows the phagocytosis rate of oral and blood isolates of S. mutans. The results shown in Fig. 3 ⁇ ⁇ ⁇ show the average standard deviation of five experiments. In Figure 3 ⁇ , the phagocytosis rate of the 12 strains was tested after 10 minutes incubation.
- Figure 3 ⁇ shows the changes in phagocytosis of ⁇ 8148 (see), MT8148GD ( ⁇ ), FT1 ( ⁇ ), and TW295 (mouth) at 15, 30, 60, 90, and 120 minutes of incubation.
- the phagocytosis rate of the MT8148GD strain was 22.0 ⁇ 2.4%, which was significantly lower than that of the parent strain MT8148 (68.4 ⁇ 4.1%) (P ⁇ 0%). . 001).
- oral isolates of NN2001 (c), NN2002 (e) and NN2003 (f) showed similar phagocytosis rates to MT8148, whereas serotype k oral isolates FT1, SU1 and YK1 also The phagocytosis rate was significantly lower than that of MT8148 (P ⁇ 0.001).
- the phagocytosis rates of all four of the blood isolates were significantly lower than those of the oral isolates (P ⁇ 0.001).
- the phagocytosis rate of MT8148GD, FT1 and TW295 was significantly lower than that of MT8148 up to 60 minutes of inactivation.
- the phagocytosis rate of TW295 was also significantly lower than MT8148 90 minutes after inactivation. (P ⁇ 0.001).
- the RR extracts of two blood isolates (TW295 and TW871), 152 oral isolates (FT1-FT51, SU1-SU51, and YK1-YK50), and gluA-inactivated strain (MT8148GD) were TW295 or TW871 A sedimentation band was formed with antiserum.
- these isolates were shown to have the biological characteristics typical of S. mutans, including high levels of sucrose-dependent attachment and hydrophobicity, and darcosyltransferase.
- sobrinus isolates from human plaque, carious dentin, or fecal samples had serotypes c and e. , F, d or g.
- all 144 S. mutans or S. sorbinus obtained from plaque were classified as force serotypes c, e, d or g, And no f-type or serotyped strains were detected.
- nine out of 103 subjects were recently reported to have serologically variable S. mutans, but there is no accurate description of the characteristics of serotype-specific polysaccharides. Helped. The above shows that the present inventors have recently revealed serotype k in Japan.
- a specific gene sequence was present in the first half of the rgpF gene in the k-type strain of S. mutans. Using this region, a forward primer was prepared based on the sequence common to each serotype (c, e, f, and k) strains upstream of the start codon of the rgpF gene.
- CEF-R CCGACAAAGACCATTCCATCTC 6508-6529 corresponds to the position of the Xc (c) strain (GenBank accesion no. AB01 0970).
- S. mutans k-type strains TW295, TW871, FT1, and YT1
- saliva samples were also extracted from genomic DNA, and primer pairs of CEFK-F and CEF-R, and Using a primer pair of CEFK-F and KR, a PCR reaction solution was prepared according to FIG. One cycle of C5 minutes, 94. C30 seconds, 60. C 30 seconds, 72.
- the PCR reaction was performed under the conditions of 30 cycles of C30 seconds and 1 cycle of 72 ° C for 7 minutes.
- the resulting reaction solution was electrophoresed on a 1.5% agarose gel.
- Figure 16 shows the results.
- S. mutans k-type strains (TW295 strain and FT1 strain) were subjected to PCR amplification with primers specific to k-type, and in c-type (MT8148 strain), PCR amplification with no primers occurred.
- the detection limit is 50-500 cells for the primer pair specific to the serotype cZeZf strain, and 5-50 cells for the primer pair specific to the serotype k strain, indicating that the sensitivity is very good. all right.
- genomic DNA (lanes 1-4) extracted from bacteria of serotype cZeZf strain using primer pairs (CEFK-F and KR) (B) specific for serotype k strain, serum PCR reactions were performed using genomic DNA extracted from bacteria of type k strain (lanes 5 to 8) and genomic DNA extracted from saliva samples (lanes 914) as templates.
- lane 1 is MT8148 (c type)
- lane 2 is NN2001 (c type)
- lane 3 is NN2002 (e type)
- lane 4 is NN2003 (f type).
- Lane 5 is TW295 (k type)
- lane 6 is TW871 (k type)
- lane 7 is FT1 (k type)
- lane 8 is YTl (k type)
- lane 9 Is Steptococcus sanguinis ATCC1 0556, lane 10 force ⁇ Streptococcus oralis ATCC10557, lane 11 Streptococcus gordonii ATCC10558,
- lane 12 is Streptococcus mitis ATCC903
- lane 13 is Streptococcus milleri NCTC10703
- lane 14 is Streptococcus salivarius HHT.
- primer pairs CEFK-F and CEF-R specifically detected the serotype cZeZf strain
- the primer pairs CEFK-F and KR specifically detected the serotype k strain. No streptococci other than S. mutans were detected.
- the use of primer pairs CEFK-F and CEFK-R and primer pairs CEFK-F and KR not only specifically detect serotype cZeZf and serotype k strains, respectively. It has been found that only one can be specifically detected.
- Example 6 Identification of subject having S. mutans serotype k strain by PCR using saliva sample
- Ejected whole saliva was used in 200 children or adolescents (2-18 years old, mean age 7.9 ⁇ 3.6 years) who visited Osaka University's School of Dentistry in December 2004 )). These saliva samples were used in PCR assays with some modifications of the method reported by Hoshino et al. (2004). Briefly, unstimulated whole saliva was collected in sterile tubes and placed on ice. The cells were collected from 500 1 saliva in a microcentrifuge tube with 16, OOO X g trowel for 5 minutes, treated in an electronic oven at 500 W for 5 minutes, and N-Acetylmura Mildase SG (Seikagaku Corp. , Tokyo, Japan) 1 hour digested.
- a serotype cZeZf strain was used using primer pairs CEFK-F and CEF-R (A), and primer pairs CEFK-F and KR were used.
- serotype k strain (B) was detected (Fig. 18 ⁇ ⁇ ⁇ ).
- 190 were non-specific for serotype k (serotype cZeZf). (A), but negative for the serotype k strain-specific primer pair).
- the remaining 10 specimens were compared with a primer pair specific for serotype k strain (B) and a primer pair nonspecific for serotype k strain (specific for serotype cZeZf strain) (A).
- A primer pair specific for serotype k strain
- Fig. 18A the primer pair CEFK-F and CEF-R were used, and the primer pair (A) non-specific for serotype k strain (specific for serotype cZeZf strain) was positive.
- the primer pair (B) specific to the serotype k strain are shown.
- primers versus CEFK-F and KR were used for detection of serotype k strains.
- lanes 1 to 5 show five representative samples among the samples of the 190 strains in which the primer pair specific to the serotype k strain was negative.
- Lanes 6-8 show strains that were positive for the primer pair specific for the serotype k strain.
- k-type strains of S. mutans TW295, TW871, FT1, SU1, YK1, YT1, and ATI strains
- clinical isolates of S. mutans N2000 series: c (Type 78 strains, e type 17 strains, f type 3 strains)
- PCR amplification with primers specific to k type occurred, but no PCR amplification with primers specific to c type, e type or f type .
- PCR amplification using primers specific to c-type, e-type or f-type occurred, and PCR amplification using primers specific to k-type occurred. It did not happen.
- S. mutans is classified into serotypes c, e and f based on the chemical composition of its cell surface polysaccharide (Linzer et al., 1987). It is known that the serotype-specific polysaccharide of S. mutans is also capable of rhamnose-glucose polymer having a rhamnose skeleton and a side chain of an OC-linked or a ⁇ -linked darcoside residue.
- indefinite serotypes obtained from the blood of patients who develop bacteremia and serotypes obtained from the blood of patients who develop infective endocarditis (TW871) was shown to decrease the amount of glucose side chains over serotype-specific polysaccharides (Fujiwara et al., 2001).
- MT8148GD showing k-type serotype showed high levels of sucrose-dependent
- the adherence rate was significantly lower than that of the parent strain MT8148 (c-type).
- the present inventors analyzed the role of the glucose side chain of the serotype-specific polysaccharide in the cariogenicity of the newly elucidated serotype k strain of S. mutans.
- Table 6 shows the S. mutans strains used in this example.
- the oral isolate of MT8148 (c) was selected from our laboratory culture stock collection.
- FT1 strain (k), SU1 strain (k) and YK1 strain (k) were also isolated from the oral cavity of Japanese infants.
- the YT1 strain was isolated from the oral cavity of a 6-year-old healthy boy and confirmed to be S. mutans serotype k according to the method described in Example 1.
- the MT8148R and YK1R strains were rendered resistant to streptomycin by repeated subculturing in increasing concentrations of streptomycin (to a final concentration of 1500 g / ml agar) (Ooshima et al., 2000).
- M T8148GD strain (MT8148 gluA-inactive dangdo mutant) was constructed in the same manner as in Example 1.
- TW871k Blood isolate from a 45-year-old woman who developed infective endocarditis associated with subarachnoid hemorrhage
- Table 7 shows the biological properties obtained from the in vitro analysis of cariogenicity.
- MT8148GD showed significantly lower values for sucrose-dependent adhesion to the glass surface, sucrose-independent adsorption to SHA, dextran binding ability, CA-CTF activity and CF-CTF activity ( P ⁇ 0.001). Again, there were no significant differences between FT1 and FT1GD for these properties.
- the transcribed protein band was reacted with a rabbit antibody against CA-GTF or CF-GTF, followed by an anti-heron immunoglobulin G antibody conjugated with an alkaline phosphatase (New England Biolabs, Beverly, Mass., USA) and 5 Visualization was performed using -bromo-4 chloro-3-indolyl phosphate-trouble tetrazolium substrate (Moss Inc., Pasadena, MD, USA). Furthermore, the ratio of expression intensity to GTFB in each strain was evaluated by relative densitometry analysis of the reaction band using NIH image software (National Technical Information Service, bpringfield, VA, UbA). .
- NIH image software National Technical Information Service, bpringfield, VA, UbA
- GTFB, GTFC, and GTFD were found to be expressed in all of the strains tested.
- the strength of GTFB was significantly stronger in MT8148 than in any other strain.
- GTFB expression intensity The ratio of ZGTFC expression intensity was 1.80 ⁇ 0.15. This value was significantly higher than the MT8148GD value (0.80 ⁇ 0.11) and the values of other blood and oral isolates of serotype k (values in the range 0.17-0.81). (P ⁇ 0.00 Do in contrast, there was no significant difference in GTFD expression intensity among all strains tested.
- the CA- GTF activity and CF- CTF activity were evaluated by [14 C] glucan synthesis from using [14 C] sucrose.
- One unit of GTF activity was defined as the amount of enzyme required for 1 mol of glucose residues to be incorporated into sucrose dalcan per minute.
- the gluA gene (encoding an enzyme that catalyzes the production of UDP-D-glucose, the immediate precursor in the glucose side chain donor) was constructed by insertion and inactivation.
- the biological properties of MT8148GD are compared to those of parent strain MT8148. And compared. Since UDP-D-glucose has been reported to be important for viability of S. mutans in low pH environmental conditions, the present inventors have suggested that the gluA gene itself alters the properties associated with cariogenicity. Expected that it could cause Therefore, the present inventors constructed a further mutant strain (FT1GD) of serotype k strain FT1 in which the gluA gene was inserted and inactivated.
- FT1GD further mutant strain
- FIG. 19A the whole cells (A) were separated by 7% SDS polyacrylamide gel electrophoresis, and the protein band transcribed on the PVDF membrane was compared with CA-GTF of S. mutans. The rabbit was allowed to react with a heron antibody.
- FIG. 19B the culture supernatant concentrated by ammonium sulfate precipitation was separated by 7% SDS polyacrylamide gel electrophoresis, and the protein band transcribed on the PVDF membrane was reacted with an egret antibody against CF-GTF.
- lane 1 is MT8148 strain
- lane 2 is MT8148GD strain
- lane 3 is TW295 strain
- lane 4 is TW871 strain
- lane 5 is FT1 strain
- lane 6 is Is the FT1GD strain
- lane 7 is the SU1 strain
- lane 8 is the YK1 strain
- lane 9 is the YT1 strain.
- GTFB is thought to be responsible for most of the insoluble glucan synthesis and is considered to be an important toxic factor for the adhesion of S. mutans to the tooth surface and the accumulation of plaque. (Mattos-Graner et al., 2000).
- the lower CA-CTF activity of the serotype k strain may be due to lower expression of GTF B.
- its expression on the cell surface can correlate with the presence of the glucose side chain of the serotype-specific polysaccharide.
- an S. mutans strain that is likely to be involved in infection of infectious endocarditis can be easily identified as a novel serotype k-type. It can be widely used in the pharmaceutical industry and the inspection industry, etc., just at medical sites such as the dental care field.
- an indeterminate serotype of S. mutans is present in a subject, which is considered to be important from the viewpoint of preventing the development of infectious endocarditis that may result in death. It is possible to provide a method of effectively and efficiently determining whether or not the determination is made.
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Chemical & Material Sciences (AREA)
- Engineering & Computer Science (AREA)
- Molecular Biology (AREA)
- Biomedical Technology (AREA)
- Genetics & Genomics (AREA)
- Immunology (AREA)
- Organic Chemistry (AREA)
- General Health & Medical Sciences (AREA)
- Biochemistry (AREA)
- Biotechnology (AREA)
- Hematology (AREA)
- Urology & Nephrology (AREA)
- Medicinal Chemistry (AREA)
- Physics & Mathematics (AREA)
- Microbiology (AREA)
- Biophysics (AREA)
- Virology (AREA)
- Proteomics, Peptides & Aminoacids (AREA)
- General Physics & Mathematics (AREA)
- Pathology (AREA)
- Gastroenterology & Hepatology (AREA)
- Analytical Chemistry (AREA)
- Food Science & Technology (AREA)
- Cell Biology (AREA)
- Tropical Medicine & Parasitology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- Plant Pathology (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Peptides Or Proteins (AREA)
Abstract
Description
Claims
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AU2004309257A AU2004309257A1 (en) | 2003-12-30 | 2004-12-28 | Novel serum type streptococcus mutans and utilization of the same |
| EP04807986A EP1710310A4 (en) | 2003-12-30 | 2004-12-28 | NOVEL STREPTOCOCCUS MUTANT IN THE SERUM AND ITS USE |
| JP2005516706A JP4819504B2 (ja) | 2003-12-30 | 2004-12-28 | 新規血清型のストレプトコッカスミュータンスおよびその利用 |
| US10/584,990 US20090041782A1 (en) | 2003-12-30 | 2004-12-28 | Novel serotype streptococcus mutans and utilization of the same |
| IL176585A IL176585A0 (en) | 2003-12-30 | 2006-06-27 | Novel serum type streptococcus mutans and utilization and utilization of the same |
Applications Claiming Priority (4)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| US53307603P | 2003-12-30 | 2003-12-30 | |
| US60/533,076 | 2003-12-30 | ||
| JP2004-106825 | 2004-03-31 | ||
| JP2004106825 | 2004-03-31 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| WO2005063992A1 true WO2005063992A1 (ja) | 2005-07-14 |
Family
ID=34742195
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| PCT/JP2004/019631 Ceased WO2005063992A1 (ja) | 2003-12-30 | 2004-12-28 | 新規血清型のストレプトコッカス ミュータンスおよびその利用 |
Country Status (6)
| Country | Link |
|---|---|
| US (1) | US20090041782A1 (ja) |
| EP (2) | EP1710310A4 (ja) |
| KR (1) | KR20060133560A (ja) |
| AU (1) | AU2004309257A1 (ja) |
| IL (1) | IL176585A0 (ja) |
| WO (1) | WO2005063992A1 (ja) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011111790A1 (ja) | 2010-03-10 | 2011-09-15 | 国立大学法人浜松医科大学 | 高病原性口腔細菌による腸炎誘発原因分子の産生とその高感度検出法 |
Families Citing this family (5)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5747370B2 (ja) * | 2009-03-31 | 2015-07-15 | 国立大学法人浜松医科大学 | 高病原性口腔細菌の高感度検出法 |
| EP2606153A4 (en) * | 2010-08-22 | 2013-12-25 | Univ Rochester | METHOD FOR PREDICTING AND AVOIDING CARDIOVASCULAR DISEASES |
| RU2618459C1 (ru) * | 2016-07-11 | 2017-05-03 | Федеральное государственное бюджетное образовательное учреждение дополнительного профессионального образования "Российская медицинская академия непрерывного профессионального образования" Министерства здравоохранения Российской Федерации (ФГБОУ ДПО РМАНПО Минздрава России) | Способ определения генетической предрасположенности к заболеванию инфекционным эндокардитом |
| KR102248812B1 (ko) | 2019-05-29 | 2021-05-06 | 국민대학교산학협력단 | 상승효과를 갖는 글리시리진 및 글리시레트산을 포함하는 바이오필름 형성 억제용 조성물, 및 구강 질환 예방, 개선 또는 치료용 조성물 |
| WO2025137492A1 (en) * | 2023-12-22 | 2025-06-26 | Siemens Healthcare Diagnostics Inc. | Method for enriching pathogen dna and implementation thereof |
Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0171496A2 (en) | 1984-08-15 | 1986-02-19 | Research Development Corporation of Japan | Process for the production of a chimera monoclonal antibody |
| EP0173494A2 (en) | 1984-08-27 | 1986-03-05 | The Board Of Trustees Of The Leland Stanford Junior University | Chimeric receptors by DNA splicing and expression |
| WO1986001533A1 (en) | 1984-09-03 | 1986-03-13 | Celltech Limited | Production of chimeric antibodies |
| US4631211A (en) | 1985-03-25 | 1986-12-23 | Scripps Clinic & Research Foundation | Means for sequential solid phase organic synthesis and methods using the same |
| WO1987002671A1 (en) | 1985-11-01 | 1987-05-07 | International Genetic Engineering, Inc. | Modular assembly of antibody genes, antibodies prepared thereby and use |
| US4708781A (en) | 1985-10-18 | 1987-11-24 | Andromaque, S.A. | Process of simultaneously printing and electroforming ceramic articles |
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| US5908746A (en) | 1995-06-09 | 1999-06-01 | Nisshinbo Industries, Inc. | Method for analyzing biologically active substances |
| JP2003185669A (ja) * | 2001-12-19 | 2003-07-03 | Tokuyama Dental Corp | 微生物の測定方法 |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP0826066B1 (en) * | 1995-05-05 | 2000-09-13 | The Perkin-Elmer Corporation | Methods and reagents for combined pcr amplification and hybridization probing assay |
| US6586210B1 (en) * | 1996-08-23 | 2003-07-01 | Human Genome Sciences, Inc. | Polynucleotides encoding T1 receptor like ligand II |
| WO1998031818A2 (en) * | 1997-01-21 | 1998-07-23 | Human Genome Sciences, Inc. | Tace-like and matrilysin-like polypeptides |
-
2004
- 2004-12-28 AU AU2004309257A patent/AU2004309257A1/en not_active Abandoned
- 2004-12-28 WO PCT/JP2004/019631 patent/WO2005063992A1/ja not_active Ceased
- 2004-12-28 KR KR1020067015268A patent/KR20060133560A/ko not_active Withdrawn
- 2004-12-28 EP EP04807986A patent/EP1710310A4/en not_active Withdrawn
- 2004-12-28 US US10/584,990 patent/US20090041782A1/en not_active Abandoned
- 2004-12-28 EP EP08017504A patent/EP2009105A1/en not_active Withdrawn
-
2006
- 2006-06-27 IL IL176585A patent/IL176585A0/en unknown
Patent Citations (9)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US4816567A (en) | 1983-04-08 | 1989-03-28 | Genentech, Inc. | Recombinant immunoglobin preparations |
| EP0171496A2 (en) | 1984-08-15 | 1986-02-19 | Research Development Corporation of Japan | Process for the production of a chimera monoclonal antibody |
| EP0173494A2 (en) | 1984-08-27 | 1986-03-05 | The Board Of Trustees Of The Leland Stanford Junior University | Chimeric receptors by DNA splicing and expression |
| WO1986001533A1 (en) | 1984-09-03 | 1986-03-13 | Celltech Limited | Production of chimeric antibodies |
| US4631211A (en) | 1985-03-25 | 1986-12-23 | Scripps Clinic & Research Foundation | Means for sequential solid phase organic synthesis and methods using the same |
| US4708781A (en) | 1985-10-18 | 1987-11-24 | Andromaque, S.A. | Process of simultaneously printing and electroforming ceramic articles |
| WO1987002671A1 (en) | 1985-11-01 | 1987-05-07 | International Genetic Engineering, Inc. | Modular assembly of antibody genes, antibodies prepared thereby and use |
| US5908746A (en) | 1995-06-09 | 1999-06-01 | Nisshinbo Industries, Inc. | Method for analyzing biologically active substances |
| JP2003185669A (ja) * | 2001-12-19 | 2003-07-03 | Tokuyama Dental Corp | 微生物の測定方法 |
Non-Patent Citations (24)
| Title |
|---|
| BITTLE, F. J. ET AL., J. GEN. VIROL., vol. 66, 1985, pages 2347 - 2354 |
| BOULIANNE ET AL., NATURE, vol. 312, 1984, pages 643 |
| CHOW, M. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 82, pages 910 - 914 |
| D. BENNETT ET AL., JOURNAL OF MOLECULAR RECOGNITION, vol. 8, 1995, pages 52 - 58 |
| DATABASE MEDLINE [online] NAKANO K. ET AL.: "Development of a PCR method for rapid identification of new Streptococcus mutants serotype k strains", XP002987171, Database accession no. 2004556459 * |
| FUJIWARA T. ET AL.: "Biochemical and genetic characterization of serologically untypable Streptococcus mutants strains isolated from patients with bacteremia", EUR. J. ORAL. SCI., vol. 109, no. 5, October 2001 (2001-10-01), pages 330 - 334, XP002987167 * |
| GEYSEN, H. M. ET AL., PROC. NATL. ACAD. SCI. USA, vol. 81, 1984, pages 3998 - 4002 |
| HOUGHTEN, R. A., PROC. NATL. ACAD. SCI. USA, vol. 82, 1985, pages 5131 - 5135 |
| J. CLIN. MICROBIOL., vol. 42, no. 11, November 2004 (2004-11-01), pages 4925 - 4930 * |
| K. JOHANSON ET AL., THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 270, no. 16, 1995, pages 9459 - 9471 |
| KENNEDY ET AL., CLIN. CHIM. ACTA, vol. 70, 1976, pages 1 - 31 |
| MANIATIS, T. ET AL.: "Molecular Cloning A Laboratory Manual", 1989, COLD SPRING HARBOR LABORATORY PRESS |
| MORRISON, SCIENCE, vol. 229, 1985, pages 1202 |
| NAKANO K. ET AL.: "Demonstration of Streptococcus mutants with a cell wall polysaccharide specific to a new serotype, k, in the human oral cavity", J. CLIN. MICROBIOL., vol. 42, no. 1, January 2004 (2004-01-01), pages 198 - 202, XP002987170 * |
| NEUBERGER ET AL., NATURE, vol. 314, 1985, pages 268 |
| OI ET AL., BIOTECHNIQUES, vol. 4, 1986, pages 214 |
| S. W. BURCHIEL ET AL.: "Tumor Imaging: The Radiochemical Detection of Cancer", 1982, MASSON PUBLISHING INC., article "Immunopharmacokinetics of Radiolabelled Antibodies and Their Fragments" |
| SCHURS ET AL., CLIN. CHIM. ACTA, vol. 81, 1977, pages 1 - 40 |
| See also references of EP1710310A4 |
| SHIBATA Y. ET AL.: "Analysis of loci required for determination of serotype antigenicity in Streptococcus mutants and its clinical utilization", J. CLIN. MICROBIOL., vol. 41, no. 9, September 2003 (2003-09-01), pages 4107 - 4112, XP002987169 * |
| SHIBATA Y. ET AL.: "Expression and characterization of streptococcal rgp genes required for rhamnan synthesis in Escherichia coli", INFECT. IMMUN., vol. 70, no. 6, June 2002 (2002-06-01), pages 2891 - 2898, XP002987172 * |
| WAHL ET AL., J. NUCL. MED., vol. 24, 1983, pages 316 - 325 |
| WILSON, I. A. ET AL., CELL, vol. 37, 1984, pages 767 - 778 |
| YAMASHITA Y. ET AL.: "Genes involved in cell wall localization and side chain formation of rhamnose-glucose polysaccharide in Streptococcus mutants", J. BACTERIOL., vol. 180, no. 21, November 1998 (1998-11-01), pages 5803 - 5807, XP002987168 * |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2011111790A1 (ja) | 2010-03-10 | 2011-09-15 | 国立大学法人浜松医科大学 | 高病原性口腔細菌による腸炎誘発原因分子の産生とその高感度検出法 |
| US9297811B2 (en) | 2010-03-10 | 2016-03-29 | National University Corporation Hamamatsu University School Of Medicine | Production of enteritis evoking causal factor by highly pathogenic oral bacteria and high sensitivity detection method therefor |
Also Published As
| Publication number | Publication date |
|---|---|
| EP2009105A1 (en) | 2008-12-31 |
| EP1710310A1 (en) | 2006-10-11 |
| IL176585A0 (en) | 2006-10-31 |
| EP1710310A4 (en) | 2007-02-21 |
| US20090041782A1 (en) | 2009-02-12 |
| KR20060133560A (ko) | 2006-12-26 |
| AU2004309257A1 (en) | 2005-07-14 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US6887660B2 (en) | Compounds for immunodiagnosis of prostate cancer and methods for their use | |
| CA2281952C (en) | Compounds for immunotherapy of prostate cancer and methods for their use | |
| ES2277432T3 (es) | Compuestos y metodos para terapia y diagnosis de cancer de pulmon. | |
| EP2298877B1 (en) | Compounds for immunotherapy of prostate cancer and methods for their use | |
| US5854206A (en) | Compounds and methods for treatment and diagnosis of prostate cancer | |
| KR101655486B1 (ko) | 헤르페스 바이러스의 잠복 감염에 관여하는 인자 및 그 이용 | |
| AU2344399A (en) | Compounds for therapy and diagnosis of lung cancer and methods for their use | |
| HUT76730A (en) | The taga gene and methods for detecting predisposition to peptic ulceration and gastric carcinoma | |
| KR20020007362A (ko) | 유방암의 면역요법 및 진단용 화합물 및 이의 사용 방법 | |
| JP2004501613A (ja) | 乳腺癌の診断、モニタリング、ステージング、イメージング及び処置のための組成物並びに方法 | |
| EP3255148B1 (en) | Detection of bacterium belonging to the genus campylobacter which targets cytolethal distending toxin | |
| KR20060133560A (ko) | 신규 혈청형 스트렙토코쿠스 뮤탄스 및 그 이용 | |
| CA2364670A1 (en) | Tuberculosis antigens and methods of use therefor | |
| JP4819504B2 (ja) | 新規血清型のストレプトコッカスミュータンスおよびその利用 | |
| CN100506988C (zh) | 新型血清型变形链球菌及其利用 | |
| US6379951B1 (en) | Compounds for immunotherapy of breast cancer and methods for their use | |
| EP2570486A1 (en) | Production of enteritis evoking causal factor by highly pathogenic oral bacteria and high sensitivity detection method therefor | |
| WO2002053016A2 (en) | Compounds and methods for the diagnosis and treatment of babesia infection | |
| US7008772B1 (en) | Compounds for immunodiagnosis of prostate cancer and methods for their use | |
| JP2009195236A (ja) | 乳癌の免疫療法および診断のための化合物ならびにそれらの使用のための方法 | |
| EP1285068A2 (en) | Compounds and methods for the diagnosis and treatment of babesia microti infection | |
| JP2004522945A (ja) | スタフィロコッカス・アウレウス必須遺伝子及びそのコードされるタンパク質staau_r2に関連する組成物及び方法 | |
| HK1087737A (en) | Compounds for immunodiagnosis of prostate cancer and method for their use | |
| MXPA97009364A (en) | Sequence of desoxirribonucleico acid and specific codified breast protein to detect m cancer | |
| EP2003201A2 (en) | Compounds and methods for therapy and diagnosis of lung cancer |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| AK | Designated states |
Kind code of ref document: A1 Designated state(s): AE AG AL AM AT AU AZ BA BB BG BR BW BY BZ CA CH CN CO CR CU CZ DE DK DM DZ EC EE EG ES FI GB GD GE GH GM HR HU ID IL IN IS JP KE KG KP KR KZ LC LK LR LS LT LU LV MA MD MG MK MN MW MX MZ NA NI NO NZ OM PG PH PL PT RO RU SC SD SE SG SK SL SY TJ TM TN TR TT TZ UA UG US UZ VC VN YU ZA ZM ZW |
|
| AL | Designated countries for regional patents |
Kind code of ref document: A1 Designated state(s): BW GH GM KE LS MW MZ NA SD SL SZ TZ UG ZM ZW AM AZ BY KG KZ MD RU TJ TM AT BE BG CH CY CZ DE DK EE ES FI FR GB GR HU IE IS IT LT LU MC NL PL PT RO SE SI SK TR BF BJ CF CG CI CM GA GN GQ GW ML MR NE SN TD TG |
|
| 121 | Ep: the epo has been informed by wipo that ep was designated in this application | ||
| WWE | Wipo information: entry into national phase |
Ref document number: 176585 Country of ref document: IL |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2005516706 Country of ref document: JP |
|
| NENP | Non-entry into the national phase |
Ref country code: DE |
|
| WWW | Wipo information: withdrawn in national office |
Country of ref document: DE |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004309257 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 2004807986 Country of ref document: EP |
|
| ENP | Entry into the national phase |
Ref document number: 2004309257 Country of ref document: AU Date of ref document: 20041228 Kind code of ref document: A |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004309257 Country of ref document: AU |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 200480041006.8 Country of ref document: CN |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 1020067015268 Country of ref document: KR |
|
| WWP | Wipo information: published in national office |
Ref document number: 2004807986 Country of ref document: EP |
|
| WWP | Wipo information: published in national office |
Ref document number: 1020067015268 Country of ref document: KR |
|
| WWE | Wipo information: entry into national phase |
Ref document number: 10584990 Country of ref document: US |



















